Downloaded from on May 19, 2020 by guest · 2011/07/01 · 137 electrocompetent E. coli ( strains...

1

CZB: A Zinc-binding domain common to cytoplasmic bacterial chemoreceptors 1

2

Jenny Draper1,2, Kevin Karplus1, Karen M. Ottemann2* 3

4

1Department of Biomolecular Engineering University of California at Santa Cruz, Santa Cruz, 5

CA 95064, USA. 6

2Department of Microbiology and Environmental Toxicology, University of California at Santa 7

Cruz, Santa Cruz, CA 95064, USA. 8

* Corresponding author at: 1156 High Street, METX, Santa Cruz, CA 95064, USA. 9

[email protected] 10

11

Running title: The CZB Zinc binding domain 12

13

14

15

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Bacteriol. doi:10.1128/JB.05140-11 JB Accepts, published online ahead of print on 1 July 2011

on April 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

2

ABSTRACT 16

We report the identification and characterization of a previously-unidentified protein domain 17

found in bacterial chemoreceptors and other bacterial signal transduction proteins. This domain 18

contains a motif of three non-contiguous histidines and one cysteine, arranged as 19

Hxx[WFYL]x21-28Cx[LFMVI]Gx[WFLVI]x18-27HxxxH. This domain was first identified in the 20

soluble Helicobacter pylori chemoreceptor TlpD. Using inductively-coupled plasma mass 21

spectrometry on heterologously- and natively-expressed TlpD, we determined that this domain 22

binds zinc with a sub-femtomolar dissociation constant. We thus named the domain CZB, for 23

chemoreceptor zinc binding. Further analysis showed that many bacterial signaling proteins 24

contain the CZB domain, most commonly proteins that participate in chemotaxis, but also in c-25

di-GMP signaling and nitrate/nitrite-sensing, among others. Proteins bearing the CZB domain 26

are found in several bacterial phyla. The variety of signaling proteins using the CZB domain 27

suggests it plays a critical role in several signal transduction pathways. 28

29

30

INTRODUCTION 31

Chemotactic signaling systems are employed by bacteria and archaea to follow beneficial 32

chemical gradients and avoid harmful ones (Reviewed in (31, 42)). Chemotaxis is guided by 33

chemoreceptor proteins that sense particular ligands, either directly or indirectly, and transmit 34

that ligand-binding signal to downstream members of the chemotaxis signal transduction 35

cascade. Chemoreceptors are readily divided into two domains (44). The sensory domain 36

detects ligands, and is highly variable between different receptors, while the highly-conserved 37


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

3

signaling domain interacts with the coupling protein CheW and has several names, including 38

the “methyl-accepting (MA) domain” and “MCP signal", although not all such domains are 39

methylated (15, 44). Chemoreceptors act in a ternary complex with CheW and the CheA kinase 40

to control the activity of CheA and, in turn, to dictate the amount of phosphorylated CheY, the 41

substrate of CheA. Most chemoreceptor protein sequences, as classified by the presence of the 42

MA domain, also contain transmembrane regions. In the bacterial chemotaxis system, 43

localization in the cell membrane is congruous with the function of chemoreceptors to detect 44

extracellular environmental signals. However, a large number of proteins with the 45

chemoreceptor MA domain lack transmembrane regions and are thought to monitor the 46

intracellular energy or metabolic status of the cell (44). The best characterized of these is the 47

Bacillus subtilis HemAT chemoreceptor that utilizes a heme domain to sense oxygen (18). 48

The bacterial pathogen Helicobacter pylori requires chemotaxis to promote mammalian 49

colonization (13, 38). H. pylori has three transmembrane chemoreceptors, TlpA, TlpB, and TlpC, 50

and a single cytoplasmic chemoreceptor, TlpD, that was formerly called HylB or HlyB (2, 11, 51

40). TlpA and TlpC are needed for mouse stomach colonization (5) and TlpA has been proposed 52

to sense arginine and a few other molecules (10), while no ligands have been found for TlpC. 53

TlpB is not required for wild-type mouse or gerbil stomach colonization (29, 43), and has been 54

shown to mediate H. pylori's response to low pH (11). 55

The H. pylori TlpD protein, the focus of this work, lacks transmembrane domains and 56

resides as a soluble protein (30). Experiments suggest that TlpD senses H. pylori's cellular 57

energy levels (30). Specifically, Schweinitzer and colleagues observed that treating H. 58

pylori with chemicals that disrupt electron transport and deplete cellular ATP cause the bacteria 59

to swim without direction changes, a response that and matches the attractant response observed 60


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

4

for E. coli (36). Nutrient or electron donor supplementation boosted the frequency of direction 61

switches for wild-type H. pylori but not for strains lacking tlpD or the gene encoding the 62

chemotaxis kinase cheA. TlpD is sufficient for this response, based on observations using H. 63

pylori strains that retain only TlpD and lack TlpABC (30). tlpD mutants retain the ability to 64

migrate through soft agar, another chemotaxis assay, suggesting they are not completely 65

chemotaxis defective (11). One interpretation of these findings is that TlpD senses some aspect 66

of the electron transport chain or cellular ATP, mediating a link between metabolism and 67

swimming behavior. tlpD mutants have a modest mouse colonization defect that disappears after 68

about one month of infection and is more severe in competition infections ((43) and S. M. 69

Williams and K. M. O, in preparation). This phenotype is similar to those of tlpA and tlpC 70

mutants (5). 71

We were curious about the ligand sensing possibilities of TlpD, and so performed 72

Hidden-Markov based homology searches with the TlpD sequence external to the MA domain. 73

We found that TlpD bears a conserved C-terminal set of amino acids that is common throughout 74

bacterial chemoreceptors and other signaling proteins. We report here that this conserved 75

domain, termed CZB, binds zinc. 76

77

MATERIALS & METHODS 78

Protein Sequence Analysis 79

Alignments, SAM-T08 HMM submissions, and PHI- and PSI- BLAST searches to characterize 80

the CZB domain were performed on the TlpD sequence from H. pylori strain 26695 (locus 81

HP0599; also known as hlyB and hylB). The C-terminal (CZB domain) residues 301-433 of TlpD 82

were submitted to the SAM-T08 server (located at http://compbio.soe.ucsc.edu/sam.html) to 83


