1521-0111/87/4/582–594$25.00 http://dx.doi.org/10.1124/mol.114.096313MOLECULAR PHARMACOLOGY Mol Pharmacol 87:582–594, April 2015Copyright ª 2015 by The American Society for Pharmacology and Experimental Therapeutics

Repression of the Nuclear Receptor Small Heterodimer Partnerby Steatotic Drugs and in Advanced Nonalcoholic FattyLiver Disease

Marta Benet, Carla Guzmán, Sandra Pisonero-Vaquero, M. Victoria García-Mediavilla,Sonia Sánchez-Campos, M. Luz Martínez-Chantar, M. Teresa Donato, José Vicente Castell,and Ramiro JoverExperimental Hepatology Unit, IIS Hospital La Fe, Valencia (M.B., C.G., M.T.D., J.V.C., R.J.); CIBERehd, Centro de InvestigaciónBiomédica en Red de Enfermedades Hepáticas y Digestivas, Barcelona (M.B., M.V.G.-M., S.S.-C., M.L.M.-C., M.T.D., J.V.C.,R.J.); Institute of Biomedicine, University of León, León (S.P.-V., M.V.G.-M., S.S.-C.); CIC bioGUNE, Technology Park of Bizkaia, Derio(M.L.M.-C.); and Department of Biochemistry and Molecular Biology, University of Valencia, Valencia, Spain (M.T.D., J.V.C., R.J.)

Received October 8, 2014; accepted January 9, 2015

ABSTRACTThe small heterodimer partner (SHP) (NR0B2) is an atypical nuclearreceptor that lacks a DNA-binding domain. It interacts with and in-hibits many transcription factors, affecting key metabolic processes,including bile acid, cholesterol, fatty acid, and drug metabolism. Ouraim was to determine the influence of steatotic drugs and non-alcoholic fatty liver disease (NAFLD) on SHP expression andinvestigate the potential mechanisms. SHP was found to berepressed by steatotic drugs (valproate, doxycycline, tetracycline,and cyclosporin A) in cultured hepatic cells and the livers ofdifferent animal models of NAFLD: iatrogenic (tetracycline-treatedrats), genetic (glycine N-methyltransferase–deficient mice), andnutritional (mice fed a methionine- and choline-deficient diet).Among the different transcription factors investigated, CCAAT-enhancer-binding protein a (C/EBPa) showed the strongest

dominant-repressive effect on SHP expression in HepG2 andhuman hepatocytes. Reporter assays revealed that the inhibitoryeffect of C/EBPa and steatotic drugs colocalize between 2340and 2509 base pair of the SHP promoter, and mutation of apredicted C/EBPa response element at2473 base pair abolishedSHP repression by both C/EBPa and drugs. Moreover, inhibi-tion of major stress signaling pathways demonstrated that themitogen-activated protein kinase kinase 1/2 pathway activates,while the phosphatidylinositol 3 kinase pathway represses SHPin a C/EBP-dependent manner. We conclude that SHP is down-regulated by several steatotic drugs and in advanced NAFLD.These conditions can activate signals that target C/EBPa andconsequently repress SHP, thus favoring the progression andseverity of NAFLD.

IntroductionThe small heterodimer partner (SHP) (NR0B2) is a unique

orphan nuclear receptor that contains a dimerization andligand-binding domain but lacks the conserved DNA-bindingdomain (Zhang et al., 2011; Garruti et al., 2012). SHP interactswith a wide variety of conventional nuclear receptors and

transcription factors and negatively regulates their trans-criptional activity (Bavner et al., 2005). SHP expression ispredominantly observed in the liver (Seol et al., 1996; Lee et al.,1998), where a large number of direct and indirect SHP targetgenes have been identified, including bile acid (BA), cholesterol,fatty acid, glucose, and drug metabolism genes (Boulias et al.,2005; Zhang et al., 2011). Moreover, the involvement of SHP inkey hepatic regulatory networks denotes its relevance andcentral role in liver homeostasis (Zhang et al., 2011;Garruti et al.,2012). Therefore, chronic deregulation of SHP expression maylead to pathologic consequences and favor liver disease. Thepotential negative consequences of SHP deregulation can beextrapolated from studies with liver-specific SHP-transgenicand SHP-deficient mice (Wang et al., 2003; Boulias et al.,2005; Park et al., 2008; Zhang et al., 2008, 2010, 2014; Chandaet al., 2009).

This work has been partly supported by Grants PI-13/01470 and PI-11/01588 from Fondo de Investigación Sanitaria (FIS) (Instituto de Salud CarlosIII), Grant BFU2013-48141-R from Programa Estatal de Investigación(Ministerio de Economía y Competitividad), Grant LE135U13 from Consejeríade Educación (Junta de Castilla y León), and Grant ETORTEK-2012/SanidadGobierno Vasco 2013. M.B. and M.V.G.M were recipients of CIBERehdcontracts [EHD-10-DOC2 and EHD-24-DOC], respectively. The funders hadno role in study design, data collection and analysis, decision to publish, orpreparation of the manuscript.

dx.doi.org/10.1124/mol.114.096313.

ABBREVIATIONS: BA, bile acid; ChIP, chromatin immunoprecipitation; CITCO, 6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde-O-(3,4-dichlorobenzyl)oxime; DMSO, dimethylsulfoxide; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GW7647, 2-[[4-[2-[[(cyclohexylamino)carbonyl](4-cyclohexylbutyl)amino]ethyl]phenyl]thio]-2-methylpropanoic acid; HCC, hepatocellular carcinoma; HFD, high-fat diet; LUC, luciferase;LY294002, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one hydrochloride; MCD, methionine and choline deficient; NAFLD, nonalcoholic fattyliver disease; NASH, nonalcoholic steatohepatitis; PBGD, porphobilinogen deaminase; PCR, polymerase chain reaction; RE, response element;ROS, reactive oxygen species; SB203580, 4-(49-fluorophenyl)-2-(49-methylsulfinylphenyl)-5-(49-pyridyl)-imidazole; SHP, small heterodimer partner;SP600125, anthra[1-9-cd]pyrazol-6(2H)-one; TG, triglyceride; U0126, 1,4-diamino-2,3-dicyano-1,4-bis[2-aminophenylthio]butadiene.

582

at ASPE

T Journals on January 19, 2021

molpharm

.aspetjournals.orgD

ownloaded from

BAs are potent agonists of FXRa, which induces the ex-pression of SHP. Induced SHP in turn leads to transcriptionalrepression of the rate-limiting CYP7A1 and CYP8B1 enzymesof the BA biosynthetic pathway (Chiang, 2003). In line withthis, transgenic mice with sustained overexpression of SHP inthe liver show depletion of the hepatic BA pool. Moreover,these mice show an indirect activation of the lipogenic factorsPPARg and SREBP-1c, which trigger triglyceride (TG) ac-cumulation and fatty liver (Boulias et al., 2005).SHP also represses genes with an important role in liver

fibrosis (Zhang et al., 2011). Consequently, the lack of ex-pression of SHP in SHP2/2 mice results in increased sen-sitivity to liver damage and liver fibrosis induced by bile ductligation (Park et al., 2008; Zhang et al., 2014). In agreement,progressive fibrosing steatohepatitis was reversed in wild-type mice after AMPK-mediated induction of SHP, but thiswas not observed in SHP2/2 mice (Chanda et al., 2009). SHPdeficiency could have even more severe consequences asspontaneous hepatocellular carcinoma (HCC) is observed inSHP2/2 mice due to hepatocyte hyperproliferation and in-creased cyclin D1 expression (Zhang et al., 2008). Moreover,SHP targets mitochondria, induces apoptosis, and inhibitstumor growth (Zhang et al., 2010), but this protective role maybe lost when SHP is deficient.All these studies reinforce the notion that SHP controls

major liver functions; therefore, sustained changes in SHPexpression may significantly trigger or worsen liver injury anddisease progression. Induction of SHP may exacerbate diet-induced dyslipidemia and fatty liver (Boulias et al., 2005;Hartman et al., 2009). On the contrary, repression of SHP maypromote fibrosis and HCC (Park et al., 2008; Zhang et al., 2008,2010, 2014; Chanda et al., 2009). A key question then iswhether hepatic SHP expression is altered in pathophysiolog-ical conditions.It has been proven that repression of SHP by epigenetic

silencing is a common denominator of HCC (He et al., 2008).However, the regulation of SHP in other conditions, such ashazardous xenobiotic exposure or fatty liver disease, is not sowell characterized or is controversial. The response of SHP toendogenous factors, such as BAs, fatty acids, cholesterol, glu-cose, insulin, cytokines, and hormones, has been well charac-terized (Zhang et al., 2011; Garruti et al., 2012), but theeffect of drugs and xenobiotics on SHP has not been in-vestigated. On the other hand, SHP seems to be upregulatedin genetic (leptin-deficient ob/ob mice) and dietary [high-sucrose or high-fat diet (HFD)] mouse models of fatty liver(Huang et al., 2007; Trauner, 2007). However, SHP expressionappears diminished in human nonalcoholic steatohepatitis(NASH) (Zhang et al., 2014).Our aim in the present study was to determine whether

SHP is regulated by steatotic drugs and nonalcoholic fattyliver disease (NAFLD) and investigate the potentialmechanisms.We demonstrate that SHP is repressed by several steatotic drugsand that SHP is downregulated in models of severe NAFLD. Weidentify CCAAT/enhancer-binding protein a (C/EBPa) as aSHP repressor and demonstrate that several steatotic drugsand stress pathways modulate SHP by signaling via a C/EBPresponse element at 2473 bp in the human SHP promoter.This study uncovers new mechanisms of transcription

regulation of the human SHP gene and reveals novel path-ways that target SHP expression that could favor the severityand progression of liver disease.

