lable at ScienceDirect

Tuberculosis 91 (2011) 231e237

Contents lists avai

Tuberculosis

journal homepage: http : / / int l .e lsevierhealth.com/journals / tube

IMMUNOLOGICAL ASPECTS

Increased frequencies of T helper type 17 cells in tuberculous pleural effusion

Tingting Wang a,c, Mingming LV a,c, Qian Qian b, Yunzhong Nie a, Like Yu b,*, Yayi Hou a,**

a Immunology and Reproduction Biology Lab, Medical School & State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing 210093, Chinab First Department of Respiratory Medicine, Nanjing Chest Hospital, 215 Guangzhou Road, Nanjing 210029, China

a r t i c l e i n f o

Article history:Received 15 November 2010Received in revised form20 January 2011Accepted 1 February 2011

Keywords:Th17 cellsTuberculous pleural effusionCytokineIFN-g

* Corresponding author. Tel./fax: þ86 25 8372 8558** Corresponding author. Tel./fax: þ86 25 83686341

E-mail addresses: yulike66@163.com (L. Yu), yayihc These authors contributed equally to this work.

1472-9792/$ e see front matter � 2011 Elsevier Ltd.doi:10.1016/j.tube.2011.02.002

s u m m a r y

Th17 cells have emerged as an important mediator in inflammatory and autoimmune diseases. Recentstudies suggest a potential impact of Th17 cells on tuberculosis (TB) infection. This study was designed toinvestigate the possible involvement of Th17 cells in tuberculous pleural effusion. Compared withhealthy volunteers, patients with TB had a higher proportion of Th17 cells in peripheral blood mono-nuclear cells (PBMCs). Moreover, the percentage of Th17 cells in pleural effusions of TB patients wasobviously higher than that in PBMC from TB patients or healthy controls. Furthermore, the mRNA andprotein expression levels of IL-17 and IL-6 were significantly increased in the patients with tuberculouspleural effusion, while expression level of TGF-b was decreased in the pleural effusion. Correlationanalysis showed a significant correlation between IFN-g concentrations and the frequencies of Th17 cellsin tuberculous pleural effusion. These results indicate that Th17 cells may contribute to the immuno-pathogenesis of tuberculous pleural effusion.

� 2011 Elsevier Ltd. All rights reserved.

1. Introduction

Tuberculosis (TB) is an international public health priority andkills almost two million people annually. 14% of patients with TBwill have tuberculous pleuritis,1 which usually presents as an acuteillness with fever, cough, pleuritic chest pain and tuberculouspleural effusion. TB-related pleural effusions occur in approxi-mately 2%e10% of TB patients, with a male to female ratio of 2:1,and can result from primary or reactive TB.2,3 The pleural fluid is anexudate in which the predominant cell type is lymphocytes. It iswell known that bacterial, host and environmental factors influ-ence the development of TB.4 An improved understanding of theimmunopathogenesis of tuberculous pleural effusion can drive thedevelopment of new immunodiagnostic tools, accelerate andfacilitate the evaluation of new therapeutic interventions.

T cell response is a critical component of the protective immu-nity against mycobacterium (M.) tuberculosis.5 During mycobac-terial infection, the CD4þ Th1 cells mount a much stronger IFN-gresponse than CD8þ T cells,6 and are thought to play a prominentrole in protection.7 The lack of CD4þ T cells may result in delayeddistribution of activated CD8þ T cells from draining lymph nodes todistant organs and consequently cause a delayed acquisition of

..ou@nju.edu.cn (Y. Hou).

All rights reserved.

immune protection.8 Moreover, the CD4þ T cells can be differenti-ated into Th1, Th2, Th17 and Treg cells. The Th1 cells producecytokines, notably IFN-g, which prompt stimulation of Th1 cells,CD8þ T cells, and maturation and activation of macrophages. TheTh2 cells produce B cell-stimulation factors, which promote anti-body production but suppress the Th1 type immune response. Earlystudies have proved that IFN-g-producing Th1 cells are essential tocontrol the mycobacterial replication, but Th1 cells alone do notexplain the resistance/susceptibility to infection and disease.9 Themore recently described Th17 cells have also been associated withM. tuberculosis infection. The Th17 cells, a distinct subset of helperT cells, produce unique cytokines of IL-17, IL-17F, IL-21 and IL-22,which stimulate defensin production and recruit neutrophils andmonocytes to the site of inflammation, and are involved in the earlyphase of host defence. IL-17 is produced early during immuneresponse against M. tuberculosis and it has been proposed to beassociated with reactivation in latent TB infected individuals.10

Importantly, the kinetics of IFN-gand IL-17 production and thephenotypic and functional characteristics of Th1 and Th17 cells aredifferent.11 Nevertheless, the precise role of Th17 cell in theimmunopathogenesis of TB, especially in tuberculous pleuraleffusion remains unclear.

