SUPPLEMENTAL FIGURE LEGENDS

Figure S1. Expression Pattern of LIN28B. (A, B) Lin28a, Lin28b, Myc, Hmga2, and Igf2bp1

expression levels in whole embryonic small intestine or colon anlagen. (C) Mature Let-7 levels in small

intestine anlage. Relative (D) and estimated proportional (E) Let-7 levels in isolated intestinal

epithelium from 3-week old mice. (F) Total Let-7 levels rise from 3 to 15 weeks of age. (G-J)

Expression pattern of Lin28b by IHC in developing small intestine, exhibiting foci of staining in the

nucleus, predominantly in endoderm. (K) No staining was detected without the primary Ab. Expression

in small intestine (L) crypt appears primarily in the transit-amplifying region. (M) Colon exhibits

scattered staining of nuclei, mostly toward the crypt base within foci of the nucleus (inset in M). In 3-

week old mice, differentiated epithelial cells of jejunum (N) and colon (O) show cytoplasmic staining,

with some remaining nuclear foci. (P) IF staining for LIN28B (green) in Caco-2 cells reveals staining

in the nucleus (stained with Hoechst, blue), with some faint cytoplasmic localization. (Q) Caco-2 cells

exhibits decreasing levels of LIN28B protein upon differentiation. (R) Adult small intestine was

fractionated into crypt and villus epithelium. Lin28b mRNA is detected primarily in the crypt, along

with crypt-restricted Prom1, whereas Let-7 (all 9 miRNAs) is expressed in a pattern similar to villus-

restricted Trpv6. Lin28a was not detected. S) Lin28b is expressed in Lgr5+ cells and crypt cells. For

mouse results, mean is plotted +/–S.D., where n ≥ 3, * = p < 0.05, or ** = p < 0.01, by Student’s T-test.

Figure S2. LIN28B-Bound RNAs are Typified by Cross-Link Induced Mutations (CIMS).

Mutation profile of one CLIP sample (A) and one input sample (B) from Caco-2 cells. CLIP samples

(A) have significantly more deletions (left), but not significant differences in insertions (middle) and

substitutions (right), compared to input (B). (C) MEME analysis (Baily et al. 2006) yielded two

significant motifs from the CIMS dataset from Caco-2 cells. (D) Expression levels of LIN28B target

mRNAs affect CLIP-seq sensitivity, where lower-expressed mRNAs (as measured by RPKM values)

are detected (as determined by fold-enrichment) at a lower frequency between two replicates from Vil-

Lin28b colonic epithelium. (E) CLIP-seq in Caco-2 cells reveals the same phenomenon, where mRNAs

repeatedly identified in all three replicates exhibit a higher expression level compared to mRNAs not

replicated. (F, G) RNAs with or without CIMS do not exhibit significant different levels of expression,

but do represent RNAs that had intimate contact with LIN28B at specific positions where amino acids

were cross-linked to aromatic amino acids. Box plot whiskers represent 1.5x the interquartile range

(IQR) above third quartile or below the first quartile, and * = p < 0.01 using Student’s unpaired T-test.

Figure S3. Examination of Epithelial Lineages in the Small Intestine. (A-B) Sirius red stain reveals

Paneth cell granules at the base of crypts, illustrating a loss of this lineage with increasing LIN28B

expression in transgenic mice. (E-H) Alcian blue stain for sulphated mucins indicates that Goblet cells

are not adversely affected, except in some regions of the small intestine of Vil-Lin28bHi mice (H). IHC

for chromogranin-A (I-L) or alkaline phosphatase stain (M-P) does not reveal any significant effect on

enteroendocrine or enterocyte lineages, respectively. Magnification: 20x for all images.

Figure S4. mTOR Signaling is Not Altered in Vil-Lin28b Intestine. (A) Comparison with expression

arrays from caloric restricted mice (Yilmaz et al. 2012) indicates that genes upregulated following

caloric restriction are downregulated in Vil-Lin28b mice. (B) Immunoblots of lysates from jejunum

crypts for phospho-Akt (S473), Akt, phospho-S6 (S235/236), S6, phosopho-4E-BP1 (Thr37/46), and 4-

E-BP1 suggest no significant alteration in mTORC1 or mTORC2 activity in 4.5-week old Vil-Lin28bLo

mice or Vil-Lin28bLo / Let7IEC-KO mice. Immunoblots for these markers in villus tip epithelium yielded

similar results (not shown). There was no change detected in mRNA levels for putative Let-7 targets,

Insr, Igf1r, Irs2, Kras, or Myc (c-Myc) in intestinal crypts (C) or total epithelium (not shown).

SUPPLEMENTAL TABLES

Table S1. Adenomas and Adenocarcinomas (AdCA) Incidence in Vil-Lin28b Transgenic F0, F1, and N2 Cohort

3 to 10 Months of Age 12 to 17 Months of AgeLine Cases Site Multiplicity P-

value*Cases AdCA

FoundMedian Age

Site Multiplicity P-value*

WT 0/26 N/A N/A N/A 3/43 0 15.3 S.I. 3.67 N/ALet7IEC-KO 0/5 N/A N/A N.S. 1/5 0 14.7 S.I. 1 0.42TGLo 0/11 N/A N/A N.S. 5/17 0 15.5 S.I. 2.25 0.035TGMed 1/13 S.I. 1 (AdCA) 0.33 10/14 3 14.7 S.I. 2.1 5.2 x 10-6

TGHi 2/4 S.I. Pervasive† (Adenoma)

0.024 3/3 0 15.1 S.I. & Colon

Pervasive† 0.0013

TGVar 1/2 S.I. 1 (AdCA) 0.095 11/17 0 15.5 S.I. 3 9.1 x 10-6

*P-value calculated using Fisher’s Exact Test†Individual polyps/adenomas could not be easily distinguished histologically on H&E sections.

Table S2. Statistics on CLIP and Input Sites Containing DeletionsSample Sites

covered by reads

Sites with deletions (%)

Del sites after filtering out m=1

Del sites after filtering out m<3, or k<4, or m/k<0.2 (%)

Human Caco2_CLIP (CTTGTA) 412811 2130 (0.52%) 1203 534 (0.1294%)

Caco2_CLIP (GCCAAT) 335697 1896 (0.56%) 1027 426 (0.1269%)

Caco2_CLIP (TGACCA) 590777 3438 (0.58%) 1731 631 (0.1068%)

Caco2_Input (CTTGTA) 3226107 1158 (0.034%) 265 13 (0.00040%)

Caco2_Input (GCCAAT) 3828888 1273 (0.033%) 276 21 (0.00055%)

Caco2_Input (TGACCA) 3181607 1424 (0.044%) 341 13 (0.00041%)

DLD1_CLIP 3348330 10378 (0.31%) 8383 5293 (0.1585%)

DLD1_Input 564179179 770604 (0.14%) 111238 17500 (0.0031%)

LoVo_CLIP 3094987 11713 (0.33%) 10338 6754 (0.2189%)

LoVo_Input 607177211 806782 (0.13%) 96229 11576 (0.0019%)

Mouse Jejunum_CLIP 2585025 9951 (0.385%) 8093 6764 (0.2617%)

Colon_CLIP (CTTGTA) 1049404 2893 (0.28%) 2035 1385 (0.1320%)

Colon_CLIP (GCCAAT) 888613 2723 (0.31%) 1678 1029 (0.1158%)

Colon_Input (CTTGTA) 10826660 65890 (0.37%) 5844 268 (0.00015%)

Colon_Input (GCCAAT) 223249615 60811 (0.27%) 6525 820 (0.00037%)

Table S3. Cellular Component GO Categories of CLIP-Seq Targets

Cellular Component GOAdjusted p-value (Benjamini and Hochberg, 1995)Jejunum Colon Caco2 DLD1 Lovo

Intracellular part GO:0044424 7.71E-178 3.17E-70 1.65E-37 8.81E-63 2.52E-39Intracellular organelle GO:0043229 3.94E-142 1.96E-54 2.66E-34 7.41E-46 8.59E-39

Organelle GO:0043226 4.48E-141 1.62E-54 4.22E-34 1.35E-45 8.59E-39Intracellular GO:0005622 1.19E-185 2.91E-72 5.66E-36 1.7E-56 2.1E-38Membrane-bounded organelle GO:0043227 1.16E-129 5.42E-52 1.08E-34 7.57E-41 9.35E-35