Materials and MethodsAnimals. Male mice (3 and 9months of age) deficient inmethionine

adenosyltransferase 1A (MAT1A) (Lu et al., 2001; Martinez-Chantaret al., 2002) and glycine N-methyltransferase (GNMT) (Martinez-Chantar et al., 2008) and their wild-type C57BL/6 littermates wereobtained from the animal facility of CIC bioGUNE (Derio, Bizkaia,Spain). Mice were housed at 22°C with a 12-hour light-dark cycle andallowed food (Teklad Global 18% Protein Rodent Diet 2018S; Madison,WI) and water ad libitum. To induce NAFLD,male C57BL/6Jmice (10–12 weeks old) were fed a methionine and choline deficient (MCD) dietfor up to 5 weeks (ICN, Aurora, OH). Control mice received the sameMCD diet supplemented with DL-methionine (3 g/kg) and cholinechloride (2 g/kg) (ICN). At the end of the experiments, mice wereanesthetized (sodium pentobarbital, 60 mg/kg, i.p.) and livers werecollected. The presence of steatohepatitis was proven histologically.Male Sprague-Dawley rats (125 g) were purchased from Charles River(Barcelona, Spain), maintained for 4 weeks in an air-conditionedanimal room (21–25°C, 30–70% humidity, 12-hour light-dark cycle),and fed ad libitum with a standard diet (Research Diets, Gentofte,Denmark). Rats were randomly placed into two groups (n 5 6), andtetracycline dissolved in methylcellulose 0.5% (vehicle) was adminis-tered by oral gavage (2 g/kg per day) during 4 consecutive days. Controlrats were treated with vehicle. Animals were euthanized 24 hours afterthe last administration, and livers were collected. The InstitutionalAnimal Care and Use Committee that specifically approved this studywas the Bioethical and Animal Welfare Committee of CIC bioGUNE(IACUC: P-CBG-CBBA 02-10) in accordance with the guidelines of theEuropean Research Council for animal care and use.

Culture of Human HepG2 and HepaRG Cells. HepG2 cells(American Type Culture Collection, Rockville, MD) were cultured inHam’s F-12/Leibovitz L-15 (1:1, v/v) medium (Gibco BRL/Invitrogen,Barcelona, Spain) supplemented with 7% newborn calf serum and2 mM L-glutamine. In addition, culture media were supplementedwith 50 U/ml penicillin and 50 mg/ml streptomycin. HepaRG cellswere obtained from Biopredic International (Rennes, France). Un-differentiated cells were cultured in a growth medium (Biopredic) for2 weeks, and cell differentiation was induced with a differentiationmedium (Biopredic) for 2 more weeks. At that stage, HepaRG cellsreached a differentiated hepatocyte-like morphology. Cells werefurther maintained in a HepaRG differentiation medium for theduration of the experiments.

Isolation and Culture of Hepatocytes. Human hepatocyteswere isolated from nonsteatotic liver biopsies (1–4 g) using a two-stepperfusion technique (Gomez-Lechon et al., 1990). Liver samples wereobtained in conformity with the rules of the Hospital’s Ethics Com-mittee. None of the donors (four men and one woman aged between 37and 74) were regular consumers of alcohol or other drugs and were notsuspected of harboring any infectious disease. Rat hepatocytes wereobtained from Sprague-Dawley male rats (180–250 g) by perfusion ofthe liver with collagenase. Freshly isolated hepatocytes (150 � 103

viable cells/cm2) were plated on a six-well plate precoated with acollagen gel layer. Sandwich cultures were established by the depositionof a second layer of collagen 24 hours later, as described elsewhere(Gomez-Lechon et al., 1998). Cells were cultured in serum-freeWilliams/Ham’s F-12 (1:1, v/v) medium (Gibco BRL/Invitrogen) supplementedwith 5 mM glucose, 0.2% bovine serum albumin, 0.01 mM insulin, and0.01 mM dexamethasone.

Chemicals and Treatment of Cultured Cells. Amitriptyline,cyclosporin A, doxycycline, fluoxetine, flutamide, ketotifen, simvas-tatin, tamoxifen, tetracycline, tianeptine, tilorone, valproate, U0126[1,4-diamino-2,3-dicyano-1,4-bis[2-aminophenylthio]butadiene], andLY294002 [2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-onehydrochloride]were acquired from Sigma-Aldrich (Madrid, Spain). Steatotic drugs andnonsteatotic compounds were chosen on the basis of previous infor-mation on their steatotic, phospholipidosic, hepatotoxic, or nonhepatotoxiceffect (Benet et al., 2014). Stock solutions were prepared in dimethylsulf-oxide (DMSO) or water and were diluted in a culturemedium. The kinase

SHP Repression by C/EBPa in Drug-Induced Steatosis 583

at ASPE

T Journals on January 19, 2021

molpharm

.aspetjournals.orgD

ownloaded from

inhibitors U0126 and LY294002 were prepared in DMSO and added 24hours before analysis. The final concentration of DMSO never exceeded0.5% (v/v), and control cultures were treated with the same amount ofsolvent.

Adenoviral Infection. The recombinant adenoviruses encodingCAR, PXR, C/EBPa, C/EBPb, FOXA1, PGC1a, RXRa, and PPARawere developed in our laboratory as described (Guzman et al., 2013).Cultured cells were infected with recombinant adenoviruses encodingtranscription factors or with an insertless adenoviral vector (Ad-CTRL)for 24 hours at a multiplicity of infection ranging from 2 to 45 plaque-forming units/cell. Thereafter, cells were washed and a fresh mediumwas added. To activate the expressed nuclear receptors (CAR, PXR,RXRa, and PPARa), selective ligand agonists were added at 24 hourspostinfection, and at 48 hours, postinfection cells were harvested andanalyzed. Ligands were dissolved in DMSO and added to culture mediaat the following concentrations: 500 nM CITCO [6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde-O-(3,4-dichlorobenzyl)oxime] (CAR), 1 mM GW7647 [ 2-[[4-[2-[[(cyclohexylamino)carbonyl](4-cyclohexylbutyl)amino]ethyl]phenyl]thio]-2-methylpropanoic acid](PPARa), 50 mM rifampicin (PXR), and 1 mM 9-cis retinoic acid(RXRa). Control cultures were treated with 0.5% DMSO.

RNA Purification, Reverse Transcription, and QuantitativeReal-Time Polymerase Chain Reaction. Total RNA was extractedfrom cultured cells with the RNeasy Plus Mini Kit from Qiagen(Madrid, Spain). To extract RNA from tissue, frozenmouse and rat liversamples (25–50mg)were placed in 2-ml tubes containingCK14 ceramicbeads (Precellys, Saint Quentin en Yvelines, France) and 800 ml of RLTbuffer (Qiagen). Then, liver tissues were homogenized twice for 10seconds at 6000 rpm at 4°C in a Precellys 24 dual system equipped witha Criolys cooler. Tubes were centrifuged at 3000g for 5 minutes at 4°C,and total RNAwas extracted from supernatants and reverse transcribedas described (Benet et al., 2014). Diluted cDNA was amplified ina LightCycler 480 Instrument (RocheApplied Science, Barcelona, Spain)using LightCycler DNA Master SYBR Green I (Roche Applied Science).In parallel, mouse and rat glyceraldehyde 3-phosphate dehydrogenase(GAPDH) or human porphobilinogen deaminase (PBGD) were analyzedfor normalization. In each amplification, a reference calibrator cDNAmade from a pool of human livers was included. The relative mRNAwascalculated with the LightCycler Relative Quantification Analysissoftware (Roche Applied Science). The efficiency of each polymerasechain reaction (PCR) was estimated from a serially diluted human livercDNA curve. Based on these PCR efficiencies and the cycle thresholds(Ct), the relative concentration of the target and reference (GAPDH orPBGD) cDNAs and their ratio were determined.