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

5

generate a multiple alignment and structure prediction (22-24). The SAM-T08 server reports 84

alignments from the earlier SAM-T04 and SAM-T02 versions, which gave very similar results; 85

the SAM-T04 results were arbitrarily chosen for analysis. By examining the conserved residues 86

from the SAM multiple sequence alignment, we created the PROSITE Pattern (19) 87

(x(11)Hxx[WFYL]x(21,28)Cx[LFMVI]Gx[WFLVI]x(18,27)HxxxHx(11); this pattern includes 88

eleven additional residues on the N- and C-terminal ends to capture the placement of the CZB 89

domain but to allow the possibility of two adjacent CZB domains. To facilitate identification of 90

the domain, we created an HMMer HMM model (http://hmmer.janelia.org/) (file: CZB.hmm) 91

from an alignment (file: CZB_588B.dotted-a2m). Both of these files are available as 92

supplementary information. 93

94

To aid analysis of the domain architecture of proteins containing CZB domains (presented in 95

Figure 5), we wrote a Perl script that processes the SAM alignments and the results of a SMART 96

database search on the homologs identified by SAM to report domain architecture and taxonomy 97

information. This script allowed us to visually locate our previously unidentified domain (which 98

did not exist in the domain architecture databases) amongst known protein architectures. The 99

inputs to the script were the SAM-T04 .a2m alignment file (trimmed to use only the first header 100

for sequences with multiple identities), and the results of an April 2010 SMART batch search on 101

CZB-domain containing proteins identified in the SAM multiple alignment. For each SAM hit 102

found in the SMART database, the script calculated the position of the hit on the protein domain 103

image returned by SMART, and identified the location of the CxxGx[WF] motif and the 104

downstream Zn-binding HxxxH motif. Hits which did not contain the central CxxGx[WF] 105

motif were excluded from analysis. 106


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

6

107

Searches for protein-based metal binding motifs were carried out at the Metal Coordination Sites 108

In Proteins web site (http://tanna.bch.ed.ac.uk/) or the Metalloprotein Database and Browser web 109

site (http://metallo.scripps.edu/). 110

111

Cloning and Mutagenesis of tlpD 112

The tlpD gene or its mutant variant was cloned into pGEX6P-2 for overexpression. tlpD was 113

PCR amplified with Pfu Turbo polymerase (Stratagene) using the primers TlpD_pG_f (5’-114

GGAATTCCCATGTTTGGGAATAAGC-3’) and TlpD_pG_r (5’-115

ATAAGAATGCGGCCGCGAATCATTCGCCTTTTTG-3’) from strain J99 genomic DNA 116

(tlpD_J99), or the plasmids pL30A2 for tlpD from strain SS1 (tlpD_SS1) (Williams et al, 2007) 117

or pL30A2H2A (tlpD_SS1_H2A); TlpD proteins from J99 and SS1 have nearly identical CZB 118

domains and behaved the same in all assays. pL30A2H2A changes the coding sequence of the 119

last two histidines of the motif to alanines (H368A H372A). It was constructed using the 120

mutagenic oligonucleotides Hisalasense (5' 121

GAGCTTTAGAAAGCCACGCTGCAAGCGTGGCTGCTGAAGCTAATGATTTGG) and 122

Hisaalasense-R (5' 123

CCAAATCATTAGCTTCAGCAGCCACGCTTGCAGCGTGGCTTTCTAAAGCTC) following 124

the method described by Stratagene in their Quicktime mutagenesis protocol. Briefly, phosphate 125

groups were added to the primers using T4 polynucleotide kinase at 37°C for one hour. 126

Approximately 5µg of primers were used for mutagenic PCR, with 500ng pL30A2 as the 127

template, 100mM dNTPs, PFU Turbo polymerase, and manufacturers recommended buffers and 128

conditions, with a 55°C annealing temperature. 129


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

7

130

H. pylori genomic DNA was prepared using the DNeasy (Qiagen) or Wizard (Promega) kits, and 131

plasmids were isolated from E. coli using Midi- or Mini- Prep kits (Qiagen). PCR products were 132

gel-purified with a GFX kit (GE Healthcare), and digested with EcoRI and NotI (New England 133

Biolabs). The plasmid pGEX6P-2 (GE Healthcare) was digested with EcoRI and NotI, and de-134

phosphorylated with Calf Intestinal Phosphatase (New England Biolabs). Plasmid and PCR 135

products were ligated with T4 Ligase (New England Biolabs), and transformed into 136

electrocompetent E. coli (strains DH10B or XL1-Blue MRF’) onto selective 100 µg/ml 137

ampicillin LB plates. The correct insertion of the cloned gene was verified by restriction 138

analysis, sequencing, and protein expression. Protein expression was carried out in E. coli strain 139

BL21. 140

141

Protein Purification 142

For protein production, cells were grown in 2x yeast-tryptone broth (per liter, 16 g tryptone, 10 g 143

yeast extract, 5 g NaCl) at 37ºC; GST-TlpD expression was induced with 1.0 mM Isopropyl β-D-144

1-thiogalactopyranoside (IPTG) for two hours at 30ºC. These and all chemicals were from either 145

Fisher Scientific or Sigma, and all bacteriological media was from BBL. After induction, cells 146

were collected by centrifugation, frozen in liquid nitrogen, and ground with a mortar and pestle. 147

The frozen cells were resuspended in approximately 50ml ice-cold lysis buffer (50mM Tris-Cl, 148

150mM NaCl, 5mM DTT, 1mM 4-(2-Aminoethyl)benzenesulfonyl fluoride hydrochloride, 149

(AEBSF), pH 7.0) and lysed by sonication. Cell debris was removed by centrifugation, and the 150

remaining supernatant was filtered through a 0.45mM filter (Millipore) on ice before 151

purification. 152


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

8

Purification of GST-TlpD was performed on a “Biologic HR Workstation” FPLC 153

(BioRad) at 4oC, using a GSTPrep FF16/10 glutathione column (GE Healthcare). The loaded 154

sample was washed with Wash Buffer (50mM Tris-Cl, 150mM NaCl, pH 7.0), and eluted in 155

Elution Buffer (50mM Tris-Cl, 150mM NaCl, 10mM glutathione, pH 8.0). Peak fractions were 156

pooled and concentrated using Centriplus Centricon filters (Millipore), and buffer-exchanged 157

using PD-10 desalting columns (GE Healthcare) into either Cleavage Buffer (50mM Tris-Cl, 158

150mM NaCl, 1mM EDTA, 5mM tris(2-carboxyethyl)phosphine (TCEP, pH 7.0), Minimal 159

Buffer (50mM Tris-Cl, 150mM NaCl, 5mM TCEP, pH 7.0), or Hepes Buffer (40mM HEPES, 160

5mM TCEP, pH 7.4). The sample was sterilized by syringe filtration with a 0.22mM filter and 161

stored at 4oC until analysis. Protein concentration was measured using the BioRad Protein 162

Assay with bovine serum albumin as as a standard, or absorbance at 280nm on a NanoDrop 163

ND-1000 using an estimated extinction coefficient calculated from the protein sequence of 164

