Vol 2(2), June 2012 - Webs 5/Final - JORNAMEN… · 66 Journal of Ornamental and Horticultural...

Direct Multiple Shoot Regeneration from Shoot Tip and Nodal Explants of Solanum NigrumL. A Medicinal Herb........................................................................................................................65

M.S. Kavitha, E.G. Wesely and P. Mehalingam.

The Effect of Hot Water Treatments on Gray Mold and Physicochemical Quality of Kiwi

fruit During Storage................................................................................................................................73

J. Fattahi Moghadam and H. Ebadi.

Molecular Cloning and Analysis of Two Flowering Related Genes from Apple (Malus ×domestica)................................................................................................................................................83

N. Mahna and B. Baghban Kohneh Rouz.

Copper Effects on Growth Parameters of Hollyhock (Althaea rosea L.)...........................................95

M. Kamali, M. Sarcheshme Pour and A.A. Maghsoudi Moud.

Controlling Ornamental Cabbage and Kale (Brassica oleracea) Growth via Cycocel .....................103

A. Gholampour, D. Hashemabadi, Sh. Sedaghathoor and B. Kaviani.

Susceptibility Assessments of Tomato Genotypes to Root-Knot Nematodes, Meloidogynejavanica.....................................................................................................................................................113

M. Nasr Esfahani, A.R. Ahmadi and K. Shirazi.

Effect of Pre-Treated Chemicals on Keeping Quality and Vase Life of Cut Rose (Rosa hybridacv.‘ Yellow Island’)........................................................................................................................123

M.B. Hoseinzadeh Liavali and M. Zarchini.

Evaluation of Antipyretic Activity of Pedalium murex Against Brewer’s Yeast-Induced

Pyrexiain Rats.................................................................................................................................................131

V. Siva, N.J. Jeffrey Bose, P. Mehalingam and A. Thanga Thirupathi.

Vol 2(2), June 2012

Journal of

Ornamental and Horticultural Plants

It is approved publication of Journal of Ornamental and Horticultural Plants (JOHP) based on

approbation of 61st session of "Survey and Confirmation Commission for Scientific Journals" at

Islamic Azad University dated on 01/25/2010.

Publisher: Islamic Azad University, Rasht, Iran.

Executive Director: Dr. Ali Mohammadi Torkashvand

Editor-in-Chief: Dr. Davood Hashemabadi

Executive Manager: Dr. Shahram Sedaghat Hoor

Editorial Board:

Professor Ramin, A., Isfahan University of Technology, Iran

Associated Professor Naderi, R., University of Tehran, Iran

Professor Aytekin, P., Ataturk University, Antakya, Turkey

Professor Honarnejad, R., Islamic Azad University-Varamin Branch, Iran

Professor Peyvast, G., University of Guilan, Iran

Professor Nagar, P.K., Institute of Himalayan Bio-Resource Technology, India

Assistant Professor YU,W., The Chinese University of Hongkong

Associated Professor Hokmabadi, H., Pistachio Research Institute, IranProfessor Salah El Deen, M.M., Al Azhr University, EgyptAssociate Professor Qureshi, R., Pir Mehr Ali Shah Arid Agriculture University, Pakistan

Assistant Editor: Zahra Bagher Amiri

Abstracting/Indexing

SID, Index Copernicous, Islamic World Science Citation Center (ISC), Open-J-Gate, Magiran,

EBSCO.

Journal of Ornamental and Horticultural Plants (JOHP) is an international journal devoted to the

publication of original papers and reviews in the ornamental and horticultural fields. Articles in the

journal deal with Floriculture, Olericulture, Pomology, Medicinal and Aromatic Plants and Landscape.

The scope JOHP includes all ornamental and horticultural crops even medicinal plants. All articles

published in JOHP are peer-reviewed. The journal is concerned with ornamental, vegetables and

fruits crops, and covers all aspects of physiology, molecular biology, biotechnology, protected

cultivation, and environmental areas of plants.

Publication schedule: The journal publishes: (i) article on original research in ornamental and

horticultural plants and related fields that contain new information for solving ornamental and

horticultural problems, of world, (ii) invitational papers and review article which concentrate on

particular subject of interest to horticultural science.

Submission of article: Typescripts should be submitted in Journal of Ornamental and Horticultural

Plants (IAU-Rasht Branch, Rasht, Iran) by email: [email protected]. Authors are urged to

refer to “Instruction to Authors” (published in all issues before submission of their typescripts).

Address: Islamic Azad University, Rasht, Iran.

Telfax: 0131- 4224069, email: [email protected]

Web Site: www. jornamental.com

Direct Multiple Shoot Regeneration from Shoot Tip and Nodal Explants of Solanum Nigrum L. A

Medicinal Herb..................................................................................................................................65

The Effect of Hot Water Treatments on Gray Mold and Physicochemical Quality of Kiwi fruit

During Storage...............................................................................................................................................73

Molecular Cloning and Analysis of Two Flowering Related Genes from Apple (Malus ×domestica).......................................................................................................................................................83

Copper Effects on Growth Parameters of Hollyhock (Althaea rosea L.)...........................................95

Controlling Ornamental Cabbage and Kale (Brassica oleracea) Growth via Cycocel .....................103

Susceptibility Assessments of Tomato Genotypes to Root-Knot Nematodes, Meloidogynejavanica...............................................................................................................................................................113

Effect of Pre-Treated Chemicals on Keeping Quality and Vase Life of Cut Rose (Rosa hybrida cv.‘

Yellow Island’)...................................................................................................................................123

Evaluation of Antipyretic Activity of Pedalium murex Against Brewer’s Yeast-Induced Pyrexiain

Rats....................................................................................................................................................131

Content Page

www.jornamental.com

Journal of Ornamental and Horticultural Plants, 2 (2): 65-72, June, 2012 65

Direct Multiple Shoot Regeneration from Shoot Tip and

Nodal Explants of Solanum Nigrum L. A Medicinal Herb

In vitro multiple shoot regeneration of Solanum nigrum L., an Indian

medicinal plant was accomplished on MS medium utilizing shoot tip and

nodal explants. Direct multiple shoots differentiated within 6 weeks when

explants were cultured on MS medium containing BAP (1.0 – 5.0 mg/l) and

KIN (1.0 – 5.0 mg/l) individually. Among various concentrations of cytokinins

tested, maximum number of multiple shoots was obtained on MS medium

supplemented with BAP (1.0 mg/l) from shoot tip (20.4 ± 0.22) and MS

medium supplemented with BAP (3.0 mg/l) from nodal explants (8.4 ± 0.22).

