Ch 10 DNA, RNA, and Protein Synthesis
description
Transcript of Ch 10 DNA, RNA, and Protein Synthesis
![Page 1: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/1.jpg)
CH 10
DNA, R
NA, AND PR
OTEIN SYN
THESIS
![Page 2: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/2.jpg)
![Page 3: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/3.jpg)
REVIEW What did Mendel tell us about
heredity?Did he know what was being
transmitted?
This chapter will help us identify the structure, and function of DNA.
![Page 4: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/4.jpg)
10-1 DISCOVERY OF DNA10-2 STRUCTURE OF DNAYEAR SCIENTIST Conclusion
1928 Frederick Griffith
1940’s Oswald Avery
1952 Hershey & Chase
1953 Watson & Crick
early1950s
Rosalind Franklin
1949 Erwin Chargaff
SKIP 2-3 lines between
rows.
![Page 5: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/5.jpg)
GRIFFITH’S EXPERIMENT• 1928 Britain• Studied Streptococcus
pneumoniae • Trying to develop a vaccine• Identified two strains1. virulent: disease causing
Colonies with smooth edges (S strain)2. non-virulent
Colonies with Rough edges (R strain)
![Page 6: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/6.jpg)
![Page 7: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/7.jpg)
10-1 DISCOVERY OF DNA10-2 STRUCTURE OF DNASCIENTIST ConclusionFrederick Griffith Virulent bacteria released ‘hereditary
factor’ that transformed the non-virulent bacteriaTransformation: movement of genetic material from one organism to another
Oswald Avery
Hershey & Chase
Watson & Crick
Rosalind Franklin
Erwin Chargaff
![Page 8: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/8.jpg)
DNA
“Heredity factors” = genes
Genes are located on DNA molecule
![Page 9: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/9.jpg)
AVERY’S EXPERIMENTSIs transforming agent protein, RNA, or DNA???• Used R and S strains on mice again.
![Page 10: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/10.jpg)
10-1 DISCOVERY OF DNA10-2 STRUCTURE OF DNASCIENTIST ConclusionFrederick Griffith Virulent bacteria released ‘heredity
factor’ that transformed the non-virulent bacteriaTransformation: movement of genetic material from one organism to another
Oswald Avery DNA is responsible for transformation in bacteria.
Hershey & Chase
Watson & Crick
Rosalind Franklin
Erwin Chargaff
![Page 11: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/11.jpg)
HERSHEY-CHASE EXPERIMENTBacteriophage: virus that infects bacteria
![Page 12: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/12.jpg)
Is DNA or protein the hereditary material viruses transfer when they infect a bacterial cell?
All viral DNA entered bacterial cell.
Very little protein entered.
![Page 13: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/13.jpg)
10-1 DISCOVERY OF DNA10-2 STRUCTURE OF DNASCIENTIST ConclusionFrederick Griffith Virulent bacteria released ‘heredity
factor’ that transformed the non-virulent bacteriaTransformation: movement of genetic material from one organism to another
Oswald Avery DNA is responsible for transformation in bacteria.
Hershey & Chase DNA is the hereditary molecule in viruses, not protein.
Watson & Crick
Rosalind Franklin
Erwin Chargaff
![Page 14: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/14.jpg)
10-2 DNA STRUCTURE
• 1953• Watson and Crick
identified the 3-D structure of DNA
![Page 15: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/15.jpg)
•Rosalind FranklinFemale scientistCrucial final clueX-Ray diffraction technique
![Page 16: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/16.jpg)
10-1 DISCOVERY OF DNA10-2 STRUCTURE OF DNASCIENTIST ConclusionFrederick Griffith Virulent bacteria released ‘heredity
factor’ that transformed the non-virulent bacteriaTransformation: movement of genetic material from one organism to another
Oswald Avery DNA is responsible for transformation in bacteria.
Hershey & Chase DNA is the hereditary molecule in viruses, not protein.
