20 essential amino acids

Linked together to make proteins

Made of amine group, carboxylic

acid, and R group (side chain)

Sequence of amino acids

Depends on the DNA sequence

› mRNA is formed by pairing with DNA

› mRNA is then read by the ribosome

› tRNA with the mRNA to bring correct amino acid

to the right place

› as more tRNA comes in the amino acids produced

are then connected with a peptide bond

ACAAUGGAACAUAGAUACAUA

ACAAUGGAACAUAGAUACAUA

Uses “weak” hydrogen bonds to form

Types:

› Coils

› Pleats/sheets

“Folding” of proteins

› Occur because different attractions

(bonds) form between alpha helices

and beta sheets

2 or more amino acids put together

Multiple tertiary proteins

Lipids

Organic molecule insoluble in water

3 types:

› Neutral fats (triglycerides)

› Phospholipids (cell membrane)

› Cholesterol

Triglycerides

› 3 fatty acid chains

Saturated/Unsaturated

› Glycerol molecule

Store energy

Insulate body tissue

Protects organs

Modified triglycerides

Nonpolar fatty acid chain = tail

› Hydrophobic (“fears” water)

Polar phosphate = head

› Hydrophilic (“loves” water)

4 connected Carbon rings

Stabilizes cell membranes

Carbohydrates

Organic compound made of Carbon, Hydrogen, & Oxygen in ratio of › 1C : 2H : 1O

Used for energy storage

3 types:› Monosaccharides

› Disaccharides

› Polysaccharides

Simple sugars

Soluble in water

Examples: Glucose &Galactose

Two monosaccharide sugars linked

together by dehydration synthesis

Soluble in water

Example: Sucrose

More than 2 sugars linked together

Formed by dehydration synthesis

Usually not soluble in water

Examples: Starch, cellulose, & Glycogen

Starch:› Sugars the same way

› Primary source of calories

Cellulose:› Sugars are opposite every other one

Glycogen:› Sugars are branched

Monomers joined together to make

polymers

› Loss of water when they are joined

› Electrons are rearranged

› New bond is formed

Adding water to a polymer to break it

apart

Synthesis reactions: combining atoms

› Anabolic reactions

› Require more energy than produced

Decomposition reactions: breaking apart

› Catabolic reactions

› More energy released than needed