Specific primers for quantitative real-time PCR were as follows:human PBGD, forward, 59- CGGAAGAAAACAGCCCAAAGA, andreverse, 59- TGAAGCCAGGAGGAAGCACAGT; human SHP, forward,59- CAGCAGCAGTGGAGGCAGTG, and reverse, 59- CGGGGTTGAAGAG-GATGGTC; human SREBP1c, forward, 59- GGAGGGGTAGGGCCA-ACGGCCT, and reverse, 59- CATGTCTTCGAAAGTGCAATCC; mouseand rat GAPDH, forward, 59- AGGGCTCATGACCACAGTCCAT, andreverse, 59- GCCAGTGAGCTTCCCGTTCAG; mouse SHP, forward,59- AGGGCACGATCCTCTTCAAC, and reverse, 59- AGGGCTCCAA-GACTTCACAC; rat SHP, forward, 59- GGCACTATCCTCTTCAACCCA,and reverse, 59- TCCAGGACTTCACACAATGCC.

Protein Samples and Immunoblotting Analysis. Culturedcells or liver tissue were homogenized in an M-PER or T-PER reagentfrom Pierce (Fisher Scientific, Madrid, Spain) and a protease inhibitorcocktail. Protein concentration was determined using the ProteinAssay Kit from Bio-Rad Laboratories (Madrid, Spain). Proteins wereresolved by 12% SDS-PAGE, transferred to Immobilion membranes(Millipore Iberica, Madrid, Spain), and incubated with anti-SHP,antitubulin (Santa Cruz Biotechnology, Dallas, TX), or anti–b-actin(Sigma-Aldrich) antibodies. Blots were developed with horseradishperoxidase–labeled IgG (DAKO, Glostrup, Denmark) using an ECLkit from Amersham Biosciences/GE Healthcare (Buckinghamshire,UK). Equal loading was verified by Coomassie Brilliant Blue orPonceau S staining.

Plasmid Constructs. Chimeric luciferase reporter constructs withdifferent lengths of the 59 flanking region of the human SHP gene wereobtained by cloning SHP-59 flanking sequences into the enhancerless,promoterless pGL3-Basic vector (Promega Biotech Iberica, Madrid,Spain). The 22500 to 127 bp SHP-59 flanking sequence was syn-thesized by GenScript Technologies (Piscataway, NJ) and cloned in apUC57 plasmid. Fragments corresponding to22500,21362, and2612were excised from the pUC57 plasmid by restriction enzymes to besubcloned in pGL3-Basic. Three DNA fragments spanning nucleotides2509, 2340, and 2150 to 110 bp of the SHP-59 flanking region werePCR cloned from the2612-SHP-pGL3 plasmid using the Expand HighFidelity PCR System (Roche Applied Science). The PCR primers usedare SHP-UP-150-MluI, 59-CCTACGCGTACCACTTCCCCACCAT,SHP-UP-340-MluI, 59-AATACGCGTACACCTGCTGATTGTG, SHP-UP-509-MluI, 59-CTGACGCGTGCTTCTGGCTGACAACA, and SHP-DN-HindIII, 59-CTCAAGCTTCCAGCTCTCTGGC.Theresultingampliconswere digestedwith the restriction and ligated into the pGL3-Basic vectorpreviously digested with the same enzymes.

Chromatin Immunoprecipitation Assay. A chromatin immuno-precipitation (ChIP) assay was done as previously reported (Benetet al., 2010). Briefly, HepG2 cells were infectedwith Ad-C/EBPa or witha control (insertless) adenovirus (Ad-pACC) and 48 hours afterinfection, cells were treated with 1% formaldehyde for 10 minutes.Thereafter, cells were lysed and sonicated on ice for 8� 15 second stepsat a 20% output in a Branson Sonicator (VWR International Eurolab,Barcelona, Spain). DNA content was quantified and properly diluted tomaintain an equivalent amount of DNA in all samples (inputDNA). Forimmunoprecipitation of C/EBPa-DNA complexes, 4 mg of a specificantibody (Santa Cruz Biotechnology) was added (bound DNA fraction).Mock immunoprecipitation with rabbit preimmune IgG (Santa CruzBiotechnology) was performed in parallel (background DNA fraction).Samples were incubated overnight at 4°C on a 360° rotator. The immu-nocomplexes were affinity absorbed with protein G agarose/salmonsperm DNA (Millipore) and collected by centrifugation. DNA fractionswere washed, and the crosslinks were reversed using 100 ml of 10%Chelex (Bio-Rad Laboratories) (Benet et al., 2010). Amplification wasreal-time monitored, stopped in the exponential phase of amplification,and analyzed by agarose gel electrophoresis. Amplification of a SHP59-flanking sequence (2329/2678 bp) among the pull of DNA wasperformed with specific primers flanking these regions: forward,59- CAGACCTGGCCTTTCAGGAG, and reverse, 59- ATCAGCAGGTG-TCCCCATTG. An exonic region in the ribosomal protein, large,P0 (RPLP0) gene devoid of C/EBPa consensus binding sites and expectednot to be enriched in antibody-bound DNA fractions was PCR amplifiedas a negative control (Guzman et al., 2013).

Statistical Analysis. Differences among groups were analyzed byone-way analysis of variance and Tukey’s pairwise comparisons.Differences between groups were evaluated by the nonparametricMann-Whitney test as indicated. A P value of less than 0.05 wasconsidered to be statistically significant. Values are expressed asmean 6 S.D.

ResultsRegulation of SHP by Drugs. Human hepatoma HepG2

cells were incubated for 24 hours with different drugspreviously characterized and classified as nonhepatotoxic,hepatotoxic, phospholipidosic, and steatotic. The concentra-tions selected were always subcytotoxic (#IC10), thus avoid-ing acute necrotic or apoptotic side effects (Benet et al., 2014).Moreover, we have previously shown that in these conditions,the selected steatotic drugs trigger lipid accumulation inHepG2 cells (Benet et al., 2014). We observed that moststeatotic drugs (valproate, doxycycline, tetracycline, cyclosporineA, and tianeptine) negatively affected SHP expression (Fig. 1A).However, this was not a common effect observed with all knownsteatotic compounds, as tamoxifen, amiodarone, and zidovudine

584 Benet et al.

at ASPE

T Journals on January 19, 2021

molpharm

.aspetjournals.orgD

ownloaded from

Fig. 1. Regulation of SHP by drugs. (A) HepG2 cells, (B) HepaRG cells, and (D) cultured rat hepatocytes were incubated with steatotic andnonsteatotic control compounds for 24 hours, and SHP mRNA was measured and normalized to GAPDH. H, hepatotoxic; NH, nonhepatotoxic; P,phospholipidosic. Results are expressed as a fold change versus DMSO-treated cells and represent the mean 6 S.D. of three to five independentexperiments. *P , 0.05; **P , 0.01; and ***P , 0.001 versus control cells (one-way analysis of variance and Tukey’s test). (C) Liver SHP expressionon rats treated with tetracycline (n = 5) or vehicle (n = 5) was determined by quantitative real-time PCR and normalized to GAPDH. Results arerepresented in box plots with the median (black line) and the mean (cross), and expressed as a fold change versus a control rat liver pool. **P , 0.01(Mann-Whitney test).

SHP Repression by C/EBPa in Drug-Induced Steatosis 585

at ASPE

T Journals on January 19, 2021

molpharm

.aspetjournals.orgD

ownloaded from

did not repress SHP (Fig. 1A and data not shown). Hepatotoxicand phospholipidosic drugs did not influence or consistentlyaffect SHP expression.To better support the relevance of these findings, we in-

vestigated the response of SHP to steatotic drugs in HepaRGcells, a more differentiated human hepatic cell model, which ismuch more similar to primary human hepatocytes and livertissue than HepG2 cells (Hart et al., 2010). Results in Fig. 1Bdemonstrate that cyclosporine A tetracycline, doxycycline,and valproate also caused a significant repression of SHP indifferentiated HepaRG cells.To find out if the repressive effect of steatotic drugs occurs

in vivo, we treated rats with tetracycline or vehicle during 4consecutive days. Results demonstrate that tetracyclinestrongly repressed SHP in the rat liver (Fig. 1C). Finally, weincubated cultured rat hepatocytes in a collagen-sandwich

configuration with some selected steatotic drugs to search forpotential interspecies differences between human and ratmodels. We found that some steatotic drugs, such as cyclosporineA and tetracycline, decreased SHP expression as in humanhepatic cultures; however, tamoxifen only significantly repressedSHP in rat hepatocytes (Fig. 1D).Regulation of SHP in Mouse Models of NAFLD. Liver

SHP expression was first analyzed in two genetic models ofNAFLD: MAT1A2/2 and GNMT2/2 mice. These two modelsspontaneously develop fatty liver, where GNMT2/2 is a moresevere NAFLD model than MAT1A2/2.The 3-month-old MAT1A2/2 mouse does not present

hepatosteatosis but shows increased expression of lipidsynthesis genes (Martinez-Chantar et al., 2002) and de-creased TG output in very low-density lipoprotein (Canoet al., 2011), whereas the 9-month-old MAT1A2/2 exhibits

Fig. 2. Liver SHP expression is decreased in mouse models of advanced NAFLD. Total RNA from 3- and 9-month old MAT1A2/2 (A) and GNMT2/2 (B)male mouse livers was purified, and the mRNA level of SHP was determined by quantitative real-time PCR (Q-RT–PCR) and normalized to GAPDHmRNA. WT, wild-type. (C) SHP expression level was analyzed in mice livers fed with an MCD or control diet for up to 5 weeks by both Q-RT–PCR andWestern blot (SHP molecular mass: ∼28 kDa). Data represent the mean 6 S.D. (n = 5–6) expressed as a fold change versus a control mouse liver pool.*P , 0.05 and **P , 0.01 by the nonparametric Mann-Whitney test.

