Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL...

27
Mr. Armfield – Level II Biology 1,2 Mr. Armfield – Level II Biology 1,2 Science Department Science Department Deerfield High School, Deerfield IL Deerfield High School, Deerfield IL Transcription, Translation & Transcription, Translation & Protein Synthesis Protein Synthesis

Transcript of Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL...

Page 1: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Transcription Translation ampTranscription Translation ampProtein SynthesisProtein Synthesis

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Do you remember what proteinsDo you remember what proteinsare made of are made of

Hundreds of Amino Acids link together to make one Protein 1048708 There are 20 types of amino acids some we can make and some we canrsquot 1048708 There are infinite combinations of amino acids 1048708 Can be hundreds or thousands

monomersLongThese long chains are called polypeptide

chains

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Protein SynthesisProtein Synthesis

Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA

Howeverndash DNA is only found in the nucleusndash Proteins are only made outside the

nucleus ndash in the cytoplasm Houston we have a problem

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Protein SynthesisProtein Synthesis

How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus

A molecular cousin of DNA ndash RNA ndash is used to carry these messages

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm)

There are three types of RNA1 mRNA ndash carries a message from the DNA to

the cytoplasm2 tRNA ndash transports amino acids to the mRNA

to make a protein3 rRNA ndash make up ribosomes which make

protein

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

RNA is almost exactly like DNA exceptndash Contains a ribose sugar instead of a

deoxyribose sugar (hence the namehellip)

ndash Contains uracil instead of thyminendash RNA is single-stranded not double-

stranded (usuallyhellip)

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Protein SynthesisProtein Synthesis

Occurs in TWO steps1Transcription ndash the genetic

information from a strand of DNA is copied into a strand of mRNA

2Translation ndash the mRNA with the help of the ribosome forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Central DogmaThe Central Dogma

This order of events is called the central dogma of molecular biology

DNA RNA P RO T E

IN

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix

2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different

3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACT

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed

An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

DNA

exon 1 interon exon 2 interon exon 3

pre-RNA (in nucleus)

exon 1 exon 2 exon 3

RNA (in cytoplasm)

transcription

interon

interon

RNA editing

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo

Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence

How does the mRNA sequence translate into an amino acid sequence

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 2: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Do you remember what proteinsDo you remember what proteinsare made of are made of

Hundreds of Amino Acids link together to make one Protein 1048708 There are 20 types of amino acids some we can make and some we canrsquot 1048708 There are infinite combinations of amino acids 1048708 Can be hundreds or thousands

monomersLongThese long chains are called polypeptide

chains

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Protein SynthesisProtein Synthesis

Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA

Howeverndash DNA is only found in the nucleusndash Proteins are only made outside the

nucleus ndash in the cytoplasm Houston we have a problem

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Protein SynthesisProtein Synthesis

How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus

A molecular cousin of DNA ndash RNA ndash is used to carry these messages

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm)

There are three types of RNA1 mRNA ndash carries a message from the DNA to

the cytoplasm2 tRNA ndash transports amino acids to the mRNA

to make a protein3 rRNA ndash make up ribosomes which make

protein

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

RNA is almost exactly like DNA exceptndash Contains a ribose sugar instead of a

deoxyribose sugar (hence the namehellip)

ndash Contains uracil instead of thyminendash RNA is single-stranded not double-

stranded (usuallyhellip)

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Protein SynthesisProtein Synthesis

Occurs in TWO steps1Transcription ndash the genetic

information from a strand of DNA is copied into a strand of mRNA

2Translation ndash the mRNA with the help of the ribosome forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Central DogmaThe Central Dogma

This order of events is called the central dogma of molecular biology

DNA RNA P RO T E

IN

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix

2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different

3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACT

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed

An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

DNA

exon 1 interon exon 2 interon exon 3

pre-RNA (in nucleus)

exon 1 exon 2 exon 3

RNA (in cytoplasm)

transcription

interon

interon

RNA editing

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo

Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence

How does the mRNA sequence translate into an amino acid sequence

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 3: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Protein SynthesisProtein Synthesis

Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA

Howeverndash DNA is only found in the nucleusndash Proteins are only made outside the

nucleus ndash in the cytoplasm Houston we have a problem

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Protein SynthesisProtein Synthesis

How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus

A molecular cousin of DNA ndash RNA ndash is used to carry these messages

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm)

