JOURNAL OF BACTERIOLOGY, Sept. 2011, p. 4338–4345 Vol. 193, No. 170021-9193/11/$12.00 doi:10.1128/JB.05140-11Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Identification of a Chemoreceptor Zinc-Binding Domain Common toCytoplasmic Bacterial Chemoreceptors�

Jenny Draper,1,2 Kevin Karplus,1 and Karen M. Ottemann2*Department of Biomolecular Engineering, University of California at Santa Cruz, Santa Cruz, California 95064,1 and

Department of Microbiology and Environmental Toxicology, University of California at Santa Cruz, Santa Cruz, California 950642

Received 25 April 2011/Accepted 23 June 2011

We report the identification and characterization of a previously unidentified protein domain found inbacterial chemoreceptors and other bacterial signal transduction proteins. This domain contains a motif ofthree noncontiguous histidines and one cysteine, arranged as Hxx[WFYL]x21-28Cx[LFMVI]Gx[WFLVI]x18-27HxxxH (boldface type indicates residues that are nearly 100% conserved). This domain was first identified inthe soluble Helicobacter pylori chemoreceptor TlpD. Using inductively coupled plasma mass spectrometry onheterologously and natively expressed TlpD, we determined that this domain binds zinc with a subfemtomolardissociation constant. We thus named the domain CZB, for chemoreceptor zinc binding. Further analysisshowed that many bacterial signaling proteins contain the CZB domain, most commonly proteins thatparticipate in chemotaxis but also those that participate in c-di-GMP signaling and nitrate/nitrite sensing,among others. Proteins bearing the CZB domain are found in several bacterial phyla. The variety of signalingproteins using the CZB domain suggests that it plays a critical role in several signal transduction pathways.

Chemotactic signaling systems are employed by bacteria andarchaea to follow beneficial chemical gradients and avoidharmful ones (reviewed in references 31 and 42). Chemotaxisis guided by chemoreceptor proteins that sense particular li-gands, either directly or indirectly, and transmit that ligand-binding signal to downstream members of the chemotaxis sig-nal transduction cascade. Chemoreceptors are readily dividedinto two domains (44). The sensory domain detects ligands andis highly variable between different receptors, while the highlyconserved signaling domain interacts with the coupling proteinCheW and has several names, including the “methyl-accept-ing” (MA) domain and the “methyl-accepting chemotaxis pro-tein (MCP) signal,” although not all such domains are meth-ylated (15, 44). Chemoreceptors act in a ternary complex withCheW and the CheA kinase to control the activity of CheAand, in turn, to dictate the amount of phosphorylated CheY,the substrate of CheA. Most chemoreceptor protein se-quences, as classified by the presence of the MA domain, alsocontain transmembrane regions. In the bacterial chemotaxissystem, localization in the cell membrane is congruous with thefunction of chemoreceptors to detect extracellular environ-mental signals. However, a large number of proteins with thechemoreceptor MA domain lack transmembrane regions andare thought to monitor the intracellular energy or metabolicstatus of the cell (44). The best characterized of these is theBacillus subtilis HemAT chemoreceptor that utilizes a hemedomain to sense oxygen (18).

The bacterial pathogen Helicobacter pylori requires che-motaxis to promote mammalian colonization (13, 38). H. pylorihas three transmembrane chemoreceptors, TlpA, TlpB, andTlpC, and a single cytoplasmic chemoreceptor, TlpD, which

was formerly called HylB or HlyB (2, 11, 40). TlpA and TlpCare needed for mouse stomach colonization (5), and TlpA wasproposed previously to sense arginine and a few other mole-cules (10), while no ligands have been found for TlpC. TlpB isnot required for wild-type mouse or gerbil stomach coloniza-tion (29, 43) and has been shown to mediate the response of H.pylori to low pH (11).

The H. pylori TlpD protein, the focus of this work, lackstransmembrane domains and resides as a soluble protein (35).Previously reported experiments suggest that TlpD senses thecellular energy levels of H. pylori (35). Specifically, Schwein-itzer and colleagues observed that the treatment of H. pyloriwith chemicals that disrupt electron transport and deplete cel-lular ATP causes the bacteria to swim without directionchanges, a response that matches the attractant response ob-served for Escherichia coli (35). Nutrient or electron donorsupplementation boosted the frequency of direction switchesfor wild-type H. pylori but not for strains lacking tlpD or thegene encoding the chemotaxis kinase cheA. TlpD is sufficientfor this response, based on observations using H. pylori strainsthat retain only TlpD and lack TlpABC (35). tlpD mutantsretain the ability to migrate through soft agar, another che-motaxis assay, suggesting that they are not completely che-motaxis defective (11). One interpretation of these findings isthat TlpD senses some aspect of the electron transport chainor cellular ATP, mediating a link between metabolism andswimming behavior. tlpD mutants have a modest mouse colo-nization defect that disappears after about 1 month of infec-tion and is more severe in competition infections (43; S. M.Williams and K. M. Ottemann, unpublished data). This phe-notype is similar to those of tlpA and tlpC mutants (5).

We were curious about the ligand-sensing possibilities ofTlpD and so performed hidden Markov model (HMM)-basedhomology searches with the TlpD sequence external to the MAdomain. We found that TlpD bears a conserved C-terminal setof amino acids that is common throughout bacterial chemore-

* Corresponding author. Mailing address: METX, University of Cal-ifornia at Santa Cruz, 1156 High Street, Santa Cruz, CA 95064. Phone:(831) 459-3482. Fax: (831) 345-3524. E-mail: Ottemann@ucsc.edu.

� Published ahead of print on 1 July 2011.

4338

on April 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

ceptors and other signaling proteins. We report here that thisconserved domain, termed the CZB (chemoreceptor zinc-binding) domain, binds zinc.

