Divine Mercy Parish · Today · Divine Mercy Parish Parroquia Divina Misericordia Formerly St....

Post on 26-Jul-2020

4 views 0 download

Transcript of Divine Mercy Parish · Today · Divine Mercy Parish Parroquia Divina Misericordia Formerly St....

Divine Mercy Parish Parroquia Divina Misericordia

Formerly St. Mary’s and St. Mark’s Roman Catholic Churches Serving Jesus Christ since 1854 and 1871 232 Central Avenue, Rahway NJ 07065

h ps://www.divinemercyrahway.church

New Mass Schedule Effec ve June 21, 2020

Weekday 12:00 pm Monday to Friday Martes 7:00 pm Misa en Español Saturday 9:00 am, 4:00 pm (Vigil Mass) Sunday 8:00 am, 9:30 am, 11:00 am, 12:30 pm Misa en Español Holydays 6:00 pm (Vigil Mass) 12:00 pm, 6:00 pm, 7:00 pm Misa en Español

Rev. Alexander T. Cruz

Pastor, extn 103 Email:fr.alex@divinemercyrahway.church

Rev. Jozef Krajnak, Ph.D. Resident Priest, extn 104

Email:frjozef63@divinemercyrahway.church Joseph Keefe Arlene Mione

Trustees

The Seventeenth Sunday in Ordinary Time July 26, 2020

Parish Membership

Our parish embraces diversity. We may come from different origins but we are

one in faith, love & devo on to the merciful Heart of Jesus. Everyone is

welcome to join our growing communi-ty. Please email or visit our office to

register. Parish Office/Rectory

Hours: Monday to Friday 9 am - 3 pm

Email: office@divinemercyrahway.church Tel (732)388-0082, (732)388-0083

CCD (732)382-0004

The Perfect Prayer in time of Covid19

Eternal God, in whom mercy is endless and the treasury of com-

passion inexhaustible, look kindly upon us, and increase Your mercy in us, that in difficult moments, we might not despair nor become despondent, but with great confi-dence, submit ourselves to Your

holy will, which is Love and Mercy itself.

Amen.

THE SEVENTEENTH SUNDAY IN ORDINARY TIME JULY 26, 2020

GIFTS AND OFFERINGS

The Tabernacle Lamp is being offered for Ϯ Albert F. Reitenmeyer. The Altar Bread is being offered for Ϯ John R. Reitenmeyer. The Altar Wine is being offered for Ϯ Margaret Reitenmeyer The Altar Candles are being offered for Ϯ Albert F. Reitenmeyer .

Sacramental Schedule Confession Saturdays 3:00 pm to 4:00 pm or

call the priest for an appointment

Bap sm Call the parish office to make an ap-pointment with a priest

Marriage Couples planning marriage must no fy the Parish rectory a year in advance for date and requirement. Call the Parish Office to make an appointment with a priest.

Anoin ng of the Sick Contact a priest at any me.

Holy Communion For anyone who are homebound or confined in hospitals and would like to receive Holy Communion please contact the parish office or rectory.

Divine Mercy Parish Community Worship Apostolate meets in Room 104 Rosary Society meets four mes a year Filipino Community Mass every 3rd Sunday of the month with

the Filipino Choir, 5:00 pm to 6:30 pm at the Church Divine Mercy Ministry of Jesus Meets at the Vigil Mass on every

4TH Saturday of the month Spanish Community Reuniones Hispanas Eucaris a Dominical 12:30 pm Bau sos Por favor llamar la oficina de Lunes a Viernes. Matrimonio Feligreses registrados enen que presentarse un

año antes de la boda. Reconciliación Cada Martes Despues de la Misa 12:00 pm Y de

la 7:00 pm, Cada Miercoles Despues de la Misa de la 12:00pm

Unción de los Enfermos Por favor llamar a la oficina para visitas a las casa o hospital.

Mensajeras del Amor de Cristo Visitan los enfermos Diana (732)535-0278 Educación Religiosa llamada (732)382-0004 Movimiento Juan XXIII Jueves 8:00 pm Parish School #104 Grupo Guadalupano Martes 7:00 pm Iglesia Grupo Juvenil "Angeles de Jesús" Sábado 4:00pm - 6:00pm Aula 202 Grupo de Oración Sábado 7:00 pm Connell Hall “Grupos Voluntarios Limpian La Iglesia” Mil Avemarias - Cada Primera Semana del mes, Miercoles

manana Juan XXIII - Cada Segunda Semana del mes, Sábado Guadalupanos - Cada Tercera semana del mes, Sábado Grupo de Oracion– Cada Cuarta semana del mes, Sábado

DUE TO COVID 19 ALL MEETINGS ARE TEMPORARILY SUSPEND-

ED. MEETINGS WILL START TO RESUME SEPTEMBER 2020.