(64.3, 23.6, and 40.7) x103 for GST-TlpD, TlpD, and GST respectively. 165

To cleave GST-TlpD, PreScission Protease (GE Healthcare) was added to GST-TlpD in 166

Cleavage Buffer per the manufacturer’s instructions, and incubated overnight. Cleaved TlpD 167

was separated from GST and PreScission Protease using the GST-Prep FF16/10 column, and 168

eluted in Cleavage Buffer. 169

170

ICP-MS 171

GST-TlpD, GST-TlpDH2A, and GST were purified as described above and eluted in Elution 172

Buffer. Samples were concentrated with Centriplus concentrators (10kD cutoff). Samples were 173

diluted 1:10 with MilliQ H2O, and analyzed on a Thermofinnigan Neptune ICP Mass 174

Spectrometer by the UCSC Keck Isotope Facility. Filtrate from the concentration step and plain 175


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

9

elution buffer (all diluted 1:10 in MilliQ H2O), as well as plain MilliQ H2O were included in the 176

analysis as controls. A solution containing 100 ppb of each the metals being detected 177

(Mg,Ca,Mn,Fe,Co,Ni,Cu,Zn) dissolved in Elution Buffer was used as a standard. 178

179

Zn Chelation 180

GST-TlpD samples purified as above were buffer-exchanged into HEPES Buffer using a PD-10 181

desalting column (GE Healthcare). TPEN (N,N,N,N-tetrakis(2-pyridyl-methyl)ethylenediamine) 182

was prepared as a 50mM solution in DMSO. A 300μl volume of 15 μM GST-TlpD with 75-600 183

μM TPEN was incubated at 4oC for ~48 hours with only initial mixing. After incubation, the 184

sample was filtered through a MicroCon 10kD centrifugal concentrator (Millipore) to generate 185

significant filtrate. The absence of protein in the buffer filtrate was confirmed by Bio-Rad 186

Protein Assay. Samples were prepared for ICP-MS by diluting 1:10 in MilliQ water. Samples 187

were analyzed for metal content on a Thermo Element XR ICP-MS at the UCSC Keck Isotope 188

Laboratory, using a glass nebulizer to avoid blockage by TPEN precipitate. 189

190

Immunoprecipitation 191

H. pylori wild-type strain mG27 (9), or its isogenic mutants cheA (mG27 ∆cheA::cat (38)) and 192

tlpD (mG27 ∆tlpD::cat-D1 (43)) were grown for ~20 hours in microaerobic conditions (10% O2, 193

10% CO2, ~80% N2) at 37oC, in 25-60 ml batches of freshly prepared HAMS-F10 (Sigma) 194

containing additional 12.3 µM (1µg/ml) of Zn-SO4 or 67Zn-SO4. ZnSO4 solutions were prepared 195

by dissolving ZnO (Mallinckrodt ACS grade) or 67ZnO (Oakridge National Laboratory) in dilute 196

H2SO4 (Fisher). Purity and motility of H. pylori cultures was verified by microscopy prior to 197

harvesting at an O.D.600 of 0.1-0.2 after 20 hours of growth. 198


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

10

Cells were harvested by centrifugation and lysed with B-PER reagent (Pierce) containing 0.01 199

mg/ml lysozyme (Fisher) per the manufacturer’s instructions. Immunoprecipitation was 200

performed with the Crosslink Immunoprecipitation Kit (Pierce) according to the manufacturer's 201

protocol, using the anti- H. pylori chemoreceptor antibody GST-TlpA-22 (43). GST-TlpA-22 is a 202

rabbit polyclonal antibody generated against the MA domain from the H. pylori chemoreceptor 203

TlpA that recognizes all four H. pylori chemoreceptors. Reactions used a 3:1 bead slurry : serum 204

ratio for column preparation, and a 3:1 or 4:1 lysate:bead ratio for immunoprecipitations. The 205

antigen-binding step was incubated on an end-over-end rotator at 4oC for 6 hours. 206

Immunoprecipitated samples were eluted from the immobilized GST-TlpA-22 using the elution 207

buffer provided with the kit. 208

Zn isotope analysis of immunoprecipitated samples was performed on a Thermo Element XR 209

ICP-MS. IP samples were diluted 1:10 into 1% HNO3 ± 100ppb 59Co for analysis. We measured 210

levels of the Zn isotopes 67Zn (4% of natural background Zn) and 66Zn (28%), as well as 56Fe 211

(control) and 59Co (standard). 67Zn content was measured as a skew of the ratio of 66Zn:67Zn 212

away from its expected natural value of 7 (calculation: 7/[66Zn counts per second/67Zn counts per 213

second]). 214

215

Western Blotting 216

Western analysis of the immunoprecipitation samples was performed by separating 5 µl of each 217

sample on a 10% SDS-PAGE gel, transferring to a PVDF membrane (Biorad), and 218

immunoblotting with the GST-TlpA-22 antibody (1:2,000 dilution) (43). Blots were developed 219

with a luminol/peroxidase reaction using a chicken anti-rabbit-HRP conjugate secondary 220

antibody (1:2,000 dilution) (Santa Cruz Biotech), and visualized with light-sensitive film 221


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

11

(Kodak). Successful transfer and protein loading was visualized by staining the membrane with 222

DB71 dye prior to immunoblotting. 223

224

RESULTS 225

TlpD contains a conserved C-terminal Domain 226

To investigate the function of the H. pylori TlpD chemoreceptor, we used the sequence 227

alignment and modeling program SAM (22-24) to generate a multiple alignment of distant 228

homologs to the N-terminal (residues 1-140) and C-terminal (residues 301-433) portions of the 229

protein, excluding the central MA domain that would overwhelm the alignment. The N-terminal 230

region is homologous only to very close relatives within the epsilon-proteobacteria (data not 231

shown). The C-terminal region, however, contains a clear conserved amino acid set indicative of 232

a potential metal-binding site: a set of highly-conserved, non-contiguous histidines and one 233

cysteine, arranged in a Hxx[WFYL]x21-28Cx[LFMVI]Gx[WFLVI]x18-27HxxxH motif (Fig. 1). 234

As more prokaryotic genomes were sequenced, this set of amino acids became easily detectable 235

by a default, one-iteration PSI-BLAST (3) search, which identifies hundreds of homologous 236

sequences from chemoreceptors in diverse bacterial lineages (data not shown). We refer to this 237

set of amino acids as the Chemoreceptor Zinc Binding domain, or CZB, based on the analysis 238

detailed in this manuscript below. We used the term domain based on similar usage in other 239

proteins, although we do not yet know if this domain is able to fold independently. 240

Further analysis showed that automated protein family and domain detection programs 241

occasionally recognize the CZB domain. NCBI’s automated conserved domain database CDD 242