The in vitro regenerated shoots were rooted (8.4 ± 0.16 roots per shoot) on MS

medium supplemented with NAA (1.0 mg/l) within 2-3 weeks of culture and

the regenerated plantlets could be successfully established in soil where they

grow normally.

Keywords: BAP, Black nightshade, Micropropagation, NAA, Solanaceae.

M.S. Kavitha1, E.G. Wesely2 and P. Mehalingam3

1Centre for Biotechnology, Muthayammal College of Arts & Science, Rasipuram-637408, Tamil Nadu,

India. 2PG Department of Botany, A.A. Government Arts College, Namakkal, Tamil Nadu, India.3Research Centre in Botany, V.H.N. Senthikumara Nadar College, Virudhunagar, Tamil Nadu India.

*Corresponding author,s email: [email protected]

Abstract

Journal of Ornamental and Horticultural Plants, 2 (2): 65-72, June, 201266

INTRODUCTION

Solanum nigrum L. (Family: Solanaceae) commonly known as black nightshade is an herba-

ceous annual plant. It has been utilized as a general promoter of health in medicine (Jain et al.,2011). The plant is effective in the treatment of cirrhosis of the liver (Lin et al., 2008). The plant

is also credited with emollient, diuretic, antiseptic and laxative properties (Kiritikar and Basu,

1935, Jain, 1968). Solanum nigrum was found to possess lot of medicinal properties including

anti-tumour, liverfibrosis inhibitory activity, hepatoprotective activity, antiulcer activity, etc., (Jian

Lia et al., 2008, Jain et al., 2011). This can be also utilized for bioremediation of land having heavy

metal contamination (Shuhe Wei et al., 2006).

Micropropagation via shoot culture, often utilized to maintain clonal fiedility, would be a

special advantage in this case (Franca et al., 1995). Most of the secondary metabolites start to ac-

cumulate when the proper organs are regenerated from the cultured cells. Production of these com-

pounds in cultured cells requires decoupling of biochemical differentiation from morphological

differentiation, which has so far been successful. This situation makes organ cultures a favored

option. Shoot cultures have been considered appropriate when the target secondary metabolites

are produced in aerial parts of the plant (Saito and Mizukami, 2002). Hence, the purpose of this

study was to develop in vitro propagation methods from shoot tip and nodal explants of Solanumnigrum. Few preliminary studies on Solanum nigrum, with a limited success, have been reported

on in vitro regeneration of the plants. Amzad Basha Kolar et al., (2008) reported that highest fre-

quency of multiple shoots was obtained from nodal explants on MS containing 6.0 mg/l BAP and

0.5 mg/l IAA. Direct organogenesis and in vitro flowering was obtained in Solanum nigrum by

Venugopal et al., (2005). The highest frequency and number of multiple shoots were obtained from

leaf and nodal explants on MS medium supplemented with benzyladenine and IAA. Sathish et al.,(2010) reported the production of synthetic seeds from Solanum nigrum by using in vitro proliferated

shoot tip explants. In vitro regeneration of Solonum nigrum with enhanced solasodine production

was achieved by using leaf explants on MS medium fortified with BAP (2.0 mg/l) and KN (1.5

mg/l) (Bhat et al., 2010). In vitro regeneration of Solanum nigrum with a high power of alkaloid

accumulation was achieved on MS-basal medium containing BA and NAA (0.5 mg/ml each). A se-

ries of in vitro and in vivo plants were successfully produced and chemical analysis revealed contents

of glycoalkaloids higher than those reported for intact field plants (Hanan et al., 2010).

The regeneration technique has to be improved in order to use this system for effective

clonal propagation; supplying these plants for phytopharamceutical industries for the production

of phytopharmaceuticals at large scale level and genetic improvement of the plant through trans-

formation. As a first step towards establishing a system to achieve this goal, we report a reliable

and efficient protocol for shoot regeneration of Solanum nigrum using different explants such as

shoot tip and node.

MATERIALS AND METHODS

The plantlets were collected from Botanical Garden of Muthayammal College of Arts and

Science, Rasipuram. The shoot tip and nodal explants were washed thoroughly under running tap

water for 10 min followed by treatment with solution of 0.1% bavistin (fungicide) for 1 min and

thereafter washed thoroughly under running tap water for 15 min to completely remove the fun-

gicide. The explants were then transferred to the sterile hood and surface disinfected with

0.1%(w/v) HgCl2 for different time intervals (3-8 min) and finally rinsed with sterile distilled

water for 3-4 times. The explants were blotted dry before inoculation. The explants were then

trimmed at both the ends prior to inoculation. MS medium fortified with various concentrations

of cytokinins such as BAP (1.0 mg/l - 5.0 mg/l) and KIN (1.0 mg/l - 5.0 mg/l) were investigated

for to optimize hormonal requirements for multiple shoot induction from shoot tip and nodal ex-


plants. The effect of auxins on multiple shoot induction was tested by using BAP (1.0 mg/l) and

NAA, IAA (0.1 – 1.0 mg/l) individually. Single disinfected explants were culture on MS media

(Murashige and Skoog, 1962) basal medium supplemented with 100 mg/l myo-inositol and 3%

w/v sucrose. The pH of the medium (supplemented with respective growth regulators) was adjusted

to 5.7±0.1 using 1N HCl or 1N NaOH before adding 0.8 % agar (Himedia Mumbai). The medium

was dispensed into culture tubes and was subsequently autoclaved under 105 kPa at a temperature

at 121°C for 15 min. The explants were implanted vertically on the culture medium (test tubes

