ARTICLE OPEN ACCESS

Teriflunomide Promotes Oligodendroglial89-Unsaturated Sterol Accumulation andCNS RemyelinationElodie Martin PhD Marie-Stephane Aigrot PhD Foudil Lamari MD PhD Corinne Bachelin PhD

Catherine Lubetzki MD PhD Brahim Nait Oumesmar PhD Bernard Zalc MD PhD and

Bruno Stankoff MD PhD

Neurol Neuroimmunol Neuroinflamm 20218e1091 doi101212NXI0000000000001091

Correspondence

Dr Stankoff

brunostankoffaphpfr

AbstractBackground and ObjectivesTo test whether low concentrations of teriflunomide (TF) could promote remyelination weinvestigate the effect of TF on oligodendrocyte in culture and on remyelination in vivo in 2demyelinating models

MethodsThe effect of TF on oligodendrocyte precursor cell (OPC) proliferation and differentiation wasassessed in vitro in glial cultures derived from neonatal mice and confirmed on fluorescence-activated cell sortingndashsorted adult OPCs The levels of the 89-unsaturated sterols lanosteroland zymosterol were quantified in TF- and sham-treated cultures In vivo TF was administeredorally and remyelination was assessed both in myelin basic proteinndashGFP-nitroreductase (MbpGFP-NTR) transgenic Xenopus laevis demyelinated by metronidazole and in adult micedemyelinated by lysolecithin

ResultsIn cultures low concentrations of TF down to 10 nM decreased OPC proliferation andincreased their differentiation an effect that was also detected on adult OPCs Oligodendrocytedifferentiation induced by TF was abrogated by the oxidosqualene cyclase inhibitor Ro 48-8071and was mediated by the accumulation of zymosterol In the demyelinated tadpole TF en-hanced the regeneration of mature oligodendrocytes up to 25-fold In the mouse demyelinatedspinal cord TF promoted the differentiation of newly generated oligodendrocytes by a factor of17-fold and significantly increased remyelination

DiscussionTF enhances zymosterol accumulation in oligodendrocytes and CNSmyelin repair a beneficialoff-target effect that should be investigated in patients with multiple sclerosis

These authors contributed equally to this work

From the Sorbonne Universite Paris Brain Institute CNRS Inserm (EM M-SA CB CL BNO BZ BS) Pitie-Salpetriere Hospital APHP (FL CL) and Saint Antoine HospitalAPHP (BS) Paris France

Go to NeurologyorgNN for full disclosures Funding information is provided at the end of the article

The Article Processing Charge was funded by the authors

This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 40 (CC BY-NC-ND) which permits downloadingand sharing the work provided it is properly cited The work cannot be changed in any way or used commercially without permission from the journal

Copyright copy 2021 The Author(s) Published by Wolters Kluwer Health Inc on behalf of the American Academy of Neurology 1

The landscape of multiple sclerosis (MS) treatment has changeddramatically over the last decades with great therapeutic pro-gresses achieved for the prevention of clinical relapses Howevercontrolling the disability worsening remains a key unsolved issueas currently applied therapeutic strategies targeting the adaptiveimmune system are mostly insufficient to prevent later disabilityaccrual and disease progression Disability in MS is mainly aconsequence of irreversible neuronal damage that could be in-duced jointly by chronic inflammation and persistingdemyelination12 Following a demyelinating insult an endoge-nous spontaneous repair process may take place to prevent thedeleterious consequences of demyelination and protect axonsfrom degeneration34 Whereas some remyelination may occurin MS5-7 this regenerative process is often abortive and gener-ally insufficient to fully repair lesion and prevent neuro-degeneration8 Beside immunomodulation a major therapeuticgoal aiming at promoting remyelination has therefore emergedFrom in vitro and in vivo experimental models a certain numberof either repurposed or newly designed molecules have beenidentified as promising remyelinating compounds8 Of interestmost of these molecules were shown to promote oligodendro-cyte differentiation and (re)myelination independently of theircanonical targets through the accumulation of 89-unsaturatedsterols in myelinating cells9 Whether some currently approveddrugs targeting the adaptive andor innate immunity could alsoexert a promyelinating effect through off-target mechanismsremain poorly investigated but would open the perspective of adual beneficial impact on MS course

Teriflunomide (TF) is an oral immunomodulatory therapythat has been approved for relapsing-remitting forms of MS10

Its primary mechanism of action is an inhibition of dihy-droorotate dehydrogenase (DHODH) a mitochondrial en-zyme involved in pyrimidine synthesis pathway highlyexpressed in proliferating lymphocytes11 Beyond its impacton lymphocytes it has been suggested that TF could promoteoligodendrocyte differentiation in primary cultures from im-mature rat brains12 However this effect was observed only forvery short pulses on immature cells disappeared when ad-ministration was prolonged for several days and was observedonly for a single concentration of 5 μM which correspondsapproximately to the one to be found in the blood but thatcould hardly be reached in the brain of human treated subjectsThese results are therefore difficult to translate to human care

prompting us to explore more in depth the potential impact ofthis drug on myelinating cells and remyelination

Combining a range of in vitro and in vivo models from differentspecies we have obtained results supporting a promyelinatingeffect of TF (1) at nanomolar concentrations TF promotes thedifferentiation of neonatal and adult mouse oligodendrocytes(2) its effect on oligodendrocyte was associated with an accu-mulation of the 89-unsaturated sterol zymosterol and revertedby inhibition of the oxidosqualene cyclase and (3) TF pro-moted remyelination in vivo both in Xenopus laevis and in mice

MethodsAnimalsAll animal experiments were conducted with respect to theEuropean Union regulations and approved by the ethicalcommittee for animal use (approval number Ce52010025)(APAFIS 6269 and APAFIS 5842-2016101312021965)

MiceC57Bl6 and transgenic PDGFRαGFP (reference 13 RRIDIMSR_JAX007669) mice were grown in our animal facility(agreement A75-13-19) Experiments were conducted withrespect to the European Union regulations and approved bythe ethical committee for animal use (approval number Ce52010025) (APAFIS 6269)

XenopusIn the myelin basic proteinndashGFP-nitroreductase (MbpGFP-NTR) transgenicXenopus laevis line the expression of the greenfluorescent protein GFP reporter gene and the bacterial NTRenzyme is controlled by a portion of the mouse myelin basicprotein (MBP) regulatory sequence14 enabling a selective ex-pression of the transgene in myelinating oligodendrocytes andthe induction of oligodendrocyte death and demyelinationwhenmetronidazole (MTZ) is added to the swimming water15

