Lazarus Opening Sequence - Shot List

2
Shot List SHOT LIST “Lazarus Opening Sequence” By Anne and Reece Draft “1” Date: “04/11/14” Scene 1 – INT. ABANDONED WAREHOUSE - NIGHT Shot Number Shot Description 1 Medium close up of protagonists feet. Camera follows her feet and tracks right before gradually tilting up to a close up of the side of her face in an eye level angle. Camera continues to follow her movement and tracks right. 2 Medium long shot of protagonist looking down at the floor as she abruptly stops moving. 3 Point of view shot – panning across the warehouse (tables with circus equipment laid out.) The point of view shot tracks forwards closer to a medium shot of the table with a mask. 4 High angle of the protagonist as she grabs the mask and gradually pulls it closer to her face Scene 2 – INT. STAGE - NIGHT Shot Number Shot Description 5 Long shot of protagonist and then zooms in with a dutch tilt which turns to a close up of the protagonist wearing the mask Production’s Name Here

Transcript of Lazarus Opening Sequence - Shot List

Page 1: Lazarus Opening Sequence - Shot List

Shot List

SHOT LIST“Lazarus Opening Sequence”

By Anne and ReeceDraft “1”

Date: “04/11/14”

Scene 1 – INT. ABANDONED WAREHOUSE - NIGHTShot Number Shot Description

1 Medium close up of protagonists feet. Camera follows her feet and tracks right before gradually tilting up to a close up of the side of her face in an eye level angle. Camera continues to follow her movement and tracks right.

2 Medium long shot of protagonist looking down at the floor as she abruptly stops moving.

3 Point of view shot – panning across the warehouse (tables with circus equipment laid out.) The point of view shot tracks forwards closer to a medium shot of the table with a mask.

4 High angle of the protagonist as she grabs the mask and gradually pulls it closer to her face

Scene 2 – INT. STAGE - NIGHTShot Number Shot Description

5 Long shot of protagonist and then zooms in with a dutch tilt which turns to a close up of the protagonist wearing the mask

Production’s Name Here


Lazarus y Messer

Lazarus y Messer

09VWCMA056 NAINA LAZARUS

09VWCMA056 NAINA LAZARUS

CANTERBURY COLLEGE MEDIA DEPARTMENT…  · Web viewSTORYBOARD SHEET. Shot No.1: Shot No. 2; Shot No. 3; Dialogue: B Roll of Outside of the studio in Ramsgate with title sequence.

CANTERBURY COLLEGE MEDIA DEPARTMENT…  · Web viewSTORYBOARD SHEET. Shot No.1: Shot No. 2; Shot No. 3; Dialogue: B Roll of Outside of the studio in Ramsgate with title sequence.

The Lazarus Constellation - LEXFO · 2020. 10. 8. · The Lazarus Constellation 05 I. Rise of Lazarus I. RISE OF LAZARUS INTRODUCING THE LAZARUS APT GROUP Lazarus activities have

The Lazarus Constellation - LEXFO · 2020. 10. 8. · The Lazarus Constellation 05 I. Rise of Lazarus I. RISE OF LAZARUS INTRODUCING THE LAZARUS APT GROUP Lazarus activities have

Neil lazarus Brochure

Neil lazarus Brochure

Assassination Opening Sequence Shot List and Storyboard

Assassination Opening Sequence Shot List and Storyboard

Identification of Arterial Hyperenhancement in CT …...(3D) dual gradient-echo sequence, breath-hold multi-shot T2-weighted sequence, and respiratory-triggered single shot T2- and

Identification of Arterial Hyperenhancement in CT …...(3D) dual gradient-echo sequence, breath-hold multi-shot T2-weighted sequence, and respiratory-triggered single shot T2- and

Lazarus production schedule

Lazarus production schedule

Neil lazarus

Neil lazarus

Raising Lazarus

Raising Lazarus

Hymie Lazarus

Hymie Lazarus

Lazarus (Leonid Andreyev)

Lazarus (Leonid Andreyev)

Single-Shot Dense Depth Sensing with Color Sequence Coded ......sensors Article Single-Shot Dense Depth Sensing with Color Sequence Coded Fringe Pattern Fu Li *, Baoyu Zhang, Guangming

Single-Shot Dense Depth Sensing with Color Sequence Coded ......sensors Article Single-Shot Dense Depth Sensing with Color Sequence Coded Fringe Pattern Fu Li *, Baoyu Zhang, Guangming

Zero-shot Sequence Labeling: Transferring Knowledge from ...Zero-shot sequence labeling 3 + + + - + + + + + - + I like to playing the guitar and sing very louder . It was so long time

Zero-shot Sequence Labeling: Transferring Knowledge from ...Zero-shot sequence labeling 3 + + + - + + + + + - + I like to playing the guitar and sing very louder . It was so long time

Video to Action Shot Sequence - pages.cs.wisc.edu

Video to Action Shot Sequence - pages.cs.wisc.edu

One-Shot Action Localization by Learning Sequence ......One-shot Action Localization by Learning Sequence Matching Network Hongtao Yang The Australian National University u5226028@anu.edu.au

One-Shot Action Localization by Learning Sequence ......One-shot Action Localization by Learning Sequence Matching Network Hongtao Yang The Australian National University [email protected]

Mohamed, M. E., Pahirulzaman, K. A. K., & Lazarus, C. M ... name primer sequence atlox2for 5’ caccatgtattgtagagagtccttgtc 3’ atlox2rev 5’ agatcaaatagaaatactataagg 3’ ataosfor

Mohamed, M. E., Pahirulzaman, K. A. K., & Lazarus, C. M ... name primer sequence atlox2for 5’ caccatgtattgtagagagtccttgtc 3’ atlox2rev 5’ agatcaaatagaaatactataagg 3’ ataosfor

elebrating Leadership & Service Lazarus Leadership Fellows ... · the Lazarus Leadership Fellows Program, tax-deductible donations made payable to “Leaders Institute/Lazarus”

elebrating Leadership & Service Lazarus Leadership Fellows ... · the Lazarus Leadership Fellows Program, tax-deductible donations made payable to “Leaders Institute/Lazarus”

Tutorial Lazarus

Tutorial Lazarus

Project Lazarus description FINAL - Intranasalintranasal.net/Peer Reviewed literature/Project Lazarus, North... · Project Lazarus Wilkes County, North Carolina Page | 2 • What

Project Lazarus description FINAL - Intranasalintranasal.net/Peer Reviewed literature/Project Lazarus, North... · Project Lazarus Wilkes County, North Carolina Page | 2 • What