586 Benet et al.

at ASPE

T Journals on January 19, 2021

molpharm

.aspetjournals.orgD

ownloaded from

macrovesicular steatosis (25–50% of hepatocytes) and focalareas of inflammation (Lu et al., 2001). Only the 9-month-oldmouse shows increased serum aminotransferases, but fibrosisis not observed (Cano et al., 2011). Intriguingly, SHP wassignificantly induced in 3-month-old MAT1A2/2 mice, but no

differences were observed in 9-month-old deficient mice withestablished fatty liver (Fig. 2A).TheGNMT2/2mouse shows elevated serumaminotransferases

at both 3 and 9 months of age. The livers of the 3-month-oldmutant mouse already shows steatosis and fibrosis, which are

Fig. 3. C/EBPa and FOXA1 repress SHP, whereas RXRa [(+)-9-cis-RA] induces SHP transcription. (A) HepG2 cells and (B) cultured human hepatocyteswere infected with adenoviruses encoding eight transcription factors for 48 hours. pACC, insertless control adenovirus. Selective ligand agonists forCAR, PXR, RXRa, and PPARa (seeMaterials and Methods) were added during the last 24 hours. The SHP mRNA level was determined by quantitativereal-time PCR and normalized to PBGD. Data represent mean6 S.D. (n = 3–5) expressed as a fold change versus control noninfected cells. (A) *P, 0.05and **P , 0.01 versus control cells (one-way analysis of variance and Tukey’s test). (B) *P , 0.05 and **P , 0.01 versus control cells (Mann-Whitneytest). (C) Time-dependent alterations in SHP mRNA after transduction of HepG2 and human hepatocyte cells with Ad-FOXA1 and Ad-C/EBPa. Datarepresent the mean of two experiments expressed versus control adenovirus-infected cells.

SHP Repression by C/EBPa in Drug-Induced Steatosis 587

at ASPE

T Journals on January 19, 2021

molpharm

.aspetjournals.orgD

ownloaded from

more pronounced in the livers of 9-month-old animals. More-over, apoptosis increases and genes involved in inflammationare induced. At 9 months, the GNMT2/2 mouse also sponta-neously develops multifocal HCC (Martinez-Chantar et al.,2008; Varela-Rey et al., 2010). SHP was found repressed in theliver of GNMT2/2mice, particularly 9-month-old deficient micethat exhibit more manifest liver disease (Fig. 2B).We next investigated the regulation of SHP in the MCD

diet model of NAFLD. Mice fed the MCD diet for more than 2weeks exhibit elevated serum aminotransferases, inflam-mation, and hepatic fibrosis in addition to simple steatosis(Anstee and Goldin, 2006; Itagaki et al., 2013). Liver SHPwas also found repressed in mice on an MCD diet. Therepression began after 1 week and was very significant at 5weeks of diet (Fig. 2C). The reduced expression at themRNA level correlated with progressive, reduced expres-sion at the protein level, as determined by immunoblotting(Fig. 2C).Altogether, these data support that both steatotic drugs and

advanced NAFLD (NASH/fibrosis) trigger SHP downregulation

in the liver, and therefore, a commonmechanismmay exist thatcauses SHP gene repression in these conditions.Screening for SHP Gene Repressors: Identification

of C/EBPa as an SHP Dominant Negative Factor. SHPis activated by multiple transcription factors, but no SHPgene repressor has been identified. We aimed to investigatethe potential repressive role of new transcription factorswhose effects on the SHP gene have not been investigated yet:C/EBPa, C/EBPb, FOXA1, CAR, PXR, PPARa, RXRa, and thecoactivator PGC1a. These factors are associated with liverlipid/energy metabolism and the hepatic phenotype. Previousstudies from our laboratory have shown that all these factorsare expressed in HepG2 at a lower level than in human liver(Donato et al., 2013; Guzman et al., 2013), which discouragesthe use of knockdown approaches to study their role. There-fore, we decided to force their re-expression and transfectedHepG2 cells with adenoviral vectors encoding these factors.The experimental conditions selected induced expression inHepG2 to levels within the wide range found in human liver(Guzman et al., 2013).

Fig. 4. SHP response to combined transcription factors. HepG2 cells were infected with Ad-C/EBPa, Ad-FOXA1, and Ad-RXRa either individually orcombined. Twenty-four hours later, 1 mM 9-cis-retinoic acid or solvent (DMSO) was incorporated, and at 48 hours postinfection, cells were harvested andprocessed for quantitative real-time PCR andWestern blot. Data represent the mean6 S.D. (n = 3) expressed as a fold change versus control noninfectedcells. *P , 0.05 and **P , 0.01 versus Ad-RXRa infected cells (one-way analysis of variance and Tukey’s test). ns, not significant.

588 Benet et al.

at ASPE

T Journals on January 19, 2021

molpharm

.aspetjournals.orgD

ownloaded from

Results demonstrate that C/EBPa and FOXA1 downregu-lated SHP, whereas PGC1a and RXRa caused gene activation(Fig. 3A). Moreover, C/EBPa, FOXA1, and RXRa caused thesame effect on SHP in cultured human hepatocytes (Fig. 3B).Time-course analysis demonstrated that Ad-C/EBPa causes

a fast downregulation, which reaches ∼50% by 8 hours afteradenoviral infection, both in HepG2 and cultured humanhepatocytes. Ad-FOXA1 required $24 hours to trigger SHPgene repression (Fig. 3C).A combination of these transcription factors demonstrated

that C/EBPa acts on SHP as a dominant negative factor,which is able to substantially repress both basal and RXRa-induced SHP levels. The repressive effect of FOXA1 was lesssignificant when combined with RXRa, and no further re-pression was observed when combined with C/EBPa (Fig. 4).Analysis of SREBP1c, one of the few positive targets of SHP

(Boulias et al., 2005), demonstrated a very similar response.C/EBPa repressed both basal and induced SREBP1c mRNAlevels, whereas FOXA1 had no significant effect on this gene(Fig. 4). These results indicate that repression of SHP by C/EBPatranslates into downstream SHP-dependent functions.Altogether, our results demonstrate that C/EBPa is an ef-

fective dominant repressor of SHP both in HepG2 and cul-tured human hepatocytes.C/EBPa Negatively Regulates the Human SHP Gene

by Binding to a Response Element at 2473 bp in theSHP Promoter. We cloned 2500 bp of the 59-flanking regionof the human SHP gene and generated serially deletedluciferase (LUC) reporter constructs. Basal reporter analysisof the different fragments in HepG2 cells indicated that theactivity of the proximal promoter between110 and2340 bp isvery low (Fig. 5). Transcription increased notably and stepwisebetween2340 and2612 bp, and no significant further increasewas observed with longer sequences up to22500 bp. When thebasal response was assayed in the nonhepatic HeLa cells (Fig.5), a very low activity with all SHP promoter fragments wasdetected and no major increase in activity with the sequencebeyond 2340 bp was achieved. Results demonstrate that mostof the constitutive transcription of the SHP gene in HepG2depends on response elements (REs) located between2340 and2612 bp, and that the transcription factors acting on theseregions are likely liver-enriched factors that are only present inthe hepatic cell line. The significant increase in reporteractivity observed in HepG2 with the sequence between 2509and 2612 bp can be elicited by HNF4a (not present in HeLa),as an HNF4a-RE at2580 bp in the human SHP gene has beenpreviously reported (Shih et al., 2001).We next investigated the response of the SHP promoter to

C/EBPa. Results in Fig. 6A demonstrate that C/EBPa repressesSHP-LUC activity in HepG2 in consonance with the negativeeffects of this factor on SHP expression (mRNA and protein).The repressive effect of C/EBPa is located between 2340 and2509 bp.Sequence analyses with MatInspector software (Genomatix