MATERIALS AND METHODS

Protein sequence analysis. Alignments, SAM-T08 HMM submissions, andPHI- and PSI-BLAST searches to characterize the CZB domain were performedon the TlpD sequence from H. pylori strain 26695 (locus HP0599; also known ashlyB and hylB). C-terminal (CZB domain) residues 301 to 433 of TlpD weresubmitted to the SAM-T08 server (located at http://compbio.soe.ucsc.edu/sam.html) to generate a multiple alignment and structure prediction (22–24). TheSAM-T08 server reports alignments from the earlier SAM-T04 and SAM-T02versions, which gave very similar results; the SAM-T04 results were arbitrarilychosen for analysis. By examining the conserved residues from the SAM multi-ple-sequence alignment, we created the PROSITE (19) pattern x(11)Hxx[WFYL]x(21,28)Cx[LFMVI]Gx[WFLVI]x(18,27)HxxxHx(11); this pattern includes 11additional residues on the N- and C-terminal ends to capture the placement ofthe CZB domain but to allow the possibility of two adjacent CZB domains. Tofacilitate the identification of the domain, we created an HMMer HMM model(http://hmmer.janelia.org/) (HMMer file CZB.hmm) from an alignment (HMMerfile CZB_588B.dotted-a2m). Both of these files are available upon request.

To aid the analysis of the domain architecture of proteins containing CZBdomains (presented in Fig. 5), we wrote a Perl script that processes the SAMalignments and the results of a SMART database search on the homologsidentified by SAM to report domain architecture and taxonomy information.This script allowed us to visually locate our previously unidentified domain(which did not exist in the domain architecture databases) among known proteinarchitectures. The inputs to the script were the SAM-T04.a2m alignment file(trimmed to use only the first header for sequences with multiple identities), andthe results of an April 2010 SMART batch search on CZB domain-containingproteins identified in the SAM multiple alignment. For each SAM hit found inthe SMART database, the script calculated the position of the hit on the proteindomain image returned by SMART and identified the location of theCxxGx[WF] motif and the downstream Zn-binding HxxxH motif. Hits which didnot contain the central CxxGx[WF] motif were excluded from the analysis.

Searches for protein-based metal binding motifs were carried out at the MetalCoordination Sites in Proteins website (http://tanna.bch.ed.ac.uk/) or the Met-alloprotein Database and Browser website (http://metallo.scripps.edu/).

Cloning and mutagenesis of tlpD. The tlpD gene or its mutant variant wascloned into pGEX6P-2 for overexpression. tlpD was PCR amplified with PfuTurbo polymerase (Stratagene) by using primers TlpD_pG_f (5�-GGAATTCCCATGTTTGGGAATAAGC-3�) and TlpD_pG_r (5�-ATAAGAATGCGGCCGCGAATCATTCGCCTTTTTG-3�) from strain J99 genomic DNA (tlpD_J99)or plasmid pL30A2 for tlpD from strain SS1 (tlpD_SS1) (43) or pL30A2H2A(tlpD_SS1_H2A); TlpD proteins from J99 and SS1 have nearly identical CZBdomains and behaved the same in all assays. pL30A2H2A changes the codingsequence of the last two histidines of the motif to alanines (H368A H372A).This plasmid was constructed by using the mutagenic oligonucleotides His-alasense (5�-GAGCTTTAGAAAGCCACGCTGCAAGCGTGGCTGCTGAAGCTAATGATTTGG) and Hisaalasense-R (5�-CCAAATCATTAGCTTCAGCAGCCACGCTTGCAGCGTGGCTTTCTAAAGCTC) according to themethod described by Stratagene in their Quicktime mutagenesis protocol.Briefly, phosphate groups were added to the primers by using T4 polynucle-otide kinase at 37°C for 1 h. Approximately 5 �g of primers was used formutagenic PCR, with 500 ng pL30A2 as the template, 100 mM deoxynucleo-

side triphosphates (dNTPs), Pfu Turbo polymerase, and the manufacturer-recommended buffers and conditions, with a 55°C annealing temperature.

H. pylori genomic DNA was prepared by using the DNeasy (Qiagen) or Wizard(Promega) kit, and plasmids were isolated from E. coli by using Midiprep orMiniprep kits (Qiagen). PCR products were gel purified with a GFX kit (GEHealthcare) and digested with EcoRI and NotI (New England BioLabs). PlasmidpGEX6P-2 (GE Healthcare) was digested with EcoRI and NotI and dephos-phorylated with calf intestinal phosphatase (New England BioLabs). Plasmid andPCR products were ligated with T4 ligase (New England BioLabs) and trans-formed into electrocompetent E. coli cells (strain DH10B or XL1-Blue MRF�)on selective LB plates with 100 �g/ml ampicillin. The correct insertion of thecloned gene was verified by restriction analysis, sequencing, and protein expres-sion. Protein expression was carried out with E. coli strain BL21.

Protein purification. For protein production, cells were grown in 2� yeast-tryptone broth (16 g tryptone, 10 g yeast extract, and 5 g NaCl per liter) at 37°C;glutathione S-transferase (GST)-TlpD expression was induced with 1.0 mMisopropyl-�-D-1-thiogalactopyranoside (IPTG) for 2 h at 30°C. These and allchemicals were obtained from either Fisher Scientific or Sigma, and all bacteri-ological media were obtained from BBL. After induction, cells were collected bycentrifugation, frozen in liquid nitrogen, and ground with a mortar and pestle.The frozen cells were resuspended in approximately 50 ml ice-cold lysis buffer [50mM Tris-Cl, 150 mM NaCl, 5 mM dithiothreitol (DTT), 1 mM 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF) (pH 7.0)] and lysed by sonica-tion. Cell debris was removed by centrifugation, and the remaining supernatantwas filtered through a 0.45-�m filter (Millipore) on ice before purification.