Watson & Crick DNA’s structure is a “double helix” (2 strands of nucleotides twisted in a
spiral shape)Rosalind Franklin Shape of DNA
Erwin Chargaff
![Page 17: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/17.jpg)
DNA made of 2 chains that wrap around each other to form a double helix
![Page 18: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/18.jpg)
DNA NUCLEOTIDES• MONOMER of
nucleic acids• Three components
5-Carbon sugarPhosphate groupNitrogenous base
![Page 19: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/19.jpg)
DNA DOUBLE HELIX• 2 strands of DNA likened to a twisted
ladder• Nitrogenous bases = “rungs”• Held together with H-Bonds between
complementary nitrogenous bases• Sugar and phosphate compose
“backbone” or “handrails”
![Page 20: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/20.jpg)
NITROGENOUS BASES
Only 41. Adenine (A)2. Guanine (G)
3. Thymine (T)4. Cytosine (C)
Double ringed: Purines
Single ringed: Pyrimidines
![Page 21: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/21.jpg)
COMPLEMENTARY BASES• 1949; Erwin Chargaff• %A = %T• %G = %C• ADENINE always bonds with THYMINE• GUANINE always bonds with CYTOSINE• Nitrogenous bases are complementary to
each other• What is the complementary strand to ATTG?
![Page 22: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/22.jpg)
10-1 DISCOVERY OF DNA10-2 STRUCTURE OF DNASCIENTIST ConclusionFrederick Griffith Virulent bacteria released ‘heredity
factor’ that transformed the non-virulent bacteriaTransformation: movement of genetic material from one organism to another
Oswald Avery DNA is responsible for transformation in bacteria.
Hershey & Chase DNA is the hereditary molecule in viruses, not protein.
Watson & Crick DNA’s structure is a “double helix” (2 strands of nucleotides twisted in a spiral shape)
Rosalind Franklin Shape of DNA
Erwin Chargaff Base-pairing ruleA – TC - G
![Page 23: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/23.jpg)
What is the complementary strand to A C C T G T G A G A C
G?
![Page 24: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/24.jpg)
QUIZ NEXT CLASSMATCH THE FOLLOWING SCIENTISTS TO THEIR WORK• Frederick Griffith• Hershey & Chase• Watson & Crick• Erwin ChargaffStructure of a NUCLEOTIDEStructure of DNA• Purines vs. pyrimidines• Complelementary bases
![Page 25: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/25.jpg)
10-3 DNA REPLICATION
• Process by which DNA is copied
• In nucleus• During s phase of cell
cycle prior to mitosis• Two strands of DNA
separate• Each strand serves as
a template(?) for new strand
![Page 26: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/26.jpg)
![Page 27: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/27.jpg)
STEPS 1. DNA unwound by helicase
Helicase moves along DNA & breaks H-bonds b/w bases
![Page 28: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/28.jpg)
![Page 29: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/29.jpg)
STEPS continued…Nucleotides floating in nucleus
DNA Polymerase adds complementary nucleotides to original strand
Covalent bonds b/w sugar and phosphates of adjoining nucleotides
Hydrogen bonds b/w bases
![Page 30: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/30.jpg)
![Page 31: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/31.jpg)
![Page 32: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/32.jpg)
STEPSDNA Polymerase finishes and releases DNA strands• 2 identical DNA strands result
![Page 33: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/33.jpg)
DNA REPLICATIONhttp://www.youtube.com/watch?v=yqESR7E4b_8
![Page 34: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/34.jpg)
DNA REPLICATION REVIEWATC GTC GAT GTA AGG
1. Identify the complementary bases first2. Divide the two strands using one color3. Using a second color, identify the new
complimentary strand
![Page 35: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/35.jpg)
ERRORS IN REPLICATIONNormally very accurateOne error per 1 billion nucleotidesDNA polymerase can proofread DNA for
mistakesWhen found, mistake is correctedMutation: change in nucleotide sequence
of a DNA molecule
![Page 36: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/36.jpg)
CANCERMutation in genes that control cell division can result in
uncontrolled cell growth (cancer)Tumor: abnormal mass of cells
![Page 37: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/37.jpg)
PROTEIN SYNTHESISFlow of genetic information:Genes in DNA are TRANSCRIBED into mRNA in the nucleusmRNA is TRANSLATED in cytoplasm into a sequence of amino
acids (protein)DNA RNA protein
transcription
translation
![Page 38: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/38.jpg)
RNADNA = DEOXYribonucleic acidRNA = ribonucleic acidDifferences (3)1. Sugar: RNA = ribose DNA = deoxyribose2. Shape: RNA = single stranded DNA = double stranded3. Nitrogenous bases In RNA, replace thymine with Uracil (U)