(26) contains the family PRK09894, which consists of 30 small bacterial proteins (primarily 243


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

12

from different strains of E. coli) containing a CZB domain N-terminal to a GGDEF domain (a 244

diguanylate cyclase domain named after its “GGDEF” motif). Pfam’s automated database PfamB 245

(12), as generated by the automated domain decomposition algorithm ADDA (12, 17), recently 246

identified the domain under the identifier PB0001058 in an April 2011 search. Additionally, the 247

CZB domain will be officially recognized in release 26 of PfamA, with the accession number 248

PF13682. 249

250

The CZB domain binds zinc in heterologously expressed TlpD 251

The presence of highly-conserved histidines and cysteines in the CZB domain suggested 252

that it might have a metal-binding function. To test this possibility, we examined whether metals 253

were associated with heterologously-overexpressed, purified TlpD protein. The tlpD gene from 254

H. pylori strain SS1 was cloned into an E. coli expression vector, generating an N-terminal 255

fusion with GST. We also constructed a site-directed mutant of cloned TlpD that changed the 256

distal histidines of the CZB domain to alanines (H368A H272A, hereafter referred to as 257

TlpDH2A). The proteins were expressed in E. coli, purified on a glutathione column, and assayed 258

for metal content both before and after cleavage of the GST moiety. Purified GST from the 259

expression vector without an insert was used as a control. 260

Purified GST-TlpD, GST-TlpDH2A, and GST were tested for the presence of bound Fe, 261

Zn, Ni, Ca, Cu, Mg, Mn, and Mo by Inductively Coupled Plasma Mass Spectrometry (ICP-MS). 262

This highly-sensitive method atomizes the sample, and is thus unaffected by binding affinity or 263

protein structure. ICP-MS analysis revealed the presence of zinc in purified TlpD (Fig. 2). Zinc 264

binding capability, however, was almost completely abolished in the TlpDH2A mutant, indicating 265

that the C-terminal histidines in the CZB domain are essential for Zn-binding capability. GST 266


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

13

similarly did not bind detectable zinc (Fig. 2). There were negligible levels of other metals in 267

these samples, although we did note a small but consistent presence of iron in both TlpD 268

samples. Similar results were obtained with TlpD cleaved from the GST (data not shown). We 269

also noted that the TlpDH2A variant was somewhat more prone to precipitation than the wild-type 270

protein, but did not detect any changes in secondary structure signature as compared to wild-type 271

TlpD using circular dichroism spectroscopy (data not shown). 272

To assay Zn binding affinity, we attempted to chelate the bound Zn from TlpD. As 24-273

hour exposure to 1mM EDTA (Kd ≈ 10-14 - 10-16 (20, 28)) during purification did not appreciably 274

reduce the levels of bound zinc, TlpD was exposed to up to 40-fold excess of the Zn chelator 275

TPEN (N,N,N,N-tetrakis(2-pyridyl-methyl)ethylenediamine, Kd ≈ 10-16 (20)) for 48 hours. The 276

protein was filtered from the buffer, and protein and filtrate were assayed separately by ICP-MS. 277

Zinc concentration remained steady for both protein and buffer samples regardless of TPEN 278

concentration (Fig. 3), indicating that the Zn was either bound with a Kd < 10-16, or was 279

inaccessible to the TPEN. 280

281

The CZB domain binds zinc in natively expressed TlpD 282

The results above suggest that TlpD is able to bind zinc, but did not prove that zinc is the 283

normal ligand for TlpD. We thus analyzed TlpD directly from H. pylori using 284

immunoprecipitation to isolate the protein, with the goal of determining whether zinc was 285

specifically associated with native TlpD. We initially carried out these experiments with regular 286

growth media, but found that background levels of zinc were too high to detect any TlpD-bound 287

metals. So we instead grew H. pylori in the minimal media HAMS-F10, which lacks sufficient 288

zinc (39), and added an uncommon but stable zinc isotope, 67Zn (in the form of 67Zn-SO4) as the 289


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

14

sole source of zinc. There are five naturally-occurring zinc isotopes: 67Zn is present as 4.11% of 290

naturally-occurring zinc, while the most common isotopes, 64Zn and 66Zn, are present as 48.89% 291

and 27.81% of normal zinc; the other two isotopes comprise 19.02% (68Zn) and 0.63% (70Zn). 292

The natural ratio of 66Zn:67Zn is thus roughly seven. Use of the 67Zn thus allowed us to increase 293

the signal-to-noise ratio, as there is very little background 67Zn. For these experiments, TlpD was 294

expressed from its normal chromosomal location with its native promoter. After growth in the 295

67Zn-supplemented media, the H. pylori cells were lysed with detergent, and TlpD was isolated 296

by immunoprecipitation with an antibody specific for the H. pylori chemoreceptor MA domain. 297

Because this antibody recognizes all H. pylori chemoreceptors, we used a mutant lacking TlpD 298

as a control. These immunoprecipitated samples were then subjected to ICP-MS analysis to 299

detect 67Zn and 66Zn. We then calculated the ratio of 66Zn/67Zn in regular-zinc grown TlpD and 300

as expected, it was seven (Fig. 4). For ease of interpretation, we divided all of our ratios into 301

seven, such that a normal ratio of 66Zn/67Zn (28%/4%) is expressed as one (Fig. 4). For example, 302

if 67Zn is elevated 2-fold, the 66Zn/67Zn ratio would now be 3.5; dividing 7 by 3.5 yields a skew 303

of two. Indeed, when we analyzed TlpD from 67Zn-supplemented media, we found an elevated 304

amount of 67Zn (Fig. 4). This elevation was dependent on TlpD, as samples lacking this protein 305

did not have elevated 67Zn (Fig. 4). These experiments thus support that TlpD binds zinc when 306

natively expressed in H. pylori as well as when recombinantly-expressed in E. coli. 307

308

The CZB Domain is found mostly but not exclusively as a C-terminal chemoreceptor domain 309

To investigate the variety of protein families containing CZB domains, we analyzed the 310

sequences identified by our original SAM-T04 multiple alignment to find those with defined 311

protein architectures, by searching for matching entries in the SMART database (25, 34). Out of 312