Intracellular membrane-bounded organelle

GO:0043231 2.65E-129 2.82E-52 8.32E-35 8.82E-41 1.04E-34

Table S4. Antibodies Used for IHC, IF, Immunocytofluorescence (IC), and Western BlotsAntibodies for IHC, IF, and ICAntigen/Gene Species Type Source and Cat# Dilution Detection

Mouse Lin28b Rabbit pAb Cell Sig. Tech. #5422 1:500 IHC w/TSAHuman LIN28B Rabbit pAb Cell Sig. Tech. #4196 1:1000 ICKi67 Rabbit mAb Abcam ab16667 1:200 or 1:50(IF) IHC and IFHMGA2 Rabbit mAb Cell Sig. Tech. #8179 1:100 IHC and IFHA-Tag Mouse mAb Covance MMS-101P 1:500 IFβ-Catenin Rabbit mAb Cell Sig. Tech. #8480 1:100 IFHA-Tag Mouse mAb Covance, MMS-101P 1:100 IFGFP Chick. pAb Abcam ab13970 1:3000 IF w/TSALysozyme/Lyz1 Rabbit pAb Diagnostic Biosys. RP-028 1:1000 or 1:500(IF) IHC and IFCleaved-Casp.3 Rabbit pAb Cell Sig. Tech. #9661 1:1000 IHCChromogranin-A Rabbit pAb Abcam ab15160 1:1000 IHCBrdU Mouse mAb DSHB (clone G3G4) 1:100 IFAntibodies for Western BlotsAntigen/Gene Species Type Source and Cat# Dilution DetectionMouse Lin28b Rabbit pAb Cell Sig. Tech. #5422 1:2000 ECL or near-IR Fluor.Human LIN28B Rabbit pAb Cell Sig. Tech. #4196 1:5000 ECL or near-IR Fluor.HA-Tag Mouse mAb Covance, MMS-101P 1:2000 near-IR Fluor.ACTIN/ACTB Mouse mAb Sigma A5316 1:10,000 near-IR Fluor.GAPDH Mouse mAb Millipore Mab374 1:10,000 near-IR Fluor.EEF2 Rabbit pAb Cell Sig. Tech. #2332 1:2000 near-IR Fluor.EIF4G1 Rabbit pAb Cell Sig. Tech. #2498 1:2000 near-IR Fluor.RAB11A, B Rabbit pAb Invitrogen #71-5300 1:5000 ECLCDK7 Rabbit pAb Santa Cruz Biotech. sc-723 1:5000 ECLCyclinD1/CCND1 Mouse mAb BD Biosciences #556470 1:2000 ECLCortactin/CTTN Rabbit pAb Cell Sig. Tech. #3502 1:2500 ECLClaudin-1/CLDN1 Rabbit pAb Invitrogen #71-7800 1:1000 near-IR Fluor.p120-catenin/CTNND1 Mouse mAb BD Biosciences #610134 1:2000 near-IR Fluor.PKM2 Rabbit mAb Cell Sig. Tech. #4053 1:2000 near-IR Fluor.HIST1HI Mouse mAb Santa Cruz Biotech sc-8030 1:5000 ECLAXIN-2 Rabbit pAb Millipore #06-1050 1:2500 ECLc-MYC/MYC Rabbit mAb Cell Sig. Tech. #5605 1:2500 ECL or near-IR Fluor.

Table S5. Primers and ProbesOligo/Probe name

Target Sequence or Catalog #

Oligos for shRNA ConstructionLIN28B shRNA (S)

Hu LIN28B

TGCTGAGTAATGGCACTTCTTTGGCTGTTTTGGCCACTGACTGACAGCCAAAGGTGCCATTACT

LIN28B shRNA (AS)

Hu LIN28B

CCTGAGTAATGGCACCTTTGGCTGTCAGTCAGTGGCCAAAACAGCCAAAGAAGTGCCATTACTC

Non-specific shRNA (S)

N/A TGCTGAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT

Non-specific shRNA (AS)

N/A CCTGAAATGTACTGCGTGGAGACGTCAGTCAGTGGCCAAAACGTCTCCACGCGCAGTACATTTC

mirBXL adapter1

N/A S: GATCCTGGAGGCTTGCTGAAGGCTGTAAS: AGCATACAGCCTTCAGCAAGCCTCCAG

mirBXL adapter2

N/A S: CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCA GATCTGGCCGCACAS: TCGAGTGCGGCCAGATCTGGGCCATTTGTTCCATGTGAGTGCTAGTA ACAGGCCTTGTGT

Oligos and Taqman Probes for RT-PCRmLin28b Taqman

Mus Lin28b

Forw: GAGTCAATACGGGTAACAGGCProbe: /56-FAM/CCTTTGGCT/ZEN/TTCTCTTTTGCAGGGTC/3IABkFQ/Rev: TTCTCGCACAGTCCACATC

mLin28a Taqman

Mus Lin28a

Forw: TGTTCTGTATTGGGAGTGAGCProbe: /56-FAM/TGTCTCCTT/ZEN/TGGATCTTCGCTTCTGC/3IABkFQ/

Rev: GCTTGCATTCCTTGGCATGmMyc Taqman

Mus c-Myc Forw: GCTGTTTGAAGGCTGGATTTCProbe: /56-FAM/CGTAGTCGA/ZEN/GGTCATAGTTCCTGTTGGT/3IABkFQ/Rev: GATGAAATAGGGCTGTACGGAG

mIgf2bp1Taqman

Mus Igf2bp1

Forw: GAGCAGGAGATGGTACAAGTGProbe: /56-FAM/TGGCGAAGC/ZEN/GGGAGAGTTGT/3IABkFQ/Rev: TGGCGAAGCGGGAGAGTTGT

mIgf2bp2Taqman

Mus Igf2bp2

Forw: TCTCGGGTAAAGTGGAATTGCProbe: /56-FAM/TGCAGGTGA/ZEN/GGCGGGATGTT/3IABkFQ/Rev: TGTCCCATATTCAGCCAACAG

mHmga2Taqman

Mus Hmga2

Forw: CAAGAGGCAGACCTAGGAAATGProbe: /56-FAM/CTGCGGACT/ZEN/CTTGCGAGGATGT/3IABkFQ/Rev: GATCCAACTGATGCTGAGGTAG

mProm1Taqman

Mus Prom1 Forw: GCTCTGCGAACCTTATGAAAACProbe: /56-FAM/TGGACACTC/ZEN/CCTATCTGCTCAAGGAAC/3IABkFQ/Rev: ATCCCTGTAGACTTGCTCAAAG

mPbx2 Taqman

Mus Pbx2 Forw: GAGGGAAGCAAGACATCGGProbe: /56-FAM/AATGACCAT/ZEN/CACGGACCAGAGCC/3IABkFQ/Rev: CAGGACACTAAACAGGGCAG

mE2f5 Taqman

Mus E2f5 Forw: TGTAACTCACGAAGACATCTGCProbe: /56-FAM/CCATTCAGG/ZEN/CACCTTCTGGTACACA/3IABkFQ/Rev: TGTCCATTCTGTCCCATTTCTG

mAcvr1c Taqman

Mus Acvr1c

Forw: AGAACATCCTCGGTTTCATCGProbe: /56-FAM/AGCCAGAGT/ZEN/TGTGTCCAAGTTCCAT/3IABkFQ/Rev: TTGACCATTCCAGCCACAG

mKras Taqman

Mus Kras Forw: GTCCTGGTAGGGAATAAGTGTGProbe: /56-FAM/TCCCGTAAC/ZEN/TCCTTGCTAACTCCTGA/3IABkFQ/Rev: AGAAGGCATCGTCAACACC

mLyz1 Taqman

Mus Lyz1 Forw: CAAAGAGGGTGGTGAGAGATCProbe: /56-FAM/CAAGGCATT/ZEN/CGAGCATGGGTGG/3IABkFQ/Rev: TGAGAAAGAGACAGAATGGGC

mMmp7 Taqman

Mus Mmp7 Forw: TGGAAAGAGGAACACGCTGProbe: /56-FAM/AGCTCAGGA/ZEN/AGGGCGTTTGTTCA/3IABkFQ/Rev: ACAAGGAAGAGGGAAACAGG

mTbpTaqman

Mus Tbp Forw: CACCAATGACTCCTATGACCCProbe: /5HEX/CACTCCTGC/ZEN/CACACCAGCTTCT/3IABkFQ/Rev: CAAGTTTACAGCCAAGATTCACG

mHprtTaqman

Mus Hprt Forw: CCCCAAAATGGTTAAGGTTGCProbe: /56-FAM/CTTGCTGGT/ZEN/GAAAAGGACCTCTCGAA/3IABkFQ/Rev: AACAAAGTCTGGCCTGTATCC

mIgf1r (F)mIgf1r (R)