In this model remyelination (spontaneous or induced by TF)can be assessed following a recovery period of 3 days Treat-ment was performed at a pre-metamorphosis stage16

Cell Cultures and TreatmentOligodendrocyte precursor cells (OPCs) were isolated fromneonatal mice (P1 or P2) using a Percoll gradient17 OPCs were

GlossaryANOVA = analysis of variance APC = adenomatous polyposis coli BBB = blood brain barrier Br = brain BrdU =bromodeoxyuridine DHODH = dihydroorotate dehydrogenase DIV = days in vitro EBP = emopamil binding proteinFACS = fluorescence-activated cell sorting IFNγ = interferon-gamma IL-17 = interleukin-17 Li = liver LPC =lysophosphatidylcholine MBP = myelin basic protein MbpGFP-NTR = myelin basic proteinndashGFP-nitroreductase MOG =myelin oligodendrocyte glycoprotein MS = multiple sclerosis MTT = 3-(45-dimethylthiazol-2-yl)-25-diphenyltetrazoliumbromide MTZ = metronidazole OPC = oligodendrocyte precursor cell PBS = phosphate-buffered saline PDGFαGFP =platelet derived growth factor receptor-alphagreen fluorescent protein PFA = paraformaldehyde SC = spinal cord Sp =spleen TF = teriflunomide

2 Neurology Neuroimmunology amp Neuroinflammation | Volume 8 Number 6 | November 2021 NeurologyorgNN

isolated from 2-month-old adult platelet derived growth factorreceptor-alphagreen fluorescent protein (PDGFαGFP) hemi-zygous mice1819 through GFP+O4+ fluorescence-activated cellsorting (FACS)

At days in vitro (DIV) 3 teriflunomide (Genzyme) at concentra-tions ranging from10nMto 5 μMwas added and cellswere grownfor 24 48 and 96 hours to assess the survival proliferation anddifferentiation respectively OPCs were either untreated or treatedwith 10 nMRo48-8071 fumarate (Tocris an inhibitor of lanosterolsynthesis) 25 μM uridine (Sigma-Aldrich) rat recombinant in-terferon-gamma (IFNγ) (10 ngmL PeproTech) andor ratrecombinant interleukin-17 (IL-17) (50 ngmL RampD Systems)either alone or in combination with 10 nM TF for 96 hours

Cell Survival AssayCell survival was measured by the 3-(45-dimethylthiazol-2-yl)-25-diphenyltetrazolium bromide (MTT) rapid colorimetricassay (05 mgmLMTT incubated at 37degC with 5 CO2 for 4hours Sigma-Aldrich M5655)20

Sterol AnalysisOPCs were grown on poly-L-lysinendashcoated 100 mm2 Petridish and at DIV 3 either TF (10 nM) orand Ro 48-8071fumarate (10 nM) orand uridine (25 μM)were added during24 hours Cells were dissociated using 05 trypsinethylenediaminetetraacetic acid scraped and centrifuged 10minutes at 10000 rpm and the supernatant was frozen atminus80degC

Sterol extraction and derivatization were performed as de-scribed21 Briefly 20 μL of a mixture of deuterated sterols(Avanti Polar Lipids Coger-Paris 15) consisting of (d5-zymosterol [1 μgmL] d7-cholesterol [10 μgmL] and d6-lanosterol [1 μgmL]) in methanol as internal standards wasadded to 100 μL of cell lysates Following extraction in n-hexane the dried residue of free sterols was derivatized dis-solved in methanol and injected into the ultra performanceliquid chromatography coupled with mass spectroscopyMSsystem consisting in a Triple Quadrupole Mass Spectrometer(TQD-Waters) equipped with an electrospray ionizationprobe and coupled to an ultra performance liquid chroma-tography Acquity system (Waters)22 A calibration curve wasobtained by a mixture of zymosterol lanosterol (025 μgmLeach) and cholesterol (50 μgmL) Sterol levels were nor-malized to protein concentration (bicinchoninic acid assay)

Emopamil Binding Protein and DHODHReverse Transcriptase-QuantitativePolymerase Chain ReactionOPCs and mouse tissue (brain spinal cord [SC] spleen andliver) messenger RNAs were isolated with the Maxwell RSCsimplyRNA Cells (Promega) Primers for emopamil bindingprotein (EBP) (forward primer TGTGCGAGGAGGAAGAA-GAT reverse primer GATAGGCCACCCCGTTTATT) andDHODH (forward primer TCCAATGGGATGCAGGCAGreverse primer CAGGGCCCGCTTTCTCAG) and glyceral-dehyde 3-phosphate dehydrogenase (forward primer

GGGTTCCTATAAATACGGACTGC reverse primerCCATTTTGTCTACGGGACGA) were designed by NCBIPrimer-BLAST and manufactured by Eurofins Genomics ALightCycler 480 SYBR Green I Master (Roche Diagnostics) wasused for quantitative real-time PCR The cycle time was calcu-lated using LightCycler 96 Software V11

AntibodiesAnti-O4 antibody (mouse IgM hybridoma provided by ISommer) was revealed by a phycoerythrin anti-mouse IgM (BDPharmingen) For cell immunostainings we used a rabbit anti-Olig2 Ab (diluted 1500 Millipore AB15328) a mouse antindashmyelin oligodendrocyte glycoprotein (MOG) Ab (diluted 15hybridoma provided by Dr C Linington) a mouse IgG1 anti-Ki-67 Ab (diluted 1100 BD BiosciencesndashPharmingen) and arat anti-bromodeoxyuridine (anti-BrdU) (diluted 120 Abcam)

For immunohistochemistry we used a chicken anti-MBP Ab(diluted 140 Millipore) a rabbit anti-Olig2 Ab (diluted 1500 Millipore AB15328) and a mouse IgG2b antindashadenomatous polyposis coli (APC clone CC1 diluted 1300Calbiochem) Secondary antibodies used were Alexa conju-gated antibodies (Invitrogen) at a 11000 dilution

ImmunofluorescenceCells were fixed 15minutes with 4 paraformaldehyde (PFA)and permeabilized 10 minutes by 01 Triton-phosphate-buffered saline (PBS) For BrdU immunocytochemistry fixedcells were incubated 10 minutes in 1M HClmdashPBS on ice and10 minutes in 2M HClmdashPBS at room temperature beforeapplying anti-BrdU antibody overnight at +4degC

Demyelinating Lesion InductionFocal demyelination was induced by an injection of 05 mL of1 LPC (lysophosphatidylcholine Sigma-Aldrich St LouisMO) in the dorsal SC of 2-month-old anesthetized PLP-GFPtransgenic mice as described23