![Page 39: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/39.jpg)
TYPES OF RNA1. Messenger RNA (mRNA) Single stranded Carries instructions from a gene (DNA) to make protein to ribosome2. Ribosomal RNA (rRNA) Composes ribosome3. Transfer RNA (tRNA) Transfers amino acids to ribosome
![Page 40: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/40.jpg)
![Page 41: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/41.jpg)
TRANSCRIPTION Process by which genetic instructions in a specific gene are re-
written into mRNAIn nucleus1. RNA polymerase binds to promoter Enzyme forms RNA on a DNA templatePromoter: specific sequence of nucleotides that initiates
transcription
![Page 42: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/42.jpg)
TRANSCRIPTION 2. RNA polymerase adds free RNA nucleotides that are complementary to template strand of DNA- Remember: in RNA, replace thymine with uracilDNA strand: ATCGACmRNA strand: UAGCUGDNA ATCGGATTACAmRNA UAGCCUAAUGU
![Page 43: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/43.jpg)
TRANSCRIPTION RNA pol reaches termination signalReleases both DNA and new mRNA transcript
![Page 44: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/44.jpg)
![Page 45: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/45.jpg)
TRANSCRIPTION AND TRANSLATIONhttp://www.youtube.com/watch?v=41_Ne5mS2ls
![Page 46: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/46.jpg)
BELLWORK ASSIGNMENTTake out your notes, draw, and fill in the table below
Transcription DNA replication
Enzyme used
Polymer made
Number of template strands
![Page 47: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/47.jpg)
Transcription DNA replication
Enzyme used RNA polymerase DNA polymerase
Polymer made RNA DNA
Number of template strands
One Two
![Page 48: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/48.jpg)
DNA RNA PROTEINUp until now we’ve gone from DNA to mRNA through
transcriptionNow, we are going to translate the code in the mRNA into a
sequence of amino acidsWe are changing the language. Hence the name: Translation
![Page 49: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/49.jpg)
THE GENETIC CODEGenetic code: the rules that relate how a sequence of
nitrogenous bases corresponds to a particular amino acid Nucleotides are read three nucleotides at a time to code for an
amino acidCodon: three-nucleotide sequence in mRNA that encodes an
amino acid
![Page 50: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/50.jpg)
![Page 51: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/51.jpg)
DECODING DNA64 codons 20 amino acidsSome amino acids are coded by 2, 3, or 4 codons Start codon: AUG (indicates where translation should begin) Code for Methionine (Met)Stop codons (there are 3) end translation Do not code for an amino acid
![Page 52: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/52.jpg)
PAGE 207 IN YOUR BOOK
![Page 53: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/53.jpg)
TRANSLATION PRACTICE
Translate the following sequences of mRNA (write the first three letters of the amino acid: Methionine = Met)
AUG-AAA-GGG-UGAMet- Asp- Gly
AUG-CGU-GCA-UGC- CGU-GCA-UGA-UUG-CMet- Arg- Gly- Cys- Arg- Ala
AG-AUG-AAG-CUG-CAU-GCA-UGC-UAG-U Met-Lys- Leu-His- Ala- Cys
![Page 54: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/54.jpg)
AUG-CGU-GGG-GUA-UAAMet- Arg- Gly- Val-
UGAUGGAUGAAACCUGAGGU Met-Asp-Glu-Thr
![Page 55: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/55.jpg)
TRANSLATION
Where? cytoplasm5 steps1. Ribosome attaches to mRNA at AUGtRNA anticodon attaches
to complementary mRNA codon
Anticodon: sequence of 3 nucleotides on tRNA that are complementary to the mRNA codon
First amino acid: Methionine
![Page 56: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/56.jpg)
TRANSLATION
2. Next tRNA comes in and binds to codon Peptide bond forms b/w
Methionine and next amino acidRibosome moves to next codon
![Page 57: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/57.jpg)
TRANSLATION
3. First tRNA detaches and leaves Met behindRibosome continues to move down and
elongation of polypeptide chain continues to grow
![Page 58: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/58.jpg)
TRANSLATION 4. Process ends when ribosome reaches a stop codon
![Page 59: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/59.jpg)
TRANSLATION 5. dissasembly: ribosome complex falls apart
![Page 60: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/60.jpg)
Several ribosomes translate the same mRNA at the same time
![Page 61: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/61.jpg)
![Page 62: Ch 10 DNA, RNA, and Protein Synthesis](https://reader031.fdocuments.us/reader031/viewer/2022011717/5681696a550346895de13719/html5/thumbnails/62.jpg)
TRANSCRIPTION AND TRANSLATIONhttp://www.youtube.com/watch?v=41_Ne5mS2ls