Software GmbH, Munich, Germany) and defined C/EBP fre-quency matrices from the PAZAR database lead to the iden-tification of a potential C/EBP-RE at2473 bp (GTTAGGCAAA).To prove that this is the RE for C/EBPa in the SHP

promoter, we constructed a2509 bp reporter vector with 3-bpsubstitution in the predicted C/EBP-RE at2473 bp (509-mut,TCAAGGCAAA, Fig. 6B). We found that mutation of thiselement completely abolished the repressive effect of C/EBPa

on SHP (Fig. 6B). Indeed, the 509-mut-SHP-LUC constructshowed a very similar response to that of the 340-SHP-LUC.ChIP assays were performed to assess binding of the trans-

cription factor to the native SHP promoter. The DNA sequenceresponsive to C/EBPa was PCR amplified after immunopre-cipitation. Infection of HepG2 cells with Ad-C/EBPa causeda noticeable increase in the amount of immunoprecipitatedSHP DNA by anti-C/EBPa antibody, suggesting actual bindingof this transcription factor in vivo (Fig. 6, C and D). C/EBPa isexpressed at a low level in human hepatoma cells (Jover et al.,1998), and consequently forced re-expression by adenoviralvector is needed to observe significant binding by a ChIP assay.We conclude that C/EBPa represses the human SHP gene

via direct binding to a newly identified C/EBP-RE located at2473 bp.Steatotic Drugs Modulate SHP Expression by Sig-

naling via the2473 bp C/EBP-RE. We have demonstratedthat steatotic drugs repress SHP mRNA in cultured hepaticcells and in vivo. Therefore, our next step was to analyze theresponse of the SHP promoter to these drugs. We found thatthe repressive effect of valproate (1 and 2.5 mM), doxycycline(250 and 500 mM), and cyclosporine A (25 and 50mM) localizedbetween2340 and2509 bp of the SHP promoter (Fig. 7A), the

Fig. 5. Basal activity of SHP promoter deletion constructs in HepG2 andHeLa cells. HepG2 (A) or HeLa (B) cells were transfected with sequentialdeletion fragments of SHP-firefly-LUC vectors and the normalizationpRL-SV40 plasmid. Luciferase activities were determined 48 hours post-transfection. Bars represent the mean 6 S.D. of four to five independentexperiments expressed as firefly/Renilla luciferase activity ratios. Statis-tical differences were evaluated by one-way analysis of variance andTukey’s pairwise comparisons. ***P , 0.001.

SHP Repression by C/EBPa in Drug-Induced Steatosis 589

at ASPE

T Journals on January 19, 2021

molpharm

.aspetjournals.orgD

ownloaded from

same fragment through which C/EBPa causes SHP repres-sion, thus suggesting that steatotic drugs may repress SHP bysignaling via C/EBPa.To evaluate this possibility, we analyzed the effect of steatotic

drugs on the2509 bp reporter vectorwith themutatedC/EBP-RE(509-mut) and found that the repressive effects of these drugswere abolished or significantly reduced (Fig. 7B). Resultsdemonstrate that steatotic drugs repress SHP at least partiallyby a C/EBP-dependent mechanism.Mitogen-Activated Protein Kinase Kinase 1/2 and

Phosphatidylinositol 3 Kinase Kinases Modulate SHPExpression by Signaling via the 2473 bp C/EBP-RE.Because SHP repression occurs both by steatotic drugs andin advanced steatosis, it is tempting to suggest that a commonmechanism may be involved. Many different pathways maybe involved in metabolic and iatrogenic NAFLD, includinginsulin, lipid intermediate, mitochondrial dysfunction, oxi-dative stress, and inflammatory pathways (Larrain andRinella, 2012). To preliminarily investigate the involve-ment of major cell stress pathways on SHP repression, weincubated HepG2 cells with well characterized inhibitors ofphosphatidylinositol 3 kinase (PI3K) (LY294002), p38 (SB203580

[4-(49-fluorophenyl)-2-(49-methylsulfinylphenyl)-5- (49-pyridyl)-imidazole]), JNK (SP600125 [anthra[1-9-cd]pyrazol-6(2H)-one]),and MEK1/2 (U0126) kinases. Results demonstrated that in-hibition of PI3K resulted in upregulation of SHPmRNA,whereasinhibition of MEK1/2 caused SHP repression. Maximal effectswere observed by 2-hour incubation (Fig. 8A). Inhibition of p38and JNK did not significantly modify SHP mRNA levels inHepG2 (data not shown).We next investigated the effects of PI3K and MEK1/2

inhibitors on the 509-SHP-reporter construct. Inhibition ofPI3K induced, whereas inhibition of MEK1/2 repressed thehuman SHP promoter (Fig. 8B), which is in agreement withtheir effects on SHPmRNA. This suggests that these pathwaysmodulate factors that control SHP gene transcription.MEK1/2 activates ERK1/2 kinases, whereas PI3K represses

the GSK3 kinase. Both ERK1/2 and GSK3 can phosphorylateC/EBP factors and modulate C/EBPa activity (Nakajimaet al., 1993; Ross et al., 1999, 2004). It is then feasible to thinkthat the effects of these signaling pathways on SHP could beC/EBP dependent. To examine this possibility, we comparedthe effects of the MEK1/2 and PI3K inhibitors on the wild-typeand C/EBP-RE-mut SHP promoters. Results demonstrate that

Fig. 6. Transactivation of SHP reporter constructs by C/EBPa. (A) Repressing effect of C/EBPa on SHP promoter. HepG2 cells were infected with Ad-control or Ad-C/EBPa. The next day, cells were transfected with the different SHP promoter vectors and the normalization pRL-SV40 plasmid. At 48hours post-transfection, cells were lysed, and both firefly andRenilla reniformis luciferase activities were determined. Bars represent the mean6 S.D. ofthree to five independent experiments expressed as a fold change versus Ad-control.*P , 0.05; **P , 0.01; ***P , 0.001; ns, not significant (one-wayanalysis of variance and Tukey’s test). (B) Response of the SHP promoter with mutated C/EBP-RE to C/EBPa. Cells were infected with Ad-control orAd-CEBPa, and the next day, they were transfected with wild-type (509) or C/EBP-RE mutated (509-mut) promoter reporter vectors. Luciferaseactivities were measured 48 hours post-transfection. Bars represent the mean6 S.D. of three to five independent experiments expressed as fold changeversus Ad-control. *P , 0.05 (Mann-Whitney test). (C) ChIP assay demonstrates binding of C/EBPa to the SHP promoter. Formaldehyde crosslinkedchromatin from adenovirus-infected HepG2 cells was incubated with antibody against C/EBPa or with preimmune IgG. Immunoprecipitated purifiedDNA was PCR amplified with primers specific for the SHP 59-flanking region (2329/2678 bp, 34 cycles) or for an exonic region of the human RPLP0(negative binding control, 39 cycles). Aliquots (10 ml) of PCR amplifications from a representative experiment were subjected to electrophoresis on 2%agarose gel and stained with SYBRGreen Safe. M, 100-bp DNA ladder. (D) Recovery of DNA in the immunoprecipitates is represented as the percentageof input DNA (100%).

590 Benet et al.

at ASPE

T Journals on January 19, 2021

molpharm

.aspetjournals.orgD

ownloaded from

the repression of 509-SHP-LUC by U0126 (MEK/ERK inhibitor)was partially but significantly abrogated in 509-mut-SHP-LUC,whereas the induction of 509-SHP-LUC by LY294002 (PI3Kinhibitor, GSK3 activator) was completely abolished in themutated construct (Fig. 8B). This experimental evidence supportsthe notion that phosphorylated C/EBP forms (by ERK1/2 and/orGSK3) activate SHP, whereas nonphosphorylated C/EBPs causeSHP repression.

DiscussionOne important finding of this study is that several steatotic

drugs repressed SHP in human HepG2 and HepaRG cells.However, other steatotic drugs failed to significantly repressSHP in these cell models. There are several possible explan-ations for this discrepancy. First, not all steatotic drugs sharethe same mechanism of action: inhibition of b-oxidation,increased TG synthesis, alterations of mitochondria (respira-tory chain, membrane potential, oxidative phosphorylation,and mitochondrial DNA), inhibition of lipoprotein synthesis,and secretion, etc. (Begriche et al., 2011). Secondly, only somesteatotic drugs induce lipid peroxidation, lipotoxicity, andreactive oxygen species (ROS). Regarding the present study,some steatotic drugs with no effect on SHP induced only a lowlevel of lipid accumulation in HepG2 (i.e., tamoxifen andamiodarone) (Benet et al., 2014), whereas others did not induceROS (i.e., tianeptine and zidovudine) (Donato et al., 2012).Therefore, a threshold level of lipid accumulation and a par-ticular subsequent toxic mechanism may be required for drug-induced SHP repression.The drug concentrations selected in this in vitro study were

above therapeutic plasma concentrations. However, the ratio

of the effective concentration in vitro to the therapeutic peakplasma concentration (Cmax) is considered a risk index thatprovides an estimation of the safety margin. We foundsignificant effects of steatotic drugs on SHP at ratios of 10-(tetracycline and valproate) and 25-fold (cyclosporine A anddoxycycline) Cmax. These ratios are considered low safetymargins (O’Brien et al., 2006; Xu et al., 2008), and suggestthese four steatotic drugs are at risk of having negative effectson SHP under therapeutic doses in vivo.These observations prompted us to study the regulation of

SHP in different mouse modes of fatty liver (iatrogenic andNAFLD/metabolic) and found that SHP was repressed intetracycline-treated rat livers and MCD diet and GNMT2/2

mice livers, but was not repressed in the MAT1A2/2 model.One major difference among these NAFLD models is that thelivers of GNMT2/2 and MCD diet mice show early symptomsof severe disease with fibrosis and even HCC in GNMT2/2

