Pseudomonas aeruginosa AlgR Phosphorylation Modulates ... · this study, we further characterize...

Pseudomonas aeruginosa AlgR Phosphorylation ModulatesRhamnolipid Production and Motility

Yuta Okkotsu,a Prince Tieku,b Liam F. Fitzsimmons,a Mair E. Churchill,b Michael J. Schurra

Department of Microbiology, University of Colorado School of Medicine, Aurora, Colorado, USAa; Department of Pharmacology, University of Colorado School ofMedicine, Aurora, Colorado, USAb

AlgR is a key Pseudomonas aeruginosa transcriptional response regulator required for virulence. AlgR activates alginate produc-tion and twitching motility but represses the Rhl quorum-sensing (QS) system, including rhamnolipid production. The role ofAlgR phosphorylation is enigmatic, since phosphorylated AlgR (AlgR-P) is required for twitching motility through the fimU pro-moter but is not required for the activation of alginate production. In order to examine the role of AlgR phosphorylation in vivo,a PAO1 algRD54E strain (with algR encoding a D-to-E change at position 54), which constitutively activates fimU transcriptionand exhibits twitching motility, was created. A corresponding PAO1 algRD54N strain (with algR encoding a D-to-N change atposition 54) that does not activate fimU or twitching motility was compared to PAO1, PAO1 algRD54E, PAO1 �algZ (deletion ofthe algZ [fimS] gene, encoding a putative histidine kinase), and PAO1 �algR for swarming motility, rhamnolipid production,and rhlA transcription. PAO1 and PAO1 algRD54E produced approximately 2-fold-higher levels of rhamnolipids than PAO1algRD54N and PAO1 �algZ, thereby indicating that phosphorylated AlgR is required for normal rhamnolipid production. Ex-amination of purified AlgR, AlgR-P, AlgR D54N, and AlgR D54E showed that AlgR-P and AlgR D54E bound preferentially to thefimU and rhlA promoters. Additionally, AlgR-P bound specifically to two sites within the rhlA promoter that were not bound byunphosphorylated AlgR. Taken together, these results indicate that phosphorylated AlgR-P has increased affinity for the rhlApromoter and is required for the coordinate activation of twitching motility, rhamnolipid production, and swarming motility inP. aeruginosa.

Pseudomonas aeruginosa is an opportunistic human pathogencapable of causing fatal infections in patients with a defective

immune system, such as those with AIDS, burn wounds, or cysticfibrosis (CF) (1–3). The majority of CF patients have chronic P.aeruginosa pulmonary infections recalcitrant to antibiotic treat-ment and immune clearance from the lungs. One of the virulencefactors produced by P. aeruginosa that exacerbate chronic infec-tion is the exopolysaccharide alginate (4). Alginate biosynthesisand its export by P. aeruginosa are tightly controlled and require alarge number of genes encoding enzymes and export proteins (4–6). Motility also plays a significant role in the pathogenesis of P.aeruginosa (7, 8) and facilitates the colonization of the host as wellas biofilm formation (9, 10). P. aeruginosa exhibits three majorforms of appendage-mediated motility: (i) flagellum-based swim-ming motility in an aqueous environment, usually assessed on lowagar concentrations (0.3% [wt/vol]) in vitro, (ii) type IVa pilus-associated twitching motility, evaluated on solid surfaces (1% [wt/vol] agar) or at the interstitial surface between the agar and theplastic or glass (11), and (iii) swarming motility, which requiresboth flagella and type IV pili and is observed on semisolid surfaces(0.5 to 0.7% [wt/vol] agar) (12, 13). Swarming motility also usesbiosurfactants produced by the bacteria, such as rhamnolipidsand 3-(3-hydroxyalkanoyloxy)alkanoic acids (HAAs), which de-crease the surface tension between the bacterial cells and the sur-face (14, 15). In addition to swimming, twitching, and swarming,P. aeruginosa exhibits sliding/spreading motility on semisolid sur-faces in the absence of both flagella and type IV pili (16). Murrayand Kazmierczak have shown that rhamnolipid production is re-quired for sliding motility, and this phenotype responded to someof the same environmental cues as swarming motility (16).

Signal transduction through two-component regulatory sys-tems (TCSs) is an important mechanism by which microorgan-

isms detect environmental stimuli and establish an adaptive re-sponse. Typical bacterial TCSs consist of a “sensing” histidinekinase (HK), which detects the stimulus and modulates the signalpathway, and a “receiving” response regulator (RR), which directsthe output of the signal. To date, 58 RRs, 59 sensor HKs, and 7sensor/regulator hybrids have been annotated in the P. aeruginosaPAO1 genome (17). The capacity of this organism to detect andadapt to various environments has been attributed to its largenumber of two-component systems (18). One TCS of P. aerugi-nosa, AlgZ (FimS)-AlgR, controls both alginate production andtwo different types of motility, twitching and swarming (13, 19–21). AlgR, a member of the LytTR family of two-component re-sponse regulators, was one of the first response regulators identi-fied in P. aeruginosa. Under conditions where the AlgU (alsoknown as AlgT, or �22)/MucA sigma factor/antisigma factor-de-pendent pathway is turned on, AlgR is required for full activationof the algD operon and the algC gene, encoding the alginate bio-synthetic, modification, and transport enzymes that confer themucoid phenotype (19, 22). AlgR is also essential for the tran-scription of the fimU operon in nonmucoid P. aeruginosa strains(20, 21). The N terminus of AlgR is homologous to the receiver(REC) domain of two-component regulators and has been phos-

Received 19 June 2013 Accepted 29 September 2013

Published ahead of print 4 October 2013

Address correspondence to Michael J. Schurr, [email protected].

Supplemental material for this article may be found at http://dx.doi.org/10.1128/JB.00726-13.

Copyright © 2013, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JB.00726-13

December 2013 Volume 195 Number 24 Journal of Bacteriology p. 5499 –5515 jb.asm.org 5499

on October 4, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

http://dx.doi.org/10.1128/JB.00726-13

http://dx.doi.org/10.1128/JB.00726-13

http://dx.doi.org/10.1128/JB.00726-13

http://jb.asm.org

http://jb.asm.org/

phorylated in vitro by the Escherichia coli histidine protein kinaseCheA and acetyl phosphate (AcP) (20, 24, 25). The role of AlgRphosphorylation is enigmatic, since it is not necessary for alginateproduction but is essential for twitching motility (20, 24, 25). AlgRcan also act as a negative regulator of hydrogen cyanide (HCN)production in a nonmucoid background (26) and can repress rhlIand rhlA transcription in a biofilm-specific manner (28).

In order to understand the role of AlgR phosphorylation in P.aeruginosa, we created a phosphomimetic form of AlgR (27). Wereport here, for the first time, the generation and utilization of aphosphomimetic form of a P. aeruginosa response regulator. Inthis study, we further characterize the role of AlgR phosphoryla-tion in P. aeruginosa gene expression by comparing PAO1 con-taining algRD54E, a constitutively “on” allele, to PAO1 containingalgRD54N (strain WFPA8), encoding a constitutively “off” formof AlgR. Previous evidence has suggested that deletion of algRcaused a dysregulation of the Rhl quorum-sensing system throughthe derepression of the rhlI and rhlA genes (28). We present evi-dence that AlgR phosphorylation coactivated rhamnolipid pro-duction and twitching motility, resulting in normal swarmingmotility. In contrast, the expression of the phosphodefectivealgRD54N allele in P. aeruginosa resulted in less rhamnolipid pro-duction and loss of swarming and twitching motility.

MATERIALS AND METHODSBacterial strains, plasmids, media, and culture conditions. All strains andplasmids used in this study are listed in Table 1. Pseudomonas strains weremaintained on Pseudomonas isolation agar (PIA), and E. coli strains weremaintained on Miller lysogeny broth (LB) agar (Difco). For antibioticselection, 150 �g/ml gentamicin, 200 �g/ml tetracycline, or 300 �g/�lcarbenicillin was added to PIA, and 100 �g/ml ampicillin, 15 �g/ml gen-tamicin, 10 �g/ml tetracycline, 50 �g/ml kanamycin, or 30 �g/ml chlor-amphenicol was added to LB agar, where appropriate. Overnight brothcultures were grown in LB with the antibiotic concentrations listed aboveunless otherwise indicated. For allelic exchange mutagenesis, Pseudomo-nas cultures were selected on VBMM (29), supplemented with 50 �g/mlgentamicin for positive selection or 7.5% sucrose for counterselectionwhen needed. For rhamnolipid assays, cultures were grown in tryptic soybroth (TSB) (Difco) supplemented with 1% glycerol.

Genetic manipulations. All cloning techniques were performed usingE. coli DH5� to propagate and maintain plasmids, unless otherwise indi-cated. To make the algR complementation vector, the algR coding regionwas PCR amplified from the PAO1 genome using primers algR-CdgRgn-KpnI-F and algR-CdgRgn-HindIII-R. This PCR product was digestedwith KpnI and HindIII and was ligated into pHERD30T (30) to generatepHERD30T-algR. The pHERD30T-algRD54N vector was generated in asimilar manner using chromosomal DNA extracted from WFPA8 (25).To create pHERD30T-algRD54E, the codon encoding Asp 54 (GAT) inpHERD30T-algR was mutated to Glu (GAA) using primers algR-D54E-XbaI-F and algR-D54E-XbaI-R with a Phusion site-directed mutagenesiskit (New England BioLabs). The mutagenesis was confirmed via restric-tion digest analysis and sequencing. To construct the pHERD30T rhlABvector, the rhlAB genes were amplified from the PAO1 chromosome withprimers rhlAB EcoRI F and rhlAB HindIII R and were subcloned into thepHERD30T vector using the EcoRI and HindIII restriction sites.

The algR12 (algRD54E) allele was introduced into PAO1 or PAO1�algZ by the following method. The algR open reading frame (ORF) wasamplified from pHERD30T-algRD54E using primers algRSalIF and algR-CdgRgn-HindIII-R and was subcloned into the pEX18Gm suicide vector(31), creating pEX18Gm algRD54E. Allelic exchange was performed asdescribed previously (31). The mutation was verified by PCR amplifica-tion of a region spanning algZ, algR, and part of hemC, followed by XbaIdigestion, as well as by DNA sequencing.

The fimU::lacZ transcriptional fusion was created by ligating a 609-bpPCR product amplified from the PAO1 chromosome with the primer paircomprising fimU TF XbaI and fimU TFR HindIII into mini-CTX-1 lacZto generate CTX-1 fimU::lacZ. The rhlA::lacZ transcriptional fusion wascreated by PCR amplifying 980 bp of the promoter region using theprimer pair comprising rhlA TF BamHI F and rhlA TF PstI R to generateCTX-1 rhlATF::lacZ. The CTX-1 fimU::lacZ or CTX-1 rhlATF2::lacZ plas-mid was transferred to the plasmid mobilization strain Sm10 and wasbiparentally conjugated into P. aeruginosa strains. The vector backbonewas resolved by introducing the pFLP2 vector into the strains containingCTX-1 fimU::lacZ or CTX-1 rhlATF2::lacZ and was verified by PCR. Toconstruct the AlgR protein expression plasmids, the algR, algR12(algRD54E), or algR7 (algRD54N) allele was PCR amplified using primersalgRSalIF and algRNotIR and was directionally subcloned into thepGEX4T-3 vector (GE Healthcare Life Sciences), generating plasmidpGEX4T-3algR, pGEX4T-3algRD54E, or pGEX4T-3algRD54N.

Expression studies. Transcriptional expression of the fimU and rhlApromoters was measured by a �-galactosidase assay as described previ-ously (28, 32), with modifications. Cells were lysed using a sonic dismem-brator (15 W) in breaking buffer (200 mM Tris HCl, 200 mM NaCl, 2%glycerol, 1 mM dithiothreitol [pH 7.6]). An 800-�l volume of Z-buffer (60mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4·7H2O, 50mM 2-mercaptoethanol [pH 7.0]) was mixed with 10 �g of total protein,and 200 �l of o-nitrophenyl-�-D-galactopyranoside (ONPG) solution (4mg/ml) was added to initiate the reaction. Kinetic readings were measuredas the optical density at 420 nm (OD420). The activity was expressed inmicrounits per milligram, where 1 U was defined as the enzymatic activityof �-galactosidase to convert 1 �mol ONPG to o-nitrophenol per min(33). Each strain was tested with at least three biological replicates.

