RNA and Protein RNA and Protein SynthesisSynthesis

Chapter 12, section 3Chapter 12, section 3

The Structure of RNAThe Structure of RNA

RNA, like DNA, is made up of RNA, like DNA, is made up of nucleotidesnucleotides

However, there are 3 differences However, there are 3 differences between DNA and RNA:between DNA and RNA: RNA has ribose instead of deoxyriboseRNA has ribose instead of deoxyribose RNA has uracil instead of thymineRNA has uracil instead of thymine RNA is single-stranded instead of RNA is single-stranded instead of

double-strandeddouble-stranded

3 Types of RNA3 Types of RNA Messenger RNA (mRNA) – carries the message from Messenger RNA (mRNA) – carries the message from

the DNA to the ribosomesthe DNA to the ribosomes Ribosomal RNA (rRNA) – make up part of the Ribosomal RNA (rRNA) – make up part of the

structure of a ribosomestructure of a ribosome Transfer RNA (tRNA) – transfers amino acids to the Transfer RNA (tRNA) – transfers amino acids to the

ribosomesribosomes

TranscriptionTranscription

Making RNA from DNA (in the Making RNA from DNA (in the nucleus)nucleus)

RNA polymerase binds to a special RNA polymerase binds to a special region of DNA called a region of DNA called a promoterpromoter

The RNA polymerase then separates The RNA polymerase then separates the DNA strands and uses one of the the DNA strands and uses one of the strands as a templatestrands as a template A will now pair with U, T still pairs with A will now pair with U, T still pairs with

AA C and G still pair with each otherC and G still pair with each other

TranscriptionTranscription

Practice Transcription…Practice Transcription…

DNA – AGCTCCGATGCATACTTGCCADNA – AGCTCCGATGCATACTTGCCA RNA – UCGAGGCUACGUAUGAACGGURNA – UCGAGGCUACGUAUGAACGGU

DNA – GCCAGTGCTTACGAACTGAGTDNA – GCCAGTGCTTACGAACTGAGT RNA - CGGUCACGAAUGCUUGACUCARNA - CGGUCACGAAUGCUUGACUCA

RNA EditingRNA Editing RNA requires a little editing RNA requires a little editing

before it is ready to go to the before it is ready to go to the ribosome to make proteinsribosome to make proteins

IntronsIntrons – sections of RNA that – sections of RNA that do not code for a protein (“in the do not code for a protein (“in the way”)way”) Cut outCut out

ExonsExons – sections of RNA that do – sections of RNA that do code for a protein (“expressed”)code for a protein (“expressed”) spliced back togetherspliced back together

RNA EditingRNA Editing

The Genetic CodeThe Genetic Code

Proteins are made of amino acidsProteins are made of amino acids There are 20 different amino There are 20 different amino

acidsacids A A codoncodon is a 3 base sequence is a 3 base sequence

that codes for a specific amino that codes for a specific amino acidacid There are 64 possible codonsThere are 64 possible codons

The Genetic CodeThe Genetic Code

The Genetic CodeThe Genetic Code

RNA sequence:RNA sequence: UCGCACGGUUCGCACGGU

Separate into codons:Separate into codons: UCG-CAC-GGUUCG-CAC-GGU

Identify the amino acids:Identify the amino acids: Serine-Histidine-GlycineSerine-Histidine-Glycine

TranslationTranslation

Making the proteins from the mRNA Making the proteins from the mRNA (“translating the code”)(“translating the code”)

Occurs on the ribosomesOccurs on the ribosomes

TranslationTranslation

1.1. mRNA must be transcribed from mRNA must be transcribed from the DNA in the nucleus and the DNA in the nucleus and released into the cytoplasmreleased into the cytoplasm

2.2. The mRNA attaches to the The mRNA attaches to the ribosomeribosome

3.3. The tRNA brings the proper The tRNA brings the proper amino acid to the ribosomeamino acid to the ribosome

AnticodonAnticodon – sequence of bases on – sequence of bases on the tRNA that pair with the mRNAthe tRNA that pair with the mRNA

TranslationTranslation

4.4. The amino acids form a peptide The amino acids form a peptide bond to hold them togetherbond to hold them together

5.5. The next amino acid is brought The next amino acid is brought in and is attachedin and is attached

6.6. This continues until the This continues until the ribosome reaches a stop codonribosome reaches a stop codon

7.7. The completed protein is then The completed protein is then releasedreleased

TranslationTranslation

MutationsMutations

Changes in the DNA sequence Changes in the DNA sequence that affect genetic informationthat affect genetic information

Gene mutations – result from Gene mutations – result from changes in a single genechanges in a single gene

Chromosomal mutations – Chromosomal mutations – involve changes in whole involve changes in whole chromosomeschromosomes

Gene MutationsGene Mutations

Point mutations – a mutation Point mutations – a mutation that occurs at a single point that occurs at a single point (only 1 nucleotide is changed)(only 1 nucleotide is changed) Substitution – a single nucleotide Substitution – a single nucleotide

is substituted for another one (A is substituted for another one (A instead of G)instead of G)

Insertion – a nucleotide is addedInsertion – a nucleotide is added Deletion – a nucleotide is removedDeletion – a nucleotide is removed

Gene MutationsGene Mutations

Insertions and deletions cause Insertions and deletions cause frameshift mutationsframeshift mutations because because they shift the “reading frame” of they shift the “reading frame” of the genetic message.the genetic message.

Chromosomal MutationsChromosomal Mutations

Deletion – a section of a chromosome Deletion – a section of a chromosome is deletedis deleted

Duplication – a section of a Duplication – a section of a chromosome is copied and insertedchromosome is copied and inserted

Inversion – a section of a Inversion – a section of a chromosome is moved from one spot chromosome is moved from one spot to anotherto another

Translocation – a piece of a Translocation – a piece of a chromosome is moved from one chromosome is moved from one chromosome to anotherchromosome to another

Chromosomal MutationsChromosomal Mutations