Oral TreatmentMice received 20 mgkg of TF dissolved in dimethylsulfoxydeand resuspended in a solution containing 06 carboxy-methylcellulose through oral gavage daily An equivalentvolume of identical vehicle solution without TF was given tocontrol mice Daily administration began the day followingLPC injection and was repeated for 10 days

Perfusion and Tissue Processing forImmunohistochemistryThe spinal cords of animals perfused with 4 PFA (Sigma)were cryoprotected in 15 sucrose frozen in 15 sucrose-7 gelatin and 14-μm serial cryostat sections were performedImmunohistochemistry was then realized according to thealready reported procedure23

Tissue Processing for Electron MicroscopyMice were perfused with 2 PFA and 4 glutaraldehyde(Electron Microscopy Sciences Hatfield PA) and their SCs

NeurologyorgNN Neurology Neuroimmunology amp Neuroinflammation | Volume 8 Number 6 | November 2021 3

were postfixed overnight Tissue was then processed as de-scribed23 One-μm-thick sections were stained with toluidineblue and ultrathin 70-nm sections (ultramicrotome ReichertUltraCut S) were stained with uranyl acetate and Reynoldlead citrate and observed with a transmission electron mi-croscope (Hitachi Tokyo Japan)

Image Acquisition and Quantitative AnalysisFor cell immunocytochemistry a Zeiss Axio Imager Apotomewas used Ten fields captured from each well correspondingto approximately 80ndash100 Olig2+ cells per coverslip werecounted and the percentage of myelin-forming oligoden-drocyte (Olig2+MOG+) cells was determined for at least 4coverslips per condition

For biochemistry experiments each sample was measured induplicate per condition and sterol production was normal-ized to protein concentration evaluated by bicinchoninic acidassay Results were expressed as of controls plusmn SEM of 3independent experiments

For experiments in live tadpoles the number of cellsexpressing GFP cells was quantified in each optic nerve24

using a Macroscope Nikon AZ100 with a times15 magnificationData were obtained from 5 to 8 animals per condition

For histology we used a digital camera (AxioCam Zeiss JenaGermany) attached to a microscope (Apotome Zeiss) andperformed Z-series of sections at 03-μm increment Greenred far-red and blue fluorescence were acquired sequentiallyFive to 10 sections were analyzed per animal and for everysingle image the extent of myelin loss (characterized by a lackof MBP staining) was quantified using Zen software Insidethe lesion arealesion core the number of Olig2+CC1+ cellswas assessed

For electron microscopy a mean of 25 images per animalwere analyzed within the lesion using a transmission elec-tron microscope (Hitachi Tokyo Japan) connected to adigital camera (AMT Danvers MA) at times13000 Thenumber of remyelinated axons was counted (ImageJsoftware)

Statistical AnalysisData are expressed as mean plusmn SEM Statistics were per-formed using GraphPad Prism 6 (GraphPad Software)For statistical differences between 2 groups the unpaired2-tailed Student t test was applied For grouped analysiswe used a 1-way analysis of variance (ANOVA) followedby the Dunn post hoc test to compare drug treatment tocontrol condition or Newman-Keuls test for multiple compari-son Statistical significance was defined as p lt 005 p lt 001and p lt 0001

Data AvailabilityThe data that support the findings of this study are availablefrom the corresponding author on reasonable request

ResultsTF Inhibits OPC ProliferationIn newborn glial cultures Olig-2 and 46-diamidino-2-phe-nylindole colabeling showed an 80 enrichment in OPCs(Figure 1 A and B) Compared with untreated control ad-dition of TF (10 nM and 5 μM) in the culture medium for 24hours did not affect cell viability of OPCs (Figure 1C) TFadded 48 hours to the culture medium decreased OPC pro-liferation measured as the incorporation of bromodeoxyur-idine (BrDU) by 34 up to 63 for concentration rangingbetween 10 nM and 5 μM respectively (Figure 1 DndashF) Thiseffect for the lower 10 nM concentration was further con-firmed by quantifying the expression of the proliferationmarker Ki67 (Figure 1 GndashI)

TF Increases Oligodendrocyte DifferentiationWe then asked whether the TF could influence OPC differ-entiation into mature oligodendrocytes One of the most be-lated markers of oligodendrocyte maturation is myelinoligodendrocyte glycoprotein (MOG)2526 In a first set of ex-periments a 96-hour treatment of cultures with TF induced anincrease in the ratio of mature oligodendrocytes (Olig2+MOG+ cells) by factors of 14 up to 21 for concentrationsranging from 10 nM to 1 μM respectively (Figure 2 AndashC)This acceleration ofmaturation was also efficient on adult OPCFACS isolated from the brain of 2-month-old PDGFRαGFPmice In these cultures of adult OPCs the low dose of TF (10nM) was sufficient to increase maturation (Figure 2 DndashF)

TF Promotes OPC Differentiation by Acting onthe 89-Unsaturated Sterol BiosynthesisPathwayIn newborn OPC cultures 10 nM TF significantly increasedOPC differentiation by a factor of 197-fold in comparison tocontrol (197 plusmn 016 TF vs 1 plusmn 015 Ctrl) Cotreatment withRo 48-8071 an inhibitor of lanosterol synthesis abrogated theenhanced TF-induced oligodendroglial differentiation (1 plusmn015 of Olig2+Mog+ cells in TF-treated OPCs 094 plusmn 018 ofOlig2+Mog+ cells in OPCs cotreated with TF and Ro48-8071) (Figure 3A)

To investigate the mechanism involved in TF-induced OPCdifferentiation we analyzed the levels of sterols produced bypurified newborn OPCs Cells were treated for 24 hours eitherwith TF (10 nM) or Ro 48-8071 (10 nM) or cotreated with TFand Ro 48-8071 Three sterols along the cholesterol bio-synthesis pathway were quantified lanosterol (that accumu-lates following CYP51 inhibition) zymosterol and cholesterolAlthough TF did not significantly enhance lanosterol or cho-lesterol production the zymosterol level was increased 19-foldin comparison to control Addition of Ro 48-8071 effectivelyblocked TF-induced zymosterol production (Figure 3B)

Together these findings indicate that the accumulation of the89-unsaturated sterol zymosterol in OPCs is a crucialmechanism for TF-induced oligodendrocyte differentiation A

