Download - Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Transcript
Page 1: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Disease Genes of Disease Genes of

Population: Example of Population: Example of

FinlandFinlandLeena PeltonenDepartment of Medical Genetics and Molecular MedicineUniversity of Helsinki and National Public Health Institute,

FinlandDepartment of Human Genetics, UCLA,USA

Page 2: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.
Page 3: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

• Founder Effect• Genetic Drift• Isolation• Regional Expansion

• Enrichment of Rare Diseases• Fin-Major mutation• Lack of CF, PKU• Population records since 1634• Epidemiological registers • Inbred training of clinicians • Favorable attitudes by public• Traditions in public health interventions

Finland -Finland -The Promised Land of The Promised Land of

Disease GeneticsDisease Genetics

Page 4: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

GRACILE (death in infancy) LAAHD (intrauterine death) FSH-RO (fertility disturbance) EPMR (progressive retardation) PEHO (progressive retardation) TMD (muscle disease) dominant RAPADILINO (growth disturbance with malformations) LCCS (intrauterine death) IOSCA, OHAHA (progressive retardation) CHS (progressive retardation) vLINCL (progressive retardation) HYDROLET (intrauterine death) SALLA (progressive retardation) MKS (intrauterine death) MEB (severe retardation) TCD, CHM (eye disease), X -recessive INCL (progressive retardation) HOGA (eye disease) DTD (growth disturbance) JNCL (progressive retardation) CHH (growth disturbance) MUL (growth disturbance) FAF (eye, nerve and skin disease) dominant USH3 (ear and eye disease) PLOSL (progressive retardation) AGU (progressive retardation) CLD (watery diarrhea) NKH (severe retardation) LPI (metabolic disease) CCD (watery diarrhea) APECED (autoimmune polyendocrinopathy) RESCH, RS (eye disease), X- recessive PME (neurological disease) SMB12 (anemia) CNA2 (eye disease) CNF (kidney disease)56... 58... 60... 62... 64... 66... 68... 70... 72... 74... 76... 78... 80... 82... 84 ...86... 88... 90... 92... 94... 96... 98

The Disease The Disease Genome of FinnsGenome of Finns

Gene cloned -Mutation known

Localizationknown

No localization

Page 5: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

FinnishDisease

Database

1980: 60 patients born annually, regional differences

Page 6: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Clinical Picture highly variableClinical Picture highly variable

Severe or Progressive Mental Retardation: INCL, vLINCL, JNCL, AGU, SALLA,

Intrauterine Death or Death in InfancyGRACILE, LCCS, HYDROLET, MECKEL,

Cong.nefrosis

Problems Later in Life

Dementia (PLO-SL), Autoimmune disease (APECED)

Eye or ear disease, Fertility disturbanceGrowth disturbance, Metabolic diseaseMuscle disease, Watery diarrhea

Page 7: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Congenital Congenital NephrosisNephrosis

• BirthPlaces of GreatGrandParents• Fin-major 78 %• Fin-minor 16 %• Incidence 1:8000• Carrier Frequency 1:45

Page 8: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

SALLA diseaseSALLA disease

•BirthPlaces of GreatGrandParents• Fin-Major 95 %• Incidence 1:40 000• Carrier Frequency 1:100 much higher in Salla

Page 9: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

• Small Number of Founders• No Immigration• Isolation

– Geographical– Linguistic, cultural

• Rapid Expansion

Population HistoryPopulation History

Page 10: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Expansion• 18th century - population 250 000• Today - population 5.1 million

LateSettlement

Late Settlement• 16th century• multiple bottle necks

Early Settlement • 2000 years ago• South and Coast

EarlySettlement

Page 11: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Benefits of the limited number of ancestral disease chromosomes

in disease gene hunt A sparse marker map sufficient to detect the

disease locus Association studies or “homozygosity scanning” of

affecteds only can be used instead of linkage analyses

More cost-effective disease gene mapping and identification

Page 12: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

More cost/time-effective?

Mixed populations

• 15 families with two affected children genotyped

• 400 markers for linkage analyses

30 000 genotypes

Isolates

• 5 affected individuals genotyped

• 200 markers scanned for allele sharing

1000 genotypes

Page 13: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Genome Project and Identification of Genome Project and Identification of Disease GenesDisease Genes

Linkage 5 Mb

Linkage disequilibrium 2 Mb

Shared haplotype 0.1Mb

Regional candidate genes (5-10)

Mutated gene(s)

Page 14: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

PLOPLOPolycystic

Lipomembranous

Osteodysplasia

Sclerosing

Leucoencephalopathy

Progressive presenile dementia Bone cysts Recessive, age of onset 20-40

Page 15: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

• Frontally accentuated loss of myelin• Astrocytic gliosis• Enlarged ventricles• Calcifications and atrophy of basal ganglia• Atrophy of corpus callosum• Activation of microglia• Vascular alterations

Neuropathological findings

Page 16: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Clinical phenotype described 1961 (Nasu and Hakola) Histopathology defined 1973-89 Assignment of disease locus by genome-wide scan to 19q13 to 153 kb region 1998 (Pekkarinen et al.) Gene identified 1999 (Paloneva et al.)

Short History of PLO SL

Page 17: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

DAP 12DAP 12 NK cell membrane protein

Crucial role in NK-cell activation and NK-cell-mediated lysis

Transmits activating signals via association with activating receptors recognizing MHC class 1 molecules

Page 18: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

CTGCAACCTCTGCCTCCCAGGTTCAAGCGATTCTCCTGCC..//.. CTCCACCTCCCAGGTTCAAGCGATTCTCTTGCCTGAGCCT

DA

P12

exo

ns

1-4

DA

P12

exo

n 5

cen.tel.