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

15

the 418 CZB-domain containing proteins identified by SAM in April 2010, 163 matched entries 313

in the SMART database. We then wrote a perl script to locate the CZB domain within the protein 314

architectures defined by SMART, allowing us to see the overall domain architecture of CZB-315

domain containing proteins. 316

Of the CZB-domain containing proteins we analyzed, most (~46%) are soluble 317

chemoreceptors similar to H. pylori’s TlpD (Table 1). These TlpD homologs have a short and 318

variable N-terminal region, a central MA domain, and a C-terminal CZB domain, with no other 319

discernable architectural features (Fig. 5). None of these TlpD homologs have been 320

experimentally characterized. 321

Although the majority (78%) of proteins containing the CZB domain have the MA 322

domain and can thus be considered chemoreceptors, there are a few exceptions (Table 1). These 323

non-chemoreceptor proteins are, however, likely to be signaling molecules, as they contain a 324

variety of domains involved in sensory function, including PAS (“Per-Amt-Sig” domain named 325

for the proteins it was discovered in, involved in signal sensing) (37), GGDEF (a diguanylate 326

cyclase domain named for its “GGDEF” motif, that synthesizes the signaling molecule cyclic di-327

GMP) (14, 16), EAL (a putative diguanylate phosphodiesterase domain named for its “EAL” 328

motif) (14, 30), NIT (a nitrate and nitrite sensing domain) (36), GAF (a non-catalytic cGMP 329

binding domain) (14), and CHASE (Cyclase/Histidine kinase-Associated Sensing Extracellular 330

Domain) (4, 32)) (Fig. 5). One example of a non-MA signaling protein in this class is the E. coli 331

protein YdeH, which consists of a CZB domain N-terminal to a GGDEF domain (Fig. 5). YdeH 332

has been shown to affect motility (21) and biofilm formation (8) in a cyclic-di-GMP -dependent 333

manner. The remaining 11% of CZB-domain containing sequences do not contain any annotated 334


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

16

domains; the majority of these are small proteins consisting primarily of the CZB domain (Fig. 335

5). 336

337

DISCUSSION 338

We show here that the H. pylori TlpD chemoreceptor has a conserved domain at its C-339

terminus that binds Zn. We named this domain CZB, for Chemoreceptor Zinc Binding. Many 340

chemoreceptors and other types of signaling proteins contain this domain, suggesting it has 341

widespread function in bacterial signaling; however, the nature of this function is still unclear. 342

The CZB domain in TlpD contains three sets of conserved amino acids, arranged as: 343

Hxx[WFYL]x21-28 Cx[LFMVI]Gx[WFLVI]x18-27 HxxxH, with the residues in bold being nearly 344

100% conserved. SAM-T08 structure prediction (21) suggests the first and third sets are found in 345

alpha helices, while the middle set is found in a predicted loop. It is not known how these motifs 346

are arranged in the three dimensional structure of TlpD, although the structure predictions 347

suggest that the Zn-coordinating C-terminal histidines cluster with the other highly-conserved 348

histidine and cysteine residues (data not shown). 349

Many dozen types of protein zinc binding motifs exist (6, 27), and protein-bound zinc can 350

serve catalytic, structural, or inhibitory roles, or act as a bridging ligand at a protein-protein 351

interfaces (27). Coordination by three His and one Cys, as predicted in CZB, is very rare as 352

determined by the literature and database searches of protein-based metal binding sites. We 353

found only two examples of zinc-containing proteins bearing a three His and one Cys 354

coordination site. The first is in the matrix metalloprotease family, where the Zn plays a 355

functional role in regulation of the protein’s activity via the cysteine-switch mechanism: 356

oxidation of the coordinating cysteine releases the Zn, opening the active site of the enzyme (41). 357


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

17

The second example of three His plus one Cys forming a zinc-binding site is found in a trimeric 358

interaction between two H. pylori urease accessory proteins. In this case, UreG donates a Cys 359

and a His, while two UreE molecules each donate a His to make a three His/one Cys site (7). 360

The apparent affinity of CZB for Zn is quite high, with a predicted Kd in the femtomolar 361

range. While the high affinity suggests a structural role for Zn binding, there are examples of Zn-362

sensing proteins with this affinity, suggesting that we cannot disregard sensing as a potential 363

function for the CZB domain. Examples of high-Zn affinity Zn-sensing proteins include Zur and 364

ZntR, which each have femtomolar Zn affinity and are differentially activated by the presence or 365

absence of Zn (33). Studies suggest that there is essentially no free Zn in cells, with all of it 366

bound to a network of proteins (33). This sequestration allows cells to respond to exquisitely low 367

amounts of zinc, such that these proteins can exist in Zn-bound and Zn-free states within the cell 368

despite their extremely high Zn affinity. 369

The TlpD chemoreceptor mediates H. pylori's response to energy levels (35), although it 370

is not yet known whether the CZB domain is required for this function. Energy sensing is used 371

by many microbes to monitor intracellular conditions (1); such a function fits well with the 372

observation that TlpD is cytoplasmic (35). Further experiments will be needed to assess whether 373

and how the CZB domain is needed for this function. 374

The CZB domain is found in many bacterial lineages; it appears most frequently in 375

proteobacteria, but is also found in members of the Firmicutes, Bacteroidetes and Nitrospirae 376

phyla (Table 2). It is especially prevalent among environmental metal-reducing or metallotactic 377

bacteria such as Shewanella, Geobacter, and Magnetococcus, and in commensal or pathogenic 378

bacteria, such as Helicobacter, Campylobacter, Vibrio, and Salmonella. Its frequent presence in 379


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

18

bacterial chemoreceptors and other signaling proteins suggests that it plays an important role in 380

signal transduction in many bacteria. 381

382

Acknowledgements 383

The authors thank Susan Williams for creating the plasmid pL30A2H2A, Abe Karplus for 384

subcloning of tlpDH2A, Eefei Chen for CD spectroscopy experiments, and Rob Franks at the 385

UCSC Keck Isotope Laboratory for expert assistance with the ICP-MS analysis. Susan 386

Williams, Pam Lertsethtakarn, Lisa Collison and Juan Castellon provided helpful comments on 387

the manuscript. The described project was supported by Grant Number AI050000 (to K.M.O.) 388

from the National Institutes of Allergy and Infectious Disease (NIAID) at the National Institutes 389

of Health. Its contents are solely the responsibility of the authors and do not necessarily represent 390

the official views of the NIH. 391

392 on April 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

19

393

Architecture Count Percent of Total

TlpD-like 69 46%

78% 89%

Transmembrane Chemoreceptor 47 31%

Cytoplasmic Chemoreceptor, not TlpD-like 2 1%

Other 14 9% 11%

Transmembrane, Other 2 1%

No annotated domains 17 11% 11%

Total 151

394

Table 1. The frequency of architecture types among CZB Domain proteins. 395

Chemoreceptors are defined as proteins containing an MA domain. “Other” refers to 396

proteins that contain annotated domains, but lack the MA domain found in 397

chemoreceptors. “TlpD-like” refers to proteins that contain only a CZB domain and an 398

MA domain, and lack predicted transmembrane regions. Examples are shown in Fig. 5. 399