In this study, we evaluated the frequencies of Th17 cells inperipheral blood and tuberculous pleural effusion, the mRNAexpressions of Th17 cells-related factors in cells from patients withtuberculous pleural effusion, the concentrations of Th17 cells-related cytokines in serum and effusion, allowing for analysis oftheir involvement in the pathogenesis of tuberculosis.

Table 1The name, GenBank accession number, primer sequences and reported function of Thelper type 17 (Th17) differentiation-related genes.

Genes AccessionNo.

Primers (50 to 30) Reportedfunctions

IL-1b NM_000576 FP: CTGATGGCCCTAAACAGATGAARP: TGAAGCCCTTGCTGTAGTGGTG

Induce humanTh17 polarization

IL-6 NM_000600 FP:AAGCCAGAGCTGTGCAGATGAGTARP: TGTCCTGCAGCCACTGGTTC

Induce humanand mouse Th17polarization

IL-23 NM_016584 FP: GCAGCCTGAGGGTCACCACTRP: GGCGGCTACAGCCACAAA

Unique subunitof IL-23

IL�17A NM_002190 FP: TGTCCACCATGTGGCCTAAGAGRP: GTCCGAAATGAGGCTGTCTTTGA

Main effectivecytokine of Th17cells

RORgt NM_005060 FP: GCTGTGATCTTGCCCAGAACCRP: CTGCCCATCATTGCTGTTAATCC

Master regulatorytranscriptionfactors of Th17lineage

TGF-b1 NM_000660 FP: AGCGACTCGCCAGAGTGGTTARP: GCAGTGTGTTATCCCTGCTGTCA

Suppress humanTh17 polarization

IL, interleukin; ROR, retinoid-related orphan receptor; TGF, transforming growthfactor.

T. Wang et al. / Tuberculosis 91 (2011) 231e237232

2. Materials and methods

2.1. Patients and samples

Forty-one patients diagnosed newly with tuberculous pleuraleffusion treated at the Nanjing Chest Hospital were recruited in thisstudy. The study was approved by local ethical committee andwritten informed consent was obtained from all subjects. Fresheffusions drained from patient were transferred to 50 ml tubes.Cells were prepared by centrifuging at 1500 rpm for 15 min fol-lowed by Ficoll-Hypaque (specific gravity 1.077, Pharmacia) densitycentrifugation. Erythrocytes in the pellet were lysed bymixing each5 ml of the effusion suspension with 40 ml erythrocyte lysis buffer(155 mM NH4Cl, 10 mM NaHCO3, 1 mM EDTA) and incubating atroom temperature for 15 min. The number and viability of cellswere determined by trypan blue dye and cytological examination.The final cell pellets were washed twice with PBS and prepared forflow cytometry assay and RNA extraction. Another 10 ml effusionwas also collected from each subject for determination ofbiochemical markers. All biochemical marker assays were per-formed at the Nanjing Chest Hospital and the investigators wereblinded of the clinical findings.

Peripheral blood mononuclear cells (PBMCs), collected fromnormal healthy volunteer donors and TB patients, were isolatedfrom heparinized peripheral blood of the studied subjects bystandard FicollePaque (GE Healthcare, Uppsala, Sweden) densitycentrifugation.

2.2. Flow cytometry

For Th17 cell detection, 2 � 106 cells were stimulated addi-tionally for 4 h with 50 ng/ml phorbol myristate acetate, 1 mMionomycin (both from Sigma, St Louis,MO, USA) and 10 mg/mlbrefeldin A (Tocris Cookson, Bristol, UK) in complete RPMI-1640(Invitrogen, Carlsbad, CA, USA) supplemented with 10% heat-inac-tivated fetal bovine serum (Gibco, Grand Island, NY, USA). Uponharvest, cells were first surface-stained with fluorescein iso-thiocyanate-conjugated anti-human CD4 antibodies for 20 min,then fixed and permeabilized with Perm/Fix solution, and finallystained intracellularly with phycoerythrin (PE)-conjugated anti-human IL-17A. Isotope controls were used to ensure antibodyspecificity. All antibodies and fixation/permeabilization agentswere purchased from eBioscience (eBioscience, San Diego, CA,USA). Data were acquired on FACS Vantage SE and analyzed withCellQuest software. A region encircling lymphocytes was set usinga forward scatter (FSC) versus side scatter (SSC) display, and allfluorescent parameters were gated on this population. Thefrequencies of Th17 cells were expressed as a ratio of CD4þIL-17Aþ

cells to CD4þ cells.