PLOSLFin 5’ breakpoint PLOSLFin 3’ breakpoint

TGGCATGATCTTGGCTCACTGCAACCTCTGCCTCCCAGGTTCAAGCGATTCTCTTGCCTGAGCCTCCCGAGTAGCTGGAACTA

PLOSLFin breakpoint region

PLOSLFin mutant allele:

Control sequence:

Intron 4

PLOSLFin deletion

Page 19: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.
Page 20: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

PLO patientsPLO patients

Both Finnish and Japanese mutations represent functional ‘knock-out’s for DAP12

No abnormality in the number or cytotoxic activity of NK cells

No clinical problems arising from defective NK cell function

Page 21: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

PLO shows locus heterogeneity

Some families don’t show linkage to chromosome 19 and have no mutations of DAP 12

What are the mutated gene(s) ?

Page 22: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Chromosome 19 haplotypes for Norwegian PLO-SL family

Am. J. Hum. Genet. 62:362-372 Pekkarinen et. al.

Page 23: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

IJBCB, Kerry S. Campbell et. al., 1999

Page 24: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Genes of DAP12-ligands

Protein /gene Chr Haplotype segregation

KIR2DS2 19 - MDL-1 7 - TREM-1 6 + TREM-2 6 + NKG2C/CD94 12 - SIRP-BETA-1 20 - CD49 12 - SYK 9 - ZAP70 2 -

Page 25: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Sequence analyses of TREM 2

Norwegian family: a Lys to Arg

Swedish family: Trp to STOP

US family: Asp to Gly

Bolivian family: Trp to STOP

Italian family: Splicing donator mutation

Page 26: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

DAP 12 and TREM 2

• Mutations in two separate subunits of multi-subunit receptor signaling complex result in the same human disease

• Relationship of functional defect with dementia and bone cysts??

Page 27: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Molecular pathogenesis of PLO?

Monoblaststem cells Monocyte

activation•Activated macrophage

•Microglia (CNS)

•Osteoclast (bone)

bone marrow blood tissues

-cells with functional defect represent the same lineage

Macrophage

differentiation

Page 28: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

APECED 82% AGU 98% CNF 78% INCL 98% PME 96% Diatrophic dysplasia 90% Salla Disease 94%

APECED 82% AGU 98% CNF 78% INCL 98% PME 96% Diatrophic dysplasia 90% Salla Disease 94%

Coverage of One Major Mutation

Coverage of One Major Mutation

Page 29: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

HTIFin carrier

1ATz-allele

carrier

HFEC282Y

carrier

1AT z-allele/CNFmajor/LCHADG1528C

carrier

DTDFin/LPIFin

carrier

GJB235G carrier

Finland ArrayFinland Array

Page 30: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

DNA-Chip for population screening

2400 DNA-samples analyzed for 31 disease mutations on the chip

Prevalence of recessive mutations

Regional variations

Feasibility for large screening programs

Page 31: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

TC TT

X= (signal A1) (signalA1+A2)

Y= LOG (signal A1+A2)

SNP genotyping

Genotype-calling software developed by Juha Saharinen

Page 32: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Carrier Frequencies

early settlement

Helsinki

late settlement

Page 33: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Carrier Frequencies

All 1:2,6

All 1:3,6

All Mutations 1:3

Page 34: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

AGUDiastrophic dysplasia

"Old" Finnish Mutations

Early Late Helsinki0

1

2

Congenital nephrosis

0

2

4

AGU, DD % CNF %

Page 35: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Early Late Helsinki0

1

2

3

4

5

6

INCLvLINCLBatten

2

1

0

INCL % vLINCL, Batten

NCL-diseases

Page 36: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

0

1000

2000

3000

4000

5000

6000

7000

8000

9000

1996 1997 1998 1999 2000 2001 2002

KPL

TMK

Diagnostic DNA tests in the University of Helsinki laboratory

Page 37: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Genome Studies

Accurate diagnosis / carrier detection of rare diseases (1500 currently)

New metabolic pathways, critical for human cells and tissues, identified

New molecular classification of diseases

Avenues for drug development

Page 38: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Where we fall short

We are not competent to infer from the accumulated genome information

• Physiological function of molecules• Understanding how molecules work together

We are unaware of the biochemical function of most proteins

We lack the knowledge of most interactions between cellular components

Page 39: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Function of the proteins

• Three dimensional structure of 1540 human proteins determined experimentally (www.rcsb.org.pdb)

• The function of 6000 human proteins is known

Page 40: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Ultimately it should be possible

• Examine individual’s genetic make-up at any position of the sequence

• Deduce functional consequences

• Make a well-informed choice of medical actions

Page 41: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Slowly discovering functional information of the genome

• Alternative splicing produces cell or tissue specific products

• Multiple promoters confer diversity of substrate specificity or inducible response

• Only 2/3 of the genes have canonical structure with ORF

• New classes of RNA genes• Genome landscape complexities

Page 42: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

Treatment and Cure

Drug discovery : target identification

Biology-based stratification of diseases and syndromes

Better targeted treatment trials

Prevention versus treatment

Page 43: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National.

”W e finished the genome map but we don't know how to fold it””W e finished the genome map but we don't know how to fold it”