[150 cm x 25 mm] containing 15 ml medium) and plugged tightly with non-absorbent cotton. All

the cultures were incubated at 25±2°C under 16 h photoperiod of 45-50 µmol m-2 S-1 irradiance

provided by cool white fluorescent tubes (Philips, India) and with 55-60% relative humidity. All

subsequent subculture was done at 4 week intervals. For rooting, single shoot was excised and

transferred individually to MS medium containing NAA (0.1-1.0 mg/l). Each and every experiment

was performed with 10 replicates and repeated twice. For hardening, the rooted plants were trans-

ferred to plastic vessels containing sterilized sand and vermiculture (1:1) and maintained in the

same culture conditions. They were covered with polythene bags. After 12 days polythene bags

were removed and these plantlets were placed under shade in the laboratory for 3 weeks and finally

established in the field.

RESULTS

Multiple shoot development was observed directly from shoot tip and nodal explants on

MS medium fortified with different concentrations (1.0 – 5.0 mg/l) of BAP and KIN individually.

Of the various concentrations (1.0 – 5.0 mg/l) of BAP tested for multiple shoot induction from

shoot tip, 1.0 mg/l produced the maximum number (20.4 ± 0.22) of shoots per explants with the

maximum percentage of response (79.8%). Shoot tip explants cultured on MS medium supple-

mented with KIN (3.0 mg/l) produced the maximum number of shoots (12.6 ± 0.68) per explants

(Table 1, Fig. 1). The nodal explants produced the maximum number (8.4 ± 0.22 per explants) of

shoots on MS medium fortified with BAP (3.0 mg/l). Nodal explants cultured on MS medium sup-

plemented with 5.0 mg/l of KIN produced 7.0 ± 0.83 shoots per explants (Table 1, Fig. 1). The ex-

plants cultured on MS medium supplemented with BAP (1.0 mg/l) and different concentrations

(0.1 – 1.0 mg/l) of auxins (NAA, IAA) individually showed only callus formation. The regenerated

shoots transferred individually into MS solid medium containing NAA (0.1- 1.0 mg/l) for rooting.

The root initiation was observed from 0.3 to 1.0 mg/l concentration. The maximum number of

roots (8.4 ± 0.16) was observed in MS medium supplemented with NAA (1.0 mg/l) (Fig. 1, Table

2). In vitro raised plantlets resumed normal growth was transferred to plastic cups filled with sand

and soil (1:1) and developed healthy leaves 2 weeks after transplantation. The plantlets transferred

to the field where they grew normally.

DISCUSSION

Raising the demand for wild source herbal source, herbal drugs has abetted over the ex-

ploitation of medicinal plants, leading to cumulative and sustainable use of forest wealth. The im-

portance of conservation of genetic resources cannot be over emphasized. The maintenance of

living material by traditional method is expensive, laborious and risky. Clonal propagation through

tissue cultures offers an alternative to vegetative practices used in the past and has the potential to

provide high multiplication of uniform genotypes, resulting in short term gains (Sacha L. Beck etal., 1998). Beta 2-solamargine , solamargine , solanoside and degalactotigonin are the important

secondary metabolites of Solanum nigrum. The shoot tip and nodal culture could be a valuable

technique for the production of these secondary metabolites in large scale (Sen and Sharma, 1999).

In the present study on MS basal medium the explants (shoot tip and node) shriveled within

3 weeks after emergence of 2-3 leaves without forming the multiple shoot. Similar results have


also reported in Ocimum sanctum (Girija et al., 2006). These findings suggested that endogenous

levels of hormones present in these explants are not sufficient to sustain their growth in the basal

medium. MS medium supplemented with BAP or Kin induced multiple shoots from both the shoot

tip and nodal explants. However, MS medium supplemented with BAP (1.0 mg/l) was found to

produce the maximum number multiple shoots than the KIN or BAP in combination with NAA or

2,4-D individually. The BAP is the most efficient cytokinin in promoting adventitious shoot for-

mation in many plants (Pirek, 1987). BA was superior to KIN in inducing high frequency shoot

regeneration in many numbers of plants (Devendra et al., 2010; Malek et al., 2010; Johnson and

Manickam, 2003; Johnson et al., 2004; Johsnon et al., 2007). Combination of auxin and cytokinin

favored shoot bud differentiation in many plants (Sudha et al., 2005; Sanjaya Rathore et al., 2005).

In contrast in the present study, when the explants cultured on MS medium supplemented with

BAP and NAA/2, 4-D individually showed only callus formation without multiple shoot induction.

This may be due to the fact that requirement of cytokinin and auxin depends on the endogenous

levels these substances in the tissues used for the culture (Gupta, 1998). Shoot tip explants were

found to be an excellent explants source to induce direct organogenesis than nodal explants in

Solanum nigrum. The shoot tips are better than nodal segment for multiple shoot production be-

cause of the higher cytokinin to auxin ratio present in the shoot tip. Similarly the shoot tip was

found to be the superior explants for micropropagation in many number of plants, for example

Cannabis sativa (Ren Wang et al., 2009); Boehmeria nivea (L) Gaud (Sut et al., 2004), Ocimum

sanctum (Girija et al., 2006), Alternanthera sessils (Wesely et al., 2011), Lippia nodiflora (Evelyne

Priya, S and Ravindhran, R., 2011), Cicer arietinum (Islam et al., 1995) and Stevia rebaudiana

Bert., (Arpita Das et al., 2011). The percentage of shoots forming roots and the number of roots

per shoot significantly varied depending on concentrations of NAA. The maximum number of

roots was obtained in medium containing 1.0 mg/ l NAA. Root development was; however, slow

at lower concentrations of NAA. Jabeen et al., (2005) reported that NAA was a more effective

rooting agent for Solanum nigrum. On the other hand Sundari et al. (2010) observed only 3-4 roots

on MS medium supplemented with combination of IAA (5.58 μM) IBA (4.92 μM). NAA was also

found to promote rooting in many numbers of plants (Gyana Ranjan Rout, 2004; Mohammad Anis

et al., 2003; Kambaska Kumar Behera and Santilata Sahoo, 2009; Andrew Riseman and Siva

Chennareddy, 2004).