CDC and Archdiocesan Guidelines in Celebra ng Mass during Pandemic

1. Everyone MUST WEAR MASK all the me while inside

the church. 2. Front of every available seats are marked with a

WHITE CROSS. Seats without the white cross should be le vacant.

3. To follow and maintain social distancing 70 to 80 peo-ple only will be allowed inside the church.

4. Keep social distancing at all mes (6 feet apart from each other) Couples and families living in one roof may seat next to each other

5. NO SHAKING OF HANDS and NO KISSING during the giving of the sign of peace. NOD and WAVING of HANDS are the methods acceptable in giving the sign of peace.

6. Use the middle aisle to receive Holy Communion. Stay on the floor markings to keep social distancing. Use the le or right aisle to return to the pew.

7. Communion by hands are highly recommended and encouraged at this me.

8. Anyone who feels the need to step out of the church during mass for a moment to breath may do so and may return to the seat a er.

9. The Chapel at the le side of the church will be used as extension of the church during mass and will open for people with special condi on and to those in need of space and flexibility. The chapel has a maximum capacity of 6 people at this me. Communion will be served to all occupants by a Eucharis c minister.

10. Please maintain social distancing when leaving the church.

11. Congrega ng a er mass inside the church is not al-lowed.

12. Please follow all the guidelines religiously. Thank you very much for your coopera on

and understanding.

THE SEVENTEENTH SUNDAY IN ORDINARY TIME JULY 26, 2020

SATURDAY, JULY 25 ( Vigil Mass ) 4:00 pm (V) Ϯ Ida Mele

SUNDAY, JULY 26 The Seventeenth Sunday in Ordinary Time

8:00 am Ϯ Ruth McCarthy 9:30 am Ϯ Yuhas Family 11:00 am Ϯ John Reitenmeyer 12:30 pm (SP) Ϯ Paulina Rivas

MONDAY, JULY 27

12:00 pm People of the Parish

TUESDAY, JULY 28 12:00 pm Ϯ Margaret Reitenmeyer 7:00 pm (SP) Ϯ Albert Reitenmeyer

WEDNESDAY, JULY 29 Feast of Saint Martha

12:00 pm David & Rosewynne De Guzman (Wedding Anniversary)

THURSDAY, JULY 30

Feast of Saint Chrysologus 12:00 pm Ϯ John Reitenmeyer

FRIDAY, JULY 31

Feast of Saint Igna us of Loyola 12:00 pm Ϯ Gerlando Miliziano ( Death Anniversary)

SATURDAY, AUGUST 1 Feast of Saint Alphonsus Liguori

9:00 am Ϯ Bill McCarthy 4:00 pm (V) Ϯ Mary Pileggi

SUNDAY, AUGUST 2 8:00 am Ϯ Dorothy Sullivan

9:30 am Ϯ Agnes Barrone 11:00 am Ϯ Albert Reitenmeyer 12:30 pm (SP) Ϯ Margaret Reitenmeyer

Legend: (V) Vigil Mass , (SP) Spanish Mass, (F) Filipino Mass

Please remember to include our parish in your prayers. Every-one can s ll send weekly offerings for our Parish by signing up @ Parish Giving online. It is fast, secure and easy. Thank you

and be safe everyone. God bless.

FOLLOWING THE DIRECTIVES OF THE ARCHDIOCESE OF NEWARK

Welcome to PHASE 3 Started June 21, 2020

The Church will be reopened for SUNDAY Masses. Includes everything that reopened and all direc ves on Phase 2 and Phase 1 Only 50% capacity of the Church or 70 people only are allowed inside the Church excess will be turned away.

STRICT OBSERVANCE OF THE CARDINAL’S DIRECTIVE

BELOW FOR REOPENING IS WITHOUT EXCEPTION

1. Dispensa on from the obliga on to a end Mass on Sun-days and Holy Days will remain in effect. No one will be required to a end Mass when public celebra ons resume.