For real-time PCR analysis, total RNA was extracted from culturesusing RNeasy spin columns (Qiagen) and was treated with DNase I (NewEngland BioLabs). cDNA was generated using SuperScript II reversetranscriptase (Invitrogen Life Science Technologies). Real-time PCRswere conducted in a LightCycler 480 instrument with LightCycler 480Probes Master Mix (Roche Applied Science), and rhlA and rpoD tran-scripts were analyzed using appropriate primer pairs (Table 2). Data wereanalyzed using LightCycler 480 software, release 1.5.0 (Roche AppliedScience). Relative expression was normalized to rpoD cDNA levels in eachsample.

For AlgR protein expression, 100-ml flasks were inoculated with 5.7 �106 to 7.5 � 106 CFU. Collected cells were sonicated in phosphate-buff-ered saline (PBS) and were centrifuged (5 min, 16,000 � g) to pellet celldebris. Denatured samples were separated by SDS-PAGE. Separated pro-teins were transferred to a polyvinylidene difluoride (PVDF) membrane(Bio-Rad). Western blotting was performed as described previously (34)with modifications. Duplicate blots were probed either with an anti-AlgRrabbit serum (Open Biosystems) preabsorbed with a cell extract from anovernight culture of PAO1 �algR or with an anti-OmlA antibody (a giftfrom Michael Vasil). A horseradish peroxidase (HRP)-conjugated goatanti-rabbit antibody and the ECL kit (GE Healthcare) were subsequentlyused to detect AlgR or OmlA proteins using chemiluminescence-basedimmunodetection. Blots were imaged with the ChemiDoc XRS system,and band intensities were quantified using Image Lab, version 2.0.1 (Bio-Rad), from biological replicates of three different time courses.

Purification of AlgR, AlgR D54N, and AlgR D54E. The pGEX4T-3algR, pGEX4T-3algRD54N, and pGEX4T-3algRD54E vectors weretransformed into BL21 Rosetta cells (Novagen) and grown in LB supple-mented with antibiotics. Cells were grown at 37°C until cultures reachedan OD600 of 0.48, and protein expression was induced with 0.5 mM iso-propyl-�-D-thiogalactopyranoside (IPTG) for 4 h at 15°C. Cells were cen-trifuged (30 min, 8,000 � g) and were lysed in PBS containing 1 mMphenylmethylsulfonyl fluoride (PMSF) in a French pressure cell. Cell ex-tracts were treated with 30 U/ml DNase, 1 mg/ml lysozyme, and Haltprotease inhibitor (Thermo Scientific), centrifuged, and passed through a0.2-�m-pore-size GD/X PVDF filter (Millipore), and supernatants con-

Okkotsu et al.

5500 jb.asm.org Journal of Bacteriology


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

taining soluble glutathione S-transferase (GST)-AlgR fusion protein werebound to glutathione-Sepharose beads (GE Healthcare Life Sciences).Beads were fitted into a gravity column and were washed with PBS. TheAlgR protein was cleaved from the GST tag with thrombin (10 U/mlcolumn volume) for 18 h (GE Healthcare Life Sciences) before elutionwith PBS. All fractions were tested for protein expression and contamina-tion by resolution on an SDS-PAGE gel and Coomassie blue staining (seeFig. S2 in the supplemental material). PBS was immediately replaced withstorage buffer (20 mM Tris, 100 mM NaCl, 5 mM MgCl2, 10% glycerol

[pH 7.5]) using a stirred ultrafiltration cell (Millipore), and protein ali-quots were stored at �80°C.

AlgR biochemical studies. Electrophoretic mobility shift assays(EMSAs) were performed using purified AlgR proteins, as described pre-viously (35). DNA fragments were prepared by PCR amplification ofPAO1 chromosomal DNA with Taq polymerase (New England BioLabs)and the oligonucleotides listed in Table 2 for fimU and rhlA. Oligonucle-otides were 5=-end labeled with [-32P]ATP (6,000 Ci/mmol) (Perkin-Elmer) with polynucleotide kinase (New England BioLabs). Excess radio-

TABLE 1 Strains and plasmids used in this study

Strain or plasmid DescriptionReference orsource

P. aeruginosa strainsPAO1 Wild-type lab stock 90PSL317 �algR 51PAO1 algRD54E algR12 (or algRD54E), encoding AlgR D54E This studyWFPA8 algR7 (or algRD54N), encoding AlgR D54N 25PAZ-1 �algZ 26PAZ algRD54E �algZ algR12 This studyPAO1A pilA::Tc Daniel HassettPAO1C fliC::Gm Daniel HassettPAO1 �rhlA �rhlA Michael VasilPDO111 rhlR::Tn501 91PAO1 rhlA::lacZ rhlA::lacZ (in attB site) This studyPSL317 rhlA::lacZ �algR rhlA::lacZ (in attB site) This studyPAO1 algRD54E rhlA::lacZ algR12 rhlA::lacZ (in attB site) This studyWFPA8 rhlA::lacZ algR7 rhlA::lacZ (in attB site) This studyPAZ rhlA::lacZ �algZ rhlA::lacZ (in attB site) This studyPDO111 rhlA::lacZ rhlR::Tn501 rhlA::lacZ (in attB site) This studyPAO1 rhlI::lacZ rhlI::lacZ (in attB site) 28PSL317 rhlI::lacZ �algR rhlI::lacZ (in attB site) 28PAO1 algRD54E rhlI::lacZ algR12 rhlI::lacZ (in attB site) This studyPAO1 algRD54N rhlI::lacZ algR7 rhlI::lacZ (in attB site) This study

E. coli strainsDH5� F� 80dlacZ�M15 �(lacZYA-argF)U169 deoR recA1 endA1 hsdR17(rK

� mK�) phoA supE44

�� thi-1 gyrA96 relA1Lab strain

Sm10 thi-1 thr leu tonA lacY supE recA::RP4-2-Tc::Mu Lab strainBL21 Rosetta F� ompT hsdSB(rB

� mB�) gal dcm pRARE2 (Cmr) Novagen

PlasmidspGEM-T Easy PCR product cloning vector PromegapEX18Gm Suicide cloning vector; Gmr 31pEX18Gm algRKO algR deletion vector; Gmr This studypEX18Gm algRD54E algRD54E allelic replacement vector; Gmr This studypEX18Gm algRD54N algRD54N allelic replacement vector; Gmr This studypHERD30T pBAD-based Pseudomonas expression vector; Gmr 30pHERD30T algR algR in pHERD30T; Gmr This studypHERD30T algRD54N algRD54N in pHERD30T; Gmr This studypHERD30T algRD54E algRD54E in pHERD30T; Gmr This studypHERD30T rhlAB rhlAB in pHERD30T; Gmr This studypGEX4T-3 GST fusion expression vector; Ampr GE Healthcare Life

SciencespGEX4T-3 algR algR in pGEX4T-3; Ampr This studypGEX4T-3 algRD54N algRD54N in pGEX4T-3; Ampr This studypGEX4T-3 algRD54E algRD54E in pGEX4T-3; Ampr This studyMini-CTX-1 attB site chromosomal integration vector 92Mini-CTX-1 lacZ attB site chromosomal integration vector with promoterless lacZ This studyCTX-1 fimU::lacZ fimU promoter cloned into mini-CTX-1 lacZ This studyCTX-1 rhlA::lacZ rhlA promoter cloned into mini-CTX-1 lacZ This studypFLP2 Source of FLP recombinase; Ampr 31pRK2013 Tra� Mob� ColE1 replicon; Kmr 93

AlgR Phosphorylation Modulates Rhamnolipids

December 2013 Volume 195 Number 24 jb.asm.org 5501


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

nucleotide was removed with Illustra Microspin G-25 columns (GEHealthcare). The templates for the rhlA�1 (primers rhlA SDM delta RB1F and rhlA SDM WT RB2R), rhlA�2 (primers rhlA SDM WT RB1 F andrhlA SDM delta RB2R), and rhlA�1�2 (primers rhlA SDM delta RB1 Fand rhlA SDM delta RB2R) oligonucleotides were created using site-di-rected mutagenesis of the pGEMT-rhlAprom vector. Purified AlgR pro-tein was preincubated for 30 min at 37°C with nonradioactive acetyl phos-phate (acetyl phosphate lithium potassium salt; Sigma) at theconcentrations indicated in Fig. 2 prior to DNA binding studies.

Binding assays were performed as described previously (35) with thefollowing modifications. Binding reaction mixtures were supplementedwith 2.5 ng/�l poly(dI·dC) (Sigma-Aldrich). Samples were loaded in anative 6.5% polyacrylamide gel (10 mM Tris [pH 8.0], 0.38 mM glycine, 1mM EDTA, 6.5% [2.67% bisacrylamide] acrylamide), applied to either aphosphor screen or Kodak film, and imaged using Molecular Imager FXand Quantity One software (Bio-Rad).

Motility assays. Subsurface twitching motility assays were performedas described previously (36). Briefly, overnight cultures were inoculated inthe interstitial space between the plastic petri dish and the basal surface ofLB–1.0% Bacto agar and were incubated for 48 h at 37°C. Cultures werestained with 0.5% crystal violet, and the diameter of the twitching zonewas measured. Surface twitching motility assays were performed as de-

scribed previously (37, 38). Cultures were grown in brain heart infusion(BHI) medium (Difco) to an OD600 of 1.2 and were concentrated to 9 �109 cells/ml in morpholinepropanesulfonic acid (MOPS) buffer (10 mMMOPS, 8 mM MgSO4 [pH 7.6]). A 2.5-�l volume of the suspension wasspotted onto buffered twitching motility plates (10 mM Tris, 8 mMMgSO4, 1 mM NaPO4, 0.5% glucose [pH 7.6], solidified with 1.5% Bactoagar) and was incubated at 37°C for 24 h under 5% O2 (HERAcell 150;Thermo Scientific). The twitching zone was imaged using a digital cameraand an Axiovert 25 inverted light microscope at �100 magnification (10�phase-contrast objective lens and 10� optical eyepiece) (Carl Zeiss).Swarming motility was measured as described previously (39). Briefly,stationary-phase cultures were concentrated by centrifugation and wereadjusted to an OD600 of 3.0 in PBS. Five microliters was spotted onto thecenter of modified M9 medium agar (20 mM NH4Cl, 12 mM Na2HPO4,22 mM KH2PO4, 8.6 mM NaCl, 1 mM MgSO4, 1 mM CaCl2·2H2O, 11mM dextrose, 0.5% Casamino Acids, solidified with 0.5% Bacto agar),and cultures were grown for 10 h at 30°C, followed by 20 h at roomtemperature. For arabinose induction, volumes from a 20% stock solu-tion of L-arabinose were added to swarming plates prior to solidifying.Swimming motility assays were performed using 0.3% agar as the solidi-fying agent. Swarming and swimming plates were imaged with the Chemi-

