Bioengineering Red Fluorescent Tags from Thermosynechococcus elongatus
0911T Characterization & Contamination
Mo Kaze
What’s the opposite of Eureka?
Identify the problem (What happened?)Hypothesizing explanations for unexpected result (Why did it happen?)Locate source (How did it happen?)Find the real 911T !
Identifying the problem
Pelleted proteins were the wrong color therefore, Protein expressed was NOT the correct
gene
So which one was it?
Hypothesizing possibilities
Exploring potential reasons for resultsSample information was labeled incorrectly,
entirely different gene was expressedSamples themselves were contaminated by
another plasmid and the blue clone was dominant
Contamination
Exploring possible sources of contaminationOur glycerol stock of E.coli cells (LMG-194-
PCB or DH5α) was contaminated with the blue (mutated) clone
Tools or other implements contaminated our cultures during the expression process and the blue clone was dominant
Procedures: preparing DNA for sequencing
Mini prepping DNA Grow 2 mL cultures from the blue pellet Centrifuge to collect the bacteria Add lysis buffer to E.coli Extract proteins, chromosomal DNA, cell walls Centrifuge to remove debris Bind and wash and elute plasmid DNAMiniprep product = pure plasmid DNA Make 2 separate samples for sequencing
One with pBAD forward DNA PCR primers One with CBD reverse DNA PCR primers
Procedures: Sequencing DNA
Off the samples go to UC Berkeley’s DNA sequencing facility where their powerful equipment can sequence DNA and have results back in less than 2 days time
http://mcb.berkeley.edu/barker/dnaseq/
Procedures: Interpreting DNA results
oWhat we get back from UCB by email: oText file of raw sequence
ATTGAGCAGGCAGCCAAATGTGCAGATTGCTTACGTCAGGCTGCGGTGCAGTTAAGTGAGTTGCGCGATC
GCCAAGCCATTTTTGAGACCCTTGTGGCAAAGGGCCGTGAACTATTGGCCTGCGATCGTGTCATTGTCTA
TGCCTTTGATGACAACTATGTGGGAACAGTCGTAGCCGAGTCGGTGGCAGAGGGTTGGCCACAAGCTCGA
GATCAGGTAATTGAGGATCCCTGTTTCCGCGAACACTGGGTAGAGGCCTACCGCCAGGGCCGCATTCAAG
CCACGACGGATATTTTCAAGGCAGGGCTAACGGAGTGTCACCTGAATCAACTCCGGCCCCTCAAGGTTCG
GGCAAATCTTGTCGTGCCGATGGTGATCGACGACCAACTTTTTGGTCTCCTGATTGCCCACCAGTGCAGT
GAACCACGCCAGTGGCAGGAGATCGAGATTGACCAATTCAGTGAACTGGCGAGCACCGGCAGCCTTGTCC
TGGAGCGTCTCCATTTCCTTGAGCAG
Procedures: Interpreting DNA results
Using a free tool provided by UCSD we upload sequences and compare them
We have the entire genesequences uploaded to thedatabase already so we can compare our sequenceto the known, publishedgene sequences from T.elongatus
Sequence comparison results
This was the first explicit confirmation of what we suspected
“0911T” was NOT what we had expressed
0911T was actually 0569TM another one of our T.elongatus genes
Tracking down the source
Using lab books to determine possible dates where mislabeling could have occurred
Locating properly labeled glycerol stocks prior to the suspected date and then sequencing plasmid DNA
Moving forward
Ensuring the correct gene is being used Double checking DNA sequence data Segregating samples Using consistent, sterile technique Start expression process to verify expected result:
Yellow!