20 essential amino acids
Linked together to make proteins
Made of amine group, carboxylic
acid, and R group (side chain)
Sequence of amino acids
Depends on the DNA sequence
› mRNA is formed by pairing with DNA
› mRNA is then read by the ribosome
› tRNA with the mRNA to bring correct amino acid
to the right place
› as more tRNA comes in the amino acids produced
are then connected with a peptide bond
ACAAUGGAACAUAGAUACAUA
ACAAUGGAACAUAGAUACAUA
Uses “weak” hydrogen bonds to form
Types:
› Coils
› Pleats/sheets
“Folding” of proteins
› Occur because different attractions
(bonds) form between alpha helices
and beta sheets
2 or more amino acids put together
Multiple tertiary proteins
Lipids
Organic molecule insoluble in water
3 types:
› Neutral fats (triglycerides)
› Phospholipids (cell membrane)
› Cholesterol
Triglycerides
› 3 fatty acid chains
Saturated/Unsaturated
› Glycerol molecule
Store energy
Insulate body tissue
Protects organs
Modified triglycerides
Nonpolar fatty acid chain = tail
› Hydrophobic (“fears” water)
Polar phosphate = head
› Hydrophilic (“loves” water)
4 connected Carbon rings
Stabilizes cell membranes
Carbohydrates
Organic compound made of Carbon, Hydrogen, & Oxygen in ratio of › 1C : 2H : 1O
Used for energy storage
3 types:› Monosaccharides
› Disaccharides
› Polysaccharides
Simple sugars
Soluble in water
Examples: Glucose &Galactose
Two monosaccharide sugars linked
together by dehydration synthesis
Soluble in water
Example: Sucrose
More than 2 sugars linked together
Formed by dehydration synthesis
Usually not soluble in water
Examples: Starch, cellulose, & Glycogen
Starch:› Sugars the same way
› Primary source of calories
Cellulose:› Sugars are opposite every other one
Glycogen:› Sugars are branched
Monomers joined together to make
polymers
› Loss of water when they are joined
› Electrons are rearranged
› New bond is formed
Adding water to a polymer to break it
apart
Synthesis reactions: combining atoms
› Anabolic reactions
› Require more energy than produced
Decomposition reactions: breaking apart
› Catabolic reactions
› More energy released than needed
Top Related