Purification of GST-TlpD was performed with a Biologic HR Workstation fastprotein liquid chromatography (FPLC) system (Bio-Rad) at 4°C by using aGSTPrep FF16/10 glutathione column (GE Healthcare). The loaded sample waswashed with wash buffer (50 mM Tris-Cl, 150 mM NaCl [pH 7.0]) and eluted inelution buffer (50 mM Tris-Cl, 150 mM NaCl, 10 mM glutathione [pH 8.0]). Peakfractions were pooled and concentrated by using Centriplus Centricon filters(Millipore) and were buffer exchanged by using PD-10 desalting columns (GEHealthcare) into either cleavage buffer [50 mM Tris-Cl, 150 mM NaCl, 1 mMEDTA, 5 mM Tris(2-carboxyethyl)phosphine (TCEP) (pH 7.0)], minimal buffer(50 mM Tris-Cl, 150 mM NaCl, 5 mM TCEP [pH 7.0]), or HEPES buffer (40 mMHEPES, 5 mM TCEP [pH 7.4]). The sample was sterilized by syringe filtrationwith a 0.22-�m filter and stored at 4°C until analysis. The protein concentrationwas measured by using the Bio-Rad Protein Assay with bovine serum albumin asa standard or by the absorbance at 280 nm on a NanoDrop ND-1000 instrumentusing estimated extinction coefficients calculated from the protein sequence of(64.3, 23.6, and 40.7) �103 for GST-TlpD, TlpD, and GST, respectively.

To cleave GST-TlpD, PreScission protease (GE Healthcare) was added toGST-TlpD in cleavage buffer according to the manufacturer’s instructions andincubated overnight. Cleaved TlpD was separated from GST and PreScissionprotease by using the GST-Prep FF16/10 column and eluted in cleavage buffer.

ICP-MS. GST-TlpD, GST-TlpDH2A, and GST were purified as describedabove and eluted in elution buffer. Samples were concentrated with Centriplusconcentrators (10-kDa cutoff). Samples were diluted 1:10 with MilliQ H2O andanalyzed on a Thermofinnigan Neptune inductively coupled plasma (ICP) massspectrometer by the University of California at Santa Cruz (UCSC) Keck IsotopeFacility. Filtrate from the concentration step and plain elution buffer (all diluted1:10 in MilliQ H2O) as well as plain MilliQ H2O were included in the analysis ascontrols. A solution containing 100 ppb of each the metals being detected (Mg,Ca, Mn, Fe, Co, Ni, Cu, and Zn) dissolved in elution buffer was used as astandard.

FIG. 1. TlpD bears a C-terminal conserved motif. Shown is a SAM-T04 sequence logo view of the conservation in the C terminus among distanthomologs of TlpD, showing the Hxx[WFYL]x21–28Cx[LFMVI]Gx[WFLVI]x18–27HxxxH CZB motif (boldface type indicates residues that are nearly100% conserved). The letter height represents the degree of conservation.

VOL. 193, 2011 THE CZB DOMAIN 4339

on April 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

Zn chelation. GST-TlpD samples purified as described above were bufferexchanged into HEPES buffer by using a PD-10 desalting column (GE Health-care). TPEN [N,N,N,N-tetrakis(2-pyridyl-methyl)ethylenediamine] was preparedas a 50 mM solution in dimethyl sulfoxide (DMSO). A 300-�l volume of 15 �MGST-TlpD with 75 to 600 �M TPEN was incubated at 4°C for �48 h with onlyinitial mixing. After incubation, the sample was filtered through a MicroCon10-kDa centrifugal concentrator (Millipore) to generate significant filtrate. Theabsence of protein in the buffer filtrate was confirmed by a Bio-Rad ProteinAssay. Samples were prepared for ICP mass spectrometry (ICP-MS) by dilution1:10 in MilliQ water. Samples were analyzed for metal content on a ThermoElement XR ICP-MS instrument at the UCSC Keck Isotope Laboratory, usinga glass nebulizer to avoid blockage by TPEN precipitate.

Immunoprecipitation. H. pylori wild-type strain mG27 (9) or its isogenic cheA(mG27 �cheA::cat [38]) and tlpD (mG27 �tlpD::catD1 [43]) mutants were grown

for �20 h under microaerobic conditions (10% O2, 10% CO2, �80% N2) at 37°Cin 25- to 60-ml batches of freshly prepared Ham’s F-10 medium (Sigma) con-taining an additional 12.3 �M (1 �g/ml) ZnSO4 or 67ZnSO4. ZnSO4 solutionswere prepared by dissolving ZnO (Mallinckrodt ACS grade) or 67ZnO (OakridgeNational Laboratory) in dilute H2SO4 (Fisher). The purity and motility of H.pylori cultures were verified by microscopy prior to harvesting at an opticaldensity at 600 nm (OD600) of 0.1 to 0.2 after 20 h of growth.

Cells were harvested by centrifugation and lysed with B-PER reagent (Pierce)containing 0.01 mg/ml lysozyme (Fisher) according to the manufacturer’s instruc-tions. Immunoprecipitation (IP) was performed with the Crosslink immunopre-cipitation kit (Pierce) according to the manufacturer’s protocol, using the anti-H.pylori chemoreceptor antibody GST-TlpA-22 (43). GST-TlpA-22 is a rabbit poly-clonal antibody generated against the MA domain from the H. pylori chemore-ceptor TlpA that recognizes all four H. pylori chemoreceptors. Reaction mixturesused a 3:1 bead slurry-to-serum ratio for column preparation and a 3:1 or 4:1lysate-to-bead ratio for immunoprecipitations. The antigen-binding step wasincubated on an end-over-end rotator at 4°C for 6 h. Immunoprecipitated sam-ples were eluted from the immobilized GST-TlpA-22 by using the elution bufferprovided with the kit.

Zn isotope analysis of immunoprecipitated samples was performed with aThermo Element XR ICP-MS system. IP samples were diluted 1:10 into 1%HNO3 with or without 100 ppb 59Co for analysis. We measured levels of the Znisotopes 67Zn (4% of natural background Zn) and 66Zn (28%) as well as 56Fe(control) and 59Co (standard). The 67Zn content was measured as a skew of theratio of 66Zn to 67Zn away from its expected natural value of 7 [calculation:7/(66Zn counts per second/67Zn counts per second)].

Western blotting. Western analysis of the immunoprecipitation samples wasperformed by the separation of 5 �l of each sample on a 10% SDS-PAGE gel,transfer onto a polyvinylidene difluoride (PVDF) membrane (Bio-Rad), andimmunoblotting with the GST-TlpA-22 antibody (1:2,000 dilution) (43). Blotswere developed with a luminol/peroxidase reaction using a chicken anti-rabbithorseradish peroxidase (HRP)-conjugated secondary antibody (1:2,000 dilution)(Santa Cruz Biotech) and visualized with light-sensitive film (Kodak). Successfultransfer and protein loading were visualized by the staining of the membranewith DB71 dye prior to immunoblotting.