Mus Igf1r Forw: TGCTGTCTATGTCAAGGCTGRev: AGAGGAAGAGTTTGATGCTGAG

mInsr (F) mInsr (R)

Mus Insr Forw: GGAAGCTACATCTGATTCGAGGRev: TGAGTGATGGTGAGGTTGTG

mIrs2 (F)mIrs2 (R)

Mus Irs2 Forw: CCACAGTTCAGAGACCTTTTCCRev: TGAGACATTTTCCACAGAGGC

mIgf1 (F)mIgf2 (R)

Mus Igf1 Forw: TGGATGCTCTTCAGTTCGTGRev: AGTACATCTCCAGTCTCCTCAG

mDefa5 (F)mDefa5 (R)

Mus Defa5 Forw: GGCTGTGTCTATCTCCTTTGGRev: AAAGATTTCTGCAGGTCCCA

mKit (F)mKit (R)

Mus Kit Forw: TGTGGCTAAAGATGAACCCTCRev: ACACTCCAGAATCGTCAACTC

mSox9 (F)mSox9 (R)

Mus Sox9 Forw: CAAGACTCTGGGCAAGCTCRev: GGGCTGGTACTTGTAATCGG

mWnt3 (F)mWnt3 (R)

Mus Wnt3 Forw: AGCTGCCAAGAGTGTATTCGRev: CTAGATCCTGCTTCTCATGGG

mDll4 (F) Mus Dll4 Forw: CAGTGAGAAGCCAGAGTGTC

mDll4 (R) Rev: AGCTGGGTGTCTGAGTAGGmSpdef (F)mSpdef (R)

Mus Spdef Forw: ACGTTGGATGAGCACTCGRev: CCATAAAAGCCACTTCTGCAC

mTrpv6 (F)mTrpv6 (R)

Mus Trpv6 Forw: ATGGCTGTGGTAATTCTGGGRev: AGGAAGAGTTCAAAGGTGCTG

mNr6a1 (F)mNr6a1 (R)

Mus Nr6a1 Forw: TGATGTGCTTGCCAGAGATCRev: GTCACTCCTTCACCGTACTTG

mHif1an (F)mHif1an (R)

Mus Hif1an Forw: CTATCCATACCCTGTCCATCACRev: GCCAACCACTGTCTCATAACC

mAxin2 (F)mAxin2 (R)

Mus Axin2 Forw: TAGGTTCCGGCTATGTCTTTGRev: TGTTTCTTACTCCCCATGCG

mEphB2 (F)mEphB2 (R)

Mus EphB2 Forw: CAGTACCGGAAATTCACCTCGRev: TCTGTAGTCCTGTTCAATGGC

mEts2 (F)mEts2 (R)

Mus Ets2 Forw: TTTGCTGTGCTCCCTTCTCRev: GCTTTTAAGGCTTGGCTCATC

mAscl2 (F)mAscl2 (R)

Mus Ascl2 Forw: CTGCTTGACTTTTCCAGTTGGRev: CACTAGACAGCATGGGTAAGG

mCd44 (F)mCd44 (R)

Mus Cd44 Forw: TTCATCCCAACGCTATCTGTGRev: CGAAGGAATTGGGTAGGTCTG

Primers for GenotypingmmirLet7c2-320 (F)

mirLet7c2b CTGGACCTTGGTGGCCTTTAACAA

mmirLet7b+201 (F)

mirLet7c2b AGATCGCCAACCACACATTGACAC

mmirLet7b+334 (F)

mirLet7c2b TCTGTTGTTCCACTCATGTGGAGG

mmirLet7b+277targ (R)

mirLet7c2b AAGCCAGTAAGCAGTGGGTTCTCT

MVP+5498Lin28bEx1R

Vil-Lin28b Forw: ACAGGCACTAAGGGAGCCAATG 332 bp productRev: CTGGCTCTTCACCTTTGCT

SV40epA-FVil5p-R2

iiLet7 Forw: GTTTTTTGTGTCCCTGAATGCAAG 379 bp productRev: CCAAACTCCAGGTGACAGGT

SUPPLEMENTAL MATERIALS AND METHODS

Transgene Construction and Injection

A FLAG-HA-tagged mouse Lin28b cDNA and an IRES-tdTomato expression cassette was

cloned downstream of the 13 Kb mouse villin (Vil1) promoter (Madison et al., 2002) in the p13KVil-

SVLpA vector at XmaI and AgeI restriction sites. The SV40 late polyadenylation signal provides

transcription termination and polyadenylation sequences. The transgene was linearized and removed

from vector backbone sequences by digestion with PmeI (NEB). The Vil-Lin28b 16.26 Kb transgene

fragment was purified with the Qiaex II Gel Extraction Kit (Qiagen) and then further purified using an

Elutip-D Affinity Purification Column (Schleicher and Schuell). The Vil-Lin28b transgene was injected

in B6SJL F1 fertilized oocytes by the University of Pennsylvania Transgenic and Chimeric Mouse

Facility. Founders were identified by PCR and bred with C57BL/6J mice to produce F1 mice. All mice

were back-crossed to C57BL/6J mice unless noted otherwise in the text. Four lines were generated

from four founders: lines exhibiting low (Vil-Lin28bLo), medium (Vil-Lin28bMed), high (Vil-Lin28bHi),

and variegated (Vil-Lin28bVar) expression.

For construction of the tetracycline-inducible Let-7 transgene (iiLet7), 2 copies of the 1.2 Kb

chick beta globin hypersensitive site 4 (cHSIV) insulator region were cloned upstream of the TRE3G

promoter (Clontech) and an EmGFP region from the pcDNA™6.2-GW/EmGFP-miRneg control

plasmid (Invitrogen) in which the miRneg sequence was replaced with the Let-7a 155 region from a

modified pLenti6.2-GW (pBLOCK-iT) vector of the pLenti6/UbC/V5-DEST Gateway system

(Invitrogen, Carsblad, CA, USA) (a gift from Dr. Jerome Torrisani). The Let-7a chimeric shRNA

(Let7a155), which contains a modified terminal loop from mir155, was obtained from a Let-7a lentiviral

expression vector (a gift from Dr. Jerome Torrisani). This Let-7a chimeric shRNA (Let7a155) is not

recognized by LIN28A or LIN28B.

A 1.58 Kb SV40 polyadenylation signal fragment from the SV40 early transcript was cloned

downstream of this sequence. This entire cassette was flanked by two unique SfiI sites, and the

resulting plasmid called pGIT3G-Insul-Let7. The p13KVil-SVLpA plasmid was modified to contain

these two identical SfiI sites flanking the 13 Kb mouse Vil1 promoter and SV40 late polyadenylation

signal, to generate the p13KVil-SVLpA-SfiI plasmid. The rtTA-M2 (Urlinger et al. 2000) sequence

was PCR amplified using Phusion DNA polymerase (NEB) from FUdeltaGW-rtTA (Maherali et al.

2008) and cloned into XhoI and AgeI sites in the p13KVil-SVLpA-SfiI plasmid, to generate the

p13KVil-rtTA-SVLpA-SfiI plasmid. The p13KVil-rtTA-SVLpA-SfiI and the pGIT3G-Insul-Let7

cassettes were each removed from vector backbone sequences by digestion with SfiI and ligated

together overnight using T4 DNA Ligase (NEB). The circular ligation product was linearized with NotI

and purified for injection as described above for the Vil-Lin28b transgene. Founders were identified

and bred as described above. Primers for genotyping Vil-Lin28b and iiLet7 mice are listed in Table S5.