4 Neurology Neuroimmunology amp Neuroinflammation | Volume 8 Number 6 | November 2021 NeurologyorgNN

similar accumulation of zymosterol has been previouslyreported with other enhancers of myelination such as clem-astine9 and may suggest that TF which canonical signalingpathway targets the DHODH could also inhibit EBP theenzyme catalyzing zymosterol in the cholesterol biosynthesispathway

This led us to analyze the expression of EBP and DHODH inOPCs and the brain and spinal cord from adult wild typemice

We observed a moderate level of expression of both EBP andDHODH in OPCs relatively to the liver and spleen that wereused as positive control for EBP and DHODH enzymaticgene expression respectively but this OPC expression wasenriched compared with the brain or SC (Figure 3 C and D)

Whereas we could not demonstrate a direct interaction be-tween TF and EBP in a specific screening assay (supplementaldata linkslwwcomNXIA606) we showed that an excess of

Figure 1 Effect of TF on OPC Survival and Proliferation

(AndashC) Immunolabeling for Olig2 (A) and nuclei staining with 46-diamidino-2-phenylindole (B) showing that 80 of cells are Olig2+ cells (C) Cell survival wasevaluated with MTT assay results are expressed as of controls and show that TF does not induce cell death at concentrations ranging between 10 nM and5 μM (D and E) Coimmunolabeling for Olig2 and BrDU in control (Ctrl)- (D) and TF-treated conditions (E) (F) Cell proliferationwasmeasured as the proportionofOlig2+ cells that are also BrDU+ TF decreased the percentage ofOlig2+ cells coexpressing BrDU for concentrations ranging between 10 nMand 5μM (G andH) Coimmunolabeling for Olig2 and Ki67 in control (Ctrl)- (G) and TF-treated conditions (H) (I) The proportion ofOlig2+ cells coexpressing Ki67was lower in theteriflunomide condition (10 nM) comparedwith control White arrowheads indicate cells coexpressing the 2markers Data shown aremean plusmn SEM from3 to 5individual experiments p lt 005 p lt 001 p lt 0001 (1-way ANOVA Dunn post hoc test (C and F) Student 2-tailed unpaired t test (I)) Scale bar in AndashF =10 μm BrdU = bromodeoxyuridine TF = teriflunomide

NeurologyorgNN Neurology Neuroimmunology amp Neuroinflammation | Volume 8 Number 6 | November 2021 5

uridine that had no effect onOPC differentiation when addedalone could reverse the differentiation induced by TF treat-ment (Figure 3E) In addition uridine totally blocked theaccumulation of zymosterol induced by TF (Figure 3F)

Finally adding recombinant cytokines to mimic the MS in-flammatory environment27 we found that a combined IFNγIL-17 cytokine stimulation slightly decreased the OPC dif-ferentiation in comparison to control (06 plusmn 01 IFNγIL-17vs 1 plusmn 01 Ctrl) and that cotreatment with cytokines and TFreversed the differentiation induced by TF treatment (11 plusmn02 TF + IFNγIL-17 vs 32 plusmn 04 TF)

TF Treatment Increased OligodendrocyteRemyelination in Vivo

In Xenopus laevisMbpGFP-NTR transgenic Xenopus laevis tadpoles weredemyelinatedwithMTZ(10mM) for 10 days (Figure 4 A andB)and then returned to either fresh water (controls) or water con-taining increasing concentrations of TF After 10 days of exposureto MTZ the number of GFP+ cells per optic nerve significantly

decreased from 2475 plusmn 45 to 36 plusmn 11 Three days (R3) afterwithdrawal of MTZ spontaneous recovery occurred and oligo-dendrocytes per optic nerve reached 80 plusmn 11 Treatment ofdemyelinated tadpoles with TF improved remyelination by afactor of 15- 18- and 225-fold for concentrations of 1 10 and100 μM respectively (Figure 4C) These data demonstrated astrong remyelinating efficacy of TF in live animals

In MiceFollowing LPC-induced demyelination in the dorsal funiculus(Figure 5 A and B) TF (20mgkg) was administrated throughoral gavage daily for 10 days starting 1 day after LPC injection

The number of oligodendroglial lineage cells and postmitoticoligodendrocytes was quantified using Olig2 (Figure 5 C DI and J) and APC (CC1 mAb) (Figure 5 FndashJ) as markersrespectively The number of Olig2+ oligodendrocyte lineagecells within the lesion did not change between the groups(Figure 5 E) By contrast TF increased the number of CC1postmitotic oligodendrocytes in the lesion compared withanimals treated with the vehicle (2412 plusmn 198 vs 1798 plusmn 209

Figure 2 Effect of TF on OPC Differentiation

(A and B) Newborn-derived OPCs cultures fixed at DIV 7 Coimmunolabeling for Olig2 and MOG in control (Ctrl)- (A) and TF-treated conditions (B) Whitearrowheads indicate cells coexpressing Olig2 and MOG (C) A higher proportion of Olig2+ cells were coexpressing MOG when treated with TF (10 nMndash1 μM)compared with the control condition (D and E) Adult OPCs were isolated by fluorescence-activated cell sorting from the CNS of 2 months old PDGFRaGFPmice and immunostained for Olig2 and MOG in control (Ctrl)- (D) and TF-treated conditions (E) (F) The percentage of Olig2+ cells coexpressing MOG issignificantly increased in cultures treated with TF compared to control Data shown aremean plusmn SEM from 3 to 5 individual experiments p lt 005 p lt 001p lt 0001 (1-way ANOVA Dunn post hoc test (C) Student 2-tailed unpaired t test [F]) Scale bar in AndashF = 10 μmMOG=myelin oligodendrocyte glycoproteinOPC = oligodendrocyte precursor cell TF = teriflunomide

6 Neurology Neuroimmunology amp Neuroinflammation | Volume 8 Number 6 | November 2021 NeurologyorgNN

Figure 5 H) Importantly the fraction of Olig2+ cells alsopositive for CC1 was significantly increased in the lesion ofTF-treated mice (489 plusmn 31) compared with controls(287 plusmn 25) (Figure 5K) These findings demonstratedthat TF promotes oligodendrocyte differentiation in vivoduring remyelination following LPC-induced demyelination

We then investigated whether TF treatment modulated myelinrepair in the LPC induced focalmousemodel of demyelinationIn control animals remyelinating axons were characterized bythin myelin sheaths compared with TF-treated animals(Figure 6 A and B) At 11 days post-lesion quantificationrevealed 676 plusmn 35 of remyelinated axons in TF-treatedanimals compared with 562 plusmn 26 in control animals