RESULTS

TlpD contains a conserved C-terminal domain. To investi-gate the function of the H. pylori TlpD chemoreceptor, we used

FIG. 2. TlpD binds zinc. Metal contents of 5 �M recombinantGST-TlpD, 5 �M GST-TlpDH2A, and 6.5 �M GST were measured byICP-MS. Samples were normalized against a buffer blank, and a 100-ppb metal solution standard was used to convert measurements to �M.This graph shows the average data of two technical replicates, anderror bars show standard deviations of these measurements; similarresults (not shown) were obtained for cleaved TlpD. TlpD copurifieswith bound Zn, and the TlpDH2A mutation abolishes this Zn-bindingcapability. GST does not copurify with a significant amount of thesemetals.

FIG. 3. ICP-MS analysis of the metal content of TlpD after exposure to the chelator TPEN. A total of 15 �M GST-TlpD in HEPES buffer (orbuffer alone) was incubated with 75 to 600 �M TPEN for 48 h at 4°C. The protein was filtered from the buffer by centrifugation through a10-kDa-cutoff MicroCon centrifugal unit, and each sample was diluted 1:10 for metal content measurement by ICP-MS; this dilution yielded a finalprotein concentration of TlpD of approximately 0.9 �M in the retentate sample. The graph shows the Zn concentration in the protein-containingretentate (TlpD); the protein-free filtrate containing the buffer, small molecules, and/or metals removed from the protein (TlpD filtrate); untreatedbuffer (buffer alone); or buffer passed through the MicroCon units (buffer filtrate). TlpD remained in solution throughout the experiment, andTPEN exposure did not have an appreciable effect on its Zn content, nor did it trigger the release of Zn into the filtrate sample.

4340 DRAPER ET AL. J. BACTERIOL.

on April 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

the sequence alignment and modeling program SAM (22–24)to generate a multiple alignment of distant homologs to theN-terminal (residues 1 to 140) and C-terminal (residues 301 to433) portions of the protein, excluding the central MA domainthat would overwhelm the alignment. The N-terminal region ishomologous to only very close relatives within the epsilonpro-teobacteria (data not shown). The C-terminal region, however,contains a clear conserved amino acid set indicative of a po-tential metal-binding site: a set of highly conserved, noncon-tiguous histidines and one cysteine, arranged in an Hxx[WFYL]x21–28Cx[LFMVI]Gx[WFLVI]x18–27HxxxH motif (boldfacetype indicates residues that are nearly 100% conserved) (Fig.1). As more prokaryotic genomes were sequenced, this set ofamino acids became easily detectable by a default, one-itera-tion PSI-BLAST (3) search, which identified hundreds of ho-mologous sequences from chemoreceptors in diverse bacterial

lineages (data not shown). We refer to this set of amino acidsas the chemoreceptor zinc-binding domain, or CZB domain,based on the analysis detailed below. We used the term do-main based on similar usage for other proteins, although we donot yet know if this domain is able to fold independently.

Further analysis showed that automated protein family anddomain detection programs occasionally recognize the CZBdomain. The NCBI CDD automated conserved domain data-base (26) contains the family PRK09894, which consists of 30small bacterial proteins (primarily from different strains of E.coli) containing a CZB domain N terminal to a GGDEF do-main (a diguanylate cyclase domain named after its “GGDEF”motif). Pfam’s automated database PfamB (12), as generatedby the automated domain decomposition algorithm ADDA(12, 17), recently identified the domain under the identifierPB0001058 in an April 2011 search. Additionally, the CZBdomain will be officially recognized in release 26 of PfamA(12), with the accession number PF13682.

The CZB domain binds zinc in heterologously expressedTlpD. The presence of highly conserved histidines and cys-teines in the CZB domain suggested that it might have ametal-binding function. To test this possibility, we examinedwhether metals were associated with the heterologously over-expressed, purified TlpD protein. The tlpD gene from H. pyloristrain SS1 was cloned into an E. coli expression vector, gener-ating an N-terminal fusion with GST. We also constructed asite-directed mutant of cloned TlpD that changed the distalhistidines of the CZB domain to alanines (H368A H272A,hereafter referred to as TlpDH2A). The proteins were ex-pressed in E. coli, purified on a glutathione column, and as-sayed for metal content both before and after the cleavage ofthe GST moiety. Purified GST from the expression vectorwithout an insert was used as a control.

Purified GST-TlpD, GST-TlpDH2A, and GST were testedfor the presence of bound Fe, Zn, Ni, Ca, Cu, Mg, Mn, and Moby inductively coupled plasma mass spectrometry (ICP-MS).This highly sensitive method atomizes the sample and is thusunaffected by binding affinity or protein structure. ICP-MS

FIG. 4. TlpD binds zinc in vivo. (A). TlpD isolated by immunopre-cipitation from wild-type H. pylori contains an abnormally high ratio of67Zn to 66Zn, whereas the immunoprecipitate from H. pylori lackingTlpD or grown in plain ZnO contained a natural ratio of 67Zn to 66Zn.TlpD was immunoprecipitated from wild-type H. pylori mG27 (wt),mG27 lacking cheA, or mG27 lacking tlpD. Control samples werewild-type H. pylori mG27 grown with normal-isotope Zn (wt plainZnO) and wild-type H. pylori mG27 grown with 67ZnO but carriedthrough the immunoprecipitation without primary antibody GST-TlpA-22 (wt 67Zn no antibody). To prepare these samples, H. pyloriwas grown with supplemental 67ZnO or normal ZnO as indicated, andchemoreceptors were precipitated from solubilized samples with anti-GST-TlpA-22. This antibody recognizes all H. pylori chemoreceptors;none except TlpD appeared to bind Zn based on the loss of signal inthe tlpD mutant strain. The amount of 67Zn and 66Zn in the immuno-precipitated samples was measured and converted into the ratio of66Zn to 67Zn for each sample. For presentation as “Zn isotope ratioskew,” the sample ratio was divided into the normal 66Zn-to-67Zn ratioof 7. Thus, if the 66Zn/67Zn ratio is changed by 2-fold-elevated 67Zn,the 66Zn/67Zn ratio would now be 3.5; dividing 7 by 3.5 yields a skewof 2. The graph includes data from three (mG27 lacking cheA), two(wild type and mG27 lacking tlpD), or one (no antibody) biologicalreplicates; error bars indicate standard deviations between replicates.(B) Western blot of the immunoprecipitation samples from A.