TABLE 2 Primers and probes used in this study

Primer name 5=¡3= sequencea Gene(s)

algR-CdgRgn-KpnI-F TATCCGGTACCGTGACTCATGCAGGAAGCC algRalgR-CdgRgn-HindIII-R CCGCCGAAAGCTTTCAGAGCTGATGCATCA algRalgRSalIF CCTGTCGACATGAATGTCCTGATTGTCGATGAC algRalgRNotIR AGCCGCGGCCGCTCAGAGCTGATGCATCAGACG algRalgR-D54E-XbaI-F CTTCTAGAAATCCGCATGCCCGG algRalgR-D54E-XbaI-R CGGATTTCTAGAAGGACGATATC algRfimU TF XbaI CATGGTCTAGAGGTCGCAGAGAGC fimUfimU TFR HindIII CTCCAAGCTTTCTACGCCTGG fimUfimU gs frag F GGGGTCTACGCCTGGAAAGC fimUfimU gs frag R GTTGTCCTGCCCCTCGGGCCG fimUpscF GS ContF AAGGCGGTCTCGGCATTCTTTC pscEFpscF GS Cont R93 CCACGGTATCGAGGGTATTC pscEFrhlA TF BamHI F GGACGGATCCCATGACCATCAAATCG rhlArhlA TF PstI R CGAACCTGCAGACAGCTATCGCT rhlArhlA qRT F TTTCACATCGACCAGGTGC rhlArhlA qRT R CGAGACCGTCGGCAAATAC rhlArhlA qRT probe 56-FAM-ATGTGCTGA-ZEN-TGGTTGCTGGCTTTC-3IABKFQ rhlArpoD qRT F GGGCGAAGAAGGAAATGGTC rpoDrpoD qRT R CAGGTGGCGTAGGTGGAGAA rpoDrpoD qRT probe 56-FAM-TGAAGGCGG-ZEN-TGGACAAGTTCGAAT-3IABKFQ rpoDrhlA gs frag 1F GATTCGCGATCATTTTTCGCAGCT rhlArhlA gs frag 1R CACGTCGTAGCCGTAGCTGGACAC rhlArhlA gs frag 2F GTGTCCAGCTACGGCTACGACG rhlArhlA gs frag 2R GTTCGGCGGGATGATGCAGACGTCG rhlArhlA gs frag 3F CGACGTCTGCATCATCCCGCCGAAC rhlArhlA gs frag 3R CGTAGATCTTCGCCGGCAGGTTG rhlArhlA gs frag 4F CCAACCTGCCGGCGAAGATCTACG rhlArhlA gs frag 4R GTTTCCGGTGTCGAAACGCTCTG rhlArhlA gs frag 5F CAGAGCGTTTCGACACCGGAAAC rhlArhlA gs frag 5R CAAACGATTGGCGTCCGTGTTCACG rhlArhlA gs frag 6F CGTGAACACGGACGCCAATCGTTTG rhlArhlA gs frag 6R CGCGCCGCATTTCACACCTCCC rhlArhlA SDM WT RB1 F GCATGATCGAGCCGTTCGTCGAGCGCCAG rhlArhlA SDM delta RB1 F GCATGATCGAGCCATTTGTAGAGCGCCAG rhlArhlA SDM WT RB2 R CTCGATCATGCCGTGCTCCTGAGCCATGC rhlArhlA SDM delta RB2 R CTCGATCATTCCATGTTCTTGAGCCATGC rhlArhlAB EcoRI F GAGGAATTCGATGCGGCGCGAAAGTC rhlABrhlAB HindIII R CAAGCTTTCAGGACGCAGCCTTCAGC rhlABa 56-FAM, 5(6)-carboxyfluorescein; 3IABKFQ, 3= Iowa Black FQ.

Okkotsu et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

Doc XRS system (Bio-Rad), and the image contrast was adjusted usingPhotoshop, version 10.0 (Adobe).

Rhamnolipid assays. Rhamnolipid production was determined usingthree different assays: (i) an orcinol assay, (ii) thin-layer chromatography(TLC), and (iii) a hemolysis assay, as described previously (28, 40–43). Toquantify the amount of rhamnolipid produced by each strain, the orcinolrhamnolipid assay was used (28, 42, 44). Bacterial cultures were grown at37°C with shaking at 250 rpm in beveled flasks. Briefly, a 1-ml volume ofsamples was then collected and was centrifuged. Rhamnolipids were ex-tracted from cell supernatants three times with 0.5 ml ethyl acetate. Afterethyl acetate extraction, 1 ml of orcinol reagent (53% sulfuric acid, 0.2%orcinol) was added. Samples were first incubated at 80°C for 30 min andthen cooled at room temperature for 15 min. Two hundred microliters ofeach sample was then added to a 96-well plate, and the absorbance at 522nm was recorded by a Synergy 2 plate reader and was compared with astandard curve of rhamnose monohydrate. Total-rhamnolipid valueswere normalized to total-protein values of cell pellets measured by a Brad-ford assay.

TLC was performed as described previously (43). Briefly, samples wereextracted as described for the orcinol assay. Ethyl acetate extracts werecompletely dried and were resuspended in 20 �l of 90% chloroform and10% methanol. A 5-�l volume was added to a silica gel 60A thin-layerchromatography plate (Whatman) and was mobilized in a solvent systemcontaining chloroform–methanol–acetic acid (65:15:2). The plate was in-cubated in a bath of 15% sulfuric acid in ethanol and was developed witha heat gun.

The hemolysis assay was performed as described previously, with amodification for 96-well plates (45). Horse blood in Alsever’s solution(Colorado Serum Company) was washed three times with PBS prior touse. Bacterial supernatants were obtained from 1 ml of 24-h culturesgrown at 37°C, which was centrifuged for 5 min at 16,000 � g to pellet cellsand separate supernatants. The supernatants were heat treated at 95°C for10 min, cooled, and serially diluted. Diluted supernatants were applied toa final blood concentration of 1% (vol/vol). PBS and water were used asnegative and positive controls, respectively. Hemolysis reaction mixtureswere incubated for 1 h at 37°C, and solubilized hemoglobin was separatedfrom cell debris by centrifugation (10 min, 750 � g). Supernatants weretransferred to new 96-well plates, and the absorbance of free hemoglobinwas read as the OD542. The percentage of hemolysis was calculated as[(absorbance of the sample � absorbance of the blank)/absorbance of thepositive control] � 100.

RESULTSP. aeruginosa fimU expression increased in PAO1 algRD54E. Inorder to elucidate the role of AlgR phosphorylation in P. aerugi-nosa, a phosphomimetic form of AlgR was constructed for com-parison with an inactive, phosphodefective form of the protein inthe PAO1 background. In previous studies with NtrC from Sal-monella enterica, OmpR and RcsB from E. coli, and HupR fromRhodobacter capsulatus, a substitution of glutamate for the phos-phoaccepting aspartate residue (D¡E), located in the CheY-likeREC domain, resulted in constitutive activation of the responseregulators by mimicking the structure of the phosphoaspartylform of the proteins (27, 46–49).

Transcription of the fimU operon was previously found to bedependent on the AlgR protein, and a strain expressing a phos-phodefective form of AlgR (AlgR D54N) was incapable of express-ing the genes in the operon and had abrogated twitching motility(25, 50, 51). These results indicate that the phosphoaccepting as-partate of AlgR is located at residue 54 (25). Since AlgR phosphor-ylation is required for fimU expression (25, 50, 51), a chromo-somal fimU::lacZ reporter was constructed in order to determine ifthe algRD54E mutation expressed the phosphomimetic form of

AlgR. It was hypothesized that AlgR D54E would activate tran-scription, while AlgR D54N would not.

By use of site-specific recombination via allelic exchange, thealgR12 allele (encoding AlgR D54E, and therefore referred to hereas the algRD54E allele) was introduced into the PAO1 chromo-some to create PAO1 algRD54E (Fig. 1A). To study the effects ofstrains expressing different forms of AlgR, the fimU::lacZ tran-scriptional reporter was introduced into backgrounds containingthe following alleles: algR� (PAO1), �algR (PSL317), algR7 (en-coding AlgR D54N, and therefore referred to here as algRD54N)(WFPA8), or algRD54E (PAO1 algRD54E). The transcriptionalactivity of fimU in strains PAO1 �algR and PAO1 algRD54N wasgreatly decreased, whereas activity from the same promoter instrain PAO1 algRD54E showed a 15-fold increase over that inPAO1 (Fig. 1B). These data again supported the hypothesis thatAlgR D54E activated the transcription of the fimU promoter. Itwas also hypothesized that AlgR D54E should be a phosphomi-metic in the absence of its putative cognate histidine kinase, AlgZ(FimS). In order to test this hypothesis, the algRD54E allele wasintroduced into the �algZ background to create strain PAZalgRD54E (�algZ algRD54E). As shown in Fig. 1B, fimU::lacZ re-porter activity was significantly increased (36-fold) in the �algZalgRD54E background.

In order to eliminate the possibility that the fimU promoteractivities in PAO1 algRD54E and PAZ algRD54E were due to ele-vated protein expression, Western blot analysis was performedusing a polyclonal anti-AlgR antibody to measure AlgR expressionlevels. AlgR protein levels for the algR�, algRD54E, and �algZbackgrounds were comparable, and a slightly smaller amount wasexpressed in the algRD54N strain than in the wild type (WT).Unexpectedly, strain PAZ algRD54E did show a significant in-crease in AlgR protein expression over that in wild-type PAO1(Fig. 1C and D). This increased protein expression may explainthe large increase in fimU::lacZ transcriptional activity in this mu-tant. Overall, these results indicated that AlgR D54E was mostlikely locked in the phosphomimetic conformation in vivo andactivated the fimU promoter independently of phosphorylation.

Acetyl phosphate phosphorylated AlgR but not AlgR D54Eor AlgR D54N. It was then proposed that the increased fimU tran-scriptional activity observed in the strain expressing AlgR D54Ewas due to the recombinant protein being locked in the activeconformation. Previously, AlgR autophosphorylated in the pres-ence of acetyl phosphate (AcP) and carbamoyl phosphate (24).Additionally, previous studies showed that phosphorylation isspecific to the aspartate residue (D54), where E. coli CheA acted asa histidine kinase to phosphorylate AlgR, but not AlgR D54N,with [-32P]ATP as the phosphate donor (25). However, thephosphomimetic AlgR D54E has not been tested to date, and itsphosphoaccepting capacity was examined using AcP.

In order to examine the autokinase properties of AlgR or itsisoforms for the in vitro studies, all three proteins were overex-pressed and purified in E. coli, using a GST-tagged expressionsystem (see Fig. S1A in the supplemental material). An in vitrophosphorylation reaction was then performed as previously de-scribed (52); it showed that only wild-type AlgR, and not AlgRD54E or AlgR D54E, was phosphorylated by radiolabeled[32P]AcP generated (see Fig. S2 in the supplemental material).These data indicated that only wild-type AlgR was phosphorylatedin vitro by the phosphodonor AcP and that Asp 54 was required forthe phospholabeling.




http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

Phosphorylated AlgR and AlgR D54E bound specifically tothe fimU promoter. The transcriptional activity of fimU::lacZ inthe presence of AlgR D54E was higher than that with wild-typeAlgR (Fig. 1 and data not shown). Therefore, it was hypothesizedthat AlgR-P (in vitro-phosphorylated AlgR) or AlgR D54E wouldhave DNA binding characteristics different from those of AlgR. Inorder to test this hypothesis, electrophoretic mobility shift assays(EMSAs) were performed. Previous studies on the binding ofAlgR to the fimU promoter showed the presence of two AlgR bind-ing sites (ABSs) within the intergenic region of fimT and fimU(50). Therefore, an 82-bp fimU promoter fragment containingboth of the AlgR binding sites identified was tested for the effect ofincreasing amounts of AcP on the binding of AlgR to this fimUpromoter fragment (Fig. 2A). Elevating the molar ratio of AcP toAlgR increased AlgR binding (Fig. 2B, lanes 3 to 8), where a 20:1molar ratio was the minimum ratio required for binding (Fig. 2B,

lane 6). The interaction of AlgR-P with fimU DNA was specific,since the addition of unlabeled fimU DNA significantly decreasedthis interaction (Fig. 2B, lanes 9 to 12), and AlgR-P did not bind tothe pscEF promoter (Fig. 2C, lanes 11 to 13). These results indi-cated that AlgR-P might have a higher affinity for fimU DNA thanunphosphorylated AlgR.

Next, the binding of AlgR to fimU DNA was compared withthat of AlgR-P. Based on empirical evidence that a 20� excess ofAcP was required for binding (Fig. 2B), we performed bindingassays with a 500� molar excess of AcP. As shown in Fig. 2C, lanes6 to 9, AlgR pretreated with AcP (AlgR-P) showed a higher level ofbinding than AlgR by itself (Fig. 2C, lanes 2 to 5). This resultsupported the hypothesis that phosphorylation directly affectedthe affinity of AlgR for the fimU promoter DNA. At higher pro-tein/DNA ratios, an additional band was detected above theprominent main band (Fig. 2C, lane 9). The concentrations of

FIG 1 AlgR D54E increased fimU transcription. (A) Diagram showing the genotypes of the following strains: PAO1 (algR�), PSL317 (�algR), WFPA8(algRD54N), PAO1 algRD54E, PAZ (�algZ), and PAZ algRD54E (�algZ algRD54E). The dashed regions represent the deletion of the gene indicated. (B) Thestrains diagramed in panel A were tested for fimU transcriptional activity. Strains contained a fimU::lacZ transcriptional reporter in the chromosomal attB locus.�-Galactosidase activities from 21-h LB cultures grown at 37°C were assayed. Significant differences from the wild type by Student t tests are indicated (***, P 0.001). Results are means for three replicates. (C) Western blotting was performed using AlgR- and OmlA-specific antibodies. Sixteen-hour cultures of strainswithout fusion reporters were grown in LB at 37°C and were normalized to equivalent CFU/ml. Cells were sonicated, and proteins were separated by SDS-PAGE.(D) AlgR protein levels of strains relative to those of wild type were quantified by measuring the intensities of the Western blot bands, normalized to OmlA, asdescribed in Materials and Methods. Results were compared with those for the wild type by one-way analysis of variance with the Bonferroni posttest. N.D., notdetermined; n.s., not significant. Asterisks indicate P values of 0.05 to 0.01 (*) or 0.01 to 0.001 (**). Results are means from three replicates.