DiscussionWe report here that TF an immune active drug approved for thetreatment of relapsing MS enhanced oligodendroglial

differentiation in vitro at nanomolar concentrations both onneonatal and adult purified OPCs in cultures an effect mediatedby an accumulation of 89-unsaturated sterols We furthershowed that following a systemic administration TF promotedremyelination in vivo across species in 2 noninflammatorymodels of demyelination These results highlight a potentialbystander effect of the drug independent from its action on theimmune system

The classical mechanism of action of TF in MS is a reversibleinhibition of dihydroorotate dehydrogenase (DHODH) amitochondrial enzyme involved in the de novo pyrimidinesynthesis pathway This enzyme is highly expressed inproliferating lymphocytes and its inhibition in the peripheryresults in a reduced proliferation of activated lymphocytesimpeding the availability of activated autoreactive immunecells to infiltrate the CNS11 Through its action on DHODHTF targets both T- and B-cell activation28 TF was also de-scribed to enhance in humans the expression of programmed

Figure 3 OPC Differentiation Induced by Teriflunomide Is Reversed by Ro 48-8071 and Associated With 89-UnsaturatedSterol Production

(A) OPCs treatedwith unconditioned (Ctrl) or TF andor Ro48-8071were immunostained againstOlig2 andMOGat 96hours following treatment The percentageof Olig2+ cells coexpressingMOGwas significantly increased in cultures treatedwith TF comparedwith control an effect blockedby the Ro48-8071 treatment (B)Quantitation of sterol levels inOPCs treatedwith TFandor Ro48-8071 InOPC cultures treated for 24hourswith TF the level of zymosterol was increased (resultsare expressed as of controls) whereas lanosterol and cholesterol levels were unchanged (C and D) EBP and DHODH messenger RNA levels measured byreverse transcriptase-quantitative polymerase chain reaction inOPCs Br and SC The Li and Spwereusedaspositive control for EBP andDHODHenzymatic geneexpression respectivelyGlyceraldehyde3-phosphatedehydrogenasewasusedas the reference gene (E) ThepercentageofMOG+Olig2+ oligodendrocytesat 96hourswas significantly increased inOPCs treatedwithTF comparedwith control aneffect reversedby theuridine treatment (F)Uridineblocked theaccumulationof zymosterol induced by teriflunomide (G) The percentage of MOG+Olig2+ oligodendrocytes at 96 hours following treatment with TF andor IFNγIL-17 wassignificantly decreased in OPCs treated with TF and exposed to IFNγIL-17 cytokines compared with TF Data are shown as mean plusmn SEM from 3 individualexperiments p lt 005 p lt 0001 (1-way ANOVANewman-Keuls post hoc test) Br = brain DHODH=dihydroorotate dehydrogenase EBP = emopamil bindingprotein Li = liver OPC = oligodendrocyte precursor cell SC = spinal cord Sp = spleen TF = teriflunomide

NeurologyorgNN Neurology Neuroimmunology amp Neuroinflammation | Volume 8 Number 6 | November 2021 7

death-ligand 1 by monocytes contributing to a tolerogenicbias in the blood of patients with MS29 In a chronic geneticdysmyelinating model TF was also shown to foster the pro-liferation of CD8+CD122+PD-1+ regulatory T cells in theCNS resulting in neuronal protection30

Beyond its effect on the adaptive immune system only a fewbystander effects have been suggested to date In vitro highconcentration (5 μM) slightly reducedmicroglial proliferationin mixed glial cultures derived from rats but did not affectmicroglial differentiation status31 In vivo oral gavage with TFin mice chronically infected by the Theiler virus resulted in anonsignificant reduction in microglial density in the corpuscallosum32 Leflunomide a prodrug of TF could mitigateexperimental autoimmune encephalitis partly by acting onmicroglial cells independently of pyrimidine depletion33 Inrat glial cultures TF was also shown to promote the differ-entiation of OPCs toward mature oligodendrocytes but onlywhen short (1 day) and early pulses at high concentration(5 μM)were added to themedium12When the treatment wasprolonged for several days the effect on differentiation andmyelination disappeared Blood concentration of unboundTF in treated patients is usually within the submicromolarrange34 and at best reach 2ndash4 μM35 making unlikely thathigher concentration could be reached in MS lesion andprecluding any promyelinating effect behind a preservedblood brain barrier (BBB) We therefore investigated whetherlower concentration of the drug in cultures could also affectoligodendrocytes and questioned about a remyelinating effi-cacy in vivo in demyelination models with an intact BBB Weshowed that very low-concentration down to 10 nM TFdecreased OPC proliferation and enhanced oligodendrocytedifferentiation without the need to apply short pulses Ofnote this effect was shown not only for OPCs derived from

newborn animals but also onOPCs purified from adult brainswhich are the key actors of the remyelinating process thatshould be targeted by a therapeutic promyelinating agent36

As 1ndash2 of the serum concentration of TF has been shownto cross the BBB12 it is reasonable to hypothesize that inhumans a 10 nM concentration may reach the brain withoutany BBB leakage and could in theory act on adult OPCs topromote repair Our in vivo results further support a repaircapacity across species in 2 noninflammatory models with noBBB pathology In each model TF significantly enhanced thedifferentiation of newly formed oligodendrocytes and thisfinally resulted in an increased formation of newmyelin sheetscharacterized by a thinner diameter on electronic microscopyWe provided here in vivo evidence of a regenerative propertyof TF in rodents

A key finding of our study was the identification of the 89-unsaturated sterol pathway as a potential mechanism involvedin the promyelinating effect of TF Those intermediate me-tabolites in the cholesterol synthesis cascade have beenidentified as able to promote the formation of new matureoligodendrocytes and their accumulation was proposed as ashared mechanism by many small molecule enhancers ofremyelination independently of their canonical target9 In-hibition of a narrow range of cholesterol biosynthesis enzymesbetween CYP51 (a target of imidazole antifungal drugs) andEBP a potential target for the promyelinating drugs clemas-tine tamoxifen and bazedoxifene937 has therefore emergedas a promising pharmacologic pathway for remyelinatingstrategies Inhibition with Ro 48-8071 of the oxidosqualenecyclase an enzyme that catalyzes the step just before thesynthesis of lanosterol the first 89-unsaturated sterol rever-ted the oligodendroglial differentiation induced by TF inculture demonstrating the involvement of this cascade