TABLE 1. Frequencies of architecture types among CZBdomain proteinsa

ArchitectureNo. of CZB

domainproteins

% of CZBdomainproteins

TlpD-like 69 46Transmembrane chemoreceptor 47 31Cytoplasmic chemoreceptor,

not TlpD-like2 1

Other 14 9Transmembrane, other 2 1No annotated domains 17 11

Total 151

a Chemoreceptors are defined as proteins containing an MA domain. “Other”refers to proteins that contain annotated domains but lack the MA domain foundin chemoreceptors. “TlpD-like” refers to proteins that contain only a CZBdomain and an MA domain and lack predicted transmembrane regions. Exam-ples are shown in Fig. 5. Proteins with TlpD-like, transmembrane chemorecep-tor, and cytoplasmic chemoreceptor architectures made up 78% of the total CZBdomain proteins, other architectures and other transmembrane architecturesmade up 11% of the CZB proteins; together, these proteins with annotateddomains made up 89% of the total CZB proteins.

VOL. 193, 2011 THE CZB DOMAIN 4341

on April 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

FIG. 5. Sample domain architectures of proteins containing the CZB domain. The location of the CZB domain is shown as a red boxcomputationally superimposed onto a SMART domain image, with the location of the “Cx[LFMVI]Gx[WFLVI]” core motif shown as a yellow bar.Broad groups of signaling proteins are given as “transmembrane chemoreceptors”; transmembrane-localized chemoreceptors; “TlpD-like” solublechemoreceptors; “other chemoreceptors,” which are soluble chemoreceptors that differ from TlpD; “unknown,” which are proteins that lack otherdomains besides CZB; “transmembrane other”; and “other,” which are proteins that lack MA domains but have other identifiable motifs. Thespecific domains shown are indicated in the domain legend section at the bottom. TM, transmembrane domain; MA, the signature methyl-accepting domain of chemoreceptors; HAMP, HAMP-type signal transduction module; Pfam Cache2, an extracellular domain that is predicted to

4342 DRAPER ET AL. J. BACTERIOL.

on April 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

analysis revealed the presence of zinc in purified TlpD (Fig. 2).The zinc-binding capability, however, was almost completelyabolished in the TlpDH2A mutant, indicating that the C-termi-nal histidines in the CZB domain are essential for the Zn-binding capability. GST similarly did not bind detectable zinc(Fig. 2). There were negligible levels of other metals in thesesamples, although we did note a small but consistent presenceof iron in both TlpD samples. Similar results were obtainedwith TlpD cleaved from the GST (data not shown). We alsonoted that the TlpDH2A variant was somewhat more prone toprecipitation than the wild-type protein, but we did not detectany changes in the secondary structure signature compared towild-type TlpD using circular dichroism (CD) spectroscopy(data not shown).

To assay the Zn-binding affinity, we attempted to chelate thebound Zn from TlpD. As 24-h exposure to 1 mM EDTA (Kd of�10�14 to 10�16 [20, 28]) during purification did not appre-ciably reduce the levels of bound zinc, TlpD was exposed to upto a 40-fold excess of the Zn chelator TPEN [N,N,N,N-tetra-kis(2-pyridyl-methyl)ethylenediamine] (Kd [dissociation con-stant] of �10�16 [20]) for 48 h. The protein was filtered fromthe buffer, and protein and filtrate were assayed separately byICP-MS. The zinc concentration remained steady for bothprotein and buffer samples regardless of the TPEN concentra-tion (Fig. 3), indicating that the Zn either was bound with a Kd

of �10�16 or was inaccessible to TPEN.The CZB domain binds zinc in natively expressed TlpD. The

results described above suggest that TlpD is able to bind zincbut did not prove that zinc is the normal ligand for TlpD. Wethus analyzed TlpD directly from H. pylori by using immuno-precipitation to isolate the protein, with the goal of determin-ing whether zinc was specifically associated with native TlpD.We initially carried out these experiments with regular growthmedium, but we found that the background levels of zinc weretoo high to detect any TlpD-bound metals. We instead grew H.pylori cells in Ham’s F-10 minimal medium, which lacks suffi-cient zinc (39), and added an uncommon but stable zinc iso-tope, 67Zn (in the form of 67ZnSO4), as the sole source of zinc.There are five naturally occurring zinc isotopes: 67Zn is presentas 4.11% of naturally occurring zinc, while the most commonisotopes, 64Zn and 66Zn, are present as 48.89% and 27.81% ofnormal zinc, respectively; the other two isotopes comprise19.02% (68Zn) and 0.63% (70Zn) of naturally occurring zinc.The natural ratio of 66Zn to 67Zn is thus roughly 7. The use of67Zn thus allowed us to increase the signal-to-noise ratio, asthere is very little background 67Zn. For these experiments,TlpD was expressed from its normal chromosomal locationwith its native promoter. After growth in the 67Zn-supple-mented medium, the H. pylori cells were lysed with detergent,and TlpD was isolated by immunoprecipitation with an anti-body specific for the H. pylori chemoreceptor MA domain.

Because this antibody recognizes all H. pylori chemoreceptors,we used a mutant lacking TlpD as a control. These immuno-precipitated samples were then subjected to ICP-MS analysisto detect 67Zn and 66Zn. We then calculated the ratio of66Zn/67Zn in regular-zinc-grown TlpD, and as expected, it was7 (Fig. 4). For ease of interpretation, we divided all of ourratios into 7, such that a normal ratio of 66Zn/67Zn (28%/4%)is expressed as 1 (Fig. 4). For example, if the 67Zn level iselevated 2-fold, the 66Zn/67Zn ratio would now be 3.5; dividing7 by 3.5 yields a skew of 2. Indeed, when we analyzed TlpDfrom 67Zn-supplemented medium, we found an elevatedamount of 67Zn (Fig. 4). This elevated amount was dependenton TlpD, as samples lacking this protein did not have elevated67Zn levels (Fig. 4). These experiments thus support that TlpDbinds zinc when natively expressed in H. pylori as well as whenrecombinantly expressed in E. coli.