(Anstee and Goldin, 2006; Martinez-Chantar et al., 2008;Varela-Rey et al., 2010; Itagaki et al., 2013), whereasMAT1A2/2

express a less severe phenotype with delayed onset andno fibrosis or HCC (Lu et al., 2001; Martinez-Chantar et al.,2002).In a previous study, Huang et al. (2007) reported that SHP

is upregulated in fatty livers of genetic (ob/ob and KKAy) anddietary (high sucrose and high fat) mouse models. Thisapparent contradiction could also be due to differences inthe disease phenotype of the models. Leptin-deficient (ob/ob)and KKAy mice are similar models of hyperphagia, type 2diabetes, and obesity that do not develop steatohepatitis andare resistant to fibrosis. Similarly, HFD mice develop obesity,hyperinsulinemia, and hyperglycemia. However, severe fibrosisand HCC do not appear even after prolonged HFD (Takahashi

Fig. 7. Steatotic drugs negatively modulate SHP by a C/EBPa-dependent mechanism. (A) HepG2 cells were transfected with three different SHP-promoter vectors (2150,2340, and2509). The next day, cells were treated with steatotic drugs or vehicle (DMSO). Twenty-four hours later, cell extractswere prepared and assayed for firefly and Renilla luciferase activities. (B) Response of the SHP promoter with mutated C/EBP-RE to steatotic drugs.Cells transfected with reporter vectors with mutated CEBP-RE (509-mut) or wild-type (509) SHP promoters were lysed at 48 hours post-transfection.Steatotic drugs were added 24 hours before processing. Bars represent the mean 6 S.D. (n = 3–5) expressed as a fold change versus DMSO. *P , 0.05;**P , 0.01 (one-way analysis of variance and Tukey’s test).

SHP Repression by C/EBPa in Drug-Induced Steatosis 591

at ASPE

T Journals on January 19, 2021

molpharm

.aspetjournals.orgD

ownloaded from

et al., 2012; Imajo et al., 2013). On the contrary, GNMT2/2 andMCD mice develop steatohepatitis with fibrosis, but withoutobesity and insulin resistance (Varela-Rey et al., 2010;Takahashi et al., 2012; Imajo et al., 2013). Moreover, theMCD diet induces greater ROS production, mitochondrial DNAdamage, and apoptotic cell death than many other diet modelsof NAFLD (Gao et al., 2004; Anstee and Goldin, 2006).Therefore, we can speculate that SHP is upregulated at the

onset or in less severe NAFLD, but the progression of thedisease, with inflammation, liver injury, and fibrosis, triggerssignals that inhibit SHP expression. In agreement with thisview, SHP expression is significantly decreased in humanNASH cirrhotic livers (Zhang et al., 2014).Overall, our results suggest that independently of their

iatrogenic or metabolic origin, hepatosteatosis with associ-ated liver injury triggers SHP downregulation. The potentialclinical consequence of SHP repression could be extrapolatedfrom studies with SHP2/2 mice, which showed increasedsensitivity to liver damage and liver fibrosis (Park et al., 2008;Chanda et al., 2009; Zhang et al., 2014) as well as hepatocytehyperproliferation and HCC (Zhang et al., 2008). Moreover,the repression of SHP could affect the crosstalk of SHP withother nuclear receptors, particularly PXR, a well character-ized lipogenic factor (Lee et al., 2008; Hoekstra et al., 2009).SHP suppresses PXR, which is also considered a masterregulator of drug/xenobiotic metabolism (Krausova et al.,2011). On the contrary, PXR activation by rifampicin inhibits

SHP (Li and Chiang, 2006). Therefore, the repression of SHPby steatotic drugs and in advanced NAFLD could lead tohigher PXR activity and enhanced lipogenesis, which wouldalso contribute to disease severity and progression.However, the potential negative consequences mentioned

above need to be demonstrated in future studies, as the datapresented here do not demonstrate a causative link betweenthe downregulation of SHP and the severity and progressionof the disease. Our study has additional limitations becausethe different animal models are very complex systems and pre-sumably many genes (not only SHP) show altered expression.Because of the critical role of SHP in liver metabolism and

disease, many different studies have addressed the regulationof the SHP gene. It has been found that SHP is activated bymany transcription factors in response to multiple signalingpathways (Zhang et al., 2011; Garruti et al., 2012). In thepresent study, we demonstrate that RXRa [(1)-9-cis-retinoicacid] also induces SHP. This result is in line with theinduction of SHP by all-transretinoic acid (Cai et al., 2010),and suggests that SHP can be regulated by retinoids viaRXRa homodimers or RXRa-RAR heterodimers. Nevertheless,increased SHP expression by RXRa could also be mediatedby other heterodimers, such as RXRa-FXR, RXRa-LXRa, orRXRa-PPARg (Kim et al., 2007).In the present study, we have also uncovered two new SHP

repressors: FOXA1 and C/EBPa. However, comparativeanalysis showed that C/EBPa was faster and more effectiveand dominantly repressed SHP induction by RXRa. Furtheranalyses demonstrated binding of C/EBPa to a negativeresponse element at 2473 bp in the human SHP gene. Mu-tation of this element evidenced its relevance for the regulationof SHP by C/EBPa, steatotic drugs, and stress-signalingpathways. Based on these results, it is feasible to suggest thatlipid-dependent insults triggered by iatrogenic or metabolicsteatosis can alter or modulate signaling pathways that modifyC/EBPa phosphorylation and consequently cause SHP repression.Our results demonstrate that inhibition of MEK1/2 kinases

caused a very significant repression of both SHP mRNA andSHP-LUC activity. These results suggest that conditionscausingMEK/ERK inhibition will cause SHP downregulation.ERK1/2 inhibition has already been reported in severalmodels of NAFLD. For instance, mice on an MCD diet showeda remarkable suppression of hepatic ERK1/2 activation (Wanget al., 2010a). On the opposite side, an increase in the level ofphosphorylated ERK1/2 improved liver steatosis (Aghazadehand Yazdanparast, 2010). Chronic alcohol also caused a signif-icant suppression of hepatic ERK1/2 activation and triggeredfatty liver (Wang et al., 2010b). We hypothesize that one of theMEK/ERK targets could be C/EBPa or C/EBPb. ERK canphosphorylate C/EBPa at Ser 21 (Ross et al., 2004). Moreover,phosphorylation of C/EBPb at Thr235 by ERK2 is a keydeterminant of its capacity for transactivation (Nakajima et al.,1993). Based on these studies, we suggest that phosphorylatedC/EBPs would activate SHP, whereas dephosphorylated formswould not activate or repress SHP.Inhibition of PI3K induced both SHP mRNA and SHP-LUC

activity in HepG2 cells. These results suggest that conditionscausing PI3K activation will cause SHP repression. It hasbeen shown that mitochondrial ROS induces hepatocytesteatosis by upregulating the PI3K pathway (Kohli et al.,2007) and that hepatocytes exposed to the MCD mediumdeveloped significant and progressive steatosis along with

Fig. 8. SHP mRNA expression and promoter activity after inhibition ofMEK1/2 and PI3K pathways. (A) Time-course analysis of SHP mRNAlevel in HepG2 cells after treatment with 20 mM LY294002 (PI3Kinhibitor), 10 mM U0126 (MEK1/2 inhibitor), or vehicle. (B) HepG2 cellswere transfected with the2509 and 509-mut reporter vectors and the nextday were exposed to kinase inhibitors for 24 hours. Data represent fireflyactivities normalized to Renilla luciferase. Bars represent the mean 6 S.D.of three to four independent experiments. *P , 0.05 (Mann-Whitney test).

592 Benet et al.

at ASPE

T Journals on January 19, 2021

molpharm

.aspetjournals.orgD

ownloaded from

activation of PI3K/Akt (Sahai et al., 2006). Moreover, PI3K (p85)was significantly higher in NAFLD patients (Xu et al., 2011).Activation of PI3K leads to GSK3 inhibition, and GSK3 phos-phorylates C/EBPa on an evolutionarily conserved consensussite (Thr222, Thr226, and Ser230) (Ross et al., 1999). Moreover,activation of the PI3K/Akt pathway in proliferating hepatocytesand liver tumor/hepatoma cells induced the protein phosphatase2A-mediated dephosphorylation of C/EBPa on Ser193, leading toa failure of C/EBPa to cause growth arrest (Wang et al., 2004).Finally, insulin, a major activator of the PI3K pathway, causes avery significant repression of SHP in primary cultured hepato-cytes (Van Rooyen et al., 2011). Therefore, the inhibitory activityof PI3K on SHP could be mediated through the reciprocalrepression of GSK3 and/or activation of protein phosphatases,leading to both dephosphorylation of C/EBPa, which in turnwould cause SHP repression. These results again suggest thatdephosphorylated C/EBPa is the SHP repressor. Adenovirus-mediated overexpression of C/EBPa would mainly generate anonphosphorylated (repressing) C/EBPa protein.C/EBP proteins are a well known recipient of extracellular

signals resulting in multiple phosphorylations, acetylations,and SUMOylations (Nerlov, 2008). Up to eight differentphosphorylation sites have been described in C/EBPa (Tsukadaet al., 2011), and therefore the investigation of the precisephosphorylated forms involved in SHP regulation is complexand out of the scope of this paper.In summary, we hypothesize that the repression of SHP by

C/EBPa is likely dependent on dephosphorylated C/EBPa. Asimilar scenario has been demonstrated for the hepaticphosphoenolpyruvate carboxykinase gene, which is activated(Qiao et al., 2006) or repressed (Pedersen et al., 2007) by C/EBPa,depending on its phosphorylation status. Our data also supportthat harmful xenobiotics or metabolic conditions causing in-hibition of MEK1/2 or activation of PI3K pathways will triggera C/EBPa-dependent repression of SHP, which could favor theprogression and severity of NAFLD.