There are three types of RNA1 mRNA ndash carries a message from the DNA to

the cytoplasm2 tRNA ndash transports amino acids to the mRNA

to make a protein3 rRNA ndash make up ribosomes which make

protein

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

RNA is almost exactly like DNA exceptndash Contains a ribose sugar instead of a

deoxyribose sugar (hence the namehellip)

ndash Contains uracil instead of thyminendash RNA is single-stranded not double-

stranded (usuallyhellip)

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Protein SynthesisProtein Synthesis

Occurs in TWO steps1Transcription ndash the genetic

information from a strand of DNA is copied into a strand of mRNA

2Translation ndash the mRNA with the help of the ribosome forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Central DogmaThe Central Dogma

This order of events is called the central dogma of molecular biology

DNA RNA P RO T E

IN

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix

2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different

3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACT

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed

An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

DNA

exon 1 interon exon 2 interon exon 3

pre-RNA (in nucleus)

exon 1 exon 2 exon 3

RNA (in cytoplasm)

transcription

interon

interon

RNA editing

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo

Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence

How does the mRNA sequence translate into an amino acid sequence

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 4: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Protein SynthesisProtein Synthesis

How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus

A molecular cousin of DNA ndash RNA ndash is used to carry these messages

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm)

There are three types of RNA1 mRNA ndash carries a message from the DNA to

the cytoplasm2 tRNA ndash transports amino acids to the mRNA

to make a protein3 rRNA ndash make up ribosomes which make

protein

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

RNA is almost exactly like DNA exceptndash Contains a ribose sugar instead of a

deoxyribose sugar (hence the namehellip)

ndash Contains uracil instead of thyminendash RNA is single-stranded not double-

stranded (usuallyhellip)

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Protein SynthesisProtein Synthesis

Occurs in TWO steps1Transcription ndash the genetic

information from a strand of DNA is copied into a strand of mRNA

2Translation ndash the mRNA with the help of the ribosome forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Central DogmaThe Central Dogma

This order of events is called the central dogma of molecular biology

DNA RNA P RO T E

IN

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix

2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different

3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACT

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed

An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

DNA

exon 1 interon exon 2 interon exon 3

pre-RNA (in nucleus)

exon 1 exon 2 exon 3

RNA (in cytoplasm)

transcription

interon

interon

RNA editing

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo

Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence

How does the mRNA sequence translate into an amino acid sequence

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 5: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm)

There are three types of RNA1 mRNA ndash carries a message from the DNA to

the cytoplasm2 tRNA ndash transports amino acids to the mRNA

to make a protein3 rRNA ndash make up ribosomes which make

protein

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

RNA is almost exactly like DNA exceptndash Contains a ribose sugar instead of a

deoxyribose sugar (hence the namehellip)

ndash Contains uracil instead of thyminendash RNA is single-stranded not double-

stranded (usuallyhellip)

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Protein SynthesisProtein Synthesis

Occurs in TWO steps1Transcription ndash the genetic

information from a strand of DNA is copied into a strand of mRNA

2Translation ndash the mRNA with the help of the ribosome forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Central DogmaThe Central Dogma

This order of events is called the central dogma of molecular biology

DNA RNA P RO T E

IN

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix

2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different

3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACT

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed

An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

DNA

exon 1 interon exon 2 interon exon 3

pre-RNA (in nucleus)

exon 1 exon 2 exon 3

RNA (in cytoplasm)

transcription

interon

interon

RNA editing

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo

Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence

How does the mRNA sequence translate into an amino acid sequence

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 6: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

RNA is almost exactly like DNA exceptndash Contains a ribose sugar instead of a

deoxyribose sugar (hence the namehellip)

ndash Contains uracil instead of thyminendash RNA is single-stranded not double-

stranded (usuallyhellip)

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Protein SynthesisProtein Synthesis

Occurs in TWO steps1Transcription ndash the genetic

information from a strand of DNA is copied into a strand of mRNA

2Translation ndash the mRNA with the help of the ribosome forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Central DogmaThe Central Dogma

This order of events is called the central dogma of molecular biology

DNA RNA P RO T E

IN

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix

2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different

3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACT

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed

An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

DNA

exon 1 interon exon 2 interon exon 3

pre-RNA (in nucleus)

exon 1 exon 2 exon 3

RNA (in cytoplasm)

transcription

interon

interon

RNA editing

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo

Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence

How does the mRNA sequence translate into an amino acid sequence

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 7: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Protein SynthesisProtein Synthesis