2.3. RNA extraction, cDNA synthesis and quantitative PCR

Total RNA was extracted from 1 � 106 cells using Trizol LSReagent (Invitrogen, Carlsbad, CA, USA) according to the manu-facture’s protocol. All the samples were treated with DNaseI toeliminate potential genomic DNA contamination. The quality andquantity of the RNA were determined by ultraviolet spectropho-tometer. cDNA of 1 mg total RNA was synthesized using randomprimers and Primescript reverse transcriptase (TOYOBO, Osaka,Japan). Quantitative PCR reactions for target genes were carried outusing SYBR green qPCR kit (Roche, Basel, Switerland) by ABI Ste-pone Plus Detection System (Applied Biosystems, Foster City, CA,USA). The name, GenBank accession number, primer sequences andreported function of target genes are presented in Table 1. The PCRconditions were 95 �C for 10 min, followed by 40 cycles at 95 �C for

15 s, 60 �C for 30 s and 72 �C for 30 s. For the dissociation curve,reactions were incubated at 95 �C for 1 min, and ramp up from55 �C to 95 �C with a heating rate of 0.1 �C/s and continuous fluo-rescence measurement. Each sample was assayed in triplicates.Relative gene expression quantifications were calculated accordingto the comparative Ct method using b-actin as an internal standardand commercial RNA (Clontech) as calibrators. Gene expressionwasanalyzed and quantified by the formula 2�DDCt.

2.4. Cytokine analysis

Serum and supernatants of effusionwere analyzed for cytokinesusing the Proteome Profiler Array ARY005 (R&D systems, Minne-apolis, MN, USA) according to manufacturer’s instructions. Briefly,1 ml serum diluted in 0.5 ml array buffer was mixed with a 15 mlcocktail of biotinylated detection antibodies. The serum/antibodymixture is then incubated with the Human Cytokine Array Panel A.Any cytokine/detection antibody complex present is bound by itscognate immobilized capture antibody on the membrane.Following a wash to remove unbound material, Streptavidin-Horseradish Peroxidase and chemiluminescent detection reagentswere added. Array images are from 5 min exposures to X-ray film.The array allows to detect the following proteins: BLC, C5a, G-CSF,GM-CSF, I-309, Eotaxin, sICAM-1, IFN-g, IL-1a, IL-1b, IL-1ra, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12p70, IL-13, IL-16, IL-17, IL-23, IL-27,IP-10, I-TAC, KC, M-CSF, JE, MCP-5, MIG, MIP-1a, MIP-1b, MIP-2,RANTES, SDF-1, TARC, TIMP-1, TNF-a, and TREM-1.

2.5. ELISA

Concentrations of IL-23, IL-17A, TGF-band IFN-g in the super-natant of effusion and serum were measured by commerciallyavailable ELISA kits (eBioscience, San Diego, CA, USA), according tothe protocols provided by the manufacturer. All samples wereassessed in triplicate.

2.6. Statistical analysis

Datawere presented as means� standard deviation (S.D.) in thetext and figures. Normally distributed data were analyzed usingone-way anova followed by the StudenteNewmaneKeuls post-hoctest. Comparisons between paired or unpaired two groups were

Table 2Clinical characteristics of the populations studied.

Characteristic Control （n ¼ 17） TB (n ¼ 41)

Age 42.8 � 20.5 45.2 � 20.3Gender Male 8 31

Female 9 10Blood LDH (U/L) 168.6 � 60.4 187.5 � 73.1

ADA (U/L) 12.8 � 5.8 16.7 � 7.1Total protein (g/L) 70.2 � 5.5 68.8 � 6.5Albumin (g/L) 41.3 � 6.2 38.1 � 4.1

Pleural effusion LDH (U/L) 484.2 � 282.4ADA (U/L) 44.1 � 20.5IFN-g (ng/L) 487.3 � 246.2

All data are expressed as mean � standard deviation.LDH ¼ lactate dehydrogenase; ADA ¼ adenosine deaminase.

