The New York Stem Cell Foundation Accelerating Cures Through Stem Cell Research
New York Pharma Forum
Susan Solomon December 6, 2013
The New York Stem Cell Foundation
Stem Cell Research in the United States
• 1996 – Dickey Wicker Amendment
• 1998 – James Thompson and colleagues isolate hESCs
• 1999 – NIH Director Harold Varmus says NIH can fund human pluripotent stem cells per HSS General Counsel
• 2000 – NIH guidelines released for hESC research
• 2001 – Bush Executive Order
• 2006 – Senate passes Stem Cell Research Enhancement Act; vetoed
• 2006 – NYSCF’s privately funded, safe-haven laboratory opens
The New York Stem Cell Foundation
Stem Cell Research in the United States (cont’d)
• 2006 – Shinya Yamanaka derives first ever induced pluripotent stem (iPS) cells
• 2008 – NYSCF supported scientist derives first patient iPS lines (ALS)
• 2009 – Obama Executive Order and final NIH guidelines
• Allows NIH to fund some research on, but not derivation of hESCs
• Lines that were eligible under Bush era must be reviewed by a Working Group
• NIH funds cannot be used for research on stem cell lines derived from SCNT or parthenogenesis
The New York Stem Cell Foundation
Public Supports Stem Cell Research
• 73% of Americans favor expanding ESC research
• A vocal minority has controlled the message
Source: Research!America
The New York Stem Cell Foundation
Stem Cell Programs
• States responded with their own programs
• California – $3 billion over 10 years
• New York – $600 million over 11 years
• Connecticut – $100 million over 10 years
• Maryland – approximately $10 million per year
• NIH: FY12 - $1.5B for stem cell research
• $146.5M for hESC ~ 13%
• Private Funding
• New York Stem Cell Foundation Research Institute - $100 million
NYSCF Programs
NYSCF Innovators: Fellows and Investigators
NYSCF Conference and Symposia
NYSCF Research Laboratory
NYSCF Innovators
$53M dedicated to building the next generation of top stem cell researchers
• 55 3-year NYSCF Fellowships over 12 years ($12M) at 17 institutions
• 28 NYSCF Early-career Investigators over 6 years ($41M) at 10 institutions
In just eight years, NYSCF has achieved several breakthroughs in the field
NYSCF’s Proven Track Record
2013 – New therapeutic approach for diabetes • Discovery of compound that restores beta cell function in genetic
form of diabetes, may be applicable to all forms of diabetes. 2013 - Personalized bone graft advance • NYSCF Research Laboratory team engineers bone from
skin cells
2013 – First monogenic diabetes model • Mutated genes genetically corrected
2012 - Stopping mitochondrial disease • NYSCF Research Lab team develops clinical cure for inherited
disease that impacts children
2011 - Pioneering cell replacement therapy • NYSCF Research Lab team derives first ever human embryonic
stem cell from human eggs - Time magazine #1 medical breakthrough of the year
2008 - Creating first-ever disease model (ALS) • NYSCF scientist has Time and Science magazines #1 medical
breakthrough of the year
Why NYSCF Research Institute is Unique
• Focus only on translational research – translating research into cures
• Fund high-risk, high-reward “tipping point” experiments that traditional funding mechanisms won’t support
• Independent and unencumbered by bureaucracy or federal restrictions
• Leverage our proprietary research in collaboration with institutions around the world
NYSCF Research Institute
Laboratory
•45 full time researchers
•Raised and invested $100M for stem cell research
•Leader in developing stem cell technologies and disease modeling
•An international community of over 100 scientists collaborating to cure disease
NYSCF GLOBAL STEM CELL ARRAY™:AUTOMATED STEM CELL PRODUCTION, DIFFERENTIATION, MANIPULATION, AND CHARACTERIZATION
Representative
Stem Cell Lines
Reproducible stem cell production by automation
Fully quality controlled
Genetically diverse patient populations
Industrial production scale
Full GLP tracking
Array Features
Integration-free reprogramming
Defined media
Standardized substrates
Reprogramming Technology
Karyotyping
Genome analysis for identification tracking with SNP arrays
Gene expression analysis via direct mRNA
measurement (score card assays), 25 genes on
undifferentiated clones, and 100 genes on EBs
Quality Control
Produces hundreds of iPSC lines per month
Accepts up to 360 tissue samples at a time (skin [default] or
blood)
Utilizes ESCs and/or iPSCs as starting material for
expansion, differentiation, and analysis
Capacity
Partnership Opportunities
Production of iPSC lines
Large-scale parallel differentiation from and genomic
engineering of ESC/iPSCs
Assay development, validation, and scale-up
Access to NYSCF repositor y of ESC/iPSC lines
(genetically diverse and diseased populations)
Adaptation and optimization of existing diff erentiation
protocols to automation, which include:
For more information
please email: [email protected]
Scale-up stem cell research
Establish stem cell-based dr ug discovery platforms
Functionalize human genetics to accelerate the
development of stem cell-der ived interventions
Objectives
Dopaminergic Neurons OligodendrocytesRemoves manual manipulation
Massively parallel processing of samples
Produces reproducible panels of differentiated cell lines
Automation
Beta Cells Cardiomyocytes Forebrain Neurons
CTnT/Nuclei NKx2.1/Map2/DNAC-peptide/DAPI
Objectives:
• Reproducible stem cell production
• Parallel derivation & culture at scale
• Quantitative quality control assays
• Reproducible panels of differentiated cells
• Diverse and disease populations
Connect Genotype to phenotype:
• in vitro GWAS
• “Clinical trials in a dish”
NYSCF Research Institute Building infrastructure to industrialize stem cell research
• Bone regeneration
• Diabetes / auto-immune diseases
• Heart disease
• Neural disorders
• Alzheimer’s disease
• Autism
• Parkinson’s disease
• Multiple Sclerosis
• Mental Illness
NYSCF Disease Programs
Why Do Cures Take So Long?