Okkotsu et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

FIG 2 Phosphorylated AlgR and AlgR D54E bound to the fimU promoter. The effect of in vitro phosphorylation of AlgR on binding to an 82-bp fimU DNAfragment was compared with the binding of purified AlgR D54N or AlgR D54E using EMSA. (A) Diagram of the 82-bp fragment used in EMSAs and its locationwithin the fimT-fimU intergenic region. (B) Increasing amounts of the phosphate donor, AcP, were added to the AlgR protein in order to determine the effect ofphosphorylation on DNA binding. Wild-type AlgR protein was pretreated with AcP for 30 min prior to binding reactions. Lanes 1 to 8, fimU DNA alone (lane1) or in the presence of AlgR without AcP (lane 2) or with increasing concentrations of AcP (lanes 3 to 8). Lanes 9 to 12, the AlgR-P–DNA complex was competedwith the addition of nonradiolabeled fimU DNA. (C) Phosphorylated AlgR protein was compared with untreated AlgR for DNA binding. Purified AlgR proteinwas pretreated either with water only or with AcP (500� molar excess of protein) prior to binding reactions. Lanes 1 to 10, fimU DNA incubated with a no-proteincontrol (lane 1), increasing concentrations of AlgR (lanes 2 to 5) or AlgR-P (lanes 6 to 9), or 5 mM AcP only (lane 10). Lanes 11 to 13, 5 nM pscEF DNA incubatedwith a no-protein control (lane 11), 2.5 �M AlgR (lane 12), or 2.5 �M AlgR-P (lane 13). (D) Purified AlgR D54N or AlgR D54E protein was tested for bindingto fimU DNA. Lane 1, no-protein control; lanes 2 to 5, increasing concentrations of AlgR D54N; lanes 6 to 9, increasing concentrations of AlgR D54E (lanes 6 to9). Open arrowheads, unbound DNA; filled arrowheads, AlgR-DNA complexes. All concentrations given in the figure are final binding reaction concentrations.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

AlgR or AlgR-P that bound to fimU DNA did not bind to thenonspecific pscEF control DNA (Fig. 2C, lanes 11 to 13), indicat-ing that the interaction of AlgR with fimU DNA was specific.

In order to verify that the AlgR isoforms AlgR D54E and AlgRD54N mimicked phosphorylated and unphosphorylated AlgR, re-spectively, these purified proteins were tested on the same fimUpromoter fragment used in the experiments described above. Asshown in Fig. 2D, AlgR D54E had higher affinity for DNA thanAlgR D54N. Interestingly, the AlgR D54E protein did not form ahigher-order shift (Fig. 2D, lane 9) such as that observed forAlgR-P (Fig. 2C, lane 9).

We further characterized the melting temperatures of the AlgRD54E and AlgR D54N isoforms in order to determine if the Aspmutation had an effect on protein stability. Although both iso-forms displayed a 10°C decrease in melting temperature from thatof wild-type AlgR (see Fig. S1B in the supplemental material), onlythe PAO1 algRD54E strain transcriptionally activated the fimUpromoter (Fig. 1), and AlgR D54E bound the fimU promoter byEMSA (Fig. 2D). In summary, the binding of AlgR to the fimUpromoter was dependent on AlgR phosphorylation, and thestrains expressing the phosphodefective and phosphomimeticAlgR isoforms have potential use in characterizing the role of AlgRphosphorylation in P. aeruginosa.

The twitching motility phenotypes of PAO1 algRD54E andPAO1 were identical. The fimU promoter is upstream of six openreading frames (ORFs) (fimU-pilVWXY1E), which encode prepi-lins and a calcium-dependent retraction protein required for thenormal assembly and function of the type IVa pilus apparatus (36,53–56). Since the expression of the fimU operon directly affectstype IVa pilus function, the twitching motility phenotype in thecontext of the algR and algZ mutants was tested. The wild-type(algR�), �algR, algRD54N, algRD54E, �algZ, and �algZalgRD54E strains were examined for subsurface (Fig. 3A) and sur-face-associated (Fig. 3B) twitching motility. In both assays, thesize of the twitching zone for PAO1 algRD54E was comparable tothat for wild-type PAO1, indicating that despite increased fimUexpression in the algRD54E strain, there was no net effect on nor-mal twitching motility. As expected, the �algR and algRD54Nbackgrounds were defective in twitching motility due to decreasedfimU operon transcription, a finding that corroborated with pre-vious studies (25, 50, 51). Motility was also decreased in the �algZbackground, as predicted (21), since deletion of the cognatehistidine kinase would render intracellular AlgR mostly un-phosphorylated.

It was also considered possible that introduction of thealgRD54E allele into the �algZ background would restore twitch-ing motility. Yet twitching motility was mostly, but not com-pletely, restored in strain PAZ algRD54E, compared to that in thewild type, by the subsurface and surface assays (Fig. 3A and B).Western blots showed a significant increase in AlgR protein ex-pression (Fig. 1C and D), accompanied by a significant increase infimU::lacZ activity (Fig. 1B). Previously, it was shown that theexpression of the genes in the fimU operon is tightly regulated, andoverproduction of any of those genes could contribute to the lossof type IV pilus function (56). Consequently, our observations areconsistent with the view that overexpression of the genes encodedin the fimU operon, and the twitching motility defect observed instrain PAZ algRD54E, may be explained by the 12-fold increase inAlgR protein production (Fig. 1D) and the corresponding 36-foldincrease in fimU expression (Fig. 1A).

AlgR phosphorylation was required for swarming motility.Previously, an algR deletion mutant showed a 4-fold reduction inswarming motility (13, 28). Since twitching motility was affected,the effects of the phosphorylation status of AlgR on swarmingmotility were examined. Deletion of algR or algZ in PAO1 resultedin a swarming phenotype that lacked discernible dendrites (ortendrils) (Fig. 3C). In fact, when the pilA::Tc background wastested, it displayed a phenotype similar to that of the �algR or�algZ background, possibly indicating that AlgR affected swarm-ing motility through its impact on type IV pilus function (Fig. 3C).Swarming motility was also altered in the strain expressing phos-phodefective algRD54N, where the swarming zone was smallerthan that of either the wild-type strain PAO1 or PAO1 algRD54E,with no discernible dendrites. Lastly, PAO1 algRD54E repro-duced the swarming phenotype of the wild-type strain, indicat-ing that the phosphomimetic/phosphorylated form of AlgR isrequired for the swarming phenotype.

Swarming motility is thought also to be coordinated and af-fected by flagellum-mediated motility and the production of bio-surfactants [�-D-(�-D-hydroxyalkanoyloxy)alkanoic acid (HAA),monorhamnolipids, and dirhamnolipids] (14, 15, 57, 58). On theother hand, swimming motility is mediated primarily by a singlepolar flagellum and does not require rhamnolipid production(14). To eliminate the possibility that the defect in swarming mo-tility was due to AlgR- or AlgZ-mediated regulation of flagella,swimming motility assays were performed. Deletion or mutationof algR did not affect swimming motility (see Fig. S3 in the sup-plemental material), indicating that a flagellar defect was not re-sponsible for the peculiar swarming motility phenotypes. Al-though there was a discernible decrease in swimming in the �algZor �algZ algRD54E background, this phenotypic effect was smallcompared to that for the fliC::Gm negative control.

Expression of the rhlA gene decreased in the phosphodefec-tive AlgR background. The results from the swarming and swim-ming motility assays using the algR deletion, phosphodefective,and phosphomimetic mutants suggested that there was a flagel-lum-independent dysregulation of the swarming phenotype in thestrain expressing phosphodefective AlgR (AlgR D54N). Both fla-gella and rhamnolipids, as well as a number of other factors (14,58), are required for the swarming phenotype across many Pseu-domonas strains (59). We observed previously that AlgR repressedrhamnolipid production in the context of a 6-day biofilm (28).Therefore, it is possible that AlgR phosphorylation affects swarm-ing motility through the regulation of rhamnolipid production.

In order to test whether the difference in swarming motilitywas due to AlgR regulation of the genes encoding the rhamnolipidbiosynthesis genes, transcriptional analyses were performed onthe rhlA gene. Previously, AlgR was found to repress the rhlABgenes in a biofilm-specific manner and to exert its regulation spe-cifically at the rhlA promoter (28). The rhlA promoter is also rhlquorum-sensing dependent, activated by the N-butanoyl-L-ho-moserine lactone (C4-HSL)-sensing RhlR regulator (60), and astrain containing a rhlR-null allele was used as a negative controlfor rhlA expression. A transcriptional reporter of the rhlA pro-moter was constructed and placed in the wild-type, �algR,algRD54N, algRD54E, �algZ, or rhlR::Tn501 background (Fig.4A). In addition, RNA was isolated, and rhlA transcript levels weremeasured by quantitative reverse transcription-PCR (qRT-PCR)(Fig. 4B). In agreement with the rhamnolipid production results(see below), rhlA promoter activity was decreased in the

Okkotsu et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

algRD54N or �algZ background strains. As expected, expressionin the rhlR::Tn501 and �rhlA mutants was diminished.

Rhamnolipid production decreased in the phosphodefectiveAlgR background. To test whether rhamnolipid production wasaffected by AlgR phosphorylation, rhamnolipid production wasmeasured in the PAO1 (wild-type) and PAO1 �algR strains and inthe mutant strains expressing the phosphodefective and phospho-mimetic forms of AlgR. Measurements were conducted in threeseparate ways: (i) thin-layer chromatography (TLC) (Fig. 5A), (ii)an orcinol-based colorimetric assay (Fig. 5B), and (iii) a hemolysis

assay (Fig. 5C). Both the TLC and orcinol assays of the corre-sponding cell-secreted supernatants showed lower levels of totalrhamnolipid production in the algRD54N or �algZ backgroundthan in the wild type (Fig. 5A and B). In addition, heat-stablehemolytic activity was abrogated in heat-treated supernatantsfrom the algRD54N or �algZ background (Fig. 5C) (45). In con-trast, strain PAO1 algRD54E was comparable to the wild type in allassays. The �algR background, on the other hand, producedslightly decreased rhamnolipid levels in two of the three quantita-tive measurements. We were also able to replicate these results by

FIG 3 Effects of different algR alleles on twitching and swarming motility. (A) Subsurface twitching motilities were analyzed at 48 h after inoculation in LB–1%agar, and the average diameters of twitching zones were measured. Strains PAO1 (algR�) (WT), PSL317 (�algR), WFPA8 (algRD54N), PAO1 algRD54E, PAZ(�algZ), and PAZ algRD54E (�algZ algRD54E) were analyzed. PAO1A (pilA::Tc) was used as a negative control. Statistical analysis was performed by one-wayanalysis of variance. n.s., not significant; ***, P 0.001. (B) The strains for which results are shown in panel A were tested for surface-associated twitching motilityin a 5% O2 incubator. Bacteria were inoculated onto the surface of M9 minimal medium. Cells were imaged at 24 h postinoculation. Arrows mark the extent ofthe twitching front. Bar, 1 mm. (C) Strains for which results are shown in panels A and B were tested for swarming motility. As additional controls, PAO1 �rhlAand PAO1C (fliC::Gm) were examined. Bar, 1 cm.




http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

measuring rhamnolipid production in a colorimetric plate assay(cetyltrimethylammonium bromide [CTAB]/methylene blue as-say) (data not shown). These data support the hypothesis thatAlgR phosphorylation is required for full production of rhamno-lipids.

