Protein engineering and design - Andrej Sali Lab

14

Transcript of Protein engineering and design - Andrej Sali Lab

Page 1: Protein engineering and design - Andrej Sali Lab
Page 2: Protein engineering and design - Andrej Sali Lab
Page 3: Protein engineering and design - Andrej Sali Lab
Page 4: Protein engineering and design - Andrej Sali Lab
Page 5: Protein engineering and design - Andrej Sali Lab
Page 6: Protein engineering and design - Andrej Sali Lab
Page 7: Protein engineering and design - Andrej Sali Lab
Page 8: Protein engineering and design - Andrej Sali Lab
Page 9: Protein engineering and design - Andrej Sali Lab
Page 10: Protein engineering and design - Andrej Sali Lab
Page 11: Protein engineering and design - Andrej Sali Lab
Page 12: Protein engineering and design - Andrej Sali Lab
Page 13: Protein engineering and design - Andrej Sali Lab
Page 14: Protein engineering and design - Andrej Sali Lab

ANDREJ PUSTOVITOVSKIJ JAN-FREDERIK KREMER

ANDREJ PUSTOVITOVSKIJ JAN-FREDERIK KREMER

Nebojsa Mirkovic, Carles Ferrer-Costa, Marc A. Marti-Renom, Alvaro N.A. Monteiro, Andrej Sali Functional Consequences of the SNPs : BRCA1, Membrane Transporters.

Nebojsa Mirkovic, Carles Ferrer-Costa, Marc A. Marti-Renom, Alvaro N.A. Monteiro, Andrej Sali Functional Consequences of the SNPs : BRCA1, Membrane Transporters.

CV - Andrej Rezonja- mar16-all_in_one

CV - Andrej Rezonja- mar16-all_in_one

1 In · Andrej Sali Lab oratories of Molecular Bioph ysics P els F amily Cen ter for Bio c hemistry and Structural Biology The Ro c k efeller Univ ersit y 1230 Y ork Av en ue, New

1 In · Andrej Sali Lab oratories of Molecular Bioph ysics P els F amily Cen ter for Bio c hemistry and Structural Biology The Ro c k efeller Univ ersit y 1230 Y ork Av en ue, New

Andrej Mlakar 3

Andrej Mlakar 3

Propositions as [Types] - Andrej

Propositions as [Types] - Andrej

Andrej verlic e mo_nfur_ws_uc_jan 2014

Andrej verlic e mo_nfur_ws_uc_jan 2014

SALI na sa TEAM

SALI na sa TEAM

SALI Catalog

SALI Catalog

The Nucleocytoplasmic Rabies Virus P Protein Counteracts ...jvi.asm.org/content/81/8/4255.full.pdf · stranded cDNA was digested by EcoRI and SalI and inserted in frame with ... (GCCGCTAGCATGAGCAAGATCTTTGTT)

The Nucleocytoplasmic Rabies Virus P Protein Counteracts ...jvi.asm.org/content/81/8/4255.full.pdf · stranded cDNA was digested by EcoRI and SalI and inserted in frame with ... (GCCGCTAGCATGAGCAAGATCTTTGTT)

On a bender—BARs, ESCRTs, COPs, and finally - Andrej Sali Lab

On a bender—BARs, ESCRTs, COPs, and finally - Andrej Sali Lab

World Molecular Engineering Network Cabo - Andrej Sali Lab · 2013-04-01 · World Molecular Engineering Network Cabo 2012 ... World Molecular Engineering Network Twenty- ... 10:10

World Molecular Engineering Network Cabo - Andrej Sali Lab · 2013-04-01 · World Molecular Engineering Network Cabo 2012 ... World Molecular Engineering Network Twenty- ... 10:10

preparazione sali nitrati+grafite espansa

preparazione sali nitrati+grafite espansa

Repartitie Sali EMINENT 2014 2015

Repartitie Sali EMINENT 2014 2015

Sali Sasaki - Illustration Works

Sali Sasaki - Illustration Works

Predimensionare Sali

Predimensionare Sali

091614 Cabo 2014 Booklet jw - Sali Lab

091614 Cabo 2014 Booklet jw - Sali Lab

Admitere 2015 Repartizare Candidatilor in Sali

Admitere 2015 Repartizare Candidatilor in Sali

Worldwide R&D Trend, Challenge and Opportunity · Andrej Skrinjar ® Taipei, February 2017. Contents Andrej Skrinjar ® What is between ? Andrej Skrinjar ® How did we get from the

Worldwide R&D Trend, Challenge and Opportunity · Andrej Skrinjar ® Taipei, February 2017. Contents Andrej Skrinjar ® What is between ? Andrej Skrinjar ® How did we get from the

Sali McIntyre salimcintyre@hotmail.com Ph. 0417 439 394

Sali McIntyre [email protected] Ph. 0417 439 394