Identify Disease Causes
Publish Research Papers
Academic Institutions Pharmaceutical & Biotech Companies
• Mainly work on large disease markets (changing)
• Public companies - generally risk averse
• Screen on mice and cells unrelated to the disease
• Use small collections of cell lines from a narrow group of patients ?
Then what?
Drug Development • 13 Years • $4 Billion • 99% Fail
NYSCF Provides a Bridge to Cures
Academic Institutions
can scale their
discoveries
reduces time, cost, and risk
Biotech & Pharmaceutical
Companies
connecting research to cures and treatments
The stages of development of a ‘typical’ new drug
DRUG DISCOVERY
PRECLINICAL DEVELOPMENT
CLINICAL DEVELOPMENT
Phase I Phase II Phase III Phase IV
1.5 years 5-7 years 2-5 years
Target selection
Lead-finding
Lead optimization
Pharmacological profiling
Pharmacokinetics
Short-term toxicology
Formulation
Synthesis scale-up
Pharmacokinetics, tolerability, side-effects in healthy volunteers
Small-scale trials in patients to assess efficacy & dosage
Long-term toxicology studies
Large-scale controlled clinical trials
Postmarketing surveillance
1 �50 projects 12 compounds 1.7 3 5
Drug candidate
Development compound
Drug approval for marketing
Paul et al., Nature Rev Drug Discovery, 2010
This process is amazingly inefficient and shockingly expensive
First time a drug may see a human cell
Functional Cells in a Dish
Alzheimer’s Neurons
Dopamine Producing Neurons
Cardiac Cells Insulin Producing Cells
Existing Challenges with iPS cells
• Artisanal product via various methods with variable quality
• Few cell lines from relatively homogeneous populations
• Lack of standardization
• Limited scalability and slow production
• Automated robotic systems for iPS cell generation, differentiation, and analysis
• Minimize manual manipulation
• Massive parallel processing (100s-1000s)
• Produce reproducible panels of differentiated cell lines
• Cell line collection
• 95% of genetic diversity
• Major and rare diseases
NYSCF Global Stem Cell ArrayTM
26
Automated differentiated cells
Differentiated Cells:
•Other iPSC derived cell types produced at NYSCF: astrocytes, endothelial cells, osteoblasts, oligodendrocytes, and others.
Cholinergic Neurons Tuj1/CHAT/DNA
Cardiomyocytes cTnT/Nuclei
Beta Cells Insulin/Glucagon/Nuclei
ATCGTACGTTGCATGCATCGTACGTTACCGCAACCTGCATGCCACGTACGCATGCATGCATGCATGCACTGCATGCATTGCATCTAACGTACGTATACGGCGCATGTATAGTGTACGTACGTACGTACGTATGCCAGTTGCATGGCATGCATTGCATGCTTACGT
ATCGTACGTTGCATGCATCGTACGTTACCGCAACCTGCATGCCACGTACGCATGCATGCATGCATGCACTGCATGCATTGCATCTAACGTACGTATACGGCGCATGTATAGTGTACGTACGTACGTACGTATGCCAGTTGCATGGCATGCATTGCATGCTTACGT
Puts the human genome into biological context
•Current genomic analysis allows scientists to see a connection between DNA and disease
• With the addition of NYSCF’s Stem Cell Array, scientists can see how the DNA actually functions in the disease.
Finding the Genetic Causes of Disease The NYSCF Global Stem Cell Array
28
• Replicate diseases in a dish using actual diseased human cells (not mouse cells)
• Anticipate how people from genetically diverse backgrounds will respond to different drugs before clinical trials
• Predict drug toxicity in the dish
“Clinical Trials in a Dish” The NYSCF Global Stem Cell Array
Scaling the Research The NYSCF Global Stem Cell Array
Allows scientists to:
•Scale their discoveries
•Test their findings in a large population
•Translate their research into medicine and cellular treatments for disease
30
Extensive Institutional Collaborations & Key Relationships (50+)
Other Countries Australia Israel Qatar Sweden United Kingdom
Select large scale collaborations:
Michael J. Fox Foundation
NIH Undiagnosed Disease Program
Cure Alzheimer’s Fund Stem Cell Consortium
Personal Genomes Project
Tissue samples
Banking
iPS production
Distribution
NYSCF Array Distribution Team Full Documentation MTA [Academic / Government / Commercial]
NYSCF Global Stem Cell ArrayTM
Freedom to Operate - Robust Management
NYSCF Collection Sites (clinical data), SCRO Committee, and Human Subjects Team
In-house US Collaborator International
IRB Protocols MTA USDA / Customs
Consent Forms MTA
NYSCF Production Management Team SOPs – Freedom to Operate – Licensing LIMS Tracking and batch records Bank QC
Partnership Opportunities
•Large-scale production, differentiation and genomic engineering of iPS cells
• Adaptation of existing protocols to automation
• Development of new protocols
• Optimization and validation across genetically diverse populations
•Assay development and validation
•Access to repository of iPS cell lines - controls with wide genetic diversity and disease cohorts (PD, AD, MS, Diabetes, others)
•Establishment of collaborative production sites
NYSCF Research Institute
Top Related