In the present study the effective multiple shoot regeneration for maximum number of

shoots was accomplished on MS medium supplemented with BAP (1.0 mg/l) from shoot tip ex-

plants of Solanum nigrum and using this procedure the plants can be regenerated on a large scale

under in vitro conditions in a short span of time. The protocol standardized here could be used to

isolate medicinally important secondary metabolite from the multiple shoots and this protocol

would also have importance in genetic transformation of this medicinally important plant.

Literature Cited

Anis, M., Faisal, M. and Singh, S. K. 2003. Micropropagation of mulberry (Morus alba L.) through in

vitro culture of shoot tip and nodal explants. Plant Tissue Cult. 13(1): 47-51.

Bhat, M.A., Mujib, A., Junaid, A. and Mohamooduafar, M. 2010. In vitro regeneration of Solanumnigrum with enhanced solasodine production. Biologia Plantarum. 54(4): 757-760.

Das, A., Gantait, S., and Mandal, N. 2011. Micropropagation of an elite medicinal plant: Stevia rebaudianaBert. International Journal of Agricultural Research. 6: 40-48.

Devendra, N.K., Rajanna, L., Sheetal, C. and Seetharam, Y.N. 2008. In vitro clonal propagation of

Trichosanthes cucumerinaL.var. cucumerina. Plant Tissue Culture and Biotechnology. 18(2): 103-111.

Evelyne Priya, S. and Ravindhran, R. 2011. Micropropagation of Lippia nodiflora using shoot tip and

nodal explants under in vitro conditions. International Journal of Current Research. 3(10): 043-047.

Franca, S.C., Bertoni, B.W. and Dereirea, M.S. 1995. Antihepatotoxic agent in micropropagated plantlets


of Eclipta alba. Plant Cell Tissue and Organ Culture. 40: 297-299.

Girija, S., Kavitha, S. and Deepavathi, S. 2006. Direct multiple shoot regeneration from shoot tip and

nodal explants of Ocimum sanctum L. (Tulsi): a medicinal herb. Plant cell Biotechnology and

Molecular Biology. 7: 23-28.

Gupta, P.K. 1998. Elements of biotechnology, Rastogi publications, India.

Gyana Ranjan, R. 2004. Effect of cytokinins and auxins on micropropagation of Clitoria ternatea L.

Biol. Lett. 41(1): 21.26.

Hanan, Abd, Al-Hay and Al-Ashaal, A. 2010. Regeneration, in vitro glycoalkaloids production and

evaluation of bioactivity of callus methanolic extract of Solanum tuberosum L. Fitoterapia. 81(6):

600-606

Islam, R., Riazuddin, S. and Farooqui, H. 1995. Clonal propagation from seedling nodes and shoot apices

of chickpea (Cicer arietinum L.). Plant Tissue Culture. 5(1): 53-57.

Jabeen, F.T.Z., Venugopal, R.B., Kiran, G., Kaviraj, C.P. and Rao, S. 2005. Plant regeneration and in vitro flowering from leaf and nodal explants of Solanum nigrum (L). - An important medicinal

plant. Plant Cell Biotechnology and Molecular Biology. 6(1&2): 17-22.

Jain, R., Sharma, A., Gupta, S., Sarethy, I.P. and Gabrani, R. 2011. Solanum nigrum: current perspectives

on therapeutic properties. Alternative Medicine Review. 16(1): 78-85.

Jain, S.K. 1968. Medicinal plants. Thomson Press Ltd, India.

Jian, L., Qingwang, L., Tao, F. and Kun, L. 2008. Aqueous extract of Solanum nigrum inhibit growth of

cervical carcinoma (U14) via modulating immune response of tumor bearing mice and inducing

apoptosis of tumor cells. Fitoterapia. 79: 548-556.

Johnson, M. and Manickam, V.S. 2003. In vitro micropropagation of Baliospermum montanum (Willd.)

muell-arg-a medicinal plant. Indian Journal of Experimental Biol. 41: 1349-1351.

Johnson, M., Manickam, V.S., Nikhat, Y., Sonali, D. and Andal, N. 2004. In vitro multiplication of two

economically important and endangered medicinal plants - justicia gebdarussa brum and adenia

hondala (gaertn) de wilde. Malaysian J. Sci. 23: 49-53.

Johnson, M., Yasmin, N., Sonali, D. and Rajasekarapandian, M. 2007. The role of cytokinin and auxin

in organogenesis of Passiflora mollissima and evaluation of biochemical changes using isozyme.

Eth. J. Sci. Technol. 4: 27-36.

Kambaska, B. H. and Santilata, S. 2009. Rapid in vitro micropropagation of sugarcane (Saccharum officinarum L. cv-Nayana) through callus culture. Nature and Science. 7(4): 1-10.

Kolar Basha, A., Vivekanandan, L. and Ghouse Basha, M. 2008. In vitro regeneration and flower

induction on Solanum nigrum L. from pachamalai hills of eastern ghats. Plant Tissue Culture and

Biotechnology. 18(1): 43-48.

Kritikar, K. R. and Basu, B. D. 1935. Indian medicinal plants. M/S Bishen Singh Mahendrapal, New

Delhi, India.

Lin, H.M., Tseng, H.C., Wang, C.J., Lin, J.J., Lo, C.W. and Chou, F.P. 2008. Hepatoprotective effects of

Solanum nigrum Linn. extract against CCl(4)-induced oxidative damage in rats. Chem. Biol.

Interact. 171: 283-293.

Malek, M.A., Mannan, M.A., Khanam, D., Khantun, M. and Molla, M.H. 2010. In vitro culture of pointed

gourd (Trichosanthes dioica Roxb.). J. Agril. Res. 35(1): 135-142.