Production of a conditional (floxed) mirLet7c2 / mirLet7b allele

For generation of a conditional allele at the mouse mirLet7c2/mirLet7b locus, a targeting vector

was constructed consisting of 3 Kb of 5' flank and 6.5 Kb of 3' flanking genomic sequence. Within this

vector, LoxP sites flanked 1.18 Kb of sequence encompassing both the mirLet7c2 and the mirLet7b

shRNA sequences and an FRT-flanked PGK-Neo expression cassette. Mouse embryonic stem cells,

line V6.5, were electroporated with the linearized Let-7 targeting construct, and clones were selected

with G418 for one week. Colonies were picked, expanded, and genomic DNA collected for Southern

blots. Recombination was validated at both the 5' region and 3' region of the targeted region of the

mirLet7c2/mirLet7b locus by Southern blot for 12 clones, and five clones were selected for karyotype

analysis. One line was injected into Balb/c blastocysts for generation of chimeras. Germline

transmission was confirmed following crosses to C57BL/6J, and the PGK-Neo cassette was removed in

the next generation by crossing to PGK-FLPo mice (Jackson Laboratory Strain #011065). Mice

containing this floxed allele (mirLet7c2b+/lox) were intercrossed and bred with VilCre mice (Jackson

Laboratory Stock # 004586) to generate VilCre+/mirLet7c2blox/lox mice along with littermate controls.

Primers for genotyping mirLet7c2b floxed alleles are: mmirLet7b+201(F), mmirLet7b+334(F), and

mmirLet7b+277targ(R), which yield a 157 bp band for the wild-type allele, and 100 bp product for the

floxed allele. For determining Cre-mediated recombination in genomic DNA from intestinal

epithelium, PCR was performed using these primers: mmirLet7c2-320(F), mmirLet7b+201(F),

mmirLet7b+334(F), and mmirLet7b+277targ(R), which detects the wild-type allele (157 bp), the

floxed allele (100 bp), and the recombined (deleted) allele (233 bp).

All experiments and protocols with mice were reviewed and approved by the University of

Pennsylvania Institutional Animal Care and Use Committee.

Immunohistochemistry (IHC), Immunofluorescence (IF), an Immunocytofluorescence (IC)

For immunohistochemistry and immunofluorescence paraffin sections were warmed for 15

minutes at 56°C, de-paraffinized, rehydrated, and antigen retrieval was performed in 0.5 liters of 10

mM sodium citrate buffer (pH 6.0) by boiling for 10 minutes. Slides were allowed to cool slowly by

rocking, on ice, for 15 minutes. Non-specific binding was blocked with PBS blocking buffer (10% goat

serum, 1% BSA, 0.25% Triton-X, in PBS) for one hour at room temperature (RT). Slides were

incubated overnight at 4°C in a humidity chamber, washed 3 x 5 minutes in PBS, then biotinylated

secondary antibodies (at 1:200) or fluorescent conjugated antibodies (at 1:300) were added and

incubated 60 minutes at RT. Slides were washed 3 x 5 minutes and were then cover-slipped for

immunofluorescence or stained according to the manufacturers instructions using the VECTASTAIN

Elite ABC System (Vector Labs) and the DAB Peroxidase Substrate Kit (SK-4100, Vector Labs)

For mouse Lin28b and GFP immunostaining, tyramide signal amplification (TSA) was

performed. Sections were incubated overnight with rabbit anti-Lin28b (#5422, mouse-preferred, Cell

Signaling Technologies) at 1:500, or chicken anti-GFP (ab13970, Abcam) at 1:3000, overnight at 4°C

in a humidity chamber, washed 3 x 5 minutes with PBS, then biotinylated secondary antibody diluted

1:200 in TNB-BB (Vector Labs) was added and incubated 60 minutes at RT. Slides were washed 3 x 5

minutes with TNT wash (100 mM Tris, pH 7.5, 150 mM NaCl, 0.05% Tween) and were then processed

according to the manufacturers instructions using the VECTASTAIN Elite ABC System (Vector Labs).

Following incubation with ABC reagent, slides were washed 3 x 5 minutes with TNT wash, and then

incubated with biotin-tyramide (Perkin Elmer) diluted 1:50 in Amplification Diluent (Perkin Elmer) for

exactly 6 minutes (for Lin28b) or 8 minutes (for GFP), then slides were washed 3 x 5 minutes with

TNT wash. Slides were then incubated with streptavidin-HRP (Perkin Elmer) at a 1:100 dilution in

TNB-BB or streptavidin-Cy2 (Jackson Immunoresearch) at a 1:250 dilution in TNB-BB for one hour at

RT. Slides were washed 3 x 5 minutes with TNT wash. Slides were developed with 3, 3’-

diaminobenzidine for exactly 20 minutes using the DAB Peroxidase Substrate Kit (SK-4100, Vector

Labs) or cover-slipped for IF. IHC sections were briefly (2 seconds) counterstained with hemotoxylin,

rinsed with tap water, dehydrated, and cover-slipped.

For immunocytofluorescence of human LIN28B in Caco-2, cells were grown on 22 mm no 1.5

gelatin-coated coverglasses. Cells were rinsed with PBS, fixed for 10 minutes in 4% paraformaldehyde

(in PBS) on a rotating platform, the rinsed with PBS. Cells were permeabilized with 0.25% Triton-X in

PBS for 10 minutes, then blocked 30 minutes with 1% PBS in 0.25% Triton-X in PBS. Antibodies

were diluted into 1% PBS in 0.25% Triton-X in PBS, then incubated overnight at 4°C in a humidified

chamber. Coverglasses were washed briefly by immersing in PBS, then incubated for 1 hour in a

humidified chamber with a 1:1000 dilution of goat anti-rabbit Alexafluor-488 (Invitrogen) and

simultaneously stained with 0.5 µg/ml Hoechst (Invitrogen). Coverglasses were washed briefly by

immersing in PBS, then inverted onto slides with fluorescent mounting medium. Antibodies used for

IHC, IF, and IC are listed in Table S4.

Quantitative RT-PCR (Real-Time PCR)

Total RNA was isolated using Trizol reagent (Life Technologies). For miRNAs, RT reactions

on 6-10 ng of total RNA were performed using the miRNA RT kit (Life Technologies) according to

manufacturers instructions. Taqman probes for mature Let-7 miRNAs were obtained from Life

Technologies (Cat. # 4427975, assay numbers 000377, 002619, 000379, 002283, 002406, 000382,

002282, 002221, and 000577) and real-time PCR performed with 1.33 µl cDNA per 20 µl reaction

using Taqman Fast Advanced Master Mix (Life Technologies). For assaying mRNA levels, 2-5 µg of

total RNA was reverse transcribed using Superscript III RT (Life Technologies) and 50 ng of an oligo

dT primer (IDT DNA Inc.). Real-time PCR was then performed on 0.5 µl of cDNA per 20 µl reaction,

using either Taqman primer/probes (in 1x Taqman Universal PCR Master Mix from Life

Technologies) or standard primers (in 1x Power SYBR Green PCR Master Mix from Life

Technologies). Let-7 levels were normalized to snoRNA135 (Snord65) (Cat. # 4427975, assay name

snoRNA135, Life Technologies) and mRNA levels were normalized to Hprt and/or Tbp. Primers and

probes used for RT-PCR are listed in Table S5.

Crypt Isolation from iiLet7 Mice and GFP+ Sorting

Doxycycline-containing chow was given to mice (WT, iiLet7, or Vil-Lin28bMed/iiLet7 mice) for

1 week and epithelium from 4 cm of jejunum was isolated as above. Crypts were purified by passing

epithelium over stacked 80 µm, 54 µm, and 27 µm PluriStrainer Filters (PluriSelect) at 4°C. The 80 µm

and 27 µm filters were each washed with 1 ml ice-cold CMF-HBSS, and crypts were eluted off of the

27 µm filter with 4 mls ice-cold crypt culture medium (Sato et al. 2009) containing 10 µM ROCK

inhibitor (Y-27632), 5 µM CHIR99021, and 50 ng/ml EGF, but no Noggin or R-Spondin. GFP-positive

and GFP-negative crypts were sorted on a COPAS BioSort (Union Biometrica) at the Princeton

University Flow Cytometry Resource Facility (Princeton, NJ). Crypts were immediately centrifuged at

4°C and re-suspended in 800 µl Trizol for RNA Isolation, and 150 ng of total RNA was used in a

SuperScript III (Invitrogen) RT reaction with 25 ng of oligo-dT primer. For mirRNA RT-PCR 6 ng of

RNA was used for each reaction and Let-7a QPCR values were normalized to U6 miRNA values.