The CZB domain is found mostly but not exclusively as aC-terminal chemoreceptor domain. To investigate the varietyof protein families containing CZB domains, we analyzed thesequences identified by our original SAM-T04 multiple align-ment to find those with defined protein architectures bysearching for matching entries in the SMART database (25,34). Out of the 418 CZB domain-containing proteins identifiedby SAM in April 2010, 163 matched entries in the SMARTdatabase. We then wrote a Perl script to locate the CZB do-main within the protein architectures defined by SMART, al-lowing us to see the overall domain architecture of CZB do-main-containing proteins.

Of the CZB domain-containing proteins that we analyzed,most (�46%) are soluble chemoreceptors similar to H. pyloriTlpD (Table 1). These TlpD homologs have a short and vari-able N-terminal region, a central MA domain, and a C-termi-nal CZB domain, with no other discernible architectural fea-tures (Fig. 5). None of these TlpD homologs have beenexperimentally characterized.

Although the majority (78%) of proteins containing theCZB domain have the MA domain and can thus be consideredchemoreceptors, there are a few exceptions (Table 1). Thesenonchemoreceptor proteins are, however, likely to be signalingmolecules, as they contain a variety of domains involved insensory function, including the PAS domain (“Per-Amt-Sig”domain, named for the proteins in which it was discovered,involved in signal sensing) (37), GGDEF (a diguanylate cyclasedomain named for its “GGDEF” motif, which synthesizes thesignaling molecule cyclic di-GMP) (14, 16), EAL (a putativediguanylate phosphodiesterase domain named for its “EAL”motif) (14, 30), NIT (a nitrate- and nitrite-sensing domain)(36), GAF (a noncatalytic cGMP-binding domain) (14), andthe CHASE domain (cyclase/histidine kinase-associated sens-ing extracellular domain) (4, 32) (Fig. 5). One example of anon-MA signaling protein in this class is the E. coli protein

have a role in small-molecule recognition; Pfam NIT, nitrate- and nitrite-sensing domain; Pfam PilZ, c-di-GMP-sensing domain; Pfam Chase, adomain found in the extracellular portion of receptor-like proteins; Pfam hemerythrin, cation-binding domain; PAS, small-molecule-bindingdomain; PAC, a motif that occurs C terminal to a subset of all known PAS motifs and that may contribute to the PAS domain fold; GAF, a domainpresent in phytochromes and cGMP-specific phosphodiesterases; GGDEF and EAL, domains that create or degrade c-di-GMP; CBS, domain incystathionine beta-synthase and other proteins. The identifications (IDs) given for each protein are the UniProtKB identifiers submitted toSMART. Many of these architectures match multiple proteins; for these proteins, a representative was chosen, and only that ID is shown.

VOL. 193, 2011 THE CZB DOMAIN 4343

on April 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

YdeH, which consists of a CZB domain N terminal to aGGDEF domain (Fig. 5). YdeH has been shown to affectmotility (21) and biofilm formation (8) in a cyclic-di-GMP-dependent manner. The remaining 11% of CZB domain-con-taining sequences do not contain any annotated domains; themajority of these are small proteins consisting primarily of theCZB domain (Fig. 5).

DISCUSSION

We show here that the H. pylori TlpD chemoreceptor has aconserved domain at its C terminus that binds Zn. We namedthis domain CZB, for chemoreceptor zinc binding. Manychemoreceptors and other types of signaling proteins containthis domain, suggesting that it has widespread function in bac-terial signaling; however, the nature of this function is stillunclear.

The CZB domain in TlpD contains three sets of conservedamino acids, arranged as Hxx[WFYL]x21-28Cx[LFMVI]Gx[WFLVI]x18-27 HxxxH, with the residues in boldface type beingnearly 100% conserved. SAM-T08 structure prediction (22–24)suggests that the first and third sets are found in alpha helices,while the middle set is found in a predicted loop. It is notknown how these motifs are arranged in the three-dimensionalstructure of TlpD, although the structure predictions suggestthat the Zn-coordinating C-terminal histidines cluster with theother highly conserved histidine and cysteine residues (datanot shown).

Many dozen types of protein zinc-binding motifs exist (6,27), and protein-bound zinc can serve catalytic, structural, orinhibitory roles or act as a bridging ligand at protein-proteininterfaces (27). Coordination by three His residues and oneCys, as predicted for the CZB domain, is very rare, as deter-mined by the literature and database searches of protein-basedmetal-binding sites. We found only two examples of zinc-con-taining proteins bearing a three-His and one-Cys coordinationsite. The first is in the matrix metalloprotease family, where Znplays a functional role in the regulation of the protein’s activityvia the cysteine switch mechanism: the oxidation of the coor-dinating cysteine releases the Zn, opening the active site of theenzyme (41). The second example of three His residues plusone Cys forming a zinc-binding site is found in a trimericinteraction between two H. pylori urease accessory proteins. Inthis case, UreG donates a Cys and a His, while two UreEmolecules each donate a His to make a three-His and one-Cyssite (7).

The apparent affinity of CZB for Zn is quite high, with apredicted Kd in the femtomolar range. While the high affinitysuggests a structural role for Zn binding, there are examples ofZn-sensing proteins with this affinity, suggesting that we cannotdisregard sensing as a potential function of the CZB domain.Examples of high-Zn-affinity Zn-sensing proteins include Zurand ZntR, which each have femtomolar Zn affinities and aredifferentially activated by the presence or absence of Zn (33).Previous studies suggest that there is essentially no free Zn incells, with all of it being bound to a network of proteins (33).This sequestration allows cells to respond to exquisitely smallamounts of zinc, such that these proteins can exist in Zn-boundand Zn-free states within the cell despite their extremely highZn affinity.