Murashige, T. and Skoog, F. 1962. A revised medium for rapid growth and bioassay with tobacco tissue

culture. Physiologia Plant. 15: 473-497.

Pirek, P.L.M. 1987. In vitro culture of higher plants. Martinus Nijhoff Publishers, Dordrect.

Riseman, A. and Chennareddy, S. 2004. Genotypic variation in the micropropagation of Sri Lankan

Exacum hybrids. Journal of the American Society for Horticultural Science. 129(5): 698-703.

Sascha, L., Beck Dunlop, R. and Van Staden. J. 1998. Micropropagation of Acacia mearnsii for ex vivo

material. Plant Growth Regulation. 26: 143-148.

Saito, K. and Mizukami, H. 2002. Plant cell cultures as producers of secondary metabolites. p.77-108.


In: Kirsi Majra, C., Wolfang, H.B. (eds.), Plant biotechnology and transgenic plants. Marcel

Dekker Inc, New York.

Sanjaya Rathore, T.S. and Ravishankar Rai, V. 2005. Micropropagation of Pseudoxytenanthera stocksii Munro. In vitro Cell. Dev. Biol. – Plant. 41: 333-337.

Satish, K., Verma, M. K., Rai, P.A., Jaiswal, V.S. and Jaiswal, U. 2010. In vitro plantlets from

alginate-encapsulated shoot tips of Solanumnigrum L. Scientia Horticulturae. 124(4): 517-521

Sen, J. and Sharma, A.K. 1999. Micropropagation of Withania somnifera from germinating seeds and

shoot tips. Plant Cell Tiss. Org. Cult. 9: 96-698.

Sudha, C.C., Krishnan P.N., Pushpangadan, P. and Seeni, S. 2005. In vitro propagation of Decalepisarayalpathra, a critically endangered ethnomedicinal plant. In vitro Cell. Dev. Biol. – Plant.

41: 648-654.

Sundari, M.S., Benniamin, A. and Manickam, V.S. 2010. Micropropagation and in vitro flowering in

Solanum nigrumLinn. A medicinal plant. International Journal of Biological Technology. 1(1): 29-32.

Sut, D., Talukdar, P. and Singh, S. 2004. Micropropagation of ramie (Boehmeria nivea (L) Gaud) through

shoot-tip and nodal segment culture. Indian J. Agric. Res. 38 (2): 131 – 134.

Venugopal, R. B., Kaviraj, C. P., Rao, S., Jabeen, F. T. Z. and Kiran, G. 2005. Plant regeneration and in vitro flowering from leaf and nodal explants of Solanum nigrum (L.), an important medicinal

plant. Plant Cell Biotechnology and Molecular Biology. 6 (1/2): 17-22.

Wang, R., He, L. S., Xia, B., Tong, J.F., Li, N. and Peng, F. 2009. A micropropagation system for

cloning of hemp (Cannabis sativa L.) by shoot tip culture. Pak. J. Bot., 41(2): 603-608.

Wei, S., Zhou, Q. and Koval, P.V. 2006. Flowering stage characteristics of cadmium hyperaccumulator

Solanum nigrum L. and their significance to phytoremediation. Science of the Total Environment.

369: 441-446.

Wesely E.G., Antonisamy, J.M.A., Kavitha Marappampalayam Subramanian, K. and Nallyan, S. 2011.

Micropropagation of Alternanthera sessilis (L.) using shoot tip and nodal segments. Iranian

Journal of Biotechnology. 9(3): 206.


Table 1. Effect of various concentrations of BAP and kinetin individually on multiple shoot induction from

shoot tip and node.

Tables

MS medium + Cytokinin Concentration

(mg/l)

Number of multiple shoots from shoot

tip ± SE

Number of multiple shoots from

node ± SE

MS alone

MS + BAP (1.0 mg/l)

MS + BAP (3.0 mg/l)

MS + BAP (5.0 mg/l)

MS + KN (1.0 mg/l)

MS + KN (3.0 mg/l)

MS + KN (5.0 mg/l)

0.0 ± 0.00

20.4 ± 0.22

14.2 ± 0.32

10.6 ± 0.47

6.7 ± 0.39

12.6 ± 0.68

2.4 ± 0.45

0.0 ± 0.00

5.6 ± 0.30

8.4 ± 0.22

3.2 ± 0.24

2.0 ± 0.25

3.4 ± 0.45

7.0 ± 0.83

Table 2. Effect of NAA on rooting on in vitro derived shootlets of

Solanum nigrum

Concentration of NAA No. of roots per shoot ± SE

0.1 mg/l

0.2 mg/l

0.3 mg/l

0.4 mg/l

0.5 mg/l

0.6 mg/l

0.7 mg/l

0.8 mg/l

0.9 mg/l

1.0 mg/l

0.0 ± 0.00

0.0 ± 0.00

0.5 ± 0.22

1.5 ± 0.40

2.5 ± 0.45

3.6 ± 0.70

4.3 ± 0.26

5.3 ± 0.61

6.0 ± 0.69

8.4 ± 0.16


Figures

Fig. 1. Micropropagation of Solanum nigruma. Multiple shoot induction from shoot tip explant,

b. Multiple shoot induction from nodal explant,

c. Multiple shoot proliferation from shoot tip explant,

d. Multiple shoot proliferation from nodal explant,

e. Rooting


The Effect of Hot Water Treatments on Gray Mold and

Physicochemical Quality of Kiwifruit During Storage

Decline in postharvest losses of kiwifruit depended to maintain of

quality characteristics during storage and transportation. Storage losses caused

serious economic losses in kiwifruit. This study was conducted to inhibition of

pathogen infection and increasing fruit quality of Kiwifruit. Hayward kiwifruits

inoculated by B.cinerea conidia through pore wounds which formed by

removal of the pedicels. Fruits treated through immersion in hot water (45, 50

and 55 oC) for 2, 4 and 8 minutes after 3 weeks. All fruits stored at 0.5oC and

85-90 RH for 18 weeks. The samples had taken at 6th, 12th and 18th weeks and

measured some characters including weight loss, peel and pulp color indices

(L* and chroma), decay numbers, firmness, decay depth, SSC, TA, SSC/TA,

pH, EC, Ascorbic acid, compared with the control. Results showed that weight

loss rate increased about 2 fold of control but decay depth and losses prevented

at 6th and 12th weeks of storage period significantly. Firmness was higher than

control at 12th storage week in hot water treatments but had not significant

differences with control until end of storage period. Generally, L* parameter

had a positive relationship with firmness. Ascorbic acid increased specially in

control treatment during cool storage period. EC, pH, and TA parameters had

constant changes during of storage.