2. A endance will be limited to 20% for Phase 2 & 50% for Phase 3.

3. Social distancing should be strictly observed while inside the church (6 apart from each other).

4. NO MASK NO ENTRY. Mask should be worn inside the church at all mes

5. Parishioners should take their temperature before coming to Mass. Anyone with any symptoms of sickness must stay home.

6. Liturgical changes will be in placed. For Phase 3 during the Sunday masses the following will be in placed;

Dura on of mass 8:00 am English Mass

(30 minutes only, no music) 9:30 am & 11:00 am English Mass

(45 minutes only, 4 Hymns) 12:30 pm Spanish Mass

(45 minutes only, 4 Hymns) Hymns includes the Entrance, Offertory, Communion and Recessional Songs. The following will be recited only the Gloria, Alleluia, Mystery of Faith, Amen.

7. Sanita on will be done every a er mass but no one should expect that they will be any safer from germs than in other public spaces.

THE SEVENTEENTH SUNDAY IN ORDINARY TIME JULY 26, 2020

Bap sm Let’s welcome and pray for the newly Bap zed

of our Parish community Thiago Nunez, Liam Asencios, Nathan Daniel Ba sta, Goderic

Bonhomme & Diego Munoz.

THIS WEEK AT DIVINE MERCY Welcome to Phase 3

SATURDAY, JULY 25 12:00 pm First Communion Batch 2 (Church) 1:30 pm Bap sm (Liam, Nathan, Goderic, Diego) 3:00 pm Divine Mercy Chaplet (Church)

SUNDAY, JULY 26 12:00 pm Food Pantry (Annex)

TUESDAY, JULY 29 7:00 pm Guadalupano (Church)

SATURDAY, AUGUST 1 12:00 pm First Communion Batch 3 (Church) 2:00 pm Bap sm Liam Breton 5:30 pm Bap sm Alexander & Angeli Mendoza

All parish schedules are now posted at the Parish web Site h ps://divinemercyrahway.church Events & News.

PARISH RELIGIOUS EDUCATION PROGRAM

CCD Registra on SY- 2021

This is a friendly reminder to please register your children for the 2021 school year by 7/31/20. A er that date, a $10 late fee will be in effect. Classes will start on September 13, 2020. Informa on about the program, fees & payment op ons can be found at our website on h ps://www.divinemercyrahway.church/ccd. For Adults (age 18 & older) who would like to receive their sacraments in 2021, please view the RCIA informa on and registra on at h ps://www.divinemercyrahway.church/rcia

Dedica on of St. Mark’s Bell August 15, 2020

Saturday a er the Vigil Mass The original corner stone of St. Mark’s Church is part of the cur-rent memorial which has the year 1871 inscribed on the stone.

1871 was the year when the church was built. Some of the origi-nal bricks from the church were also used to build the current

memorial. The memorial is dedicated in honor of all former priests and

parishioners of St. Mark’s Church from the year 1871 to 2019. Please come and join us!

Brianna Valentina Olivos Davef Ortiz Del Pro Yalissa Ortiz Del Pro Joseph Sterlin Payano Elenny Mia Quinones Jose Luis Quinones Samantha Caroline Ramirez Natalia Alejandra Rivera Valentina Mia Rodriguez Alexander Rodriguez Marleny Judy Santiago Lopez Dayanara Santos Sophia Camila Urias Alysson Villegas Gonzalez Yazmin Estefania Yoplac

Alyson Zelaya

God Bless Our 2020 First Communicants

Jorge Acevedo Christoffer Alejandro Al-varado Nathaly Nicolle Alvarado Nastasha Isabel Cisneros Rachel Johana Cisneros John Charles Ehrig Zo ia Teresa Ehrig Elyse Figueroa Nicole Jimenez Ava Gabriella Kerlin Mary Jessica Lim Denyse Lopez David Lopez Kristal Cruz Macedas Jacqueline Mariano Angelina Joanne Martinez Nahomy Charles Monge

2020 First Communion Celebration Saturday, 12:00 PM

July 18, 25 & August 1, 2020 Divine Mercy Parish, Rahway, New Jersey

Officiated by Rev. Alexander T. Cruz, Pastor

Rev. Jozef Krajnak, Resident Priest

I am the Bread of Life …

Let the Little Children come to Me, for the kingdom of God belongs to such as these.