Authorship Contributions

Participated in research design: Benet, Castell, Jover.Conducted experiments: Benet, Guzmán, Pisonero-Vaquero, García-

Mediavilla, Sánchez-Campos, Martínez-Chantar.Contributed new reagents or analytic tools: Donato, Castell, Jover.Performed data analysis: Benet, Jover.Wrote or contributed to the writing of the manuscript: Benet, Jover.

References

Aghazadeh S and Yazdanparast R (2010) Inhibition of JNK alongwith activation of ERK1/2MAPK pathways improve steatohepatitis among the rats. Clin Nutr 29:381–385.

Anstee QM and Goldin RD (2006) Mouse models in non-alcoholic fatty liver diseaseand steatohepatitis research. Int J Exp Pathol 87:1–16.

Båvner A, Sanyal S, Gustafsson JA, and Treuter E (2005) Transcriptional cor-epression by SHP: molecular mechanisms and physiological consequences. TrendsEndocrinol Metab 16:478–488.

Begriche K, Massart J, Robin MA, Borgne-Sanchez A, and Fromenty B (2011) Drug-induced toxicity on mitochondria and lipid metabolism: mechanistic diversity anddeleterious consequences for the liver. J Hepatol 54:773–794.

Benet M, Lahoz A, Guzmán C, Castell JV, and Jover R (2010) CCAAT/enhancer-binding protein alpha (C/EBPalpha) and hepatocyte nuclear factor 4alpha(HNF4alpha) synergistically cooperate with constitutive androstane receptor totransactivate the human cytochrome P450 2B6 (CYP2B6) gene: application to thedevelopment of a metabolically competent human hepatic cell model. J Biol Chem285:28457–28471.

Benet M, Moya M, Donato MT, Lahoz A, Hervás D, Guzmán C, Gómez-Lechón MJ,Castell JV, and Jover R (2014) A simple transcriptomic signature able to predictdrug-induced hepatic steatosis. Arch Toxicol 88:967–982.

Boulias K, Katrakili N, Bamberg K, Underhill P, Greenfield A, and Talianidis I(2005) Regulation of hepatic metabolic pathways by the orphan nuclear receptorSHP. EMBO J 24:2624–2633.

Cai SY, He H, Nguyen T, Mennone A, and Boyer JL (2010) Retinoic acid repressesCYP7A1 expression in human hepatocytes and HepG2 cells by FXR/RXR-dependentand independent mechanisms. J Lipid Res 51:2265–2274.

Cano A, Buqué X, Martínez-Uña M, Aurrekoetxea I, Menor A, García-Rodríguez JL,Lu SC, Martínez-Chantar ML, Mato JM, and Ochoa B et al. (2011) Methionineadenosyltransferase 1A gene deletion disrupts hepatic very low-density lipoproteinassembly in mice. Hepatology 54:1975–1986.

Chanda D, Lee CH, Kim YH, Noh JR, Kim DK, Park JH, Hwang JH, Lee MR, JeongKH, and Lee IK et al. (2009) Fenofibrate differentially regulates plasminogen ac-tivator inhibitor-1 gene expression via adenosine monophosphate-activated proteinkinase-dependent induction of orphan nuclear receptor small heterodimer partner.Hepatology 50:880–892.

Chiang JY (2003) Bile acid regulation of hepatic physiology: III. Bile acids and nuclearreceptors. Am J Physiol Gastrointest Liver Physiol 284:G349–G356.

Donato MT, Jover R, and Gómez-Lechón MJ (2013) Hepatic cell lines for drughepatotoxicity testing: limitations and strategies to upgrade their metabolic com-petence by gene engineering. Curr Drug Metab 14:946–968.

Donato MT, Tolosa L, Jiménez N, Castell JV, and Gómez-Lechón MJ (2012) High-content imaging technology for the evaluation of drug-induced steatosis usinga multiparametric cell-based assay. J Biomol Screen 17:394–400.

Gao D, Wei C, Chen L, Huang J, Yang S, and Diehl AM (2004) Oxidative DNAdamage and DNA repair enzyme expression are inversely related in murine modelsof fatty liver disease. Am J Physiol Gastrointest Liver Physiol 287:G1070–G1077.

Garruti G, Wang HH, Bonfrate L, de Bari O, Wang DQ, and Portincasa P (2012) Apleiotropic role for the orphan nuclear receptor small heterodimer partner in lipidhomeostasis and metabolic pathways. J Lipids 2012:304292.

Gómez-Lechón MJ, López P, Donato T, Montoya A, Larrauri A, Giménez P, TrullenqueR, Fabra R, and Castell JV (1990) Culture of human hepatocytes from small surgicalliver biopsies. Biochemical characterization and comparison with in vivo. In Vitro CellDev Biol 26:67–74.

Gómez-Lechón MJ, Jover R, Donato T, Ponsoda X, Rodriguez C, Stenzel KG, KlockeR, Paul D, Guillén I, and Bort R et al. (1998) Long-term expression of differentiatedfunctions in hepatocytes cultured in three-dimensional collagen matrix. J CellPhysiol 177:553–562.

Guzmán C, Benet M, Pisonero-Vaquero S, Moya M, García-Mediavilla MV, Martínez-Chantar ML, González-Gallego J, Castell JV, Sánchez-Campos S, and Jover R(2013) The human liver fatty acid binding protein (FABP1) gene is activated byFOXA1 and PPARa; and repressed by C/EBPa: Implications in FABP1 down-regulation in nonalcoholic fatty liver disease. Biochim Biophys Acta 1831:803–818.

Hart SN, Li Y, Nakamoto K, Subileau EA, Steen D, and Zhong XB (2010) A comparisonof whole genome gene expression profiles of HepaRG cells and HepG2 cells to primaryhuman hepatocytes and human liver tissues. Drug Metab Dispos 38:988–994.

Hartman HB, Lai K, and Evans MJ (2009) Loss of small heterodimer partner ex-pression in the liver protects against dyslipidemia. J Lipid Res 50:193–203.

He N, Park K, Zhang Y, Huang J, Lu S, and Wang L (2008) Epigenetic inhibitionof nuclear receptor small heterodimer partner is associated with and regulateshepatocellular carcinoma growth. Gastroenterology 134:793–802.

Hoekstra M, Lammers B, Out R, Li Z, Van Eck M, and Van Berkel TJ (2009) Acti-vation of the nuclear receptor PXR decreases plasma LDL-cholesterol levels andinduces hepatic steatosis in LDL receptor knockout mice. Mol Pharm 6:182–189.

Huang J, Iqbal J, Saha PK, Liu J, Chan L, Hussain MM, Moore DD, and Wang L(2007) Molecular characterization of the role of orphan receptor small heterodimerpartner in development of fatty liver. Hepatology 46:147–157.

Imajo K, Yoneda M, Kessoku T, Ogawa Y, Maeda S, Sumida Y, Hyogo H, Eguchi Y,Wada K, and Nakajima A (2013) Rodent models of nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. Int J Mol Sci 14:21833–21857.

Itagaki H, Shimizu K, Morikawa S, Ogawa K, and Ezaki T (2013) Morphological andfunctional characterization of non-alcoholic fatty liver disease induced by a methionine-choline-deficient diet in C57BL/6 mice. Int J Clin Exp Pathol 6:2683–2696.

Jover R, Bort R, Gómez-Lechón MJ, and Castell JV (1998) Re-expression of C/EBPalpha induces CYP2B6, CYP2C9 and CYP2D6 genes in HepG2 cells. FEBS Lett431:227–230.

Kim HI, Koh YK, Kim TH, Kwon SK, Im SS, Choi HS, Kim KS, and Ahn YH (2007)Transcriptional activation of SHP by PPAR-gamma in liver. Biochem Biophys ResCommun 360:301–306.

Kohli R, Pan X, Malladi P, Wainwright MS, and Whitington PF (2007) Mito-chondrial reactive oxygen species signal hepatocyte steatosis by regulating thephosphatidylinositol 3-kinase cell survival pathway. J Biol Chem 282:21327–21336.

Krausova L, Stejskalova L, Wang H, Vrzal R, Dvorak Z, Mani S, and Pavek P (2011)Metformin suppresses pregnane X receptor (PXR)-regulated transactivation ofCYP3A4 gene. Biochem Pharmacol 82:1771–1780.

