pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur...

14

Transcript of pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur...

Page 1: pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur until about the fourth year postnatally, ... [13], nucleoli [23] ...
Page 2: pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur until about the fourth year postnatally, ... [13], nucleoli [23] ...
Page 3: pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur until about the fourth year postnatally, ... [13], nucleoli [23] ...
Page 4: pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur until about the fourth year postnatally, ... [13], nucleoli [23] ...
Page 5: pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur until about the fourth year postnatally, ... [13], nucleoli [23] ...
Page 6: pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur until about the fourth year postnatally, ... [13], nucleoli [23] ...
Page 7: pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur until about the fourth year postnatally, ... [13], nucleoli [23] ...
Page 8: pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur until about the fourth year postnatally, ... [13], nucleoli [23] ...
Page 9: pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur until about the fourth year postnatally, ... [13], nucleoli [23] ...
Page 10: pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur until about the fourth year postnatally, ... [13], nucleoli [23] ...
Page 11: pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur until about the fourth year postnatally, ... [13], nucleoli [23] ...
Page 12: pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur until about the fourth year postnatally, ... [13], nucleoli [23] ...
Page 13: pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur until about the fourth year postnatally, ... [13], nucleoli [23] ...
Page 14: pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur until about the fourth year postnatally, ... [13], nucleoli [23] ...

Active liquid-like behavior of nucleoli determines their ...

Active liquid-like behavior of nucleoli determines their ...

Diagnosis of Postnatally Acquired Rubella by Use of Three Enzyme

Diagnosis of Postnatally Acquired Rubella by Use of Three Enzyme

Meiosis, spermatogenesis and nucleolar behavior in the ... · optera, Coreidae) and Coptosoma punctissimum (Heteroptera, Plataspidae), nucleoli were observed at the metaphase plate

Meiosis, spermatogenesis and nucleolar behavior in the ... · optera, Coreidae) and Coptosoma punctissimum (Heteroptera, Plataspidae), nucleoli were observed at the metaphase plate

For Peer Review - pure.knaw.nl · Raaijmakers, Jos; Netherlands Institute of Ecology, Microbial Ecology Keywords: aquaculture, beneficial microbes, microbiomes, emerging diseases,

For Peer Review - pure.knaw.nl · Raaijmakers, Jos; Netherlands Institute of Ecology, Microbial Ecology Keywords: aquaculture, beneficial microbes, microbiomes, emerging diseases,

PROPHASE METAPHASE ANAPHASE TELOPHASE. Chromosomes condense and nucleoli disappear Each duplicated chromosome becomes visible as distinct sister chromatids.

PROPHASE METAPHASE ANAPHASE TELOPHASE. Chromosomes condense and nucleoli disappear Each duplicated chromosome becomes visible as distinct sister chromatids.

pure.knaw.nl  · Web viewIntegrating quantitative morphological and qualitative molecular methods to analyze soil nematode community responses to plant range expansion . Stefan Geisen1,2,*,

pure.knaw.nl  · Web viewIntegrating quantitative morphological and qualitative molecular methods to analyze soil nematode community responses to plant range expansion . Stefan Geisen1,2,*,

Case Report - downloads.hindawi.comdownloads.hindawi.com/journals/cripa/2012/271407.pdf · chromatin, nuclear clefting and indentation, inconspicuous-occasional prominent nucleoli,

Case Report - downloads.hindawi.comdownloads.hindawi.com/journals/cripa/2012/271407.pdf · chromatin, nuclear clefting and indentation, inconspicuous-occasional prominent nucleoli,

pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM

pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM

Disclosures - am.aace.comam2016.aace.com/presentations/wednesday/W41/thyroidology_baloch.pdfirregularities Intranuclear grooves, Inclusions Small peripheral nucleoli Not so easy ‐Head

Disclosures - am.aace.comam2016.aace.com/presentations/wednesday/W41/thyroidology_baloch.pdfirregularities Intranuclear grooves, Inclusions Small peripheral nucleoli Not so easy ‐Head