Protein Lysate Preparation and Immunoblots

Cells or frozen intestinal epithelial pellets were homogenized on ice in 1X NP40 lysis buffer

(50 mM HEPES, pH 7.5, 150 mM KCl, 2 mM EDTA, 1 mM NaF, and 0.5% NP40) containing these

freshly added constituents: mammalian protease inhibitor cocktail (#P8340, Sigma) at a 1:100 dilution

(or 1:50 dilutiong for intestinal epithelial cells), 1 mM dithiothreitol (DTT), 2 mM sodium

orthovanadate, and 5 mM sodium pyrophosphate. On ice, adherent cells on tissue culture plates were

washed once with cold PBS, then complete lysis buffer added (10 to 15 µl/cm2), cells removed with a

rubber scraper, transferred to a microcentrifuge tube, then incubated on ice for 5 to 10 minutes. Lysates

were frozen at -20°C for at least one hour, thawed on ice, then centrifuged for 15 minutes at 17,500 x g

at 4°C to removed insoluble components. Protein concentrations were determined using the Biorad

Protein Assay Kit II (#500-0002, Biorad). For SDS-PAGE, 25 to 30 µg of protein lysate was incubated

with 4x NuPAGE LDS Sample Buffer (NP0008, Invitrogen) and NuPAGE Sample Reducing Agent

(NP0009, Invitrogen) at 70°C for 10 minutes. Reactions were run on 1.5 mM NuPAGE Novex 4-12%

Bis-Tris polyacrylamide gels (NP0335BOX, Life Technologies) according to manufacturer's

instructions. Resolved proteins were transferred to polyvinylidene difluoride (PVDF) membranes in 1X

NuPAGE Transfer Buffer (NP0006, Invitrogen) containing 10% ethanol, at 4°C for 2-3 hours at 80

volts, or overnight at 25 volts. Membranes were rinsed briefly in TBST (50 mM Tris; 150 mM NaCl;

0.05% Tween), then blocked 60 minutes at room temperature (RT) with 5% dry milk in TBST, rinsed 3

minutes with TBST, then blocked 5 to 10 minutes with 5% bovine serum albumin (BSA). Primary

antibodies were diluted into 5% BSA in TBST and incubated overnight at 4°C with mild agitation.

Blots were washed 4 x 5 minutes with TBST at RT, and secondary antibodies were added for 60

minutes at RT, and then washed again as above. Proteins were visualized with ECL Prime Western

Blotting Detection Reagent (RPN2232, GE Healthcare Life Sciences) for HRP-conjugated antibodies

or with an Odyssey Infrared Imager (LI-COR Biosciences) for near-infrared (near-IR) fluorophore-

conjugated antibodies. Near-IR fluorescence was quantified using LI-COR Image Studio Software. For

ECL quantification of western blots, films were scanned as gray-scale images into Adobe Photoshop,

inverted, and the mean pixel intensity quantified for each band. Antibodies used for immunoblots are

listed in Table S4.

Measuring Intestine Mass

Following euthanasia, mice were weighed on an analytical balance to determine animal mass.

To measure small intestine and colon mass, organs were dissected from euthanized mice and placed

immediately in ice cold PBS, on ice. Serosa, external lymphatics and blood vessels, mesentery, and

lymph nodes were carefully removed from the external surface of the small intestine and colon.

Intestine was cut lengthwise, all contents were rinsed out using cold PBS, and any remaining serosa

and lymphatics were removed. Tissue was placed on ice for 10 to 30 seconds to allow for excess PBS

to drain off, then weighed on an analytical balance to determine wet organ mass.

Quantification of Crypt Fission, BrdU incorporation, and Ki67 staining

Crypts from weanling (3-week), adolescent (4.5-week), and adult mice were examined in H&E

stained sections at 40x magnification. Between 300 and 400 crypts were counted in the proximal small

intestine (duodenum) of each mouse, and crypts were scored as “bifurcating” if an indentation of 4 µm

or greater was observed at the base of crypts. For examining crypt epithelial proliferation, BrdU

(dissolved in PBS at 10 mg/ml) was injected intraperitoneally at a dosage of 100 mg/kg, 4 hours prior

to sacrifice. For quantification of Lysozyme-positive, BrdU-positive, or Ki67-positive cells, pictures of

jejunum sections were captured with a 20x objective and positive nuclei for each crypt counted, for a

total of 50 to 60 crypts per animal. For counting cells in iiLet7 mice, 40x images were taken of adjacent

GFP– and GFP+ crypts, when possible. Otherwise, nearby crypts were compared, and 50 to 60 crypts

were counted total (25 to 30 for each type of crypt, GFP– or GFP+). Only crypts sectioned in an

upright orientation, and revealing the central portion of the crypt, were counted. Prior to counting, the

observer was blinded to animal genotype and identifiers. Paneth cells were examined in iiLet7 after a 3-

week treatment with doxycycline chow, administered at 3.5 weeks of age. Proliferation was examined

in iiLet7 mice after a 3-week treatment with doxycycline chow, administered at 6 weeks of age.

Microarray Analysis

Transgenic mice exhibiting low expression (Vil-Lin28bLo) and medium expression (Vil-

Lin28bMed) were subjected to microarray analysis for comparison to wild-type littermates. Total

intestinal epithelium from the jejunum or colon were isolated as described above and RNA isolated

using TRIzol (Invitrogen), and then further purified using the Qiagen RNeasy Mini Kit (Qiagen).

Samples were submitted to the University of Pennsylvania Molecular Profiling and Microarray Facility

for amplification using the Affymetrix WT Expression Kit (Ambion), and hybridization to the

Affymetrix Mouse Gene 1.0ST Array. Data was analyzed using the Partek Genomics Suite (Partek).

Microarray data from DLD1 and Lovo cells stably transduced with the MSCV-PIG-LIN28B expression

vectors was obtained from our previous study (King et al., 2011a).

LIN28B shRNA knockdown

LIN28B or control shRNAs were cloned into BII-mirT3G-Puro shRNA expression, which is a

piggyBac (PB)-based vectors we generated for achieving inducible shRNA expression in stable cell

lines. A non-specific shRNA was cloned from the pcDNA™6.2-GW/EmGFP-miRneg control plasmid

(Invitrogen) and inserted at unique BamHI and SalI sites in the BII-mirT3G-Puro vectors. Oligos for

the LIN28B shRNAs were obtained from Invitrogen (see Table S5), annealed per manufacturers

instructions, then ligated 1:1 along with mirBXL adapters (see Table S5) into unique BamHI and SalI

sites in the BII-mirT3G-Puro vector. The BII-mirT3G-Puro vector is a tet-inducible vector containing

the rtTA-M2 reverse tetracycline transactivator (Urlinger et al. 2000). Approximately 2.5 x 105 DLD1,

Lovo, or Caco-2 were seeded in 6-well plates and 16-24 hours later were transfected with 500 ng of the

pCMV-hyPBase transposase (Yusa et al. 2011) and 1500 ng of the respective PB transposon vector

using 6 µl of Lipofectamine 2000 (Life Technologies) in 1 ml of antibiotic-free DMEM containing

10% fetal bovine serum (FBS). Fresh medium was exchanged after 16-24 hours, and 48 hours after

transfection, cells were selected with 2-6 µg/ml Puromycin (Life Technologies). Cells were treated

with 250 ng/ml doxycycline (Sigma) for 48 hours to induce EmGFP and shRNA expression.