Phosphorylated AlgR bound differentially to the rhlA pro-moter. Because the phosphomimetic and phosphodefective AlgRmutants showed effects on rhamnolipid production, the questionof whether phosphorylation of AlgR might alter its binding to therhlA promoter was considered. AlgR has been shown previously tobind a DNA fragment spanning positions �804 to �622 relativeto the transcriptional start site (Fig. 6A, fragment 1, AlgR bindingsite 1), with specific binding to a 9-bp consensus sequence found702 bp upstream of the transcriptional start site. A second bindingsite was also discovered previously by homology, but purifiedAlgR did not bind to this site (28). Due to the apparent distancebetween the rhlA transcriptional start site and the AlgR bindingsites, EMSAs were performed to determine if additional AlgRbinding sites exist within the rhlA promoter. Six rhlA promoterfragments, spanning 1.1 kb, were PCR amplified and radiolabeled(Fig. 6A). Both AlgR and phosphorylated AlgR (AlgR-P) displayedbinding to fragment 1 (Fig. 6B and C), and phosphorylated AlgR(AlgR-P) displayed binding to fragment 5 (Fig. 6B and E).

rhlA fragment 1 was further examined using a range of concen-trations of AlgR or AlgR-P (Fig. 6C). Phosphorylated AlgR dis-played a third bound form (Fig. 6C, top black arrow) not observedwith the nonphosphorylated form of the protein (AlgR-P versusAlgR, Fig. 6C). This result was also recapitulated with the AlgRD54N and AlgR D54E isoforms (data not shown). These resultssuggest cooperativity between multiple binding sites within thefragment tested. In order to dissect these binding characteristicsfurther, either one or both of the AlgR binding sites were mutated(Fig. 6D). Deletion of the highly conserved AlgR binding site 1resulted in decreased AlgR affinity for the DNA fragment, whileAlgR-P was still able to bind (Fig. 6D, �1). Deletion of both bind-ing sites (�1�2) resulted in loss of binding altogether, indicatingthat AlgR binding site 2 is a possible binding site only in the pres-ence of AlgR-P. However, mutation of AlgR binding site 2 (�2)did not affect binding, corroborating previous results suggestingthat this may not be a binding site (28). Additionally, a fragment

proximal to the transcriptional start site of rhlA (�192 to �36relative to the transcriptional start site) resulted in protein bind-ing. AlgR-P displayed higher affinity than AlgR for fragment 5DNA (Fig. 6B and E). These results suggest that multiple bindingsites may be involved in regulating the rhlA promoter, which de-pends on the phosphorylation-dependent affinity of the AlgR pro-tein.

Expression of rhlAB restored the swarming motility pheno-type in the algRD54N background. Based on the observationsthat the strain expressing algRD54N had a defective swarmingmotility phenotype and decreased rhamnolipid production undera range of conditions, we examined whether the swarming motil-ity defect was due to its decreased rhamnolipid production.Therefore, a vector containing the rhlAB genes with an arabinose-inducible promoter was constructed. The pHERD30T orp30TrhlAB vector was cloned into the �rhlA or algRD54N back-ground. As shown in Fig. 7A, induction with increased arabinoseconcentrations was associated with increased rhamnolipid pro-duction in the �rhlA background by TLC (Fig. 7A, lanes 3 to 5).The addition of 0.5% arabinose to the algRD54N background har-boring p30TrhlAB increased the production of monorhamnolip-ids (Fig. 7A, lane 7) over that with no arabinose (Fig. 7A, lane 6).

Because rhamnolipid production was restored by the expres-sion of the rhlAB genes, swarming motility was tested in the PAO1�rhlA background containing the p30T rhlAB vector. Increasedamounts of arabinose in the M9 medium restored the dendritesand the swarming motility for the �rhlA strain harboring p30TrhlAB, but not for the �rhlA strain carrying the empty-vector con-trol (Fig. 7B). Additionally, swarming motility was restored in thealgRD54N background harboring p30T rhlAB, but not for thesame strain harboring the vector alone (Fig. 7C). The dendriteswere again restored with increased concentrations of arabinose,supporting the hypothesis that a defect in rhamnolipid produc-tion contributes to the swarming motility defect observed in thealgRD54N background.

DISCUSSION

Phosphomimics have not yet been tested in response regulatorscontaining the AlgR/AgrA/LytR family of DNA binding domains.As summarized and suggested by Smith et al. (61), we replaced the

FIG 4 AlgR phosphorylation was required for maximal rhlA gene expression. (A) Strains contained a rhlA::lacZ transcriptional reporter in the chromosomal attBlocus. �-Galactosidase activities were assayed from 10-h cultures grown in TSB plus 1% glycerol at 37°C. Data are means from three replicates. (B) qPCR of rhlAgene expression in cultures (without reporter fusion) grown for 10 h at 37°C in LB. Total RNA was isolated and reverse transcribed to cDNA, and the amountsof rhlA transcripts were standardized to the amounts of rpoD transcripts. Results are fold differences from rhlA expression in wild-type PAO1 and are means fromfour replicates. Statistical analyses were performed by one-way analysis of variance. n.s., not significant. Asterisks indicate P values of 0.05 to 0.01 (*), 0.01 to 0.001(**), or 0.001 (***).

Okkotsu et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

phosphoaccepting aspartate (Asp 54) in the REC domain in AlgRwith a glutamate (D¡E) to create a phosphomimetic AlgR iso-form. We utilized the fimU promoter and the correspondingtwitching motility phenotype as functional readouts for AlgRD54E (phosphomimetic) or AlgR D54N (phosphodefective) ac-tivity. The expression of the algRD54E allele from a plasmid (datanot shown) or in a single copy from the chromosome (Fig. 1B)activated fimU promoter transcription and displayed wild-typetwitching motility (Fig. 3A and B). Conversely, the PAO1 �algZand PAO1 algRD54N strains had decreased fimU transcriptionalactivity (Fig. 1B) and abrogated twitching motility (Fig. 3A and B).FimU, PilV, PilW, PilX, and PilE are required for surface piliationand most likely interact with PilA to stabilize the pilus fiber (56).Our results supported previous observations that phosphorylatedAlgR is required for the expression of the fimU-pilVWXY1Eoperon and normal twitching behavior (25, 50).

Furthermore, we showed that AlgR D54E activity was indepen-dent of the histidine kinase AlgZ. The �algZ algRD54E back-ground activated fimU promoter activity (Fig. 1B) and twitchingmotility in vivo (Fig. 3A and B). This idea was supported in vitro,where AlgR D54E (or AlgR D54N) could not be phosphorylatedwith radiolabeled acetyl phosphate (see Fig. S2A in the supple-mental material). There was a 12-fold increase in AlgR D54E pro-tein expression in the �algZ algRD54E background (Fig. 1D),which potentially explains the elevated fimU reporter activity (Fig.1B). We now know the reason for elevated AlgR expression in thisbackground. The rationale for deleting the algZ region, as noted inthe discussion of Fig. 1A, was to avoid affecting the previouslyidentified transcriptional start sites/promoters for algR. It is pos-sible that this mutation, in combination with the algRD54E allele,increased AlgR expression. A proper stoichiometric expression ofthe minor pilins is essential for the formation of pilus strands andfor functional twitching motility (56). The increased amounts ofAlgR D54E resulting in the 36-fold elevation of fimU expressionwould likely disrupt the function of the type IVa pilus complexand result in the aberrant twitching motility phenotype observedfor the �algZ algRD54E strain (Fig. 3A and B). It was noted pre-viously that overexpression of individual pilins in their respectivepilin deletion backgrounds abrogated twitching motility but thatoverexpression of individual pilins in a wild-type strain expressingthe fimU-pilVWXY1Y2E genes showed only a modest decrease intwitching (56). Our result with PAZ algRD54E is agreement withthis observation, since this strain retains the fimU operon genes.Taken together, these results are in agreement with previous ob-servations for other organisms with different response regulators,where an aspartate-to-glutamate mutation results in activation ofOmpR D55E (48), NtrC D54E (27, 49), and RcsB D56E (47) attheir target promoters in a kinase-independent manner.

We provided evidence that AlgR phosphorylation appears tomodulate rhamnolipid production. We demonstrated that rhlAexpression (Fig. 4) and rhamnolipid production (Fig. 5) levelswere decreased in the algRD54N and �algZ backgrounds but wereunaffected in the algRD54E background. We also observed AlgR-dependent effects on swarming motility. The WT and algRD54Ebackgrounds exhibited discernible dendrites, but the �algR,algRD54N, and �algZ backgrounds displayed noticeable swarm-ing motility defects (Fig. 3C). The most likely explanation for thedifferent swarming phenotypes observed for the �algR andalgRD54N backgrounds is that the strain carrying the algRD54Nallele produced less rhamnolipid than the strain with the �algR

FIG 5 AlgR phosphorylation was required for maximal rhamnolipid produc-tion. (A) Thin-layer chromatography. Strains PAO1 (WT), PSL317 (�algR),WFPA8 (algRD54N), PAO1 algRD54E, PAZ (�algZ), and PAO1 �rhlA(�rhlA) were grown for 16 h in TSB plus 1% glycerol. Mono, monorhamno-lipid band; Di, dirhamnolipid band. (B) Strains for which results are shown inpanel A were tested for rhamnolipid production by use of the orcinol colori-metric assay and comparison with a standard curve (see Materials and Meth-ods). Values were normalized to total-protein values. (C) The extent of hemo-lysis due to rhamnolipid production was measured. Cultures were grown for24 h in a phosphate-limiting medium (tryptic soy broth supplemented with1% glucose), and cell-free supernatants were heat treated to denature polypep-tide-based hemolysins. Serial dilutions were applied to 1% horse red bloodcells for 1 h at 37°C, and the percentage of hemolysis was calculated based ontotal and no hemolysis. Statistical analysis was performed by one-way analysisof variance. n.s., not significant. Asterisks indicate P values of 0.05 to 0.01 (*),0.01 to 0.001 (**), or 0.001 (***).




http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

allele (Fig. 5). This decrease, in combination with abrogatedtwitching motility (Fig. 2), likely decreased overall swarming mo-tility in the algRD54N strain. Following this logic, we expected tosee similar swarming phenotypes for PAO1 algRD54N and PAO1�algZ. However, PAO1 �algZ displayed a swarming phenotype

similar to that of PAO1 �algR. PAO1 algRD54N expresses AlgRD54N protein, which is unable to be phosphorylated, while theAlgR protein expressed in PAZ may be phosphorylated by otherintracellular phosphodonors. We currently do not know if orwhen AlgR may be phosphorylated in the absence of AlgZ. If this is

FIG 6 Phosphorylated AlgR recognized three different binding sites within the rhlA promoter. (A) Diagram of fragments used for EMSAs, showing theirlocations on the rhlA promoter. The locations of the previously identified AlgR binding sites and sequences are indicated (28): the consensus AlgR binding site1 (sense strand, 5=-CCGTTCGTC) and AlgR binding site 2 (antisense strand, 5=-CCGTGCTCC). (B) EMSAs using AlgR or acetyl phosphate-treated AlgR onDNA fragments corresponding to those diagramed in panel A. The concentrations of proteins in binding reaction mixtures are indicated. Controls containrhlA fragments only (lanes 1, 5, 9, 13, 17, and 21). (C) Further examination of rhlA fragment 1, using AlgR or AlgR-P. Control lanes (lanes 1 and 10) containedrhlA fragment 1 only. For AlgR-P, AlgR was preincubated with a 10� molar ratio of acetyl phosphate prior to the binding reaction. Increasing concentrations ofAlgR (lanes 2 to 9) and AlgR-P (lanes 11 to 18) were used (1, 5, 10, 50, 125, 250, 500, and 1,250 nM protein, respectively) in the presence of 5 nM radiolabeledDNA. Black arrowheads indicate the locations of AlgR-bound DNA; open arrowheads indicate the locations of unbound DNA. (D) Either AlgR binding site 1(�1), AlgR binding site 2 (�1), or both (�1�2) were mutated (see Materials and Methods), and strains were tested for AlgR or AlgR-P binding. A 25:1 molar ratioof protein to DNA was used. (E) Binding of increasing concentrations of AlgR or AlgR-P protein to fragment 5. Control lanes (lanes 1 and 8) contained rhlAfragment 5 only. AlgR (lanes 2 to 7) and AlgR-P (lanes 9 to 14) concentrations were increased (1, 5, 10, 50, 125, and 250 nM protein, respectively) in the presenceof 5 nM radiolabeled DNA.