Figure 4 Effect of TF on Remyelination

Dose response of remyelination potency of TF (A and B) Detection of GFP+ oligodendroglial cells in optic nerves of stage53 MbpGFP-NTR tadpoles De-myelination of stage53 MbpGFP-NTR tadpoles was achieved by 10 days exposure to metronidazole (10 mM) in the swimming water Tadpoles were thenreturned to normalwater (control) or TF for 3 days Thenumber ofGFP+ cells in the optic nerve in control (A) is lower comparedwith TF-treated tadpoles (B) (C)Remyelination was assayed by counting the number of GFP+ cells per optic nerve on day 3 of the repair period Treatment of tadpoles with TF at concen-trations ranging between 1 μM and 100 μM improved remyelination up to 225-fold compared with spontaneous recovery (control) set as 1 Data shown aremean plusmn SEM n = 5ndash8 tadpoles per group p lt 005 p lt 001 (1-way ANOVA Dunn post hoc test Scale bar in A and B = 20 μmMBP-GFP-NTR =myelin basicproteinndashGFP-nitroreductase TF = teriflunomide

8 Neurology Neuroimmunology amp Neuroinflammation | Volume 8 Number 6 | November 2021 NeurologyorgNN

Furthermore we showed that TF significantly enhanced theaccumulation of zymosterol which has been identified as themost potent sterol in oligodendroglial differentiation assays9

We therefore hypothetized that TF could inhibit EBP the

enzyme catalyzing zymosterol in the cholesterol biosynthesispathwayWe found that OPCs indeed express moderate levelsof messenger RNAs for EBP but subsequently failed to showa direct effect of TF on EBP Conversely oligodendrocyte

Figure 5 TF Induces Oligodendrocyte Differentiation During Remyelination

Demyelination was induced by lyso-phosphatidylcholine on day 0 anddifferentiation was assessed on day11 (A and B) Triple immunolabelingfor Olig2 MBP and CC1 in the spinalcord lesion of control (NaCl)-treatedmice (A) and TF-treated mice (B) Thelesion limits are indicated by whitedashed lines (C and D) Immunolab-eling forOlig2 in the core of the lesionof control (NaCl)-treatedmice (C) andTF-treated mice (D) (E) No differencein the number of Olig2+cellsmm2 isobserved between the groups (F andG) Immunolabeling for CC1 in thecore of the lesion of control (NaCl)-treated mice (F) and TF-treated mice(G) (H) Significantly more CC1+ cellsare present in the lesion of TF-treatedmice compared with control (I and J)Merge showing the colabeling forOlig2 and CC1 White arrowheadsindicate cells coexpressing Olig2 andCC1 (K) The percentage of Olig2+

cells coexpressing CC1 is significantlyincreased in the lesion of TF treatedmice compared with control Datashown are mean plusmn SEM n = 5 miceper group p lt 005 p lt 0001(Student 2-tailed unpaired t test)Scale bar = 10 μm MBP = myelin ba-sic protein TF = teriflunomide

NeurologyorgNN Neurology Neuroimmunology amp Neuroinflammation | Volume 8 Number 6 | November 2021 9

differentiation and zymosterol accumulation induced by TFwere both abrogated in the presence of an excess of uridinesuggesting an involvement of the DHODH canonical path-way38 Whether inhibiting DHODH in oligodendrocyte couldresult in an indirect effect on cholesterol biogenesis cascade is aburning question that should be addressed in further research

One limitation of our study is that it focused on noninflammatoryanimal models questioning about its relevance in the humancontext MS is an inflammatory demyelinating disease in whichimmune cells could inhibit oligodendroglial differentiation andremyelination39 It was reported that the blocked oligodendroglialdifferentiation induced by proinflammatory cytokines was notrestored by the application of oligodendroglial differentiationpromoting drugs40 According to this we found that the directeffect of TF on oligodendrocyte was not maintained in thepresence of interleukin-17 and interferon-γ However adding TFto peripheral blood mononuclear cells was also shown to rescueoligodendroglial differentiation40 attesting that the dual effect ofthis drug on inflammatory and remyelination cells could indeedfavor regeneration in the human context In clinical phase 3 trialsTF reduced the annualized relapse rate in relapsing MS (around30 reduction comparedwith placebo1041) and clinically isolatedsyndrome42 However despite this moderate effect on relapsesTF consistently improved several outcomes linked to persistenttissue damage such as relapses with sequelae42 brain atrophy43

and hypointense lesions on MRI10 It also significantly reduceddisability progression in the 2 placebo-controlled phase 3 studiesin relapsing MS1041 Although not demonstrating a regenerativeor neuroprotective effect of the drug these results have raised thepossibility of a protective action beyond immunomodulationHow the impact on remyelination could be explored in clinicaltrials is a tricky question as it would imply to differentiate the anti-inflammatory and the remyelinating properties A reanalysis ofpreviously acquired imaging data from pivotal trials focusing onmarkers more sensitive to myelin content such as T1T2ratios4445 or more advanced quantitative sequences when avail-able46 would be of great added value to achieve this goal Analternative would be to design novel and focused trials aiming atinvestigating remyelination using the most specific tools available

for instance electrophysiology47 quantitative MRI46 or positronemission tomography7

In conclusion we have shown that TF decreases OPC pro-liferation induces OPC differentiation and promotesremyelination in living animals Importantly our study pro-vides a novel mechanism of action of TF on remyelination invivo through the accumulation of 89-unsaturated sterols acrucial cellular mechanism involved in oligodendrocytephysiology These findings reinforce the idea that modulationof the cholesterol biosynthesis pathway represents a promis-ing therapeutic target for the development of remyelinatingstrategies and open the perspective of an additional benefit ofTF treatment for patients with MS

AcknowledgmentThe authors thank Dr P Soriano for providing PDGFαRGFPtransgenic mice They warmly thank Anna Revellat for precioushelp and fruitful discussion They thank Guoqing Sheng fromSanofi for providing the screening assay for EBP and for testingteriflunomide on it They thank C Blanc and B Hoareau (FlowCytometry Core CyPS Sorbonne Universite Pitie-SalpetriereHospital Paris France) for their assistance on FACS The studywas performed at the cell culture (Celis) histology (Histomics)and preclinical functional exploration platforms (PHENO-ICMice and Xenopus core facility) of ICM The authors thankall the technical staff members involved in these experiments

Study FundingThis work was supported by an unrestricted grant fromGenzyme-Sanofi Our laboratory was also supported by theprogram ldquoInvestissements drsquoavenirrdquo program ANR-10-IAIHU-06 (IHU-A-ICM) INSERM CNRS and Sorbonne Universite

DisclosureE Martin M-S Aigrot and C Bachelin report no disclosuresrelevant to the manuscript F Lamari reports personal feesfrom Amicus Pharmaceutical and travel support from Sanofi-Genzyme C Lubetzki reports grants and personal fees fromBiogen and personal fees fromMerck Serono Roche Rewind