LIN28B Expression in Cell Lines

The mouse and human LIN28B sequences were generously provided by Dr. Joshua Mendell in

the MSCV-PIG expression vectors. The LIN28B sequence was modified at the N-terminus to contain a

FLAG-HA tag. This FLAG-HA tag did not affect LIN28B function, as assayed in HEK293T, DLD1,

Lovo, and HCT116 cells for down-regulation of Let-7a and Let-7b levels (data not shown). Virus

particles were generated using Phoenix-Ampho cells, and DLD1 and Lovo cells transduced as

previously described (King et al., 2011b). For RNP-CLIP-Seq and other experiments, the human

LIN28B cDNA was cloned into the BII-TT3G-Puro vector, a piggyBac (PB)-based vector we

generated for establishing tet-inducible expression of FLAG-HA-tagged LIN28B in stable cell lines.

DLD1 and Lovo cell lines were transfected and selected as described above. LIN28B expression was

induced using 5 to 250 ng/ml doxycycline for 16 to 48 hours.

Detailed RNP CLIP-Seq Protocol (Derived from HiTS-CLIP Protocol (Chi et al., 2009))

Cell Culture, Crosslinking, and Lysis:

1. Grow cells in 10 or 15 cm plates

2. Grow to about 50-100 x 106 cells per IP condition (one nearly confluent 15 cm plate).

3. At time of crosslinking, wash cells once with 5.5 ml ice-cold PBS per plate (on ice) and remove

PBS completely.

4. Place plates on a tray with ice and irradiate uncovered with 400 mJ/cm2 of 254 nm UV light in

a Stratalinker 2400 (Stratagene) or similar device.

5. Add 1 ml NP40 lysis buffer with freshly added DTT, RNase/protease/phosphatase inhibitors,

and Na pyrophosphate.

6. Scrape cells off with a rubber policeman, transfer to eppie, and incubate 5 minutes on ice.

7. Freeze cells at -20°C or -80°C to promote lysis.

8. Thaw lysates on ice.

9. Clear cell lysate by centrifugation at 13,000 x g for 15 min at 4°C

10. Clear the lysate further by filtering it through a 0.22 μm syringe filter (PES membrane).

11. Add 3 µl RNasin (Promega) per ml lysate and let tube sit on ice for 10 minutes.

12. Add 30 µl RQ1 DNase per ml lysate and incubate 5 min at 37°C. Mix every 1-2 min.

13. Add 4 µl 0.5 M EDTA per ml lysate (heavy metals inhibit RNase TI).

14. Add 0.3 µl RNase TI (Fermentas) per ml lysate (final conc. = 0.3 U/) for partial digestion.

Incubate at 22-25°C for 15 min, then place on ice.

15. Dilute sample 1:1 with NDE– buffer (lysis buffer w/o NP40, DTT, or EDTA — NP40 and DTT

interfere with FLAG antibody) plus protease/phosphatase inhibitors.

Immunoprecipitation:

1. Preparing the Magnetic Beads (anti-Flag M2 Magnetic Beads (Sigma))

a. Re-suspend the beads by gentle pipetting or inversion.

b. Wash appropriate volume (50 µl per ml lysate) of beads 2X with 10 packed volumes of

NT2 buffer.

c. Re-suspend in 5 packed bead volumes of NT2 supplemented with 5 mg/ml BSA (1:10

of 50 mg/ml) and 200 µg/ml yeast tRNA (1:50 of 10 mg/ml) and block at 4 °C for 1 hr.

d. Wash 2X with 10-20 packed volumes of NT2 buffer. Re-suspend in 1X NDE- buffer.

2. Antibody coating of magnetic beads (ChIP-Grade Protein-G – Cell Signaling Inc.)

a. Dilute beads (40 µl per ml lysate) into 5 volumes NT2 supplemented with 1 mg/ml BSA

(1:50 of 50 mg/ml) and 200 µg/ml yeast tRNA (1:50 of 10 mg/ml).

b. Add antibody (4 µg per 40 µl beads) to tube and rotate 4 hours at 4°C.

c. Wash 2X with 10-20 packed volumes of NT2 buffer.

3. Immunoprecipitation

a. Add 40 µl of blocked magnetic beads per 2 mls diluted cell lysate.

b. Incubate overnight at 4 °C on rotating wheel.

c. Collect beads using magnetic apparatus.

d. Wash beads 2X with 1 ml of NT2 wash buffer

e. Wash beads 2X with 1 ml of High Salt NT2 wash buffer.

f. Aspirate all remaining wash buffer.

On-Bead Treatments (perform incubations with 2 µl RNasin/RNaseOUT per 100 µl reaction):

1) Re-suspend in 100 µl RNase T1 mix. Incubate 15 min at 22-25°C, then ice for 5 min.

10 µl 10X T1 buffer

2 µl RNasin

0.158 µl RNaseT1 (Fermentas, 1.58 U/µ final)

87.842 µl ddH2O

2) Add 1 ml of High Salt NT2 wash buffer and separate with magnetic stand.

3) Repeat wash 2X with High Salt NT2. Aspirate all remaining wash buffer.

4) Re-suspend in 50 µl CIP reaction mix. Incubate 10 min at 37°C with periodic agitation.

5 µl 10X CIP buffer

1 µl RNasin

2.5 µl CIP (0.5 U/ final)

41.5 µl ddH2O

5) Incubate 10 min at 37°C with agitation/rotation.

6) Add 1 ml CIP wash buffer and separate with magnetic stand.

7) Wash 2X with CIP wash buffer.

8) Wash 2X with PNK wash buffer. Aspirate all remaining wash buffer.

9) Ligate RL3-biotin by adding ligation mix:

5 µl 10X ligase buffer

1 µl RNasin

1 µl RL3-biotin (20 pmol/)

1.25 µl T4 RNA Ligase (NEB)

41.75 µl ddH2O

Add 50 µl ligation mix to beads and incubate at 22-25°C for 120 min.

10) Add 1 ml PNK wash and separate with magnetic stand. Repeat wash 1X.

11) Re-suspend in 100 µl fresh PNK reaction mix:

10 µl 10X ligase buffer

2 µl RNasin

2.5 µl T4 PNK (NEB)

85.5 µl ddH2O

Add 100 µl PNK mix to beads and incubate at 37°C for 20 min.

12) Add 1 ml PNK wash and separate with magnetic stand.

13) Ligate RL5a-TYE705 by adding ligation mix:

5 µl 10X ligase buffer

1 µl RNasin

0.5 µl RL5a-TYE705 (20 pmol/)

1.25 µl T4 RNA Ligase (NEB)

42.25 µl ddH2O

Add 50 µl ligation mix to beads and incubate at 22-25°C for 120 min.

14) Wash 1X with NT2.

15) Wash 1X with High Salt NT2.

16) Wash 3X with PNK wash buffer.

17) Aspirate all remaining wash buffer.

SDS-PAGE, Transfer, Visualization of Labeled RNP, and RNA Purification:

1. Re-suspend beads in 40 μl of 1X SDS-PAGE loading buffer.

2. Heat beads for 5 min at 95°C to denature and release RNP with crosslinked RNA.

Alternatively: elute with 40 µl FLAG peptide (200 µg/ml) diluted in 50 mM Tris, 150 mM

NaCl and 1 µl RNAsin for 30 min at 4°C, rotating end-on-end (NOTE: Not very efficient.

Higher temp. (25-37°C), use of 3X FLAG peptide, and/or longer incubation may be better.)

3. Run through magnetic separator, transfer supernatant to a new microfuge tube.

4. Run supernatant on a 10-well 1.5 mm 4-12% Bis-Tris Novex gel at 175-185 V for 75-90

minutes at 4°C. (Note: running free probe off bottom of gel will reduce background).

5. Transfer with 1X MOPS transfer buffer (Invitrogen) containing 10-20% EtOH onto

nitrocellulose (Hybond C-extra) overnight at 25 V, 0°C (in cold room).

6. Mark membrane in upper right and lower right corners with red pen.

7. Rinse membrane with PBS, then visualize labeled RNP on Licor Odyssey at 700 nm.

8. Capture TIFF image and print to actual size.

9. Line up bands and cut out piece(s) of nitrocellulose/nylon.

10. Freeze nitrocellulose pieces at -80°C or proceed with proteinase-K digestion.

11. Pre-incubate 11 µg tRNA (220 ng/ final) with 11 U RQ1-DNase in 50 µl at 37°C 30’.

12. Add 5 µl stop solution (20 mM EGTA). tRNA is now 200 ng/.

13. Dilute tRNA 1:8 and Prot K 1:5 in 1X PK buffer to final concentrations of 25 ng/ml and 2

mg/ml, respectively. E.g. 25 µl tRNA, 40 µl PK (10 mg/ml), 100 µl 2x PK buffer, 35 µl H2O.