Okkotsu et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

the case, under certain conditions, AlgR could potentially increaserhamnolipid production and partially reverse the swarming de-fect. For the PAO1 �algZ algRD54E mutant, we expected to ob-serve a phenotype resembling that of the wild type or PAO1algRD54E. Instead, however, we observed a decrease in overallswarming. Rhamnolipid production appears to be finely regulatedby AlgR levels; algR expressed from a plasmid repressed rhamno-lipid production (data not shown). Since AlgR D54E expression isincreased (Fig. 1C), it is possible that this reduced swarming inPAO1 �algZ algRD54E is due to repression of rhamnolipids.

While the single polar flagellum helps to propel the organisms,the products of the RhlA, RhlB, and RhlC enzymes (HAA, mono-rhamnolipids, and dirhamnolipids) coordinate the formation ofthe dendrite phenotype in swarming cells (14). Since the algRmutants showed no swimming defects (see Fig. S3 in the supple-mental material), we opine that the swarming defect is due to adysregulation in rhamnolipid production. In fact, when rhlAB wasexpressed from a plasmid in the algRD54N background, dendriteformation was partially restored (Fig. 7). These results indicate anAlgR phosphorylation-dependent regulation of swarming motil-ity through rhamnolipid expression.

We have not eliminated the possibility that AlgR phosphoryla-tion also regulates swarming motility indirectly. Swarming motil-ity is a highly complex phenotype that is regulated by a number offactors (62–65). Recently, type IVa pili have been shown to control

swarming motility through cyclic di-GMP (c-di-GMP) levels (66).Low intracellular c-di-GMP levels are required for swarming andswimming motility (67). Deletion of bifA, encoding a phosphodi-esterase, results in a swarming defect due to a buildup of intracel-lular c-di-GMP (55). Deletion of PilY1, PilX, or PilW in a bifAdeletion strain alleviates the swarming defect found with bifA de-letion (55, 66) without changing intracellular c-di-GMP levels(55), indicating that PilY1 suppresses swarming specificallythrough BifA (66). Overexpression of PilY1 represses swarming,but not in a strain with a deletion of sadC (encoding a diguanylatecyclase that increases c-di-GMP levels), suggesting a role for PilY1in directly or indirectly regulating c-di-GMP levels through SadC(66). While we observed no transcriptional effects on sadC or bifAin our microarrays (unpublished data), and no change in swarm-ing motility in the algRD54E background (Fig. 3), it would beinteresting to explore if and how AlgZR might affect c-di-GMPlevels.

We suggest AlgR phosphorylation as a mechanism by whichAlgR coordinates the transcription of various genes, including thefimU promoter (Fig. 2) and the rhlAB promoters (Fig. 8). Phos-phorylation of AlgR appears to increase its binding affinity forthese lower-consensus binding sites to enable promoter activa-tion. We supported this hypothesis by prephosphorylating AlgRwith acetyl phosphate and observing increased AlgR binding tofimU (Fig. 2B and C) and rhlA (Fig. 6B, C, and E) DNA. Compared

FIG 7 The swarming phenotype was restored in algR D54N by rhlAB expression in trans. (A) TLC of rhamnolipids from 16-h cultures grown in TSB plus 1%glycerol at 37°C. PAO1 �rhlA containing an empty vector (p30T) or an rhlAB expression vector (p30T rhlAB) and WFPA8 (algR7) were tested. The rhlAB geneswere induced without arabinose (lanes 1, 3, and 6) or with 0.01% (lane 4) or 0.5% (lanes 2, 5, and 7) arabinose. (B) Swarming motility assays of PAO1 �rhlAcontaining p30T or p30T rhlAB with various concentrations of arabinose in swarming agar. (C) Swarming motility assays of WFPA8 (algRD54N) containingp30T or p30T rhlAB with various concentrations of arabinose.




http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

to the highest-affinity binding site from the algD promoter (5=-CCGTTCGTC), fimU ABS1 (5=-CCGTTTGGC) has two mis-matches and fimU ABS2 (5=-CCCTCGGGC) has four mismatches(50) (underlined bases differ from those in the canonical AlgRbinding site). Previous work on algC ABS2 (5=-CCGTTGTTC),algC ABS3 (5=-CCGTGCGTC), and algD ABS3 (5=-CCGTTTGTC) showed that mismatches in the binding site resulted in low-ered AlgR affinity (68, 69), indicating that the sequence is essentialfor protein binding. In support of this idea, AlgR or AlgR-P dis-played higher affinity to rhlA fragment 1 DNA (containing theconserved rhlA ABS1 [5=-CCGTTCGTC]) (Fig. 6C) than to fimUpromoter DNA (containing the less-conserved binding sites)(Fig. 2C).

The AlgR phosphorylation state may also modulate rhlAB ex-pression as a function of the AlgR binding site location and bind-ing affinities (Fig. 8). The algD and algC promoters contain AlgRbinding sites that are found hundreds of bases apart from eachother (22, 68, 70, 71). In the algD promoter, two identical ABSs arelocated �471 bp and �396 bp upstream, and one ABS is located�45 bp upstream, of the transcriptional start site (70, 71). DNAlooping has been proposed as a mechanism for algD regulation(68). Additionally, an ABS in the algC promoter has been reportedto function as an enhancer element for algC transcription (72).This idea is reminiscent of findings for other response regulators,such as OmpR, where cooperative binding of both proximal anddistal binding sites in the ompF and ompC promoters influencehow OmpR-P regulates the transcription of both promoters (48,73). In this study, we observed multiple protein-DNA complexeswith rhlA fragment 1 (Fig. 6C). We do not currently know thenature of these complexes and if or how AlgR is oligomerizing onthe DNA. The facts that AgrA-type response regulators bind im-perfect, direct 9-bp repeats separated by 12 bp (74) and that AlgRrequires both binding sites to shift rhlA fragment 1 at this concen-tration (Fig. 6D, �1�2) suggest that AlgR may be binding to mul-tiple sites in rhlA fragment 1. However, even though the sequencefor rhlA AlgR binding site 2 (5=-CCGTGCTCC) is similar to theknown AlgR binding sequence (5=-CCGTTCGTC) and is locatedat the appropriate distance for AgrA-type regulators (10 bp), ourdata also confirm previous results suggesting that rhlA AlgR bind-

ing site 2 is most likely not a real binding site (Fig. 6D, �2) (28).When EMSAs were performed with AlgR-P, the deletion of rhlAABS1 (the highly conserved site) in rhlA fragment 1 (Fig. 6D, �1)resulted in a higher shift (top black arrowhead) than that seen forWT rhlA fragment 1. These large shifts were also present whenAlgR-P (Fig. 6C, lanes 17 and 18), but not AlgR (Fig. 6C, lanes 8and 9), was added in large amounts. Additional experiments areneeded to elucidate how this occurs and whether it is biologicallyrelevant.

In this study, a second region within rhlA fragment 5 was foundto bind phosphorylated AlgR (Fig. 6E). In attempts to determinethis third binding site, a probable AlgR binding sequence in rhlAfragment 5 (5=CCGCCCGTC [underlined bases differ from thosein the canonical AlgR binding site]) was mutated, and the mutantwas investigated for binding and transcriptional activity (data notshown). We surmised that the binding site, located adjacent to theRhlR-binding lux box, is reminiscent of those found in class Iactivation of promoters, where an activator binds to a target lo-cated upstream of the �35 element (75). However, we eliminatedthis site as a possible AlgR binding site, because a mutation of thissite (5=-CCGCCCGTC to 5=-ttaCCCGTC) did not affect AlgRbinding by EMSA (data not shown). By use of a transcriptionalfusion, mutation of this site did decrease rhlA transcription, butthis effect is most likely due to disruption of RhlR binding (datanot shown) (76). Therefore, further investigation of this thirdbinding site is necessary. Considering that there may be a thirdAlgR binding site located within rhlA fragment 5, and consideringthat two other AlgR binding sites are located on rhlA, it would notbe unreasonable to suggest that a type of AlgR regulation similar tothat found on the algD promoter may occur with the rhlA pro-moter (Fig. 8). We also propose that the binding affinities for theABSs may affect whether the promoter is AlgR phosphorylationdependent or not (Fig. 8). This is supported by the fact that thealgD promoter, containing two consensus AlgR binding sites(algD RB1 and algD RB2 [5=-CCGTTCGTC]) (68), does not re-quire AlgR phosphorylation for its transcription (20, 77), whilefimU requires AlgR phosphorylation for activation (50).

Our lab has demonstrated previously that AlgR represses rhlABexpression in the context of a 6-day biofilm, since the PAO1 �algR

FIG 8 Model of AlgR phosphorylation-dependent regulation. AlgZ (FimS) phosphorylates AlgR, and AlgR-P status increases affinity for lower-affinity bindingsites. The core 9-bp consensus sequence is shown in blue. The rhlA and fimU AlgR binding sequences are boxed. Sequences with increased numbers ofmismatches (red letters) are proposed to be lower-affinity sites (red boxes). AlgR binding sites (ABSs) containing sequences identical to algD ABS1 and ABS2consensus sequences (blue letters) are proposed to be higher-affinity sites (blue boxes). AlgR-P has increased affinity for the fimU and rhlA promoters andactivates transcription.

Okkotsu et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

strain showed increased rhlA expression and rhamnolipid pro-duction (28). Therefore, we initially expected to observe AlgR re-pression of rhlA transcription. In fact, our lab previously demon-strated that stationary-phase cultures did not display differencesin rhlA expression (28), suggesting that AlgR repression of therhlA promoter occurs predominantly in a late-stage biofilm. Un-der our experimental conditions, we observed that rhlA expres-sion and rhamnolipid production in the PAO1 �algR backgroundwere unchanged or decreased from those of the wild type (Fig. 4and 5). This result may be due to the fact that in the absence ofAlgR, a modulatory component on the rhlA promoter is absent,and rhlA expression is reliant on other regulators to activate thispromoter. It was also necessary to perform multiple assays to con-firm the rhamnolipid phenotype, because the differences in pro-duction were subtle. The discrepancy between PAO1 algRD54Nand PAO1 �algR results (Fig. 5) among the three rhamnolipidassays is likely due to different experimental parameters. For thehemolysis assay, the cell supernatant was collected after 24 h, po-tentially allowing increased rhamnolipid production in PAO1�algR. We previously measured rhamnolipid production in sta-tionary phase and showed no difference in rhamnolipid produc-tion between PAO1 and PAO1 �algR (28). However, while ourcurrent experiments were performed in rich medium, our previ-ous biofilm growth experiments were performed in minimal me-dium with glutamate. Rhamnolipid production and swarmingmotility are preferentially induced by certain amino acids (57).Glutamate as the sole carbon source induces swarming motility inthe absence of the las and rhl systems, as well as rhamnolipidproduction (78). These results indicate the importance of the nu-trient source for these phenotypes. While AlgR was not requiredfor the repression of rhlA under our experimental conditions, it ispossible that AlgR repression of rhlAB occurs either with certainamino acids or at later stages of biofilm development.

The regulation of the rhlAB genes is very complex and is af-fected by a number of factors and conditions, including the Rhlquorum-sensing system (60, 79), nitrogen metabolism (15), thesigma factors RpoN (80), RpoD (41), and RpoS (81), DksA (82),iron (83), phosphate levels (8), and RsmA (84). AlgR repression ofrhamnolipids in a 6-day biofilm is attributed to AlgR repressionon the rhlI promoter (28). Therefore, we suggest that AlgR couldalso repress rhlI expression and C4-HSL production under ourconditions (see Fig. S4 in the supplemental material). We ob-served upregulation of rhlI and increases in C4-HSL levels in thePAO1 �algR and PAO1 algRD54N backgrounds. This observationseems contradictory to results for rhlA expression or rhamnolipidproduction, and it indicates that AlgR regulates rhlA indepen-dently of rhlI. RsmA has also been shown to have an effect on rhlIexpression (85). Therefore, other factors, downstream of AlgR,may also affect rhlAB expression. Further studies are being per-formed to address this problem.

AlgR affects the expression of 95 genes and 59 genes in theexponential and stationary phases, respectively (51), as well asmore than 700 genes in a biofilm (28). Undoubtedly, the AlgRregulon is complex, and it is a challenge to tease out direct andindirect regulation. AlgR phosphorylation adds another layer tothis complexity. Currently, the signal for AlgZ to phosphorylateAlgR has not been determined. We speculate that AlgR-P is re-quired either for early biofilm establishment or during biofilm capformation, since both of these scenarios require type IVa pili andrhamnolipid expression. We also predict the observation of an

AlgR phosphorylation-dependent effect on virulence, since bothgenes within the fimU operon (and twitching motility) and rham-nolipid production are virulence determinants and are requiredfor pathogenicity (86–89).