( Luke 18 : 16)

THE SEVENTEENTH SUNDAY IN ORDINARY TIME JULY 26, 2020

1 Kings 3 : 5, 7 - 12 Psalms 119 : 57, 72, 76 - 77, 127 - 128, 129 - 130

Romans 8 : 28 - 30 Gospel from Ma hew 13 : 44 - 52 or 13: 44 - 46

SUNDAY REFLECTION

Reading I: 1 Kings 3:5, 7-12 God gives Solomon a choice of gifts. Solomon asks God for "an understanding mind," so that he could always do what was just and best for his subjects. God rewards him with the gift of wisdom making him the wisest man that ever lived. — The Sunday Readings by Fr. Kevin O'Sullivan, O.F.M. Reading II: Romans 8:28-30 The theme of this reading concerns the graciousness and mer-cy of God at work in calling men to himself, justifying them, and glorifying them as well. The point of the reading is the eternal mystery of the ineffable love of God for man, even be-fore man existed. — A Celebrants Guide to the New Sacramen-tary - A Cycle by Kevin The Gospel : Ma hew 13 : 44 - 52 In today's two parables Jesus gives us a new angle on the Kingdom of Heaven. He knows we all love to ind a bargain –either by accident or a lengthy search. Firstly, Jesus draws on the custom of people hiding their valu-ables in the ground, when they feared someone would steal them. They hoped to be able to recover their treasures, as the need arose. But, sadly, such precautions could mis ire -when the only one who knew the secret whereabouts of his valua-bles died, before he'd recovered them! Then, many years later, someone might accidentally stumble across his hidden wealth. That's what happened in this para-ble. The man then bought the ield so that he could acquire the treasure he'd discovered there. In our own time, this could also happen if a ship, laden with bullion, sank in a storm. Then, centuries later, a scuba diver accidentally discovered it. He would need to sell all his pos-sessions to raise the funds to recover the lost sunken treasure -if he judged such a sacri ice was worthwhile. This parable tells us that some people do stumble across the Good News of the kingdom, without looking for it. Meeting a committed, loving, caring Christian may touch their hearts and open their eyes to the wonder of God's Kingdom. They may be moved by the hope and sense of purpose Jesus has given His followers. That, they realize, is something they must have. And they will gladly make any sacri ice to get it. In the second parable, about the pearl of great price, it's not a question of someone accidentally discovering something

precious, but of his devoting his life to inding it. He's a pearl merchant, who knows what he wants, and when he discovers it he realizes that it's worth more than all his other pearls put together. Shrewdly, he's prepared to sacri-ice everything he has in order to obtain that one precious

pearl. That pearl merchant represents all of us, who are seeking the greatest possible happiness. Like him, we can appreciate so much that is good and beautiful in life. But we are restless and dissatis ied until we discover God, who alone can satisfy our deepest longings. St. Augustine famously sums up our restlessness in this search, "You have made us for yourself, O Lord, and our heart is restless until it rests in you." But when we do discover where our true happiness lies we should be like the two characters in these parables. Neither of them was a reckless, foolhardy gambler. They appreciated the outstanding value of what they'd found and after careful consideration decided it was worth more than the sum of all their other possessions. Both were single minded; both were prepared to sacri ice absolutely everything in order to gain the treasure they'd found. Like them, we must appreciate the wonder of what we've discovered –for us, the Kingdom of Heaven –and go for it with all our hearts. It's worth any sacri ice, even our very lives! That's very different from pushing religion to the fringe of our lives and only following Jesus into His Kingdom, if and when that's convenient and undemanding!

Gospel re lection by Fr. Isidore Clarke, O.P.

671 Divine Mercy Parish, Rahway, NJ John Patrick Publishing Company • www.jppc.net • 1-800-333-3166

Spin Central Laundromat519 Avenel Street, Avenel, NJ 07001 (Next to Krauszers) 732-326-9696

Earn Free Washes!!Earn Free Washes!!

Plumbing & HeatingSewer & Drain Cleaning

Fax: (732) 738-1156 Member of the Parish24 Hour EMERGENCY Service

Call Toll Free 1-866-81CRAIG 2 7 2 4 4

Craig Lehman Plumbing License Number 11122

FULLY INSURED& BONDED

N.J. LIC. NO. 4183 “A Family Tradition of Dignifi ed Service Since 1832” N.J. LIC. NO. 3786

PRE-ARRANGEMENT CENTER • CREMATION SERVICESWilliam G. Davis Jr., Manager • John W. Tluchowski, Director371 West Milton Ave. • Rahway, NJ 07065 • P: 732.388.0038