14. Incubate for 20 min at 37°C to kill RNases.

15. Add 200 µl PK solution to nitrocellulose and incubate 20 min at 55°C with agitation.

16. Add 200 µl 50 mM Tris, 100 mM NaCl and incubate 20 min at 37°C with agitation.

Purification by Acid-Phenol-Chloroform Extraction:

1. Add an equal volume (400 ) Acid-Phenol-Chloroform pH 4.5 with IAA, 125:24:1 (Ambion

AM9720). Vortex 60 seconds. Spin 5 min max speed at RT.

2. Take aqueous layer and add an equal volume Chloroform.

3. Vortex 30 seconds. Spin 5 min max speed at RT. Take aqueous layer.

4. Add 1/10 vol. 3 M Na-Acet. pH 5.5 and 2x vol. ethanol:isopropanol (1:1) and precipitate at -20°

O/N or 1 hour at -80°C.

5. Spin 10 min max speed at 4°C.

6. Wash with 75% EtOH, dry pellet, and re-suspend in 12 µl RNase-Free ddH2O.

RT Reaction with Superscript III:

1. Mix RNA with 1 µl 10 mM dNTPs, 0.5 µl DP3 (5 pmol), and water to 13 .

2. Heat at 65°C for 5 min. Ice 1 min.

3. Add: 1 µl 0.1 M DTT

4 µl 5x first strand buffer

1 µl RNaseOUT or Rnasin

1 µl SSIII RT (or ddH2O for -RT control)

4. 50°C 45 min, 55°C 15 min, 70°C 15 min, 4°C hold.

5. OPTIONAL: Add 1 µl RNase H and incubate 20 min at 37°C.

6. Perform 1° PCR with DP5a and DP3 with 2 µl cDNA per 25 µl Phusion reaction with 0.25

µl Phusion, 0.5 µl dNTPs, 0.625 µl DP3 and DP5a (10 µM each), and 2 mM MgCl2.

8. Cycle: 98°C 2 min then 35 cycles: 98°C 15 sec and 60°C 20 sec. Hold: 72°C 5 min.

9. After verifying success of RT and size, scale up to 6 to 8 reactions, PCR again, pool, and purify

with Qiagen PCR purification kit. Size select on 2.3% gel and extract.

10. Perform 2° PCR using 0.625 µl DSFP5a and DSFP3 (20 µM each) for 12-14 cycles.

1x NP40 lysis buffer:

50 mM HEPES, pH 7.5

150 mM KCl

2 mM EDTA

1 mM NaF

0.5% (v/v) NP40

1 mM DTT (ADD FRESH)

1 x protease inhib. (Sigma) (ADD FRESH)

2 mM Na3VO4 4 µl (ADD FRESH)

5 mM Sod. Pyrophosphate (ADD FRESH)

RNasin (Promega) (ADD FRESH)

ddH2O to 1 ml

NT2 buffer:

50 mM Tris-HCl (pH 7.5)

150 mM NaCl

1 mM MgCl

0.05% NP40

High Salt NT2 bufer:

50 mM Tris-HCl (pH 7.5)

500 mM NaCl

1 mM MgCl

0.05% NP40

T1 Buffer:

50 mM Tris, pH 7.5

50 mM NaCl

2 mM EDTA

CIP wash buffer:

50 mM Tris pH 7.5

20 mM EGTA

0.05% NP40

PNK wash buffer:

50 mM Tris pH 7.5

10 mM MgCl

0.05% NP40

FLAG Peptide:

5 mg/ml (25X) in 50 mM Tris pH 7.5, 150 mM NaCl, 1% NP40

PK buffer:

50 mM Tris-HCl, pH 7.5

100 mM NaCl

10 mM EDTA

0.5% (w/v) SDS

4x NP40 lysis buffer:

200 mM HEPES, pH 7.5 (Sterile TC-Grade)

600 mM KCl (0.02% DEPC-treated)

8 mM EDTA (Mol Bio Grade)

4 mM NaF (0.02% DEPC-treated)

2% (v/v) NP40 (Sigma)

Ultrapure RNase-Free ddH2O (Sigma)

Filter through 0.22 µm PES membrane and store at 4°C

4x NDE– “lysis” buffer:

200 mM HEPES, pH 7.5 (Sterile TC-Grade)

600 mM KCl (0.02% DEPC-treated)

4 mM NaF (0.02% DEPC-treated)

Ultrapure RNase-Free ddH2O (Sigma)

Filter through 0.22 µm PES membrane and store at 4°C

10x Ligase/PNK Buffer:

250 µl 1 M Tris pH 7.5

100 µl 100 mM ATP

50 µl 1 M MgCl2

25 µ0.1 M DTT

75 µl ddH2O

Aliquot and store at -20°C

RNP CLIP-Seq

For RNP CLIP-seq analysis from DLD1 and Lovo cells, cells were treated for 17 hrs with 250

ng/ml doxycycline then cross-linked at 254 nm, on ice, using 400mJ/cm2 of UV irradiation in a

Stratalinker 2400 (Stratagene). Colonic epithelium from 12 to 15 week old Vil-Lin28bMed mice or

jejunum crypts from from 12 to 15 week old Vil-Lin28bHi mice was isolated as described above, then

placed into a 10 cm tissue culture plate and irradiated as above. Immunoprecipitation was performed

overnight at 4°C using anti-FLAG M2 magnetic beads (M8823, Sigma) for Flag-HA-tagged mouse or

human LIN28B. Caco-2 cells were grown until approximately 85 to 90% confluency and irradiated as

above. ChIP-Grade Protein G Magnetic Beads (#9006, Cell Signaling Technology) were blocked with

molecular-biology grade acetylated BSA (B2518, Sigma) and yeast tRNA (#10109495001 Roche).

Anti-LIN28B antibodies were then pre-complexed with blocked ChIP-Grade Protein G Magnetic

Beads for 4 hours at 4°C, with rotation. Immunoprecipitation of LIN28B from Caco-2 lysates was then

performed overnight at 4°C. Washes, RNase T1 digestion, adapter ligations, and RNP isolation for RT-

PCR were performed as described above in the detailed protocol. DLD1, Lovo, and jejunum crypt

samples were each sequenced on a single lane of an Illumina HiSeq 2000 sequencer. Caco-2 cells and

colon epithelium were sequenced as multiplexed triplicate samples.

Input samples were prepared from total RNA extracted from UV cross-linked cells by digestion

for 30 minutes in Proteinase-K (Roche) and purified by two extractions with acid-phenol chloroform

(Life Technologies). RNA samples were digested with RNase-free DNase (Roche) and extracted again

with acid-phenol chloroform. RNA was then depleted of ribosomal RNA using the RiboMinus

Transcriptome Isolation Kit (K1550-02, Life Technologies), and RNA was prepared for RNA-seq

using the NEBNext mRNA Library Prep Master Mix Set for Illumina (E6110S, New England Biolabs).

For Caco-2 cells, ribosomal RNA-depleted RNA was precipitated with 20 µg glycogen, digested with 2

units of RNase-T1 (Fermentas) in a 20 µl reaction for 15 minutes at room temperature, placed on ice,

and then 100 µl of 0.5% SDS was added, along with 10 µg glycogen. RNA was extracted with acid-

phenol chloroform. Adapters were ligated and reverse-transcribed using Superscript III RT. PCR was

performed for 30 cycles with adapter-specific primers, size-selected on a 2.3% agarose gel, then

amplified for 15 cycles using Illumina-adapter primers. DNA was size-selected again by gel extraction

and submitted for sequencing. RNA adapters used for CLIP-Seq: RL5a-TYE705 (TYE705-

AGGGAGGACGAUGCGG-3’) and RL3-biotin (5’-GUGUCAGUCACUUCCAGCGG-biotin). DNA

primers used for primary amplification of cDNA: DP5a (5’-AGGGAGGACGATGCGG-3’) and DP3

(5’-CCGCTGGAAGTGACTGACAC-3’). DNA primers used for secondary amplification and addition

of Illumina primer sequences DSFP5a (5’AATGATACGGCGACCACCGACTATGGATAC-

TTAGTCAGGGAGGACGATGCGG-3’) and DSFP3 (5’-CAAGCAGAAGACGGCATACGACCGC-

TGGAAGTGACTGACAC-3’). DNA primer used for sequencing reaction: SSP1 (5’-CTATGGATA-

CTTAGTCAGGGAGGACGATGCGG-3’). DNA primers used for secondary amplification and for

addition of barcodes (underlined) for multiplexed samples: RPI-4-DP3 (5’-

CAAGCAGAAGACGGCATACGAGA

TTGGTCAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCACCGCTGGAAGTGACTGACAC-

3’), RPI-6-DP3 (5’-CAAGCAGAAGACGGCATACGAGA-

TATTGGCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCACCGCTGGAAGTGACTGACAC-

3’), and RPI-12-DP3 (5’-CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCC-

TTGGCACCCGAGAATTCCACCGCTGGAAGTGACTGACAC-3’).