ACKNOWLEDGMENTS

This work was supported by funding from the Cystic Fibrosis Foundation(grant SCHURR11PO) and NIH 1R21 AI 1094487 to M.J.S., NSF 0821220to M.E.C., and NIH Training Grant 2T32 AI 052066 to Y.O.

We thank Christopher L. Pritchett, Nicholas A. Vitko, David Haw-man, and Jacinta R. Weins for contributions to this work. We thank F.Heath Damron for critical reading of the manuscript. Finally, we aregrateful to Michael Vasil for providing the PAO1 �rhlA strain and theanti-OmlA antibody and for critical reading of the manuscript.

REFERENCES1. Bodey GP, Bolivar R, Fainstein V, Jadeja L. 1983. Infections caused by

Pseudomonas aeruginosa. Rev. Infect. Dis. 5:279 –313.2. Mendelson MH, Gurtman A, Szabo S, Neibart E, Meyers BR, Policar M,

Cheung TW, Lillienfeld D, Hammer G, Reddy S, Choi K, HirschmanSZ. 1994. Pseudomonas aeruginosa bacteremia in patients with AIDS. Clin.Infect. Dis. 18:886 – 895.

3. Davies JC. 2002. Pseudomonas aeruginosa in cystic fibrosis: pathogenesisand persistence. Paediatr. Respir. Rev. 3:128 –134.

4. Govan JRW, Deretic V. 1996. Microbial pathogenesis in cystic fibrosis:mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol.Rev. 60:539 –574.

5. Damron FH, Owings JP, Okkotsu Y, Varga JJ, Schurr JR, Goldberg JB,Schurr MJ, Yu HD. 2012. Analysis of the Pseudomonas aeruginosa reguloncontrolled by the sensor kinase KinB and sigma factor RpoN. J. Bacteriol.194:1317–1330.

6. Okkotsu Y, Pritchett C, Schurr M. 2013. Regulation of exopolysaccha-ride biosynthesis in Pseudomonas aeruginosa, p 171–189. In Vasil ML,Darwin AJ (ed), Regulation of bacterial virulence. ASM Press, Washing-ton, DC.

7. Amiel E, Lovewell RR, O’Toole GA, Hogan DA, Berwin B. 2010.Pseudomonas aeruginosa evasion of phagocytosis is mediated by loss ofswimming motility and is independent of flagellum expression. Infect.Immun. 78:2937–2945.

8. Bains M, Fernandez L, Hancock RE. 2012. Phosphate starvation pro-motes swarming motility and cytotoxicity of Pseudomonas aeruginosa.Appl. Environ. Microbiol. 78:6762– 6768.

9. Head NE, Yu H. 2004. Cross-sectional analysis of clinical and environ-mental isolates of Pseudomonas aeruginosa: biofilm formation, virulence,and genome diversity. Infect. Immun. 72:133–144.

10. O’Toole GA, Kolter R. 1998. Flagellar and twitching motility are neces-sary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol.30:295–304.

11. Burrows LL. 2012. Pseudomonas aeruginosa twitching motility: type IVpili in action. Annu. Rev. Microbiol. 66:493–520.

12. Overhage J, Bains M, Brazas MD, Hancock RE. 2008. Swarming ofPseudomonas aeruginosa is a complex adaptation leading to increased pro-duction of virulence factors and antibiotic resistance. J. Bacteriol. 190:2671–2679.

13. Yeung AT, Torfs EC, Jamshidi F, Bains M, Wiegand I, Hancock RE,Overhage J. 2009. Swarming of Pseudomonas aeruginosa is controlled by abroad spectrum of transcriptional regulators, including MetR. J. Bacteriol.191:5592–5602.

14. Caiazza NC, Shanks RM, O’Toole GA. 2005. Rhamnolipids modulateswarming motility patterns of Pseudomonas aeruginosa. J. Bacteriol. 187:7351–7361.

15. Déziel E, Lepine F, Milot S, Villemur R. 2003. rhlA is required for theproduction of a novel biosurfactant promoting swarming motility in Pseu-domonas aeruginosa: 3-(3-hydroxyalkanoyloxy)alkanoic acids (HAAs),the precursors of rhamnolipids. Microbiology 149:2005–2013.

16. Murray TS, Kazmierczak BI. 2008. Pseudomonas aeruginosa exhibitssliding motility in the absence of type IV pili and flagella. J. Bacteriol.190:2700 –2708.

17. Winsor GL, Van Rossum T, Lo R, Khaira B, Whiteside MD, HancockRE, Brinkman FS. 2009. Pseudomonas Genome Database: facilitating




http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

user-friendly, comprehensive comparisons of microbial genomes. NucleicAcids Res. 37:D483–D488.

18. Rodrigue A, Quentin Y, Lazdunski A, Mejean V, Foglino M. 2000.Two-component systems in Pseudomonas aeruginosa: why so many?Trends Microbiol. 8:498 –504.

19. Deretic V, Dikshit R, Konyecsni WM, Chakrabarty AM, Misra TK.1989. The algR gene, which regulates mucoidy in Pseudomonas aeruginosa,belongs to a class of environmentally responsive genes. J. Bacteriol. 171:1278 –1283.

20. Ma S, Selvaraj U, Ohman DE, Quarless R, Hassett DJ, Wozniak DJ.1998. Phosphorylation-independent activity of the response regulatorsAlgB and AlgR in promoting alginate biosynthesis in mucoid Pseudomo-nas aeruginosa. J. Bacteriol. 180:956 –968.

21. Whitchurch CB, Alm RA, Mattick JS. 1996. The alginate regulator AlgRand an associated sensor FimS are required for twitching motility in Pseu-domonas aeruginosa. Proc. Natl. Acad. Sci. U. S. A. 93:9839 –9843.

22. Zielinski NA, Chakrabarty AM, Berry A. 1991. Characterization andregulation of the Pseudomonas aeruginosa algC gene encoding phospho-mannomutase. J. Biol. Chem. 266:9754 –9763.

23. Reference deleted.24. Deretic V, Leveau JH, Mohr CD, Hibler NS. 1992. In vitro phosphory-

lation of AlgR, a regulator of mucoidy in Pseudomonas aeruginosa, by ahistidine protein kinase and effects of small phospho-donor molecules.Mol. Microbiol. 6:2761–2767.

25. Whitchurch CB, Erova TE, Emery JA, Sargent JL, Harris JM, SemmlerAB, Young MD, Mattick JS, Wozniak DJ. 2002. Phosphorylation of thePseudomonas aeruginosa response regulator AlgR is essential for type IVfimbria-mediated twitching motility. J. Bacteriol. 184:4544 – 4554.

26. Cody WL, Pritchett CL, Jones AK, Carterson AJ, Jackson DW, Frisk A,Wolfgang M, Schurr MJ. 2009. Pseudomonas aeruginosa AlgR controlscyanide production in an AlgZ-dependent manner. J. Bacteriol. 191:2993–3002.

27. Klose KE, Weiss DS, Kustu S. 1993. Glutamate at the site of phosphor-ylation of nitrogen-regulatory protein NTRC mimics aspartyl-phosphateand activates the protein. J. Mol. Biol. 232:67–78.

28. Morici LA, Carterson AJ, Wagner VE, Frisk A, Schurr JR, Zu BentrupKH, Hassett DJ, Iglewski BH, Sauer K, Schurr MJ. 2007. Pseudomonasaeruginosa AlgR represses the Rhl quorum-sensing system in a biofilm-specific manner. J. Bacteriol. 189:7752–7764.

29. Vogel HJ, Bonner DM. 1956. Acetylornithinase of Escherichia coli: partialpurification and some properties. J. Biol. Chem. 218:97–106.

30. Qiu D, Damron FH, Mima T, Schweizer HP, Yu HD. 2008. PBAD-basedshuttle vectors for functional analysis of toxic and highly regulated genesin Pseudomonas and Burkholderia spp. and other bacteria. Appl. Environ.Microbiol. 74:7422–7426.

31. Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP. 1998.A broad-host-range Flp-FRT recombination system for site-specific exci-sion of chromosomally-located DNA sequences: application for isolationof unmarked Pseudomonas aeruginosa mutants. Gene 212:77– 86.

32. Miller HI, Kirk M, Echols H. 1981. SOS induction and autoregulation ofthe himA gene for site-specific recombination in Escherichia coli. Proc.Natl. Acad. Sci. U. S. A. 78:6754 – 6758.

33. Skoneczny M, Rytka J. 2000. Oxygen and haem regulate the synthesis ofperoxisomal proteins: catalase A, acyl-CoA oxidase and Pex1p in the yeastSaccharomyces cerevisiae; the regulation of these proteins by oxygen is notmediated by haem. Biochem. J. 350(Part 1):313–319.

34. Deretic V, Hibler NS, Holt SC. 1992. Immunocytochemical analysis ofAlgP (HP1), a histonelike element participating in control of mucoidy inPseudomonas aeruginosa. J. Bacteriol. 174:824 – 831.

35. Jones AK, Fulcher NB, Balzer GJ, Urbanowski ML, Pritchett CL, SchurrMJ, Yahr TL, Wolfgang MC. 2010. Activation of the Pseudomonas aerugi-nosa AlgU regulon through mucA mutation inhibits cyclic AMP/Vfr sig-naling. J. Bacteriol. 192:5709 –5717.

36. Alm RA, Mattick JS. 1995. Identification of a gene, pilV, required for type4 fimbrial biogenesis in Pseudomonas aeruginosa, whose product possessesa pre-pilin-like leader sequence. Mol. Microbiol. 16:485– 496.

37. Kearns DB, Robinson J, Shimkets LJ. 2001. Pseudomonas aeruginosaexhibits directed twitching motility up phosphatidylethanolamine gradi-ents. J. Bacteriol. 183:763–767.

38. Miller RM, Tomaras AP, Barker AP, Voelker DR, Chan ED, Vasil AI,Vasil ML. 2008. Pseudomonas aeruginosa twitching motility-mediatedchemotaxis towards phospholipids and fatty acids: specificity and meta-bolic requirements. J. Bacteriol. 190:4038 – 4049.

39. Tremblay J, Déziel E. 2008. Improving the reproducibility of Pseudomo-nas aeruginosa swarming motility assays. J. Basic Microbiol. 48:509 –515.

40. Ochsner UA, Koch AK, Fiechter A, Reiser J. 1994. Isolation and char-acterization of a regulatory gene affecting rhamnolipid biosurfactant syn-thesis in Pseudomonas aeruginosa. J. Bacteriol. 176:2044 –2054.

41. Pearson JP, Pesci EC, Iglewski BH. 1997. Roles of Pseudomonas aerugi-nosa las and rhl quorum-sensing systems in control of elastase and rham-nolipid biosynthesis genes. J. Bacteriol. 179:5756 –5767.

42. Tahzibi A, Kamal F, Assadi M. 2004. Improved production of rhamno-lipids by a Pseudomonas aeruginosa mutant. Iran. Biomed. J. 8:25–31.

43. Vinckx T, Wei Q, Matthijs S, Cornelis P. 2010. The Pseudomonasaeruginosa oxidative stress regulator OxyR influences production of pyo-cyanin and rhamnolipids: protective role of pyocyanin. Microbiology 156:678 – 686.

44. Bruckner J. 1955. Estimation of monosaccharides by the orcinol-sulphuric acid reaction. Biochem. J. 60:200 –205.

45. Johnson MK, Boese-Marrazzo D. 1980. Production and properties ofheat-stable extracellular hemolysin from Pseudomonas aeruginosa. Infect.Immun. 29:1028 –1033.

46. Davies KM, Lowe ED, Venien-Bryan C, Johnson LN. 2009. The HupRreceiver domain crystal structure in its nonphospho and inhibitory phos-pho states. J. Mol. Biol. 385:51– 64.

47. Gupte G, Woodward C, Stout V. 1997. Isolation and characterization ofrcsB mutations that affect colanic acid capsule synthesis in Escherichia coliK-12. J. Bacteriol. 179:4328 – 4335.

48. Lan CY, Igo MM. 1998. Differential expression of the OmpF and OmpCporin proteins in Escherichia coli K-12 depends upon the level of activeOmpR. J. Bacteriol. 180:171–174.