T. Wang et al. / Tuberculosis 91 (2011) 231e237 233

performed using the ManneWhitney U-test. Spearman’s correla-tionwas used to test correlation between two continuous variables.Statistical analysis was performed using spss version 15$0 forWindows software (SPSS, Inc., Chicago, IL, USA). P < 0.05 wasconsidered to be statistically significant.

3. Results

3.1. Clinical characteristics of studied groups

Of the 41 individuals with tuberculous pleural effusions, 31(75.6%) were male and 10 (24.4%) were female, with an average ageof 45.2 � 20.3 years (range 19e83 years). 17 healthy adults(42.8 � 20.5 years, 9 female and 8 male) were included as healthycontrols. The traditional blood and effusion markers, includinglactate dehydrogenase (LDH), adenosine deaminase (ADA), totalprotein and albumin were presented in Table 2. No parameter wassignificantly different between control and TB patient group.

Figure 1. Increased frequencies of Th17 cells in peripheral blood and effusion from patients weffusion was evaluated by flow cytometric analysis. Representative plots (A) and summarizedof Th17 cells in comparison to healthy donors. Besides, there was significant difference in themean � standard deviation.

3.2. Patients with tuberculous pleural effusions have a higherfrequency of Th17 cells

The population of Th17 cells as a percentage of total CD4þ cellswas evaluated by flow cytometric analysis. Representative plotsshowed that the population of Th17 cells in gated CD4þ T cells wasincreased in the blood of the patient with TB in comparison withthat in healthy donor. Notably, the population of Th17 cells in thepleural effusion was much higher than that in the PBMC from thesame individual (Figure 1A). Summarized data from all individualsindicated that the proportion of peripheral blood Th17 cells in TBpatients was significantly higher than that in healthy donors(5.85 � 2.60% vs 1.83 � 1.27%, P ¼ 0.002). Moreover, the percentageof Th17 cells in pleural effusions of TB patients was obviously higher(10.43� 5.49%) than that in PBMC from patients or healthy controls(P < 0.001) (Figure 1B). Next, we compared the frequencies of Th17cells between PBMC and pleural effusions in TB patients (n ¼ 32)using paired samples. We found that the proportions of Th17 cellswere significantly higher in the pleural effusion than that in thePBMC (10.43� 5.49% vs 5.79� 2.50%, P¼ 0.01). These observationsindicated that the patients with TB had a predominantly increasedpopulation of Th17 cells, especially in the pleural effusions.

3.3. Expression of Th17 cell-related genes in patients withtuberculous pleural effusions

We further investigated themRNAexpression levels of Th17 cell-related factors in blood and pleural effusions from patients with TB(n ¼ 39) by quantitative PCR. Compared with healthy controls, themRNA expressions of IL-6 and IL-17A were up-regulated signifi-cantly in the pleural effusion of TB patients, whereas TGF-b1 wasobviously down-regulated in TB patients (Figure 2). However, otherTh17 cell-related factors, including IL-1b, IL-23 and RORgt, did notappear to be expressed differentially among these groups.

ith TB. The population of Th17 cells as a percentage of total CD4þ cells in the blood anddata from all individuals (B) showed that patients with TB had an increased prevalenceprevalence of Th17 cells between the effusion and blood (C). Results were expressed as

Figure 2. Expression of Th17-related genes in patients with tuberculous pleural effusions. mRNA expressions of IL-1b (A), IL-6 (B), IL-23 (C), IL-17A (D), RORgt (E) and TGF-b1 (F)were detected using real time quantitative PCR. When compared with healthy controls, mRNA expression of IL-6 and IL-17A were significantly up-regulated, whereas TGF-b1 wasobviously down-regulated in patients with TB. Data are presented as mean � standard deviation.

T. Wang et al. / Tuberculosis 91 (2011) 231e237234

3.4. Cytokine production is increased in pleural effusion of patientwith tuberculous pleural effusions

Cytokine production is a key process by which activated T cellsparticipate in immune response. Therefore, the cytokine produc-tion ability was assessed using Proteome Profiler Array. As shown inFigure 3, multiple cytokines was significantly up-regulated inpleural effusion of TB patient compared with that in healthy doner.These cytokines include proinflammatory cytokines (IFN-gandIL-6) and chemotactic factors (CXCL1, CXCL10 and CCL2).