Keywords: Color, Cool storage, Gray mold, Hayward, Hot water, Physicochemical.

J. Fattahi Moghadam1* and H. Ebadi2

1Assistant Professor. Department of Technical and Engineering. Iran Citrus Research Institute, Ramsar,

Iran.2PhD student. Department of Technical and Engineering. Iran Citrus Research Institute, Ramsar, Iran.


Abstract


INTRODUCTION

Kiwifruit with the scientific name of Actinidia deliciosa cv. Hayward is most famous fruit

in the Iran and other countries. In recent years, there is a trend to increase kiwi cultivation especially

in the north of Iran. Globally and in some countries like New Zealand, during seventy decades,

the kiwifruit considered as commercial and important products. Therefore, the more researches

have studied on various aspects of cultivation, production and protective of Kiwi (Debersaques

and Mekers, 2007). Although in the recent years, kiwi product development has been remarkable,

but less research done on the problems of harvesting and storage of kiwifruit.

An irreparable damage occurred during storage due to the lack of a specific pattern or meth-

ods derived from scientific research. Meanwhile among different storage fungi, gray mold are the

main factor limiting of kiwifruit storage life. All new harvested products need to be without from

pathogens, insects, and synthetic chemicals and contamination. Not certain fungicides have been

registered for controlling corruption agents in the storage while not harmful to human health as

well. On the other hand, consumer knowledge has increased about consumption effects of chemical

agents to control diseases, pests and physiological damage. Therefore, we need to develop effective

materials without any damages to health maintenance of horticulture products.

Kiwifruit had excellent storage properties among other subtropical fruits. Moreover, its

quality could maintain more than eight months in controlled conditions. Base on study revealed

that high CO2 atmosphere can slow the growth of B. cinerea on apples (Janisiewicz et al., 2003).

Botrytis diseases are very common and widely distributed on vegetables, ornamentals, fruits, and

field crops throughout the world. They commonly appear as blossom blights and fruit rots (Ku-

lakiotu et al., 2004).In this case, due to fungus activity, fruit began to watery from the tip and then

gradually extends to other fruit parts.

It has reported that spores of this fungus needs to ethylene for germination and followed eth-

ylene produced by defected fruits. Ethylene production by fungi caused fruit softening even in the

before maturity and thus can reduce the storage life (Hardan et al., 2005). Also recognized that eth-

ylene was produced by B. cinerea when grown on PDA medium (Chague et al., 2002). According to

Wurms et al., (1999) report, the more conidia produced in pericarp comparison to stem end of fruit,

because of this site contains growth inhibitor agents of gray mold. Fruit age also influenced on con-

tamination levels and the fruits with early harvesting are more sensitive than lasted harvesting fruit.

Using of hot water treatments to control decay occurred for the first time in 1992 on citrus

fruit (Fallik, 2004). Paull and Chen (2000) reported the beneficial effect of immersion in hot water

to control postharvest diseases for kiwifruit. Some researchers found that by applying a moderate

heat treatment, ripening could be delayed and fungal decay reduced without major changes in fruit

quality (Kou et al., 2007). According to a study on grapes found that 45°C for 8 mm was the best

hot water treatments for table grapes (Kou et al., 2006).

Application of hot water treatment before short-term storage (few minutes) only is effective

on pathogens that exist in the outer layers of fruit peel. This treatments commonly done by several

methods such as immersion in hot water, hot steam, hot and dry air, hot shower-brush technique.

Among these treatments, hot water method used (short time) commercially (Fallik, 2004).

Various studies showed that the cause of ethylene decline by hot water is due to decreasing

of EFE (Ethylen Forming Enzyme) activity. Furthermore, the heat treatments used to prevent chilling

injury and peel damage during storage and marketing. In avocado fruits, using of hot water through

38◦C for one hour caused a significant decreasing in peel damages (Fallik, 2004; Lurie, 1998).

In relation to temperature effects on fruit quality properties, Irving et al., (1991) reported that

fruit firmness, taste, respiration rate and ethylene production not affected during optimum temperature

conditions. Ippolito et al., (1994) were used another method to reduce storage rot. In their experiments,

the kiwi fruit before transferring to cold storage placed at 5-30°C and 95-98 RH for 24-96 hours. Based

on their results, the thermal treatment at 15°C and 98-95 RH for 48 hours had the best confirmed of


decay control. Immersion of inoculated, freshly harvested table grapes for 3 min at 30, 40, or 50 °C

reduced decay to 20.7, 6.7, and 0.1 berries/kg after 30 days of storage at 1 °C, while decay after im-

mersion in water at these temperatures was 35.9, 17.6, and 1.7 berries/kg, respectively (Karabulut etal., 2004). The aim of this experiment was the studying of the effect of different hot water temperatures

on physicochemical changes and gray mold control in kiwi fruit during cold storage.


Fruit materials

Fruits were harvested at commercial maturity stage (TSS=7%) from an experiment orchard

at the Iran Citrus Research Institute (Ramsar). Fruits transferred to laboratory subsequently and

sorted based on size and the absence of physical injuries or infections.

Treatments

The fungal colonies cultured on PDA medium to produce single-spore. Then these spores

used to prepared suspension of solution. Hayward fruits inoculated firstly by applying Botrytis

cinerea conidia on wounds formed by removal of the pedicels. Then fruits divided into 12 groups

randomly, each group containing 120 fruits in three replicates and immersed into hot distilled water

with 45, 50, 55◦C for 2, 4 and 8 min. Fruits were then dried for 24 h and then stored at 0.5oC and

85-90 RH for 18 weeks. After weeks 6, 12 and 18, fruit samples (30 numbers) were obtained from

each treatment to measure the fruit quality characteristics.