Occurs in TWO steps1Transcription ndash the genetic

information from a strand of DNA is copied into a strand of mRNA

2Translation ndash the mRNA with the help of the ribosome forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Central DogmaThe Central Dogma

This order of events is called the central dogma of molecular biology

DNA RNA P RO T E

IN

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix

2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different

3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACT

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed

An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

DNA

exon 1 interon exon 2 interon exon 3

pre-RNA (in nucleus)

exon 1 exon 2 exon 3

RNA (in cytoplasm)

transcription

interon

interon

RNA editing

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo

Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence

How does the mRNA sequence translate into an amino acid sequence

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 8: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Protein SynthesisProtein Synthesis

Occurs in TWO steps1Transcription ndash the genetic

information from a strand of DNA is copied into a strand of mRNA

2Translation ndash the mRNA with the help of the ribosome forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Central DogmaThe Central Dogma

This order of events is called the central dogma of molecular biology

DNA RNA P RO T E

IN

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix

2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different

3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACT

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed

An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

DNA

exon 1 interon exon 2 interon exon 3

pre-RNA (in nucleus)

exon 1 exon 2 exon 3

RNA (in cytoplasm)

transcription

interon

interon

RNA editing

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo

Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence

How does the mRNA sequence translate into an amino acid sequence

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 9: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Central DogmaThe Central Dogma

This order of events is called the central dogma of molecular biology

DNA RNA P RO T E

IN

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix

2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different

3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACT

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed

An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

DNA

exon 1 interon exon 2 interon exon 3

pre-RNA (in nucleus)

exon 1 exon 2 exon 3

RNA (in cytoplasm)

transcription

interon

interon

RNA editing

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo

Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence

How does the mRNA sequence translate into an amino acid sequence

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 10: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix

2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different

3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACT

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed

An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

DNA

exon 1 interon exon 2 interon exon 3

pre-RNA (in nucleus)

exon 1 exon 2 exon 3

RNA (in cytoplasm)

transcription

interon

interon

RNA editing

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo

Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence

How does the mRNA sequence translate into an amino acid sequence

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 11: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACT

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed

An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

DNA

exon 1 interon exon 2 interon exon 3

pre-RNA (in nucleus)

exon 1 exon 2 exon 3

RNA (in cytoplasm)

transcription

interon

interon

RNA editing

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo

Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence

How does the mRNA sequence translate into an amino acid sequence

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 12: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACT

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed

An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

DNA

exon 1 interon exon 2 interon exon 3

pre-RNA (in nucleus)

exon 1 exon 2 exon 3

RNA (in cytoplasm)

transcription

interon

interon

RNA editing

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo

Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence

How does the mRNA sequence translate into an amino acid sequence

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 13: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step One Step One TranscriptionTranscription

Try it What RNA strand will be made from the following DNA sequence

TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed

An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

DNA

exon 1 interon exon 2 interon exon 3

pre-RNA (in nucleus)

exon 1 exon 2 exon 3

RNA (in cytoplasm)

transcription

interon

interon

RNA editing

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo

Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence

How does the mRNA sequence translate into an amino acid sequence

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 14: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed

An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

DNA

exon 1 interon exon 2 interon exon 3

pre-RNA (in nucleus)

exon 1 exon 2 exon 3

RNA (in cytoplasm)

transcription

interon

interon

RNA editing

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo

Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence

How does the mRNA sequence translate into an amino acid sequence

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 15: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step 1frac12 Step 1frac12 RNA EditingRNA Editing

DNA

exon 1 interon exon 2 interon exon 3

pre-RNA (in nucleus)

exon 1 exon 2 exon 3

RNA (in cytoplasm)

transcription

interon

interon

RNA editing

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo

Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence

How does the mRNA sequence translate into an amino acid sequence

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 16: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo

Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence

How does the mRNA sequence translate into an amino acid sequence

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 17: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Problem ndash There are 20 different amino acidsndash There are 4 RNA bases

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 18: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf

Watch the more complex animation

httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 19: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

1 So how do you exactly go about determining what protein your cells are going to make

2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 20: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 21: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 22: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 23: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 24: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp arg thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 25: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

The Genetic CodeThe Genetic Code

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 26: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

Step Two Step Two TranslationTranslation

2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids

Page 27: Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL

RECAPRECAP

1 DNA is transcribed into mRNA in the nucleus

2 The mRNA leaves the nucleus and enters the cytoplasm

3 The protein is translated from the mRNA sequence using tRNA and amino acids