3.5. Concentrations of Th17 cell-related cytokines in patients withtuberculous pleural effusions

As described above, proteome profiler array was analyzed toevaluate 40 cytokines at protein level. In addition, concentrations ofIL-6, IL-17A, TGF-b1 and IFN-g were analyzed using ELISA toconfirm the result of the proteome profiler array. As shown inTable 3, serum concentrations of IL-6 and IFN-g were significantlyhigher in TB patients than that in healthy controls (IL-6:

9.04 � 4.76 pg/ml vs 4.38 � 0.08 pg/ml, P < 0.01; IFN-g: 21.6 � 19.9pg/ml vs 1.43 � 0.83 pg/ml, P < 0.01). When compare cytokineconcentrations between effusion and serum in TB patients, IL-17A,IL-6 and IFN-g were significantly elevated in the pleural effusion.Meanwhile, the concentration of TGF-b1 was decreased in theserum and effusion from TB patient, compared with healthycontrols (2773.6 � 943.5 pg/ml vs 5765.6 � 1672.3 pg/ml, P < 0.05;2780.6 � 903.7 pg/ml vs 5765.6 � 1672.3 pg/ml, P < 0.05).

We further analyzed the correlation between the population ofTh17 cell and cytokine concentrations in the pleural effusions of TBpatients. As shown in Figure 4, we found a significant correlationbetween IFN-g concentrations and the frequencies of Th17 cells(P < 0.001, r ¼ �0.76). However, the concentration of IL-6, IL-17Aand TGF-b1 did not correlate with the frequencies of Th17 cells.

4. Discussion

TB-related pleural effusions result from the infiltration of thepleural space by M. tuberculosis antigens or bacilli. In the presentstudy, we demonstrate the involvement of Th17 cells, both cytokine

Figure 3. Proinflammatory cytokines was increased in the pleural effusion of patient with TB. Cytokine profiles from serum of healthy doner (A), serum and effusion of oneindividual TB patient (B and C) were detected by capture antibodies spotted in duplicate on nitrocellulose membranes. The high-intensity spots in the three corners are positivecontrols (PC). Selected cytokines are labeled: red, cytokines that increased by greater than 2-fold in the patient compared with healthy doner; blue, cytokines that decreased bygreater than 2-fold in the patient compared with healthy doner; black, cytokines that increased or decreased by less than 2-fold or did not change in the patient compared withhealthy donor. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

T. Wang et al. / Tuberculosis 91 (2011) 231e237 235

profile and cell numbers, in the immunology of tuberculous pleuraleffusions. Furthermore, we found that cytokine circumstance wastotally different between peripheral blood and pleural effusion inTB patient, which was theoretically prone to Th17 differentiationsin tuberculous pleural effusion.

Th17 cells and their effective cytokines are being recognizedincreasingly as important mediators in inflammatory and autoim-mune diseases, but relatively little is known about their specificroles in tuberculous pleural effusions. Wozniak et al. have provedthat an IL-17-producing CD4þ T cell population can occur inresponse to mycobacteria.12 Umemura et al. reported that theabsence of IL-17 could result in reduced mononuclear and poly-morphonuclear infiltration early in the BCGmodel.13 These findingssuggest that Th17 cells may play a role in the immunopathology oftuberculosis. Nevertheless, Chen et al. have demonstrated thatfrequency of Th17 cells in patients with active TB is lower than

Table 3Serum and effusion concentrations of Th17 cell-related cytokines in patients with TBand healthy controls.

Cytokine Serum from HealthyControls (n ¼ 8)

Serum from TBpatients (n ¼ 16)

Effusion from TBpatients (n ¼ 16)

IL-6 4.38 � 0.08 9.04 � 4.76** 613.5 � 346.5**##IL�17A 0.54 � 0.17 1.14 � 2.38 6.66 � 3.12**##TGF-b1 5765.6 � 1672.3 2773.6 � 943.5* 2780.6 � 903.7*IFN-g 1.43 � 0.83 21.6 � 19.9** 1547.8 � 1423.2**##