Physicochemical analysis

Firmness was determined by measuring compression using a hand-held Effegi penetrometer

with a 7.9 mm probe after removal of skin to a vertical depth of 1 mm on two sides of the fruit.

The firmness considered as an average peak force of 10 fruits and expressed as kg/7.9 mm2. More-

over, three fruits per replicate were weighed at the beginning of storage and throughout storage

period to calculate weigh loss percentage.

Titratable acidity (TA) was determined using 5 ml of fruit puree from five fruits mixed with

25 ml of distilled water, with two drops of phenolphthalein (1%) as indicator, titrated with 0.1N

NaOH to an endpoint pink (pH 8.2). The results expressed as percent anhydrous citric acid since

it is the dominant acid in kiwifruit (Fisk et al., 2008).

Soluble solids content (SSC) were then measured using an ATC-1E ATAGO hand-held re-

fractometer on the translucent part of the juice. The pH of the samples were measured by a pH

meters (Inolab pH 720, WTW, Germany).

The peel and pulp color was evaluated with a Minolta chromometer CR-400, which pro-

vided measurements of Hunters L*, a*, b* and chroma. L* measures lightness and varies from

100 for perfect white to zero for black. a* measures redness when its value is positive, gray when

zero, and greenness when negative, and b* measures yellowness when positive, gray when zero,

and blueness when negative.

Ascorbic acid was determined using the Dye method (Ranganna, 1977). The kiwifruit puree

samples (30 g) homogenized with 30 ml of 3% metaphosphoric acid (HPO3). Five ml of aliquot

was titrated with a standard dye solution (2, 6-dichlorophenol-indophenol) to a pink color that per-

sisted for 15 seconds using an autotitrator calibrated using standard ascorbic acid. The ascorbic

acid content (Vitamin C) expressed as mg/100g FW.

Statistical analysis

Physicochemical data analyzed with MSTAT–C statistical software (Michigan State Uni-

versity, USA). Treatments arranged in completely randomized design, and Tukey’s test (p< 0.5)

used to reveal any differences.


RESULTS AND DISCUSSION

The results of initial assessment showed that the rate of fruit TSS, firmness and TA were 9-

10 %, 2.3-kg.7.9mm-3 and 0.9 % at the time of harvest respectively. Peel color values was meas-

ured as L* (41.07), a* (6.63) and b* (21.54). Pulp color values also were recorded as well as L*

(54.99), a* (-15.51) and b* (36.01). In fact, these characteristics indicated for better evaluated the

fruit quality changes before treatment applying and transfer them to cold storage.

Weight loss

The analysis of data showed that the use of hot water increased weight loss comparison to

control. The highest weight loss observed when the fruits immersed in 55°C. The lowest weight

loss belongs to control that was nearly half of hot water treatments (Fig. 1). Hayward kiwi fruit

placed in cool storage with zero temperature. Weight loss rate decreased from 0.34% (3 days after

storage) to 0.93 % (6 weeks storage) and finally achieved to 1.54 % at the end of 12 weeks storage

(Bautista-Banos et al., 1997). Although storage temperature is higher in this experiment, but the

process of fruit weight loss is in accordance with the above report results during storage. Fruit

weight loss can be occurs due to increasing of respiration rate during storage (Aghdam et al., 2011).

Conversely, low temperature decreased fruit respiration. For this reason, hot water treatments in-

creased respiration rate comparison to control. Therefore, it is resulted to enhanced weight loss

during storage.

Decay rate

In general, all treatments had most impact to control of gray mold between 6 to 8 weeks.

In this case, the amount of contamination is less than one percent. Later on (12 and 18 weeks sam-

pling), it was increased to 2.2 and 3.2 numbers (equal to 10 %) respectively (Fig. 2)., Low tem-

perature storage reduced fungal activity in the storage (Bautista-Banos et al., 1997) besides water

temperature. In another study, with inoculated the picked wound of four trees by Botrytis and then

maintained at 0°C, it observed that the extent of pollution in 1 to 4 trees were 21.3, 17.1, 41.6 and

2.1 percent, respectively (Poole and McLeod, 1994). Our results revealed that fruit rot reduction

was due to decline of Botrytis spores in hot temperatures compared to other reports.

Fruit color changes

The peel color and chroma rate decreased during storage (Fig. 3). This value affected by

storage time mostly and water temperature had no significant effect on chroma.

The L* value of peel was maximum (average 55) in fruits which were exposed for 2 minutes

in all three temperature and control (Table 1). It is thought that immersion time had more effective

on L* value than different water temperatures.

There are not a report about influences of hot water on peel lightness changes but suggested

that the L* value was 66.6 at the harvesting time and then decreased during storage (Amodio etal., 2007). In this experiment, it was 52.09 at harvesting time but decreased to 44 (45 °C for 8

minutes) at the end of storage. Although, L* value had not significant changes at 50 and 55°C

treatments.

Based on the table 1, fruits treated with hot water and control, had high levels of chroma

at the primary sampling (6th weeks) from storage. In fact, chroma expressed saturation of green

color and associated with fruit firmness. With longer periods of fruit storage, pulp chroma de-

creased due to pulp color was darker than beginning of storage period. It reported that the chroma

value in soft and firm ripened fruits were 15.69 and 36.77, respectively. At this form, pulp had

high level of green pigment content (Costa et al., 2006). In this experiment, chroma value at all

treatments and control decreased because of fruit softening at the end of storage. This phenomenon

almost affected by storage period.


