17022011
How has lr34 yr18 conferred effective rust resistance in wheat for so long
Bio conference live 2013
Our Test Organism Drosophila simulans. Trait of Interest Red vs. White.
Allele specific PCR or ARMS test Amplification Refractory Mutation System Used to detect point-mutations and small deletions, differentiates between DNA-sequences.
Finding Sequence Motifs in Alu Transposons that Enhance the Expression of Nearby Genes Kendra Baughman York Marahrens’ Lab UCLA.
The Predictivity Concept Peter Propping Institute of Human Genetics University of Bonn, Germany CDBI Seminar on predictivity, genetic tests and insurance.
Optimal designs for one and two-colour microarrays using mixed models
Work by Antonio Izzo Based on 36 soil cores from a total of 9 plots contained within a 2.5 hectare region.
The Predictivity Concept
Primer Sequence miRNAsCloning (Forward)Cloning (Reverse) miR-7-1TAATACGACTCACTATAGGGTTGGATGTTGCTGTAGAGGCATGGCCTGTGC miR-7-2TAATACGACTCACTATAGGGCTGGATACAGTGCGATGGCTGGCACCATTAG.
The visual system Lecture 1: Structure of the eye Photoreceptors: transduction and adaptation Lecture 2: Retinal processing Primary visual cortex: simple.