Protein SynthesisProtein SynthesisWhat is RNAWhat is RNAFunction of RNAFunction of RNATypes of RNATypes of RNAWhat is protein synthesisWhat is protein synthesisProcess of protein synthesisProcess of protein synthesisWhere does the processes Where does the processes

occur in the celloccur in the cell

RNARNARNA: ribonucleic acidRNA: ribonucleic acidFunction: uses the information provided by Function: uses the information provided by

DNA to make proteins.DNA to make proteins.Structure: Structure:

1. Consists of many nucleotides1. Consists of many nucleotides2. sugar is Ribose2. sugar is Ribose

3. has the base Uracil rather than Thymine3. has the base Uracil rather than Thymine4. one strand of nucleotides4. one strand of nucleotides

RNA ContinuedRNA Continued3 forms of RNA3 forms of RNA

1. mRNA: Messenger RNA1. mRNA: Messenger RNA- single, uncoiled- single, uncoiled- transmits info from DNA to make - transmits info from DNA to make

proteinsproteins2. tRNA: Transfer RNA2. tRNA: Transfer RNA

- hairpin form- hairpin form- carries amino acids in the cytoplasm to - carries amino acids in the cytoplasm to

ribosomes to make proteinsribosomes to make proteins3. rRNA: Ribosomal RNA3. rRNA: Ribosomal RNA

- globular shaped- globular shaped- makes up ribosomes, function unknown- makes up ribosomes, function unknown

Differences between RNA and Differences between RNA and DNADNA

RNA consists of 1 strand of nucleotides; DNA has 2 RNA consists of 1 strand of nucleotides; DNA has 2 strands of nucleotidesstrands of nucleotidesRNA has the sugar ribose; DNA has the sugar deoxyriboseRNA has the sugar ribose; DNA has the sugar deoxyriboseRNA has the base URACIL; DNA has the base THYMINERNA has the base URACIL; DNA has the base THYMINE

So:: A-T DNASo:: A-T DNA A-U RNAA-U RNA

RNA exists in 3 forms; DNA exists in only 1 formRNA exists in 3 forms; DNA exists in only 1 form

EX: ATCGTTAACGCCTATCGAAEX: ATCGTTAACGCCTATCGAA UAGCAAUUGCGGAUAGCUUUAGCAAUUGCGGAUAGCUU

Making RNAMaking RNA

Process is called transcriptionProcess is called transcriptionUses DNAUses DNAOccurs in the nucleusOccurs in the nucleusProcessProcess

1.1. RNA polymerase (enzyme) attaches to a DNA molecule and breaks it RNA polymerase (enzyme) attaches to a DNA molecule and breaks it apart. apart.

2.2. RNA polymerase attaches to 1 strand of DNA and reads it one base RNA polymerase attaches to 1 strand of DNA and reads it one base at a time. It bonds the correct complementary base to make RNAat a time. It bonds the correct complementary base to make RNA

3.3. When RNA reaches the termination signal, it stops transcribing and When RNA reaches the termination signal, it stops transcribing and detaches from the DNA strand. detaches from the DNA strand.

Ex: DNA: ATTCGTCTGCAATCGCTAEx: DNA: ATTCGTCTGCAATCGCTA RNA: UAAGCAGACGUUAGCGAURNA: UAAGCAGACGUUAGCGAU

TranscriptionTranscription

Protein SynthesisProtein Synthesis

To make proteinsTo make proteinsAssembly of amino acids into a specific Assembly of amino acids into a specific form to make proteinsform to make proteinsRemember: amino acids are the building Remember: amino acids are the building blocks of proteinsblocks of proteinsAfter transcription occurs (the making of After transcription occurs (the making of RNA) translation occursRNA) translation occurs

Protein SynthesisProtein Synthesis

Process of Making Proteins: Process of Making Proteins: TranslationTranslation

Occurs in ribosomesOccurs in ribosomesmRNA provides the necessary information: carries info mRNA provides the necessary information: carries info from DNA. from DNA. Steps in the process:Steps in the process:

11. rRNA binds to mRNA. rRNA binds to mRNA2. a ribosome moves along the mRNA molecule and reads 3 bases at a time. 2. a ribosome moves along the mRNA molecule and reads 3 bases at a time. 3. these 3 bases are called a CODON. Codons provide a code for specific 3. these 3 bases are called a CODON. Codons provide a code for specific amino acids. Not all codons code for amino acids, some provide a code to amino acids. Not all codons code for amino acids, some provide a code to start and stop the process.start and stop the process.4. At each codon (3 bases) an amino acid is added to the chain . Amino acids 4. At each codon (3 bases) an amino acid is added to the chain . Amino acids are brought to the mRNA by the tRNA. tRNA contains an anitcodon: 3-bases are brought to the mRNA by the tRNA. tRNA contains an anitcodon: 3-bases that are complementary to the mRNA codon. that are complementary to the mRNA codon. 5. This process continues until a stop codon is reached. 5. This process continues until a stop codon is reached. 6. Once the process is finished, the mRNA disintegrates and the protein is left 6. Once the process is finished, the mRNA disintegrates and the protein is left to float in the cytoplasm.to float in the cytoplasm.

Protein Synthesis ExampleProtein Synthesis Example DNA TACGATAAAATGCCGCGGCATATTCGTATCDNA TACGATAAAATGCCGCGGCATATTCGTATC RNA AUG/CUA/UUU/UAC/GGC/GCC/GUA/UAA/GCA/UAGRNA AUG/CUA/UUU/UAC/GGC/GCC/GUA/UAA/GCA/UAG

Break down into 3 bases at a time to make a proteinBreak down into 3 bases at a time to make a protein AUG: Start AUG: Start UAA: StopUAA: Stop

CUA: LeucineCUA: Leucine GCAGCA UUU: PhenylalanineUUU: Phenylalanine UAGUAG UAC: TyrosineUAC: Tyrosine GGC: GlycineGGC: Glycine GCC: ALanineGCC: ALanine GUA: ValineGUA: Valine