TABLE 2. Examples of organisms with CZB domain proteinsa

Phylum Genus No. of species

Firmicutes Bacillus 1Clostridium 3Desulfitobacterium 1Syntrophomonas 1

Bacteroidetes Cytophaga 2

Nitrospirae Leptospirillum 1

Alphaproteobacteria Caulobacter 2Bradyrhizobium 1Oceanicaulis 1Rhodopseudomonas 1Roseobacter 1Magnetospirillum 2

Betaproteobacteria Acidovorax 2Azoarcus 1Dechloromonas 1

Gammaproteobacteria Aeromonas 1Alteromonas 1Beggiatoa 1Enterobacter 1Escherichia 1Halorhodospira 2Idiomarina 1Marinobacter 2Marinomonas 1Oceanobacter 1Oceanospirillum 1Photobacterium 2Pseudoalteromonas 1Pseudomonas 1Psychromonas 1Reinekea 1Salmonella 2Shigella 2Shewanella 9Thiomicrospira 1Vibrio 5

Deltaproteobacteria Desulfotalea 1Desulfuromonas 2Geobacter 2Lawsonia 1Pelobacter 1

Epsilonproteobacteria Caminibacter 1Campylobacter 5Helicobacter 3Nitratiruptor 1Sulfurimonas 1Sulfurovum 1Wolinella 1

Zetaproteobacteria Mariprofundus 1

Unclassified Proteobacteria Magnetococcus 1

a We determined the phylum, genus, and species of bacteria that containedCZB domain proteins based on the NCBI Taxonomy Browser (http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi). Note that only the firstprotein identification for each unique sequence was utilized for this analysis.Thus, organisms with identical protein sequences in multiple strains werecounted only once. This is exemplified by E. coli, which has homologs in moststrains, including K-12. This set is representative and not complete.

4344 DRAPER ET AL. J. BACTERIOL.

on April 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

The TlpD chemoreceptor mediates the response of H. pylorito energy levels (35), although it is not yet known whether theCZB domain is required for this function. Energy sensing isused by many microbes to monitor intracellular conditions (1);such a function fits well with the observation that TlpD iscytoplasmic (35). Further experiments will be needed to assesswhether and how the CZB domain is needed for this function.

The CZB domain is found in many bacterial lineages; itappears most frequently in proteobacteria but is also found inmembers of the Firmicutes, Bacteroidetes, and Nitrospirae (Ta-ble 2). It is especially prevalent among environmental metal-reducing or metallotactic bacteria, such as Shewanella, Geo-bacter, and Magnetococcus, and in commensal or pathogenicbacteria, such as Helicobacter, Campylobacter, Vibrio, and Sal-monella. Its frequent presence in bacterial chemoreceptors andother signaling proteins suggests that it plays an important rolein signal transduction in many bacteria.

ACKNOWLEDGMENTS

We thank Susan Williams for creating plasmid pL30A2H2A, AbeKarplus for subcloning of tlpDH2A, Eefei Chen for CD spectroscopyexperiments, and Rob Franks at the UCSC Keck Isotope Laboratoryfor expert assistance with the ICP-MS analysis. Susan Williams, PamLertsethtakarn, Lisa Collison, and Juan Castellon provided helpfulcomments on the manuscript.

The described project was supported by grant AI050000 (to K.M.O.)from the National Institutes of Allergy and Infectious Disease(NIAID) at the National Institutes of Health.

The contents of this work are solely the responsibility of the authorsand do not necessarily represent the official views of the NIH.

REFERENCES

1. Alexandre, G., S. Greer-Phillips, and I. B. Zhulin. 2004. Ecological role ofenergy taxis in microorganisms. FEMS Microbiol. Rev. 28:113–126.

2. Alm, R. A., et al. 1999. Genomic-sequence comparison of two unrelatedisolates of the human gastric pathogen Helicobacter pylori. Nature 397:176–180.

3. Altschul, S. F., et al. 1997. Gapped BLAST and PSI-BLAST: a new gener-ation of protein database search programs. Nucleic Acids Res. 25:3389–3402.

4. Anantharaman, V., and L. Aravind. 2001. The CHASE domain: a predictedligand-binding module in plant cytokinin receptors and other eukaryotic andbacterial receptors. Trends Biochem. Sci. 26:579–582.

5. Andermann, T. M., Y.-T. Chen, and K. M. Ottemann. 2002. Two predictedchemoreceptors promote Helicobacter pylori infection. Infect. Immun. 70:5877–5881.

6. Auld, D. S. 2001. Zinc coordination sphere in biochemical zinc sites. Bio-Metals 14:271–313.

7. Bellucci, M., B. Zambelli, F. Musiani, P. Turano, and S. Ciurli. 2009.Helicobacter pylori UreE, a urease accessory protein: specific Ni(2)- andZn(2)-binding properties and interaction with its cognate UreG. Biochem.J. 422:91–100.

8. Boehm, A., et al. 2009. Second messenger signalling governs Escherichia colibiofilm induction upon ribosomal stress. Mol. Microbiol. 72:1500–1516.

9. Castillo, A. R., A. J. Woodruff, L. E. Connolly, W. E. Sause, and K. M.Ottemann. 2008. Recombination-based in vivo expression technology iden-tifies Helicobacter pylori genes important for host colonization. Infect. Im-mun. 76:5632–5644.

10. Cerda, O., A. Rivas, and H. Toledo. 2003. Helicobacter pylori strainATCC700392 encodes a methyl-accepting chemotaxis receptor protein(MCP) for arginine and sodium bicarbonate. FEMS Microbiol. Lett. 224:175–181.

11. Croxen, M. A., G. Sisson, R. Melano, and P. S. Hoffman. 2006. The Helico-bacter pylori chemotaxis receptor TlpB (HP0103) is required for pH taxis andfor colonization of the gastric mucosa. J. Bacteriol. 188:2656–2665.