RNP CLIP-Seq Data Analysis

Read Mapping:

CLIP-seq reads for Caco-2 (50 nt), DLD-1 (36 nt), LoVo cell lines (36 nt) and mouse tissues

(50 nt) were trimmed to remove adaptor sequences and mapped to the human (hg19) and mouse

genome (mm9) using Novoalign (parameters: -l 18 –t 85 –h 90)(http://www.novocraft.com/). Reads

uniquely mapped to the genome were used in the downstream analysis. To remove potential duplicates

resulting from PCR amplification, mappable reads with the same starting genomic locations were

collapsed.

Input reads for Caco-2 control samples (non-IP reads, 50 nt) were trimmed to remove adaptor

sequences and mapped to human (hg19) using Novoalign (parameters: -l 18 –t 85 –h 90). mRNA-seq

reads for DLD-1 and LoVo cell lines (101 and 100 nt) were mapped to human (hg19) using Tophat

(Trapnell et al. 2012) and mRNA-seq reads for mouse tissues (50 nt) were mapped to mouse genome

(mm9) using Novoalign.

Identification of CLIP peaks:

The identification of CLIP peaks was performed using HOMER

(http:// biowhat.ucsd.edu/homer/ ) (Heinz et al. 2010). The threshold for the number of reads that

determine a valid peak was selected at a false discovery rate of 0.001 based on a Poisson distribution

(Heinz et al. 2010). Peak sizes were chosen based on the length distribution of mappable reads. For

Caco-2 CLIP samples with corresponding input control samples, peaks were further required to have at

least 4-fold more reads (normalized to total count) than input control samples. For other CLIP samples

with corresponding mRNA-seq data, peaks were ranked by enrichment in CLIP relative to mRNA-seq

(RPKM).

Identification of Cross-link Induced Mutation Sites (CIMS):

We first examined whether and which specific mutation types (substitutions, deletions and

insertions) are signatures of the CLIP samples. The mutation information was extracted by parsing the

alignment files. The overall mutation rate per sample was calculated to obtain a global estimate of

mutation rates in the samples. For all positions covered by reads, we counted for each the number of

mismatched bases (substitutions), deletions, and insertions, all relative to the reference genome. Upon

the identification of all sites containing these mutation types, we attempted to reveal features unique to

CLIP-seq by comparing various patterns of these mutations in CLIP-seq samples vs. input samples.

The results reveal that deletions are the signature of the cross-link induced mutation sites (CIMS).

Next, we applied filtering to obtain relatively robust CIMS. We denote the total number of reads

covering a site as k, the number of a particular mutation type as m; then m/k is the percentage of that

particular mutation type at that site. To identify robust CIMS we applied a filtering schema (removal of

sites with < 3 deletions (m) per site and < 4 reads (k) per site, or m/k < 0.2), yielding 22 to 58%

(robust/total) CIMS positions in CLIP samples but only 1 to 2% in input samples.

Using ANNOVAR (http://www.openbioinformatics.org/annovar/) (Wang et al. 2010) the robust

CIMS were annotated with various gene features (5’UTR, 3’ UTRs, coding sequence, intron etc.).

Based on annotation, we examined the proportion of CIMS mapped to these gene features. We then

examined the evenness of the positional distribution of the CIMS on the gene features, calculating for

each deletion site its distance (in # of base pairs) to the 5’-end of a gene feature (based on transcripts in

the refFlat table from the UCSC genome browser (Rhead et al. 2010)) and obtained its relative position

in the range of 0-1 (i.e. distance divided by the length of the feature). By adjusting for the total read

depth, the positional distribution appears uniform (even) across all gene features.

Statistical Analysis

Unless indicated otherwise in the text or figure legends, a two-tailed unpaired Student’s T-test

was performed on all datasets. For mouse data where comparison was made between littermate pairs, a

two-tailed paired Student’s T-test was used. For mouse tumor data, significance of tumorigenesis was

evaluated using Fisher’s exact test (Fisher 1922). For Ki67 and BrdU quantification in intestinal crypts

for Vil-Lin28b mice and Vil-Lin28b/Let7IEC-KO mice, a mixed model ANOVA analysis was

performed, where genotype was a fixed effect and mouse was a random effect. A pairwise comparison

was also performed using a Tukey correction for multiplicity. For correlation tests, a two-tailed

probability value was determined for a Pearson correlation coefficient. Gene set category and ontology

(GO) enrichment for CLIP-seq was performed using Vanderbilt University’s WEB-based Gene Set

Analysis Toolkit (http://bioinfo.vanderbilt.edu/webgestalt/). The human or mouse genome was selected

as a reference set for determining enrichment. The Benjamini-Hochberg (Benjamini and Hochberg

1995) step-up procedure was selected for generating a multiple test adjusted p-value, where categories

enriched with an adjusted p-value < 0.001 were selected for further analysis (Fig. 2F).

SUPPLEMENTAL REFERENCESBenjamini Y, Hochberg Y. 1995. Controlling the False Discovery Rate - a Practical and Powerful

Approach to Multiple Testing. J Roy Stat Soc B Met 57: 289-300.Fisher RA. 1922. On the Interpretation of χ2 from Contingency Tables, and the Calculation of P. J Roy

Stat Soc B Met 85: 87-94.Flint N, Cove FL, Evans GS. 1991. A low-temperature method for the isolation of small-intestinal

epithelium along the crypt-villus axis. Biochem J 280 ( Pt 2): 331-334.Heinz S, Benner C, Spann N, Bertolino E, Lin YC, Laslo P, Cheng JX, Murre C, Singh H, Glass CK.

2010. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Molecular cell 38: 576-589.

Maherali N, Ahfeldt T, Rigamonti A, Utikal J, Cowan C, Hochedlinger K. 2008. A high-efficiency system for the generation and study of human induced pluripotent stem cells. Cell Stem Cell 3: 340-345.

Rhead B, Karolchik D, Kuhn RM, Hinrichs AS, Zweig AS, Fujita PA, Diekhans M, Smith KE, Rosenbloom KR, Raney BJ et al. 2010. The UCSC Genome Browser database: update 2010. Nucleic acids research 38: D613-619.

Sato T, Vries RG, Snippert HJ, van de Wetering M, Barker N, Stange DE, van Es JH, Abo A, Kujala P, Peters PJ et al. 2009. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature 459: 262-265.

Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, Pimentel H, Salzberg SL, Rinn JL, Pachter L. 2012. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nature protocols 7: 562-578.

Urlinger S, Baron U, Thellmann M, Hasan MT, Bujard H, Hillen W. 2000. Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proceedings of the National Academy of Sciences of the United States of America 97: 7963-7968.

Wang K, Li M, Hakonarson H. 2010. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic acids research 38: e164.

Yilmaz OH, Katajisto P, Lamming DW, Gultekin Y, Bauer-Rowe KE, Sengupta S, Birsoy K, Dursun A, Yilmaz VO, Selig M et al. 2012. mTORC1 in the Paneth cell niche couples intestinal stem-cell function to calorie intake. Nature 486: 490-495.

Yusa K, Zhou L, Li MA, Bradley A, Craig NL. 2011. A hyperactive piggyBac transposase for mammalian applications. Proceedings of the National Academy of Sciences of the United States of America 108: 1531-1536.