Data are presented as mean � standard deviation.IL, interleukin; TGF, transforming growth factor; IFN, interferon; *P < 0.05**P < 0.01, serum from TB patients vs serum from healthy controls; #P < 0.05##P < 0.01, effusion from TB patients vs serum from TB patients.

those in healthy donors and individuals with latent TB infection.14

To assess whether Th17 cells contribute to the immunopathologyof TB, especially to tuberculous pleural effusions, we studieddifferent characteristics of Th17 cells in patients with tuberculouspleural effusions. Our results showed that the proportion ofperipheral blood Th17 cells in TB patients was significantly higherthan that in healthy donors. Moreover, the pleural effusions of TBpatients had an obviously higher percentage of Th17 cells than thatin PBMC from patients or healthy controls. These observationsindicated that patients with TB had a predominantly increasedpopulation of Th17 cells, especially in the pleural effusions. Somestudies in animals have demonstrated that IL-17 can act asa mediator of macrophage accumulation15 and can mediateinduction of CXCL chemokines containing IL-17 associatedpromoter elements.16�17 Hence, the increased number of Th17 cellsin tuberculous pleural effusions may be explained as a protectivereaction of the immune system in certain stages of the disease,which may promote local immune response and the recognition oftuberculosis through secretion of IL-17. On the other hand, Th17 cellfrequency has been reported as an evaluation of therapeutic effectin hepatocellular carcinoma and acute myeloid leukaemia.18�19 Inthe study by Chen et al,14 the reduced Th17 responses were asso-ciated with the clinical outcome of M. tuberculosis infection.Whether the measurement of Th17 cell numbers has diagnostic orprognostic significance for tuberculous pleural effusions needsfurther research.

In the present study we demonstrated a Th17-cell-relatedcytokine profile in tuberculous pleural effusions. Human Th17 celldifferentiation was reported to be induced mainly by IL-1b andenhanced by IL-6 but, unlike its murine counterpart, was

Figure 4. Spearman’s correlation of T helper type 17 (Th17) cell frequencies and related cytokine concentrations (A, IL-6; B, IL-17A; C, TGF-b1; D, IFN-g) in pleural effusion ofpatients with TB (n ¼ 32). IFN-g concentrations correlated negatively with Th17 cell frequencies (r ¼ -0.76, P < 0$001).

T. Wang et al. / Tuberculosis 91 (2011) 231e237236

suppressed by transforming growth factor (TGF)-b1.23�24 In addi-tion, IL-23, a heterodimer composed of a unique subunit p19 anda common subunit p40, was also identified to contribute to thedifferentiation and maintenance of Th17 cells.24�25 These keycontributors of Th17 differentiation, together with retinoid-relatedorphan receptor (ROR)gt, the master regulatory transcriptionfactors of Th17,26 were chosen for our present study. We founda significant increase in IL-6 and decrease in TGF-b, which weretheoretically prone to Th17 differentiations. IL-6 is a critical factorfor Th17-cell differentiation, while the role of TGF-b is subject tointense debate. Three reports have demonstrated that TGF-bdoeshave a role in promoting differentiation of human Th17 cells in vitroand that previous failures to identify a role for TGF-breflected thehigh content of this cytokine in fetal bovine or human serum usedto culture the T cells.27e29 It appears that high concentrations ofTGF-b, such as that present in FCS can inhibit Th17 differentiation,but that lower concentrations may promote it. Under these cyto-kine circumstances, the peripheral population of Th17 cells waschanged accordingly.

In the present study, we found a negative correlation betweenIFN-g concentrations and the frequencies of Th17 cells in pleuraleffusions, which suggest an involvement of Th17/Th1 balance in thedevelopment of tuberculous pleural effusions. During active TBdisease there is an exuberant local pulmonary immune responsecharacterized by the enhancement of M. tuberculosis antigen-specific Th1 responses,30 with large amounts of locally secretedIFN-g.31 IFN-gcan activate macrophages in conjunction with TNF-ato effect killing of intracellular mycobacteria through reactiveoxygen and nitrogen intermediates.32 Meanwhile, Th17 cells canrecruit neutrophils and monocytes, and IFN-g-producing CD4þ Tcells, and stimulate chemokine expression. However, IFN-g in turncan suppress the IL-17-producing Th17 cells. Cruz et al33 provedthat IFN-g regulate the induction and expansion of IL-17-producingCD4þ T cells during mycobacterial infection. Our data in this studyalso support this interaction. Thus, there appears to be a complexcross-regulation between Th1 and Th17 cell responses, which mayhave impact on the consequences of mycobacterial infection.