Figure 6 Effect of TF on Remyelination

(A and B) Electronmicrographs of the lesion areaat 11 days postlesion In control-treated mice (A)and in TF-treated mice (B) The proportion ofremyelinated axons was increased in TF-treatedmice (C) The percentage of remyelinated axonsis significantly increased in the lesion of TF-trea-ted mice compared with controls Data shownare mean plusmn SEM n = 5mice p lt 005 (Student 2-tailed unpaired t test) Scale bars = 5 μm TF =teriflunomide

10 Neurology Neuroimmunology amp Neuroinflammation | Volume 8 Number 6 | November 2021 NeurologyorgNN

and Ipsen BN Oumesmar reports grants and personal feesfrom UCB Pharma and grants from Genentech B Zalc re-ports grants from Novartis and Merck B Stankoff reportsgrants and personal fees from Roche Genzyme and MerckSerono and personal fees from Novartis Teva and BiogenGo to NeurologyorgNN for full disclosures

Publication HistoryReceived by Neurology Neuroimmunology amp NeuroinflammationNovember 9 2020 Accepted in final form August 23 2021

References1 Criste G Trapp B Dutta R Axonal loss in multiple sclerosis causes and mechanisms

Handb Clin Neurol 2014122101-1132 Lubetzki C Stankoff B Demyelination in multiple sclerosisHandb Clin Neurol 2014

12289-993 Irvine KA Blakemore WF Remyelination protects axons from demyelination-

associated axon degeneration Brain 2008131(pt 6)1464-14774 Mei F Lehmann-Horn K Shen YA et al Accelerated remyelination during in-

flammatory demyelination prevents axonal loss and improves functional recoveryElife 2016 Sep 275e18246

5 Perier O Gregoire A Electron microscopic features of multiple sclerosis lesionsBrain 196588(5)937-952

6 Prineas JW Barnard RO Kwon EE Sharer LR Cho E-SMultiple sclerosis remyelinationof nascent lesions remyelination of nascent lesions Ann Neurol 199333(2)137-151

7 Bodini B Veronese M Garcıa-Lorenzo D et al Dynamic imaging of individualremyelination profiles in multiple sclerosis Ann Neurol 201679(5)726-738

8 Lubetzki C Zalc B Williams A Stadelmann C Stankoff B Remyelination in multiplesclerosis from basic science to clinical translation Lancet Neurol 202019(8)678-688

9 Hubler Z AllimuthuD Bederman I et al Accumulation of 89-unsaturated sterols drivesoligodendrocyte formation and remyelination Nature 2018560(7718)372-376

10 OrsquoConnor P Wolinsky JS Confavreux C et al Randomized trial of oral teriflunomidefor relapsing multiple sclerosis N Engl J Med 2011365(14)1293-1303

11 Bar-Or A Pachner A Menguy-Vacheron F Kaplan JWiendl H Teriflunomide and itsmechanism of action in multiple sclerosis Drugs 201474(6)659-674

12 Gottle P Manousi A Kremer D Reiche L Hartung HP Kury P Teriflunomide promotesoligodendroglial differentiation and myelination J Neuroinflammation 201815(1)76

13 Klinghoffer RA Mueting-Nelsen PF Faerman A Shani M Soriano P The two PDGFreceptors maintain conserved signaling in vivo despite divergent embryologicalfunctions Mol Cell 20017(2)343-354

14 Stankoff B Demerens C Goujet-Zalc C et al Transcription of myelin basic proteinpromoted by regulatory elements in the proximal 5rsquo sequence requires myelino-genesis Mult Scler 19962(3)125-132

15 Kaya FMannioui AChesneauA et al Live imaging of targeted cell ablation inXenopusa new model to study demyelination and repair J Neurosci 201232(37)12885-12895

16 Nieuwkoop PD Faber J Normal Table of Xenopus laevis Garland 199417 Lubetzki C Goujet-Zalc C Gansmuller A MongeM Brillat A Zalc B Morphological

biochemical and functional characterization of bulk isolated glial progenitor cellsJ Neurochem 199156(2)671-680

18 Piaton G Aigrot MSWilliams A et al Class 3 semaphorins influence oligodendrocyteprecursor recruitment and remyelination in adult central nervous system Brain 2011134(Pt 4)1156-1167

19 Klinghoffer RA Hamilton TG Hoch R Soriano P An allelic series at the PDGFαRlocus indicates unequal contributions of distinct signaling pathways during de-velopment Dev Cell 20022(1)103-113

20 Stankoff B Barron S Allard J et al Oligodendroglial expression of edg-2 receptordevelopmental analysis and pharmacological responses to lysophosphatidic acidMolCell Neurosci 200220(3)415-428

21 Honda A Yamashita K Miyazaki H et al Highly sensitive analysis of sterol profiles inhuman serum by LC-ESI-MSMS J Lipid Res 200849(9)2063-2073

22 Hanin A Baudin P Demeret S et al Disturbances of brain cholesterol metabolism a newexcitotoxic process associated with status epilepticus Neurobiol Dis 2021154105346

23 Tepavcevic V Kerninon C Aigrot MS et al Early netrin-1 expression impairs centralnervous system remyelination Ann Neurol 201476(2)252-268

24 Mannioui A Vauzanges Q Fini JB et al The Xenopus tadpole an in vivo model toscreen drugs favoring remyelination Mult Scler 201824(11)1421-1432

25 Scolding NJ Frith S Linington C Morgan BP Campbell AK Compston DA Myelin-oligodendrocyte glycoprotein (MOG) is a surface marker of oligodendrocyte matu-ration J Neuroimmunol 198922(3)169-176

26 Solly SK Thomas JL Monge M et al Myelinoligodendrocyte glycoprotein (MOG)expression is associated with myelin deposition Glia 199618(1)39-48

27 Kirby L Jin J Cardona JG et al Oligodendrocyte precursor cells present antigen andare cytotoxic targets in inflammatory demyelination Nat Commun 201910(1)3887

28 Gandoglia I Ivaldi F Laroni A et al Teriflunomide treatment reduces B cells inpatients with MS Neurol Neuroimmunol Neuroinflamm 20174(6)e403

29 Medina S Sainz de la Maza S Villarrubia N et al Teriflunomide induces a tolerogenicbias in blood immune cells of MS patients Ann Clin Transl Neurol 20196(2)355-363