400

401


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

20

402

Phylum Genus Number of species Firmicutes Bacillus 1 Clostridium 3 Desulfitobacterium 1 Syntrophomonas 1 Bacteroidetes Cytophaga 2 Nitrospirae Leptosprillum 1 Proteobacter-alpha Caulobacter 2 Bradyrhizobium 1 Oceanicaulis 1 Rhodopseudomonas 1 Roseobacter 1 Magnetosprillium 2 Proteobacter-beta Acidovorax 2 Azoarcus 1 Dechloromonas 1 Proteobacter-gamma Aeromonas 1 Alteromadales 1 Beggiatoa 1 Enterobacter 1 Escherichia 1 Halorhodospira 2 Idiomarina 1 Marinobacter 2 Marinomonas 1 Oceanobacter 1 Oceanospirillum 1 Photobacterium 2 Pseudoalteromonas 1 Pseudomonas 1 Psychromonas 1 Reinekea 1 Salmonella 2 Shigella 2 Shewanella 9 Thiomicrospira 1 Vibrio 5 Proteobacter-delta Desulfotalea 1 Desulfuromonas 2 Geobacter 2 Lawsonia 1 Pelobacter 1 Proteobacter-epsilon Caminibacter 1 Campylobacter 5 Helicobacter 3 Nitratiruptor 1 Sulfurimonas 1


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

21

Sulfurovum 1 Wolinella 1 Proteobacter-zeta Marioprofundus 1 Proteobacter-unclassified Magnetococcus 1

403

Table 2. Examples of organisms with CZB-Domain proteins 404

We determined the phylum, genus and species of bacteria that contained CZB domain 405

proteins, based on the NCBI Taxonomy Browser 406

(http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi). Note that only the first 407

protein ID for each unique sequence was utilized for this analysis. Thus, organisms with 408

identical protein sequences in multiple strains were counted only once. This is exemplified 409

by E. coli, which has homologs in most strains, including K-12. This set is representative 410

and not complete. 411

412

413


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

22

Figure Legends 414

Figure 1. TlpD bears a C-terminal conserved motif. SAM-T04 sequence logo view of 415

conservation in the C-terminus among distant homologs of TlpD, showing Hxx[WFYL]x21-416

28Cx[LFMVI]Gx[WFLVI]x18-27HxxxH CZB motif. Letter height represents degree of 417

conservation. 418

419

Figure 2. TlpD binds zinc. Metal content of 5 μM recombinant GST-TlpD, 5 μM GST-420

TlpDH2A, and 6.5 μM GST was measured by ICP-MS. Samples were normalized against a 421

buffer blank, and a 100ppb metal solution standard was used to convert measurements to μM. 422

This graph shows the average of two technical replicates, error bars show standard deviation of 423

these measurements; similar results (not shown) were obtained for cleaved TlpD. TlpD co-424

purifies with bound Zn, and the TlpDH2A mutation abolishes this Zn binding capability. GST 425

does not co-purify with a significant amount of these metals. 426

427

Figure 3. ICP-MS analysis of the metal content of TlpD after exposure to the chelator 428

TPEN. 15 μM GST-TlpD in HEPES buffer (or buffer alone) was incubated with 75-600 μM 429

TPEN for 48 hours at 4oC. The protein was filtered from the buffer by centrifugation through a 430

10 kD-cut off microcon centrifugal unit, and each sample was diluted 1:10 for metal content 431

measurement by ICP-MS; this dilution yielded a final protein concentration of TlpD of 432

approximately 0.9 μM in the retentate sample. The graph shows the Zn concentration in the 433

protein-containing retentate (TlpD); the protein-free filtrate containing the buffer/small 434

molecules/metals removed from the protein (TlpD filtrate); untreated buffer (buffer alone); or 435

buffer passed through the microcon units (buffer filtrate). TlpD remained in solution throughout 436


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

23

the experiment, and TPEN exposure did not have an appreciable affect on its Zn content, nor 437

trigger release of Zn into the filtrate sample. 438

439

Figure 4. TlpD binds zinc in vivo. (A). TlpD isolated by immunoprecipitation from wild-type 440

H. pylori contains an abnormally high ratio of 67Zn:66Zn, whereas immunoprecipitate from H. 441

pylori lacking TlpD or grown in plain ZnO contained a natural ratio of 67Zn:66Zn. TlpD was 442

immunoprecipitated from wild-type H. pylori mG27 (wt), mG27 lacking cheA (cheA-), or mG27 443

lacking tlpD (tlpD-). Control samples of H. pylori mG27 wild type grown with normal-isotope 444

Zn (wt plain ZnO) and H. pylori mG27 wild type grown with 67ZnO but carried through the 445

immunoprecipitation without primary antibody GST-TlpA-22 (wt 67Zn no antibody). To prepare 446

these samples, H. pylori was grown with supplemental 67ZnO or normal ZnO as indicated, and 447

chemoreceptors precipitated from solubilized samples with anti-GST-TlpA22. This antibody 448

recognizes all H. pylori chemoreceptors; none except TlpD appear to bind Zn based on the loss 449

of signal in the tlpD mutant strain. The amount of 67Zn and 66Zn in the immunoprecipitated 450

samples was measured, and converted into the ratio of 66Zn:67Zn in each sample. For presentation 451

as "Zn isotope ratio skew", the sample ratio was divided into the normal 66Zn:67Zn ratio of 7. 452

Thus if the 66Zn/67Zn is changed by elevated 67Zn 2-fold, the 66Zn/67Zn would now be 3.5; 453

dividing 7 by 3.5 yields a skew of two. Data includes three (cheA-), two (wt, tlpD-), or one (no 454

antibody) biological replicates; error bars indicate standard deviation between replicates. (B). 455

Western blot of the immunoprecipitation samples from Panel A. 456

Figure 5. Domain architectures of proteins containing the CZB Domain 457

The location of the CZB domain is shown as a red box computationally superimposed on a 458

SMART domain image, with the location of the “Cx[LFMVI]Gx[WFLVI]” core motif shown as 459


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

24

a yellow bar. Broad groups of signaling proteins are given as: "Transmembrane 460

Chemoreceptors", transmembrane-localized chemoreceptors; "TlpD-like", soluble 461

chemoreceptors; "Other Chemoreceptor", soluble chemoreceptors that differ from TlpD; 462

"Unknown", proteins that lack other domains besides CZB; "Transmembrane Other" and 463

"Other", proteins that lack MA domains but have other identifiable motifs. Specific domains 464

shown are indicated in the Domain Legend section at the bottom. These are: blue bar, 465

transmembrane domain (TM); green bar, predicted coiled-coil region; MA (red-orange), the 466

signature methyl accepting domain of chemoreceptors; HAMP, (green pentagon), HAMP-type 467

signal transduction module; Pfam Cache2, (black rectangle), an extracellular domain that is 468

predicted to have a role in small-molecule recognition; Pfam NIT (black rectangle), Nitrate and 469

nitrite sensing domain; Pfam PilZ (black rectangle) c-di-GMP sensing domain; Pfam Chase 470