F: 732.388.7998 • www.pettitdavisfuneralhome.com

Pettit-DavisPettit-DavisFuneral HomeFuneral Home

Est. 1832Est. 1832

Heating & Air Conditioning • Over 35 Years Experience

685 Saint George Ave., Woodbridge, NJ 07095 • www.AirtecServiceInc.com

We Service All Makes & ModelsFurnaces • Air Conditioning • Indoor Air Quality • Boilers

Duct Fabricating • Maintenance ContractsCommercial Leasing • Residential Financing Available

732-634-4188Daniel McKenzie

airtecnj@yahoo.com

Italian Restaurant

Christenings • Bridal ShowersEngagement Parties • ShowersFuneral Repast • Anniversaries

Birthdays and Much More.732-726-3355

Fax: 732-726-9335453 Avenel St., Avenel, NJ 07001 • www.dominics-italian.com

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle to make sure it is the car they

are supposed to enter.

In Rememberance of Samantha Josephson

#WHATSMYNAME

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 • info@mallorysarmy.org It’s easy to join our mailing list! Just send

your email address by text message: Text MALLORYSARMY to 22828 to get started.

Message and data rates may apply.

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

& Public Healthcarent Public Safety O

oy &

MaM nrdrdrdrdrdrddddouddrd

eeefefefensl FacilShelte

ene Prod& Publi

ment, PubliResponder

Energy Secwaste - Trans- Public Work

Communicationhnology Worker

overnment Workufacturing - ChemM t i l Fi i

yournicationnicationWorkerWorke

service isovernment Workovernment Workacturing Chemacturing Chem

nvaluable &Materials FinanciaMaterials Financia& Public Healthcar& Public Healthcar

ent, Public Safety - OSafety - OervLaw EnEEE fo

dustrial Baes Workerservices & cts & Seealthcarafety -Food r - W

orta- II

CC

acturing - C

First Responders -y Se

Waterwaste - Transpcs - Public Works

Communicationechnology Work

Wo

To all thosenforcement, Public Sanforcement, Public Sa

essentiallture - Energylture - EnergyWater aste TraWater aste Tra

workerscs - Public Wors - Public WorCommunicatioCommunicatio

keepingechnology Wochnology Woovernment Wovernment W

us safe,acturing Caterials Finaaterials Fina

ficererereafety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercecece- Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg

ector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &sportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & giss & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc r

ons & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfornfornfornfornfornfornfornformatimammmmmmammmmmm orkers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty

Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml l Ml MChemical &&&&&&&&&&&l &l & l & l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rrrrrrrrrncial Services - DDDDDDDDDeeeeeeeee

ase - Commercialrssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa

& FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH enervices es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e

are - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc m- Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t R

d & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt

ation &&&&& & && & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e Co

Informatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn TechCoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&&s - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufl l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo

ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e Enforcforcforcffforcforcforcforcforcforcforceeme

e SaSa

gWe,

Canan

inus us e &e

methan

k yo

u

g gyWatateatttatatatattaaaaaa rwaswaswawaswaswawwwaswaswwwwwasswasawaw ste -tettttttttttteee Transportation & Log

cccscccccc - PPPPPPPPPPPPPPubliubliubliubliublililublibbliububuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrkrkkkkkrr & - & -& -&& -&& -&&&& -&& -&&&&& -&&&& -&& InfrInfInfrnfrInfInfrnfrIInffI ffInI fnfI fInfnfInnnfn astructuCCoCoCoCoCoCoCCoCCoCCCoooCCCCCCCC mmunmmunmmmmmmunmmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicatcaticaticatcatcatcatcattcatcatcatcattcatcatcatcatccacatcccacc ionsionsionsonsionononsonsiooionssonsonsonsiononoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornforforfnfnfornfornfornfornforfofornfornforrrfornnfforrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmatim

echhhhhhhhhnolonononoonnoloonolonnoln lonolonoooloonnnn onolonoln oonoo ggy Wgggg orkers - Community

Wedding InvitationsWedding Invitations Holiday CardsHoliday Cards

Log ontoLog onto www.JPPC.netwww.JPPC.net conveniently from your home or office.conveniently from your home or office.

ONLINE CATALOG - ONLINE ORDERING - ONLINE PROOFINGONLINE CATALOG - ONLINE ORDERING - ONLINE PROOFING

All Major Credit Cards Accepted All Major Credit Cards Accepted FREE UPS GROUND SHIPPINGFREE UPS GROUND SHIPPING!

Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting.

This describes the power of...

Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!

Call 1.800.333.3166 TODAY!