In summary, our study revealed that Th17 cells, both cytokineprofile and cell numbers, exists in the pleural effusion of patientswith TB, suggesting its potential role in protective immunity againstM. tuberculosis in pleural effusion. Our data lend further support tothe hypothesis that IFN-gmay play an essential role in Th17-relatedresponse during mycobacterial infection. Specifically, it is inter-esting to note that some drugs and cytokines have been reportedrecently to regulate the differentiation of Th17 cells in mice.34�35

Further research will be developed to explore the influence ofthese drugs on TB through regulation of Th17/Th1 balance.

Funding: This work was supported by grant from the majorprogram of Nanjing Medical Science and Technique DevelopmentFoundation (Personalized Therapy of Non-small Cell Lung CancerPatients), and grant from Specialized Research Fund for theDoctoral Program of Higher Education (Project number20100091120002).

Conflict of interest statement: The authors declare no conflictof interest.

Ethical approval: The study was approved by local ethicalcommittee in Nanjing Chest Hospital, China.

Acknowledgments

None.

References

1. World Health Organization. Global tuberculosis control 2009: epidemiology,strategy, financing. Geneva: WHO; 2009.

2. Porcel JM. Tuberculous pleural effusion. Lung 2009;187:263e70.3. Baumann MH, Nolan R, Petrini M, Lee YC, Light RW, Schneider E. Pleural

tuberculosis in the United States: incidence and drug resistance. Chest2007;131:1125e32.

4. Dietrich J, Doherty TM. Interaction ofMycobacterium tuberculosiswith the host:consequences for vaccine development. APMIS 2009;117:440e57.

5. Cooper AM. Cell-mediated immune responses in tuberculosis. Annu RevImmunol 2009;27:393e422.

T. Wang et al. / Tuberculosis 91 (2011) 231e237 237

6. Ngai P, McCormick S, Small C, Zhang X, Zganiacz A, Aoki N, et al. Gammainterferon responses of CD4 and CD8 T-cell subsets are quantitatively differentand independent of each other during pulmonary Mycobacterium bovis BCGinfection. Infect Immun 2007;75:2244e52.

7. Kaufmann SH, McMichael AJ. Annulling a dangerous liaison:vaccination strat-egies against AIDS and tuberculosis. Nat. Med 2005;11:S33e44.

8. Wang J, Santosuosso M, Ngai P, Zganiacz A, Xing Z. Activation of CD8T cells bymycobacterial vaccination protects against pulmonary tuberculosis in theabsence of CD4 T cells. J Immunol 2004;173:4590e7.

9. Scriba TJ, Kalsdorf B, Abrahams DA, Isaacs F, Hofmeister J, Black G, et al. Distinct,specific IL-17- and IL-22-producing CD4t T cell subsets contribute to the humananti-mycobacterial immune response. J Immunol 2008;180:1962e70.

10. Cooper AM, Khader SA. The role of cytokines in the initiation, expansion,and control of cellular immunity to tuberculosis. Immunol Rev 2008;226:191e204.

11. Annunziato F, Cosmi L, Santarlasci V, Maggi L, Liotta F, Mazzinghi B, et al.Phenotypic and functional features of human Th17 cells. J Exp Med2007;204:1849e61.

12. Wozniak T, Ryan A, Britton W. Interleukin-23 restores immunity to Mycobacte-rium tuberculosis infection in IL-12p40-deficient mice and is not required for thedevelopment of IL-17-secreting T cell responses. J Immunol 2006;177:8684e92.

13. Umemura M, Yahagi A, Hamada S, Begum M, Watanabe H, Kawakami K, et al.IL-17-Mediated Regulation of Innate and Acquired Immune Response againstPulmonary Mycobacterium bovis Bacille Calmette-Guerin Infection. J Immunol2007;178:3786e96.

14. Chen X, Zhang M, Liao M, Graner MW, Wu C, Yang Q, et al. Reduced Th17response in patients with tuberculosis correlates with IL-6R expression onCD4 þ T Cells. Am J Respir Crit Care Med 2010;181:734e42.

15. Sergejeva S, Ivanov S, Lotvall J, Linden A. IL-17 as a recruitment and survivalfactor for airway macrophages in allergic airway inflammation. Am J Resp CellMol Biol 2005;33:248e53.