Monoclonal antibody R2D5 reveals midsagittal radial glial system in postnatally developing and

Monoclonal antibody R2D5 reveals midsagittal radial glial system in postnatally developing and

Cronicon OPEN ACCESS EC GASTROENTEROLOGY AND … · 2019. 8. 1. · atypia, when enunciated, ... pleomorphic nuclei with significant hyperchromasia, prominent nucleoli, frequent mitosis,

Cronicon OPEN ACCESS EC GASTROENTEROLOGY AND … · 2019. 8. 1. · atypia, when enunciated, ... pleomorphic nuclei with significant hyperchromasia, prominent nucleoli, frequent mitosis,

Growth at song - PNAS · 2005. 5. 16. · autoradiographic sections counterstained with cresyl violet. Weusedtheknowncriteria suchasalargepalenucleus, one or two distinct nucleoli,

Growth at song - PNAS · 2005. 5. 16. · autoradiographic sections counterstained with cresyl violet. Weusedtheknowncriteria suchasalargepalenucleus, one or two distinct nucleoli,

Mitosis Meiosis comparison. In animals each centrosome has 2 centrioles. During the transition to prophase, nucleoli disappear and microtubule arrays.

Mitosis Meiosis comparison. In animals each centrosome has 2 centrioles. During the transition to prophase, nucleoli disappear and microtubule arrays.

CONSEQUENCES OF POSTNATALLY ELEVATED INSULIN-LIKE …

CONSEQUENCES OF POSTNATALLY ELEVATED INSULIN-LIKE …

Thyroid Follicular Epithelial Cell Lesionslasop.com/pgs/hdouts/2010-01_Wenig--Thyroid_Follicular_Epithelial_… · – nuclear atypia with prominent nucleoli, giant cells or unusual

Thyroid Follicular Epithelial Cell Lesionslasop.com/pgs/hdouts/2010-01_Wenig--Thyroid_Follicular_Epithelial_… · – nuclear atypia with prominent nucleoli, giant cells or unusual

NEUROPEDIATRIC EXAMINATION PRIMITIVE REFLEXES. Dominant form of movement for last 4 months prenatally and first 4 months postnatally. Primitive reflexes.

NEUROPEDIATRIC EXAMINATION PRIMITIVE REFLEXES. Dominant form of movement for last 4 months prenatally and first 4 months postnatally. Primitive reflexes.

Production of Giant Mouse Oocyte Nucleoli and Assessment ... › f7e3 › 818b8c8fc0bb... · —Technology Report— Production of Giant Mouse Oocyte Nucleoli and Assessment of Their

Production of Giant Mouse Oocyte Nucleoli and Assessment ... › f7e3 › 818b8c8fc0bb... · —Technology Report— Production of Giant Mouse Oocyte Nucleoli and Assessment of Their

Structure of the nucleus Nucleoli: rDNA, rRNA synthesis, ribosome assembly Chromatin: Genomic DNA - protein complexes, transcription Nuclear envelope –Two.

Structure of the nucleus Nucleoli: rDNA, rRNA synthesis, ribosome assembly Chromatin: Genomic DNA - protein complexes, transcription Nuclear envelope –Two.

Construction of synthetic nucleoli in human cells reveals ...

Construction of synthetic nucleoli in human cells reveals ...

pure.knaw.nl Georgopoulos,¶ Frits Meijlink,S and Hans Clevers ... GGGCAAGTAGGGCACCCTTTGAAGCTCT annealed to CCC- AGAGCTTCAAAGGGTGCCCTACTTG. All oligonucleotides

pure.knaw.nl Georgopoulos,¶ Frits Meijlink,S and Hans Clevers ... GGGCAAGTAGGGCACCCTTTGAAGCTCT annealed to CCC- AGAGCTTCAAAGGGTGCCCTACTTG. All oligonucleotides