(black rectangle), a domain found in the extracellular portion of receptor-like proteins; Pfam 471

Hemerythrin (black squares), cation-binding domain; PAS (purple ovals), small molecule 472

binding domain; PAC (purple triangles), a motif that occurs C-terminal to a subset of all known 473

PAS motifs, and may contribute to the PAS domain fold; GAF (pink ovals), a domain present in 474

phytochromes and cGMP-specific phosphodiesterases; GGDEF and EAL (mauve elongated 475

pentagons), domains that create or degrade c-di-GMP; CBS (short mauve pentagon), domain in 476

cystathionine beta-synthase and other proteins. The IDs given for each are the UniProtKB 477

identifiers submitted to SMART. Many of these architectures match multiple proteins; for these a 478

representative was chosen, and only that ID is shown. 479

480


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

25

References 481

482 1. Alexandre, G., S. Greer-Phillips, and I.B. Zhulin. 2004. Ecological role of energy taxis in 483

microorganisms. FEMS Microbiol Rev 28:113. 484 2. Alm, R.A., L.S. Ling, D.T. Moir, B.L. King, E.D. Brown, P.C. Doig, D.R. Smith, B. Noonan, 485

B.C. Guild, B.L. Dejonge, G. Carmel, P.J. Tummino, A. Caruso, M. Uria-Nickelsen, 486 D.M. Mills, C. Ives, R. Gibson, D. Merberg, S.D. Mills, Q. Jiang, D.E. Taylor, G.F. 487 Vovis, and T.J. Trust. 1999. Genomic-sequence comparison of two unrelated isolates of 488 the human gastric pathogen Helicobacter pylori. Nature 397:176. 489

3. Altschul, S.F., T.L. Madden, A.A. Schäffer, J. Zhang, Z. Zhang, W. Miller, and D.J. Lipman. 490 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search 491 programs. Nucleic Acids Res 25:3389. 492

4. Anantharaman, V., and L. Aravind. 2001. The CHASE domain: a predicted ligand-binding 493 module in plant cytokinin receptors and other eukaryotic and bacterial receptors. Trends 494 Biochem Sci 26:579. 495

5. Andermann, T.M., Y.-T. Chen, and K.M. Ottemann. 2002. Two predicted chemoreceptors 496 promote Helicobacter pylori infection. Infect Immun 70:5877. 497

6. Auld, D.S. 2001. Zinc coordination sphere in biochemical zinc sites. BioMetals 14:271. 498 7. Bellucci, M., B. Zambelli, F. Musiani, P. Turano, and S. Ciurli. 2009. Helicobacter pylori 499

UreE, a urease accessory protein: specific Ni(2+)- and Zn(2+)-binding properties and 500 interaction with its cognate UreG. The Biochemical journal 422:91. 501

8. Boehm, A., S. Steiner, F. Zaehringer, A. Casanova, F. Hamburger, D. Ritz, W. Keck, M. 502 Ackermann, T. Schirmer, and U. Jenal. 2009. Second messenger signalling governs 503 Escherichia coli biofilm induction upon ribosomal stress. Mol Microbiol 72:1500. 504

9. Castillo, A.R., A.J. Woodruff, L.E. Connolly, W.E. Sause, and K.M. Ottemann. 2008. 505 Recombination-based in vivo expression technology identifies Helicobacter pylori genes 506 important for host colonization. Infect Immun 76:5632. 507

10. Cerda, O., A. Rivas, and H. Toldeo. 2003. Helicobacter pylori strain ATCC700392 encodes 508 a methyl-accepting chemotaxis receptor protein (MCP) for arginine and sodium 509 bicarbonate. FEMS Microbiol Lett 224:175. 510

11. Croxen, M.A., G. Sisson, R. Melano, and P.S. Hoffman. 2006. The Helicobacter pylori 511 Chemotaxis Receptor TlpB (HP0103) Is Required for pH Taxis and for Colonization of 512 the Gastric Mucosa. J Bacteriol 188:2656. 513

12. Finn, R.D., J. Tate, J. Mistry, P.C. Coggill, S.J. Sammut, H.-R. Hotz, G. Ceric, K. Forslund, 514 S.R. Eddy, E.L.L. Sonnhammer, and A. Bateman. 2008. The Pfam protein families 515 database. Nucl Acids Res 36:D281. 516

13. Foynes, S., N. Dorrell, S.J. Ward, R.A. Stabler, A.A. McColm, A.N. Rycroft, and B.W. 517 Wren. 2000. Helicobacter pylori possesses two CheY response regulators and a histidine 518 kinase sensor, CheA, which are essential for chemotaxis and colonization of the gastric 519 mucosa. Infect Immun 68:2016. 520

14. Galperin, M.Y., A.N. Nikolskaya, and E.V. Koonin. 2001. Novel domains of the prokaryotic 521 two-component signal transduction systems. FEMS Microbiol Lett 203:11. 522

15. Hazelbauer, G.L., J.J. Falke, and J.S. Parkinson. 2008. Bacterial chemoreceptors: high-523 performance signaling in networked arrays. Trends Biochem Sci 33:9. 524


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

26

16. Hecht, G.B., and A. Newton. 1995. Identification of a novel response regulator required for 525 the swarmer-to-stalked-cell transition in Caulobacter crescentus J Bacteriol 177:6223. 526

17. Heger, A., and L. Holm. 2003. Exhaustive enumeration of protein domain families. J Mol 527 Biol 328:749. 528

18. Hou, S., R.W. Larsen, D. Boudko, C.W. Riley, E. Karatan, M. Zimmer, G.W. Ordal, and M. 529 Alam. 2000. Myoglobin-like aerotaxis transducers in Archaea and Bacteria. Nature 530 403:540. 531

19. Hulo, N., A. Bairoch, V. Bulliard, L. Cerutti, E. De Castro, P.S. Langendijk-Genevaux, M. 532 Pagni, and C.J. Sigrist. 2006. The PROSITE database. Nucleic Acids Res 34:D227. 533

20. Jakob, U., M. Eser, and J.C.A. Bardwell. 2000. Redox Switch of Hsp33 Has a Novel Zinc-534 binding Motif. J Biol Chem 275:38302. 535

21. Jonas, K., A.N. Edwards, R. Simm, T. Romeo, U. Römling, and O. Melefors. 2008. The 536 RNA binding protein CsrA controls cyclic di-GMP metabolism by directly regulating the 537 expression of GGDEF proteins. Mol Microbiol 70:236. 538