30 Groh J Horner M Martini R Teriflunomide attenuates neuroinflammation-relatedneural damage in mice carrying human PLP1 mutations J Neuroinflammation 201815(1)194

31 Wostradowski T Prajeeth CK Gudi V et al In vitro evaluation of physiologicallyrelevant concentrations of teriflunomide on activation and proliferation of primaryrodent microglia J Neuroinflammation 201613(1)250

32 Pol S Sveinsson M Sudyn M et al Teriflunomidersquos effect on glia in experimental de-myelinating disease a neuroimaging and histologic study J Neuroimaging 201929(1)52-61

33 Korn T Magnus T Toyka K Jung S Modulation of effector cell functions in ex-perimental autoimmune encephalomyelitis by leflunomidemdashmechanisms in-dependent of pyrimidine depletion J Leukoc Biol 200476(5)950-960

34 Hopkins AM Moghaddami M Foster DJR Proudman SM Upton RN Wiese MDIntracellular CD3 + T lymphocyte teriflunomide concentration is poorly correlatedwith and has greater variability than unbound plasma teriflunomide concentrationDrug Metab Dispos 2017458-16

35 Miller AE Oral teriflunomide in the treatment of relapsing forms of multiple sclerosisclinical evidence and long-term experience Ther Adv Neurol Disord 201710(12)381-396

36 Foerster S Hill MFE Franklin RJM Diversity in the oligodendrocyte lineage plas-ticity or heterogeneity Glia 201967(10)1797-1805

37 Rankin KA Mei F Kim K et al Selective estrogen receptor modulators enhance CNSremyelination independent of estrogen receptors J Neurosci 201939(12)2184-2194

38 Li L Liu J Delohery T Zhang D Arendt C Jones C The effects of teriflunomideon lymphocyte subpopulations in human peripheral blood mononuclear cells in vitroJ Neuroimmunol 2013265(1-2)82-90

39 Heszlig K Starost L Kieran NW et al Lesion stage-dependent causes for impairedremyelination in MS Acta Neuropathol 2020140(3)359-375

40 Starost L Lindner M Herold M et al Extrinsic immune cell-derived but not intrinsicoligodendroglial factors contribute to oligodendroglial differentiation block in mul-tiple sclerosis Acta Neuropathol 2020140(5)715-736

41 Confavreux C OrsquoConnor P Comi G et al Oral teriflunomide for patients withrelapsing multiple sclerosis (TOWER) a randomised double-blind placebo-controlled phase 3 trial Lancet Neurol 201413(3)247-256

42 Miller AE Macdonell R Comi G et al Teriflunomide reduces relapses with sequelaeand relapses leading to hospitalizations results from the TOWER study J Neurol2014261(9)1781-1788

43 Radue E-W Sprenger T Gaetano L et al Teriflunomide slows BVL in relapsing MSNeurol Neuroimmunol Neuroinflamm 20174(5)e390

Appendix Authors

Name Location Contribution

Elodie MartinPhD

Paris Brain InstituteParis France

Designed and conceptualized thestudy major role in the acquisitionof data analyzed the datainterpreted the data and draftedthe manuscript for intellectualcontent

Marie-StephaneAigrot PhD

Paris Brain InstituteParis France

Major role in the acquisition of dataanalyzed the data interpreted thedata and drafted the manuscriptfor intellectual content

FoudilLamari MDPhD

Sorbonne UniversityHospital ParisFrance

Acquisition of data (sterolquantification)

CorinneBachelin PhD

Paris Brain InstituteParis France

Acquisition of data (electronicmicroscopy)

CatherineLubetzki MDPhD

Paris Brain InstituteParis France

Designed and conceptualized thestudy and drafted the manuscriptfor intellectual content

Brahim NaitOumesmarPhD

Paris Brain InstituteParis France

Acquisition of data (electronicmicroscopy)

Bernard ZalcMD PhD

Paris Brain InstituteParis France

Acquisition of data (tadpoleexperiment) and drafted themanuscript for intellectual content

BrunoStankoff MDPhD

Paris Brain InstituteParis France

Obtained funding for the studydesigned and conceptualized thestudy acquisition andinterpretation of data and draftedthe manuscript for intellectualcontent

NeurologyorgNN Neurology Neuroimmunology amp Neuroinflammation | Volume 8 Number 6 | November 2021 11

44 Hagiwara A Hori M Kamagata K et al Myelin measurement comparison betweensimultaneous tissue relaxometry magnetization transfer saturation index and t1wt2w ratio methods Sci Rep 20188(1)10554

45 Nakamura K Chen JT Ontaneda D Fox RJ Trapp BD T1-T2-weighted ratio differsin demyelinated cortex in multiple sclerosis Ann Neurol 201782(4)635-639

46 Mallik S Samson RS Wheeler-Kingshott CA Miller DH Imaging outcomes for trialsof remyelination in multiple sclerosis J Neurol Neurosurg Psychiatry 201485(12)1396-1404

47 Heidari M Radcliff AB McLellan GJ et al Evoked potentials as a biomarker ofremyelination Proc Natl Acad Sci USA 2019116(52)27074-27083

12 Neurology Neuroimmunology amp Neuroinflammation | Volume 8 Number 6 | November 2021 NeurologyorgNN

DOI 101212NXI000000000000109120218 Neurol Neuroimmunol Neuroinflamm

Elodie Martin Marie-Stephane Aigrot Foudil Lamari et al CNS Remyelination

Teriflunomide Promotes Oligodendroglial 89-Unsaturated Sterol Accumulation and

This information is current as of October 12 2021

ServicesUpdated Information amp

httpnnneurologyorgcontent86e1091fullhtmlincluding high resolution figures can be found at

References httpnnneurologyorgcontent86e1091fullhtmlref-list-1

This article cites 46 articles 8 of which you can access for free at

Subspecialty Collections

httpnnneurologyorgcgicollectionmultiple_sclerosisMultiple sclerosisfollowing collection(s) This article along with others on similar topics appears in the

Permissions amp Licensing

httpnnneurologyorgmiscaboutxhtmlpermissionsits entirety can be found online atInformation about reproducing this article in parts (figurestables) or in

Reprints

httpnnneurologyorgmiscaddirxhtmlreprintsusInformation about ordering reprints can be found online

Academy of Neurology All rights reserved Online ISSN 2332-7812Copyright copy 2021 The Author(s) Published by Wolters Kluwer Health Inc on behalf of the AmericanPublished since April 2014 it is an open-access online-only continuous publication journal Copyright

is an official journal of the American Academy of NeurologyNeurol Neuroimmunol Neuroinflamm