What does it mean, in practice? 100%. Members of our community are only slightly less different from...
-
Upload
herbert-wilson -
Category
Documents
-
view
214 -
download
0
Transcript of What does it mean, in practice? 100%. Members of our community are only slightly less different from...
![Page 1: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/1.jpg)
What does it mean, in practice?
100%
100%100%
![Page 2: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/2.jpg)
Members of our community are only slightly less different from us than members of distant populations
85%
85%100%
![Page 3: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/3.jpg)
Variances among continents are small, but not zero. Do genotypes naturally cluster in continental or subcontinental groups?
![Page 4: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/4.jpg)
Assigning a genotype to its continent by discriminant analysis
training dataset
query genotype
?
![Page 5: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/5.jpg)
Genes, as well as morphology, suggest inconsistent clusterings of genotypes
Africa
Asia, Europe, Australia, Americas
Americas
Africa, Asia, Americas,Oceania
Asia Europe
Africa, Asia,EuropeOceania
Y chromosome: Romualdi et al. 2002
Alu insertions: Romualdi et al. 2002
X chromosome: Wilson et al. 2001
Europe,Ethiopia
S. Africa N. Guinea
Asia
![Page 6: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/6.jpg)
Genes, as well as morphology, suggest inconsistent clusterings of genotypes
377 STR loci: Rosenberg et al. 2005
Melanesia Eurasia N Africa N America
Maya
S. Africa
377 STR loci: Barbujani and Belle 2006
E Africa
C Africa
Piapoco
Suruì
Karitiana
Kalash
W. Eurasia
E. Asia
Africa
Americas
Oceania
![Page 7: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/7.jpg)
8
6
2
45
9
10
1
7
3
Genomic boundaries inferred from diversity at 377 STR loci(Barbujani and Belle 2006)
![Page 8: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/8.jpg)
Less than 8% of the alleles are continent-specific, and more than half of these are African
Rosenberg et al. (2002)
![Page 9: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/9.jpg)
Avg. numbers of haplotype blocks in 51 genome regions (1.5 million base pairs): limited continental
differentiation
![Page 10: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/10.jpg)
Africa is special: Genetic diversity in all continents is often a subset
of African genetic variation
Tishkoff et al. (1998)
![Page 11: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/11.jpg)
Approximate inferred colonization dates
Human genetic diversity largely reflects patterns of migration
![Page 12: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/12.jpg)
A pointillist view of human evolution and variation: 1
© 1999 Kenneth K Kidd, Yale University
![Page 13: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/13.jpg)
A pointillist view of human evolution and variation: 2
© 1999 Kenneth K Kidd, Yale University
![Page 14: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/14.jpg)
A pointillist view of human evolution and variation: 3
© 1999 Kenneth K Kidd, Yale University
![Page 15: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/15.jpg)
Genetic evidence on modern humans’ origins
• Extensive allele sharing across continents• Extensive haplotype sharing across continents• Largest proportion of human genetic diversity within
populations• No obvious continental clusters of populations• Genetic diversity out of Africa a subset of African
diversity• Broad-scale clines
We are a young
and mobile species
![Page 16: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/16.jpg)
• Il nostro genoma è molto piccolo• Il nostro genoma è molto grande• I nostri genomi sono molto simili• I nostri genomi sono molto differenti
La diversità genomica umana
![Page 17: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/17.jpg)
Mind the numbers
Humans and chimps share >98% of their genomes
Among the 2% differences, 1.9% are fixed differences within species
The remaining fraction, 0.1%, contains all human genomic variation
85% of that 0.1% represents differences among members of the same population
The differences among the main racial or continental groups represent 10% of 0.1% of the total, that is, 0.01%
But 0.01% of 3 billion DNA sites means 300 000 variable sites
![Page 18: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/18.jpg)
DNA-based forensic identification
Many DNA regions are characterised by a Variable Number of Tandem Repeats (VNTR): …CTAGACCCGAGAGAGAGAATTCCATGC… [5] …CTAGACCCGAGAGAGAATTCCATGC… [4] …CTAGACCCGAGAGAGAGAGAGAATTCCATGC… [7]
Each of us carries a potentially unique combination of alleles at VNTR loci
![Page 19: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/19.jpg)
Isolation of VNTRs
![Page 20: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/20.jpg)
DNA fingerprintingAlec Jeffreys et al.: Hypervariable minisatellite
regions in human DNA, Nature, 314:67-73, 1985.
![Page 21: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/21.jpg)
DNA fingerprinting: an application
![Page 22: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/22.jpg)
DNA fingerprinting: an application
![Page 23: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/23.jpg)
DNA fingerprinting: a paternity case
![Page 24: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/24.jpg)
A case of sexual violence
![Page 25: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/25.jpg)
But if races do not exist, how come forensic scientists are so good at finding them?
a. UK forensic classification (before 2005):European, Afro-Caribbean, Indian Subcontinent, South East Asian, Middle Eastern
b. UK forensic classification (after 2005)White-British, White-Irish, White-other, Asian-Indian, Asian-Pakistani, Asian-Bangladeshi, Asian-other, Black-Caribbean, Black-African, Black-other, Chinese, + 4 razze miste e Other
c. USA forensic classification Caucasian, African-American, East Asian, Hispanic, Native American
d. Bribri classificationBribri, ña
Any list can be Ok for certain purposes, no list gives an all-purpose biological classification of humankind
![Page 26: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/26.jpg)
Think about Hispanics
![Page 27: What does it mean, in practice? 100%. Members of our community are only slightly less different from us than members of distant populations 85% 100%](https://reader036.fdocuments.us/reader036/viewer/2022062518/56649e035503460f94aeecad/html5/thumbnails/27.jpg)
Consigli e sconsigli