Larrain S and Rinella ME (2012) A myriad of pathways to NASH. Clin Liver Dis 16:525–548.

Lee HK, Lee YK, Park SH, Kim YS, Park SH, Lee JW, Kwon HB, Soh J, Moore DD,and Choi HS (1998) Structure and expression of the orphan nuclear receptor SHPgene. J Biol Chem 273:14398–14402.

Lee JH, Zhou J, and Xie W (2008) PXR and LXR in hepatic steatosis: a new dog andan old dog with new tricks. Mol Pharm 5:60–66.

Li T and Chiang JY (2006) Rifampicin induction of CYP3A4 requires pregnane Xreceptor cross talk with hepatocyte nuclear factor 4alpha and coactivators, and sup-pression of small heterodimer partner gene expression. Drug Metab Dispos 34:756–764.

Lu SC, Alvarez L, Huang ZZ, Chen L, An W, Corrales FJ, Avila MA, Kanel G,and Mato JM (2001) Methionine adenosyltransferase 1A knockout mice are pre-disposed to liver injury and exhibit increased expression of genes involved inproliferation. Proc Natl Acad Sci USA 98:5560–5565.

Martínez-Chantar ML, Corrales FJ, Martínez-Cruz LA, García-Trevijano ER, HuangZZ, Chen L, Kanel G, Avila MA, Mato JM, and Lu SC (2002) Spontaneous oxidativestress and liver tumors in mice lacking methionine adenosyltransferase 1A.FASEB J 16:1292–1294.

Martínez-Chantar ML, Vázquez-Chantada M, Ariz U, Martínez N, Varela M, Luka Z,Capdevila A, Rodríguez J, Aransay AM, and Matthiesen R et al. (2008) Loss of theglycine N-methyltransferase gene leads to steatosis and hepatocellular carcinomain mice. Hepatology 47:1191–1199.

SHP Repression by C/EBPa in Drug-Induced Steatosis 593

at ASPE

T Journals on January 19, 2021

molpharm

.aspetjournals.orgD

ownloaded from

Nakajima T, Kinoshita S, Sasagawa T, Sasaki K, Naruto M, Kishimoto T, and AkiraS (1993) Phosphorylation at threonine-235 by a ras-dependent mitogen-activatedprotein kinase cascade is essential for transcription factor NF-IL6. Proc Natl AcadSci USA 90:2207–2211.

Nerlov C (2008) C/EBPs: recipients of extracellular signals through proteome mod-ulation. Curr Opin Cell Biol 20:180–185.

O’Brien PJ, Irwin W, Diaz D, Howard-Cofield E, Krejsa CM, Slaughter MR, Gao B,Kaludercic N, Angeline A, and Bernardi P et al. (2006) High concordance of drug-induced human hepatotoxicity with in vitro cytotoxicity measured in a novel cell-based model using high content screening. Arch Toxicol 80:580–604.

Park YJ, Qatanani M, Chua SS, LaRey JL, Johnson SA, Watanabe M, Moore DD,and Lee YK (2008) Loss of orphan receptor small heterodimer partner sensitizesmice to liver injury from obstructive cholestasis. Hepatology 47:1578–1586.

Pedersen TA, Bereshchenko O, Garcia-Silva S, Ermakova O, Kurz E, Mandrup S,Porse BT, and Nerlov C (2007) Distinct C/EBPalpha motifs regulate lipogenic andgluconeogenic gene expression in vivo. EMBO J 26:1081–1093.

Qiao L, MacDougald OA, and Shao J (2006) CCAAT/enhancer-binding protein alphamediates induction of hepatic phosphoenolpyruvate carboxykinase by p38 mitogen-activated protein kinase. J Biol Chem 281:24390–24397.

Ross SE, Erickson RL, Hemati N, and MacDougald OA (1999) Glycogen synthasekinase 3 is an insulin-regulated C/EBPalpha kinase. Mol Cell Biol 19:8433–8441.

Ross SE, Radomska HS, Wu B, Zhang P, Winnay JN, Bajnok L, Wright WS, SchaufeleF, Tenen DG, and MacDougald OA (2004) Phosphorylation of C/EBPalpha inhibitsgranulopoiesis. Mol Cell Biol 24:675–686.

Sahai A, Pan X, Paul R, Malladi P, Kohli R, and Whitington PF (2006) Roles ofphosphatidylinositol 3-kinase and osteopontin in steatosis and aminotransferaserelease by hepatocytes treated with methionine-choline-deficient medium. Am JPhysiol Gastrointest Liver Physiol 291:G55–G62.

Seol W, Choi HS, and Moore DD (1996) An orphan nuclear hormone receptor thatlacks a DNA binding domain and heterodimerizes with other receptors. Science272:1336–1339.

Shih DQ, Screenan S, Munoz KN, Philipson L, Pontoglio M, Yaniv M, Polonsky KS,and Stoffel M (2001) Loss of HNF-1alpha function in mice leads to abnormalexpression of genes involved in pancreatic islet development and metabolism.Diabetes 50:2472–2480.

Takahashi Y, Soejima Y, and Fukusato T (2012) Animal models of nonalcoholic fattyliver disease/nonalcoholic steatohepatitis. World J Gastroenterol 18:2300–2308.

Trauner M (2007) A little orphan runs to fat: the orphan receptor small heterodimerpartner as a key player in the regulation of hepatic lipid metabolism.Hepatology 46:1–5.

Tsukada J, Yoshida Y, Kominato Y, and Auron PE (2011) The CCAAT/enhancer (C/EBP) family of basic-leucine zipper (bZIP) transcription factors is a multifacetedhighly-regulated system for gene regulation. Cytokine 54:6–19.

Van Rooyen DM, Larter CZ, Haigh WG, Yeh MM, Ioannou G, Kuver R, Lee SP,Teoh NC, and Farrell GC (2011) Hepatic free cholesterol accumulates in obese,diabetic mice and causes nonalcoholic steatohepatitis. Gastroenterology 141:1393–1403.

Varela-Rey M, Martínez-López N, Fernández-Ramos D, Embade N, Calvisi DF,Woodhoo A, Rodríguez J, Fraga MF, Julve J, and Rodríguez-Millán E et al. (2010)Fatty liver and fibrosis in glycine N-methyltransferase knockout mice is preventedby nicotinamide. Hepatology 52:105–114.

Wang GL, Iakova P, Wilde M, Awad S, and Timchenko NA (2004) Liver tumorsescape negative control of proliferation via PI3K/Akt-mediated block of C/EBPalpha growth inhibitory activity. Genes Dev 18:912–925.

Wang L, Han Y, Kim CS, Lee YK, and Moore DD (2003) Resistance of SHP-null miceto bile acid-induced liver damage. J Biol Chem 278:44475–44481.

Wang Z, Yao T, and Song Z (2010a) Extracellular signal-regulated kinases 1/2 sup-pression aggravates transforming growth factor-beta1 hepatotoxicity: a potentialmechanism for liver injury in methionine-choline deficient-diet-fed mice. Exp BiolMed (Maywood) 235:1347–1355.

Wang Z, Yao T, and Song Z (2010b) Involvement and mechanism of DGAT2 upre-gulation in the pathogenesis of alcoholic fatty liver disease. J Lipid Res 51:3158–3165.

Xu D, Huang XD, Yuan JP, Wu J, Fan Y, Luo HS, and Yang YH (2011) Impairedactivation of phosphatidylinositol 3-kinase by leptin is a novel mechanism of he-patic leptin resistance in NAFLD. Hepatogastroenterology 58:1703–1707.

Xu JJ, Henstock PV, Dunn MC, Smith AR, Chabot JR, and de Graaf D (2008) Cellularimaging predictions of clinical drug-induced liver injury. Toxicol Sci 105:97–105.

Zhang Y, Hagedorn CH, and Wang L (2011) Role of nuclear receptor SHP in me-tabolism and cancer. Biochim Biophys Acta 1812:893–908.

Zhang Y, Soto J, Park K, Viswanath G, Kuwada S, Abel ED, and Wang L (2010)Nuclear receptor SHP, a death receptor that targets mitochondria, induces apo-ptosis and inhibits tumor growth. Mol Cell Biol 30:1341–1356.

Zhang Y, Xu N, Xu J, Kong B, Copple B, Guo GL, and Wang L (2014) E2F1 is a novelfibrogenic gene that regulates cholestatic liver fibrosis through the Egr-1/SHP/EID1 network. Hepatology 60:919–930.

Zhang Y, Xu P, Park K, Choi Y, Moore DD, and Wang L (2008) Orphan receptor smallheterodimer partner suppresses tumorigenesis by modulating cyclin D1 expressionand cellular proliferation. Hepatology 48:289–298.

Address correspondence to: Ramiro Jover Atienza, Unidad Mixta enHepatología Experimental, IIS Hospital La Fe, Torre A-6.13, 46026-Valencia,Spain. E-mail: ramiro.jover@uv.es

594 Benet et al.

at ASPE

T Journals on January 19, 2021

molpharm

.aspetjournals.orgD

ownloaded from