16. Shen F, Hu Z, Goswami J, Gaffen S. Identification of common transcriptionalregulatory elements in interleukin-17 target genes. J Biol Chem 2006;281:24138e48.

17. Khader S, Bell G, Pearl J, Fountain J, Rangel-Moreno J, Cilley G, et al. IL-23 andIL-17 in establishment of protective pulmonary CD4 + T cell responses uponvaccination and during Mycobacterium tuberculosis challenge. Nat Immunol2007;8:369e77.

18. Zhang JP, Yan J, Xu J, Pang XH, Chen MS, Li L, et al. Increased intratumoral IL-17-producing cells correlate with poor survival in hepatocellular carcinomapatients. J Hepatol 2009;50:980e9.

19. Wu C, Wang S, Wang F, Chen Q, Peng S, Zhang Y, et al. Increased frequencies ofT helper type 17 cells in the peripheral blood of patients with acute myeloidleukaemia. Clin Exp Immunol 2009;158:199e204.

23. Acosta-Rodriguez EV, Napolitani G, Lanzavecchia A, Sallusto F. Interleukins 1beta and 6 but not transforming growth factor-beta are essential for thedifferentiation of interleukin 17-producing human T helper cells. Nat Immunol2007;8:942e9.

24. Veldhoen M, Hocking RJ, Atkins CJ, Locksley RM, Stockinger B. TGF beta in thecontext of an inflammatory cytokine milieu supports de novo differentiation ofIL-17-producing T cells. Immunity 2006;24:179e89.

25. Bettelli E, Carrier Y, Gao W, Korn T, Strom TB, Oukka M, et al. Reciprocaldevelopmental pathways for the generation of pathogenic effector TH17 andregulatory T cells. Nature 2006;441:235e8.

26. Ivanov II , McKenzie BS, Zhou L, Tadokoro CE, Lepelley A, Lafaille JJ, et al. Theorphan nuclear receptor RORgammat directs the differentiation program ofproinflammatory IL17 + T helper cells. Cell 2006;126:1121e33.

27. Yang L, Anderson DE, Baecher-Allan C, Hastings WD, Bettelli E, Oukka M, et al.IL-21 and TGF-beta are required for differentiation of human T(H)17 cells.Nature 2008;454:350e2.

28. Manel N, Unutmaz D, Littman DR. The differentiation of human T(H)-17 cellsrequires transforming growth factor-beta and induction of the nuclear receptorRORgammat. Nat Immunol 2008;9:641e9.

29. Volpe E, Servant N, Zollinger R, Bogiatzi SI, Hupé P, Barillot E, et al. A criticalfunction for transforming growth factorbeta, interleukin 23 and proinflammatory cytokines in driving and modulating human T(H)-17 responses.Nat Immunol 2008;9:650e7.

30. Schwander SK, Torres M, Sada E, Carranza C, Ramos E, Tary-Lehmann M, et al.Enhanced responses to Mycobacterium tuberculosis antigens by human alve-olar lymphocytes during active pulmonary tuberculosis. J Infect Dis1998;178:1434e45.

31. Taha RA, Kotsimbos TC, Song YL, Menzies D, Hamid Q. IFN-gamma and IL-12are increased in active compared with inactive tuberculosis. Am J Respir CritCare Med 1997;155:1135e9.

32. Herrera MT, Torres M, Nevels D, Perez-Redondo CN, Ellner JJ, Sada E, et al.Compartmentalized bronchoalveolar IFN-gamma and IL-12 response in humanpulmonary tuberculosis. Tuberculosis 2009;89:38e47.

33. Cruz A, Khader SA, Torrado E, Fraga A, Pearl JE, Pedrosa J, et al. Cutting edge:IFN-gamma regulates the induction and expansion of IL-17-producing CD4 Tcells during mycobacterial infection. J Immunol 2006;177:1416e20.

34. Niedbala W, Wei X, Cai B, Hueber AJ, Leung BP, McInnes IB, et al. IL-35 isa novel cytokine with therapeutic effects against collagen-induced arthritisthrough the expansion of regulatory T cells and suppression of Th17 cells. Eur JImmunol 2007;37:3021e9.

35. Mucida D, Park Y, Kim G, Turovskaya O, Scott I, Kronenberg M, et al. ReciprocalTh17 and regulatory T cell differentiation mediated by retinoic acid. Science2007;317:256e60.