12. Finn, R. D., et al. 2010. The Pfam protein families database. Nucleic AcidsRes. 38:D211–D222.

13. Foynes, S., et al. 2000. Helicobacter pylori possesses two CheY responseregulators and a histidine kinase sensor, CheA, which are essential forchemotaxis and colonization of the gastric mucosa. Infect. Immun. 68:2016–2023.

14. Galperin, M. Y., A. N. Nikolskaya, and E. V. Koonin. 2001. Novel domainsof the prokaryotic two-component signal transduction systems. FEMS Mi-crobiol. Lett. 203:11–21.

15. Hazelbauer, G. L., J. J. Falke, and J. S. Parkinson. 2008. Bacterial chemo-receptors: high-performance signaling in networked arrays. Trends Biochem.Sci. 33:9–19.

16. Hecht, G. B., and A. Newton. 1995. Identification of a novel response regu-lator required for the swarmer-to-stalked-cell transition in Caulobacter cres-centus. J. Bacteriol. 177:6223–6229.

17. Heger, A., and L. Holm. 2003. Exhaustive enumeration of protein domainfamilies. J. Mol. Biol. 328:749–767.

18. Hou, S., et al. 2000. Myoglobin-like aerotaxis transducers in Archaea andBacteria. Nature 403:540–544.

19. Hulo, N., et al. 2006. The PROSITE database. Nucleic Acids Res. 34:D227–D230.

20. Jakob, U., M. Eser, and J. C. A. Bardwell. 2000. Redox switch of Hsp33 hasa novel zinc-binding motif. J. Biol. Chem. 275:38302–38310.

21. Jonas, K., et al. 2008. The RNA binding protein CsrA controls cyclic di-GMP metabolism by directly regulating the expression of GGDEF proteins.Mol. Microbiol. 70:236–257.

22. Karplus, K. 2009. SAM-T08, HMM-based protein structure prediction. Nu-cleic Acids Res. 37:W492–W497.

23. Karplus, K., et al. 2005. SAM-T04: what is new in protein-structure predic-tion for CASP6. Proteins 61(Suppl. 7):135–142.

24. Katzman, S., C. Barrett, G. Thiltgen, R. Karchin, and K. Karplus. 2008.PREDICT-2ND: a tool for generalized protein local structure prediction.Bioinformatics 24:2453–2459.

25. Letunic, I., T. Doerks, and P. Bork. 2009. SMART 6: recent updates and newdevelopments. Nucleic Acids Res. 37:D229–D232.

26. Marchler-Bauer, A., et al. 2009. CDD: specific functional annotation withthe Conserved Domain Database. Nucleic Acids Res. 37:D205–D210.

27. Maret, W., and Y. Li. 2009. Coordination dynamics of zinc in proteins.Chem. Rev. 109:4682–4707.

28. Martell, A. E., and R. M. Smith. 1974. Critical stability constants. PlenumPress, New York, NY.

29. McGee, D. J., et al. 2005. Colonization and inflammation deficiencies inMongolian gerbils infected by Helicobacter pylori chemotaxis mutants. Infect.Immun. 73:1820–1827.

30. Merkel, T., C. Barros, and S. Stibitz. 1998. Characterization of the bvgRlocus of Bordetella pertussis. J. Bacteriol. 180:1682–1690.

31. Miller, L. D., M. H. Russell, and G. Alexandre. 2009. Diversity in bacte-rial chemotactic responses and niche adaptation. Adv. Appl. Microbiol.66:53–75.

32. Mougel, C., and I. B. Zhulin. 2001. CHASE: an extracellular sensing domaincommon to transmembrane receptors from prokaryotes, lower eukaryotesand plants. Trends Biochem. Sci. 26:582–584.

33. Outten, C. E., and T. V. O’Halloran. 2001. Femtomolar sensitivity of met-alloregulatory proteins controlling zinc homeostasis. Science 292:2488–2492.

34. Schultz, J., F. Milpetz, P. Bork, and C. P. Ponting. 1998. SMART, a simplemodular architecture research tool: identification of signaling domains. Proc.Natl. Acad. Sci. U. S. A. 95:5857–5864.

35. Schweinitzer, T., et al. 2008. Functional characterization and mutagenesis ofthe proposed behavioral sensor TlpD of Helicobacter pylori. J. Bacteriol.190:3244–3255.

36. Shu, C. J., L. E. Ulrich, and I. B. Zhulin. 2003. The NIT domain: a predictednitrate-responsive module in bacterial sensory receptors. Trends Biochem.Sci. 28:121–124.

37. Taylor, B. L., and I. B. Zhulin. 1999. PAS domains: internal sensors ofoxygen, redox potential, and light. Microbiol. Mol. Biol. Rev. 63:479–506.

38. Terry, K., S. M. Williams, L. Connolly, and K. M. Ottemann. 2005. Che-motaxis plays multiple roles in Helicobacter pylori animal infection. Infect.Immun. 73:803–811.

39. Testerman, T. L., D. J. McGee, and H. L. Mobley. 2001. Helicobacter pylorigrowth and urease detection in the chemically defined medium Ham’s F-12nutrient mixture. J. Clin. Microbiol. 39:3842–3850.

40. Tomb, J.-F., et al. 1997. The complete genome sequence of the gastricpathogen Helicobacter pylori. Nature 388:539–547.

41. Van Wart, H. E., and H. Birkedal-Hansen. 1990. The cysteine switch: aprinciple of regulation of metalloproteinase activity with potential applica-bility to the entire matrix metalloproteinase gene family. Proc. Natl. Acad.Sci. U. S. A. 87:5578–5582.

42. Wadhams, G. H., and J. P. Armitage. 2004. Making sense of it all: bacterialchemotaxis. Nat. Rev. Mol. Cell Biol. 5:1024–1037.

43. Williams, S. M., et al. 2007. Helicobacter pylori chemotaxis modulates in-flammation and bacterium-gastric epithelium interactions in infected mice.Infect. Immun. 75:3747–3757.

44. Wuichet, K., R. P. Alexander, and I. B. Zhulin. 2007. Comparative genomicand protein sequence analysis of a complex system controlling bacterialchemotaxis. Methods Enzymol. 422:1–31.

VOL. 193, 2011 THE CZB DOMAIN 4345

on April 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from