DE conferentie 2012 - Rens Bod
Primer [immigration]
Clean Up, Speed Up, Back Up
Enhancing Social Interactions at Conferences (Conferator System)
Untitled
OEB 192 – 08.11.17 Physiological basis of adaptation.
Miki Lee / OEB 192 – 08.11.12 Mobile genetic elements and adaptive mutation.
Two upcoming talks of interest Shared Circuits and the understanding of actions, sensations, and emotions. Christian Keysers 12:30 – 2 5 A ICSI, 4/7/2006.
BIOS E-127 – 08.11.17 Pleiotropy & specialization.
OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.
More on neutral theory OEB 192 – 10.09.15. Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.
OEB 192 – 09.11.09 Optimality & evolution of networks.