49. Moore JB, Shiau SP, Reitzer LJ. 1993. Alterations of highly conservedresidues in the regulatory domain of nitrogen regulator I (NtrC) of Esch-erichia coli. J. Bacteriol. 175:2692–2701.

50. Belete B, Lu H, Wozniak DJ. 2008. Pseudomonas aeruginosa AlgR regu-lates type IV pilus biosynthesis by activating transcription of the fimU-pilVWXY1Y2E operon. J. Bacteriol. 190:2023–2030.

51. Lizewski SE, Schurr JR, Jackson DW, Frisk A, Carterson AJ, Schurr MJ.2004. Identification of AlgR-regulated genes in Pseudomonas aeruginosaby use of microarray analysis. J. Bacteriol. 186:5672–5684.

52. Xu H, Caimano MJ, Lin T, He M, Radolf JD, Norris SJ, Gherardini F,Wolfe AJ, Yang XF. 2010. Role of acetyl-phosphate in activation of theRrp2-RpoN-RpoS pathway in Borrelia burgdorferi. PLoS Pathog.6:e1001104. doi:10.1371/journal.ppat.1001104.

53. Orans J, Johnson MD, Coggan KA, Sperlazza JR, Heiniger RW, Wolf-gang MC, Redinbo MR. 2010. Crystal structure analysis reveals Pseu-domonas PilY1 as an essential calcium-dependent regulator of bacterialsurface motility. Proc. Natl. Acad. Sci. U. S. A. 107:1065–1070.

54. Johnson MD, Garrett CK, Bond JE, Coggan KA, Wolfgang MC, Red-inbo MR. 2011. Pseudomonas aeruginosa PilY1 binds integrin in an RGD-and calcium-dependent manner. PLoS One 6:e29629. doi:10.1371/journal.pone.0029629.

55. Kuchma SL, Ballok AE, Merritt JH, Hammond JH, Lu W, RabinowitzJD, O’Toole GA. 2010. Cyclic-di-GMP-mediated repression of swarmingmotility by Pseudomonas aeruginosa: the pilY1 gene and its impact onsurface-associated behaviors. J. Bacteriol. 192:2950 –2964.

56. Giltner CL, Habash M, Burrows LL. 2010. Pseudomonas aeruginosaminor pilins are incorporated into type IV pili. J. Mol. Biol. 398:444 – 461.

57. Köhler T, Curty LK, Barja F, van Delden C, Pechere JC. 2000. Swarmingof Pseudomonas aeruginosa is dependent on cell-to-cell signaling and re-quires flagella and pili. J. Bacteriol. 182:5990 –5996.

58. Tremblay J, Richardson AP, Lepine F, Déziel E. 2007. Self-producedextracellular stimuli modulate the Pseudomonas aeruginosa swarming mo-tility behaviour. Environ. Microbiol. 9:2622–2630.

59. Overhage J, Lewenza S, Marr AK, Hancock RE. 2007. Identification ofgenes involved in swarming motility using a Pseudomonas aeruginosaPAO1 mini-Tn5-lux mutant library. J. Bacteriol. 189:2164 –2169.

60. Ochsner UA, Reiser J. 1995. Autoinducer-mediated regulation of rham-nolipid biosurfactant synthesis in Pseudomonas aeruginosa. Proc. Natl.Acad. Sci. U. S. A. 92:6424 – 6428.

61. Smith JG, Latiolais JA, Guanga GP, Pennington JD, Silversmith RE,Bourret RB. 2004. A search for amino acid substitutions that universallyactivate response regulators. Mol. Microbiol. 51:887–901.

62. Kearns DB. 2010. A field guide to bacterial swarming motility. Nat. Rev.Microbiol. 8:634 – 644.

Okkotsu et al.



http://jb.asm.org/

Dow

nloaded from

http://dx.doi.org/10.1371/journal.ppat.1001104

http://dx.doi.org/10.1371/journal.pone.0029629

http://dx.doi.org/10.1371/journal.pone.0029629

http://jb.asm.org

http://jb.asm.org/

63. Kamatkar NG, Sarna MJ, Shrout JD. 2011. Population dynamics duringswarming of Pseudomonas aeruginosa. Commun. Integr. Biol. 4:689 – 691.

64. Tremblay J, Déziel E. 2010. Gene expression in Pseudomonas aeruginosaswarming motility. BMC Genomics 11:587. doi:10.1186/1471-2164-11-587.

65. Partridge JD, Harshey RM. 2013. Swarming: flexible roaming plans. J.Bacteriol. 195:909 –918.

66. Kuchma SL, Griffin EF, O’Toole GA. 2012. Minor pilins of the type IVpilus system participate in the negative regulation of swarming motility. J.Bacteriol. 194:5388 –5403.

67. Merritt JH, Brothers KM, Kuchma SL, O’Toole GA. 2007. SadC recip-rocally influences biofilm formation and swarming motility via modula-tion of exopolysaccharide production and flagellar function. J. Bacteriol.189:8154 – 8164.

68. Mohr CD, Leveau JH, Krieg DP, Hibler NS, Deretic V. 1992. AlgR-binding sites within the algD promoter make up a set of inverted repeatsseparated by a large intervening segment of DNA. J. Bacteriol. 174:6624 –6633.

69. Zielinski NA, Maharaj R, Roychoudhury S, Danganan CE, HendricksonW, Chakrabarty AM. 1992. Alginate synthesis in Pseudomonas aerugi-nosa: environmental regulation of the algC promoter. J. Bacteriol. 174:7680 –7688.

70. Mohr CD, Hibler NS, Deretic V. 1991. AlgR, a response regulator con-trolling mucoidy in Pseudomonas aeruginosa, binds to the FUS sites of thealgD promoter located unusually far upstream from the mRNA start site.J. Bacteriol. 173:5136 –5143.

71. Mohr CD, Martin DW, Konyecsni WM, Govan JR, Lory S, Deretic V.1990. Role of the far-upstream sites of the algD promoter and the algR andrpoN genes in environmental modulation of mucoidy in Pseudomonasaeruginosa. J. Bacteriol. 172:6576 – 6580.

72. Fujiwara S, Zielinski NA, Chakrabarty AM. 1993. Enhancer-like activityof AlgR1-binding site in alginate gene activation: positional, orientational,and sequence specificity. J. Bacteriol. 175:5452–5459.

73. Yoshida T, Qin L, Egger LA, Inouye M. 2006. Transcription regulationof ompF and ompC by a single transcription factor, OmpR. J. Biol. Chem.281:17114 –17123.

74. Sidote DJ, Barbieri CM, Wu T, Stock AM. 2008. Structure of the Staph-ylococcus aureus AgrA LytTR domain bound to DNA reveals a beta foldwith an unusual mode of binding. Structure 16:727–735.

75. Browning DF, Busby SJ. 2004. The regulation of bacterial transcriptioninitiation. Nat. Rev. Microbiol. 2:57– 65.

76. Medina G, Juarez K, Valderrama B, Soberon-Chavez G. 2003. Mecha-nism of Pseudomonas aeruginosa RhlR transcriptional regulation of therhlAB promoter. J. Bacteriol. 185:5976 –5983.

77. Yu H, Mudd M, Boucher JC, Schurr MJ, Deretic V. 1997. Identificationof the algZ gene upstream of the response regulator AlgR and its partici-pation in control of alginate production in Pseudomonas aeruginosa. J.Bacteriol. 179:187–193.

78. Shrout JD, Chopp DL, Just CL, Hentzer M, Givskov M, Parsek MR.2006. The impact of quorum sensing and swarming motility on Pseu-domonas aeruginosa biofilm formation is nutritionally conditional. Mol.Microbiol. 62:1264 –1277.

79. Croda-García G, Grosso-Becerra V, Gonzalez-Valdez A, Servin-

Gonzalez L, Soberon-Chavez G. 2011. Transcriptional regulation ofPseudomonas aeruginosa rhlR: role of the CRP orthologue Vfr (virulencefactor regulator) and quorum-sensing regulators LasR and RhlR. Micro-biology 157:2545–2555.

80. Thompson LS, Webb JS, Rice SA, Kjelleberg S. 2003. The alternativesigma factor RpoN regulates the quorum sensing gene rhlI in Pseudomonasaeruginosa. FEMS Microbiol. Lett. 220:187–195.

81. Whiteley M, Parsek MR, Greenberg EP. 2000. Regulation of quorumsensing by RpoS in Pseudomonas aeruginosa. J. Bacteriol. 182:4356 – 4360.

82. Branny P, Pearson JP, Pesci EC, Kohler T, Iglewski BH, Van Delden C.2001. Inhibition of quorum sensing by a Pseudomonas aeruginosa dksAhomologue. J. Bacteriol. 183:1531–1539.

83. Glick R, Gilmour C, Tremblay J, Satanower S, Avidan O, Déziel E,Greenberg EP, Poole K, Banin E. 2010. Increase in rhamnolipid synthesisunder iron-limiting conditions influences surface motility and biofilmformation in Pseudomonas aeruginosa. J. Bacteriol. 192:2973–2980.

84. Heurlier K, Williams F, Heeb S, Dormond C, Pessi G, Singer D, CamaraM, Williams P, Haas D. 2004. Positive control of swarming, rhamnolipidsynthesis, and lipase production by the posttranscriptional RsmA/RsmZsystem in Pseudomonas aeruginosa PAO1. J. Bacteriol. 186:2936 –2945.

85. Pessi G, Williams F, Hindle Z, Heurlier K, Holden MT, Camara M,Haas D, Williams P. 2001. The global posttranscriptional regulator RsmAmodulates production of virulence determinants and N-acylhomoserinelactones in Pseudomonas aeruginosa. J. Bacteriol. 183:6676 – 6683.

86. Taguchi F, Ichinose Y. 2011. Role of type IV pili in virulence of Pseu-domonas syringae pv. tabaci 6605: correlation of motility, multidrug resis-tance, and HR-inducing activity on a nonhost plant. Mol. Plant MicrobeInteract. 24:1001–1011.

87. Alarcon I, Evans DJ, Fleiszig SM. 2009. The role of twitching motility inPseudomonas aeruginosa exit from and translocation of corneal epithelialcells. Invest. Ophthalmol. Vis. Sci. 50:2237–2244.

88. Van Gennip M, Christensen LD, Alhede M, Phipps R, Jensen PO,Christophersen L, Pamp SJ, Moser C, Mikkelsen PJ, Koh AY, Tolker-Nielsen T, Pier GB, Hoiby N, Givskov M, Bjarnsholt T. 2009. Inactiva-tion of the rhlA gene in Pseudomonas aeruginosa prevents rhamnolipidproduction, disabling the protection against polymorphonuclear leuko-cytes. APMIS 117:537–546.

89. McClure CD, Schiller NL. 1996. Inhibition of macrophage phagocytosisby Pseudomonas aeruginosa rhamnolipids in vitro and in vivo. Curr. Mi-crobiol. 33:109 –117.

90. Holloway BW. 1955. Genetic recombination in Pseudomonas aeruginosa.J. Gen. Microbiol. 13:572–581.

91. Brint JM, Ohman DE. 1995. Synthesis of multiple exoproducts in Pseu-domonas aeruginosa is under the control of RhlR-RhlI, another set of reg-ulators in strain PAO1 with homology to the autoinducer-responsiveLuxR-LuxI family. J. Bacteriol. 177:7155–7163.

92. Hoang TT, Kutchma AJ, Becher A, Schweizer HP. 2000. Integration-proficient plasmids for Pseudomonas aeruginosa: site-specific integra-tion and use for engineering of reporter and expression strains. Plas-mid 43:59 –72.

93. Figurski DH, Helinski DR. 1979. Replication of an origin-containingderivative of plasmid RK2 dependent on a plasmid function provided intrans. Proc. Natl. Acad. Sci. U. S. A. 76:1648 –1652.




http://jb.asm.org/

Dow

nloaded from

http://dx.doi.org/10.1186/1471-2164-11-587

http://dx.doi.org/10.1186/1471-2164-11-587

http://jb.asm.org

http://jb.asm.org/

Pseudomonas aeruginosa AlgR Phosphorylation Modulates ... · this study, we further characterize...

Documents

Transcript of Pseudomonas aeruginosa AlgR Phosphorylation Modulates ... · this study, we further characterize...