22. Karplus, K. 2009. SAM-T08, HMM-based protein structure prediction. Nucl Acids Res 539 37:W492. 540

23. Karplus, K., S. Katzman, G. Shackleford, M. Koeva, J. Draper, B. Barnes, M. Soriano, and 541 R. Hughey. 2005. SAM-T04: What is new in protein-structure prediction for CASP6. 542 Proteins: Structure, Function, and Bioinformatics 61:135. 543

24. Katzman, S., C. Barrett, G. Thiltgen, R. Karchin, and K. Karplus. 2008. PREDICT-2ND: a 544 tool for generalized protein local structure prediction. Bioinformatics 24:2453. 545

25. Letunic, I., T. Doerks, and P. Bork. 2009. SMART 6: recent updates and new developments. 546 Nucleic Acids Res 37:D229. 547

26. Marchler-Bauer, A., J.B. Anderson, F. Chitsaz, M.K. Derbyshire, C. DeWeese-Scott, J.H. 548 Fong, L.Y. Geer, R.C. Geer, N.R. Gonzales, M. Gwadz, S. He, D.I. Hurwitz, J.D. 549 Jackson, Z. Ke, C.J. Lanczycki, C.A. Liebert, C. Liu, F. Lu, S. Lu, G.H. Marchler, M. 550 Mullokandov, J.S. Song, A. Tasneem, N. Thanki, R.A. Yamashita, D. Zhang, N. Zhang, 551 and S.H. Bryant. 2009. CDD: specific functional annotation with the Conserved Domain 552 Database. Nucleic Acids Res 37:D205. 553

27. Maret, W., and Y. Li. 2009. Coordination dynamics of zinc in proteins. Chemical reviews 554 109:4682. 555

28. Martell, A.E., and R.M. Smith. 1974. Critical Stability Constants. Plenum Press, New 556 York. 557

29. McGee, D.J., M.L. Langford, E.L. Watson, J.E. Carter, Y.-T. Chen, and K.M. Ottemann. 558 2005. Colonization and inflammation deficiencies in Mongolian gerbils infected by 559 Helicobacter pylori chemotaxis mutants. Infect Immun 73:1820. 560

30. Merkel, T., C. Barros, and S. Stibitz. 1998. Characterization of the bvgR locus of Bordetella 561 pertussis. J Bacteriol 180:1682. 562

31. Miller, L.D., M.H. Russell, and G. Alexandre. 2009. Diversity in bacterial chemotactic 563 responses and niche adaptation. Adv Appl Microbiol 66:53. 564

32. Mougel, C., and I.B. Zhulin. 2001. CHASE: an extracellular sensing domain common to 565 transmembrane receptors from prokaryotes, lower eukaryotes and plants. Trends 566 Biochem Sci 26:582. 567

33. Outten, C.E., and T.V. O'Halloran. 2001. Femtomolar sensitivity of metalloregulatory 568 proteins controlling zinc homeostasis. Science 292:2488. 569


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

27

34. Schultz, J., F. Milpetz, P. Bork, and C.P. Ponting. 1998. SMART, a simple modular 570 architecture research tool: Identification of signaling domains. Proceedings of the 571 National Academy of Sciences of the United States of America 95:5857. 572

35. Schweinitzer, T., T. Mizote, N. Ishikawa, A. Dudnik, S. Inatsu, S. Schreiber, S. Suerbaum, 573 S.I. Aizawa, and C. Josenhans. 2008. Functional characterization and mutagenesis of the 574 proposed behavioral sensor TlpD of Helicobacter pylori. J Bacteriol 190:3244. 575

36. Shu, C.J., L.E. Ulrich, and I.B. Zhulin. 2003. The NIT domain: a predicted nitrate-responsive 576 module in bacterial sensory receptors. Trends Biochem Sci 28:121. 577

37. Taylor, B.L., and I.B. Zhulin. 1999. PAS domains: internal sensors of oxygen, redox 578 potential, and light. Microbiol Mol Biol Rev 63:479. 579

38. Terry, K., S.M. Williams, L. Connolly, and K.M. Ottemann. 2005. Chemotaxis plays 580 multiple roles in Helicobacter pylori animal infection. Infect Immun 73:803. 581

39. Testerman, T.L., D.J. McGee, and H.L. Mobley. 2001. Helicobacter pylori growth and 582 urease detection in the chemically defined medium Ham's F-12 nutrient mixture. J Clin 583 Microbiol 39:3842. 584

40. Tomb, J.-F., O. White, A.R. Kerlavage, R.A. Clayton, G.G. Sutton, R.D. Fleischmann, K.A. 585 Ketchum, H.P. Klenk, S. Gill, B.A. Dougherty, K. Nelson, J. Quackenbush, L. Zhou, E.F. 586 Kirkness, S. Peterson, B. Lftus, D. Richardson, R. Dodson, H.G. Khalak, A. Glodek, K. 587 McKenney, L.M. Tizegerald, N. Lee, M.D. Adams, E.K. Kichey, D.E. Berg, J.D. 588 Gocayne, T.R. Utterback, J.D. Person, J. Kelley, M.D. Cotton, J.M. Weidman, C. Fujii, 589 C. Bowman, L. Wathey, E. Wallin, W.S. Hayes, M. Borodovsky, P.D. Karp, H.O. Smith, 590 C.M. Fraser, and J.C. Venter. 1997. The complete genome sequence of the gastric 591 pathogen Helicobacter pylori. Nature 388:539. 592

41. Van Wart, H.E., and H. Birkedal-Hansen. 1990. The cysteine switch: a principle of 593 regulation of metalloproteinase activity with potential applicability to the entire matrix 594 metalloproteinase gene family. Proc Natl Acad Sci U S A 87:5578. 595

42. Wadhams, G.H., and J.P. Armitage. 2004. Making sense of it all: bacterial chemotaxis. Nat 596 Rev Mol Cell Biol 5:1024. 597

43. Williams, S.M., Y.T. Chen, T.M. Andermann, J.E. Carter, D.J. McGee, and K.M. Ottemann. 598 2007. Helicobacter pylori chemotaxis modulates inflammation and bacterium-gastric 599 epithelium interactions in infected mice. Infect Immun 75:3747. 600

44. Wuichet, K., R.P. Alexander, and I.B. Zhulin. 2007. Comparative genomic and protein 601 sequence analysis of a complex system controlling bacterial chemotaxis. Methods 602 Enzymol 422:1. 603

604 605


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Downloaded from on May 19, 2020 by guest · 2011/07/01 · 137 electrocompetent E. coli ( strains...

Documents

Transcript of Downloaded from on May 19, 2020 by guest · 2011/07/01 · 137 electrocompetent E. coli ( strains...