Fruit firmness

The firmness of fruit pulp was 2.3 kg.7.9 mm-3 at harvesting time. Fruit firmness was

changed between 0.6 (samples taken at 18th week) to 1.6 kg.7.9 mm-3 (weeks 6 and 12) during

storage (Table 1). In this experiment, the fruit firmness of control decreased during storage. Fruit

softening in control occurred earlier and severity than other treatments. The decreasing of firmness

in this study is consistent with results of other researchers. It has reported that Botrytis conidia

needs to ethylene for germination or he can produced ethylene itself. Ethylene production by fungi

caused fruit softening even before maturity, so can reduce the storage life (Poole and McLeod,

1994; Qadir et al., 1997). Application of hot water may be destroyed the conidia that led to prevent

of ethylene production by fruit tissue. It can be delayed fruit over ripening and softening.

Depth of contamination

According to table 1, the amount of fruit and depth contamination were zero (mm) in six

weeks of cold storage. Most expansion of decay observed in the 12th weeks of storage with 2.11

cm in the control treatment, which had not significant differences with other temperatures. Maxi-

mum progress in fruit contamination depth (6.42 cm) was in fruits, which treated by water at 45°C

and stored for 12 and 18 weeks. Not only the control treatment has shown the greatest amount of

contamination in 12th week but also were occurred the maximum development of Botrytis infection

in fruit tissue. The 45 and 50°C treatments decreased development of decay until the 12th week

firstly, but increased in the last six weeks of storage. Moreover, hot water (55°C) well prevented

botrytis development during storage. Chardonnet et al., (2003) used grapes volatile oils to control

gray mold and measured contamination depth. They found that the contamination depth in treated

fruit was 2.5 mm, which was less than comparison of control (15 mm) during 7-11 days storage.

pH changes

Overall, the range of pH changes was between 3.5 and 3.7 during storage. Only the control

treatment had high pH value (3.7) in the sixth weeks of sampling date (Table 1). When kiwifruit

kept in storage at 2°C for 70 days, it was found that pH indicator increased gradual and steady

from 3.61 to 3.75 (Fisk et al., 2008). The results of this experiment were fully consistent with this

report. It seems that heat treatments had not effect on pH level significantly.

SSC, TA and SSC/TA changes

Results (Table 1) indicated that the TA levels increased in all treatments to the 12th weeks

and then decreased until the end of storage. No significant differences observed about SSC during

storage. The amount of TA was 0.85 % at harvesting time and then decreased to 0.69 % after 6

weeks. Therefore, it seems TA had more influence on SSC/TA ratio than SSC percent (Table 1).

Similarly, Marsh et al, (2004) found that the amount of fruit acid reduced from 1.5 % to 1.37 %

but had constant changes until the end of storage. In addition, TA did not influenced by hot water,

however increased firstly and then declined during storage. The decreasing trend of TA was similar

to the results of Fisk et al., (2008), that reported amount of TA reduced from 1.26% to less than

1% during 70 days of kiwifruit storage.

Electrical conductivity (EC) changes

Generally, the amount of EC had a direct relationship with time of cold storage. However,

rate of EC has increased between weeks 6 to 12 and then almost was constant in the six weeks be-

fore the end of storage (Table 2). It is seems that the heat exogenesis from hot water caused an

ionic phase in fruit tissue. In fact, EC of fruit juice represent the amount of passing electricity. En-

hancing of EC by hot temperatures depended to nature of ions and ionic concentrations. In contrast,

EC decreased with increasing of solid content and particle size, which showed there are non-ionic


parts such oils and sugars in fruit juice. In addition, EC enhanced when the acidity increased during

storage (Esteve et al., 2007).

Ascorbic acid changes

Ascorbic acid content enhanced during storage and reached to maximum (especially in con-

trol) in the end of storage. Generally, hot water treatments and time of exposure had not significant

impact on ascorbic acid content (Table 3). Some reports referred to decreasing and others to in-

creasing of ascorbic acid in kiwifruit during storage (Amodio et al., 2007). About other acids,

Marsh et al., (2004) found the amount of citric acid was decreased but it was higher in 0◦C. In this

experiment, ascorbic acid changes did not match even with the results of citric acid.

CONCLUSION

Based on the results, fruit peel sensed to water loss by applying of hot water. In contrast, it

well controlled infection rate of Botrytis between 6 and 8 weeks (less than 1%). Due to the spread

of fungi, it is important to control of molds in early weeks. Therefore, hot water treatments well

have done this duty. Moreover, it inhibited from early fruit softening via destroyed of Botrytis. On

the other hand, SSC/TA ratio decreased because of reducing of ethylene production. Ascorbic acid

and EC levels increased with greater slope between 6th to 12th weeks. If kiwi growers monitored

suspected trees to Botrytis or other fungus, they can harvest the infected fruits separately and

dipped to hot water (50°C) for 4 minutes. After that, dried fruits could place in a cold storage.

ACKNOWLEDGEMENTS

This work is part of the kiwifruit project No. 2-023-240000-14-0000-85002 funded by Iran-

ian Citrus Research Institute. We greatly thank Dr. S. Aghajanzadeh for critical supported.

Literature Cited

Aghdam, M.S., Mostofi Y., Motallebiazar A., Fattahi Moghaddam. J. and Ghasemnezhad, M. 2011.

Methyl salicylate affects the quality of hayward kiwifruits during storage at low temperature.

Journal of Agricultural Science. 3 (2): 149-156

Amodio, M.L., Colelli, G., Hasey, J.K. and Kader, A.A. 2007. A comparative study of composition

and postharvest performance of organically and conventionally grown kiwifruits. Juornal

of the Science of Food and Agriculture. 87: 1228-1236.

Bautista-Banos, S., Long, P.G. and Ganesh S. 1997. Curing of kiwifruit for control of postharvest

infection by Botrytis cinerea. Postharvest Biology and Technology. 12: 137-145

Chague V., Elad, Y., Barakat, R., Tudzynski, P. and Sharon, A. 2002. Ethylene biosynthesis in

Botrytis cinerea. Microbiology Ecology. 40:143-149.

Chardonnet, C.O., Charron C.S., Sams, C.E. and William, S. 2003. Conway chemical changes in

the cortical tissue and cell walls of calcium-infiltrated ‘Golden Delicious’ apples during

storage. Postharvest Biology and Technology. 28: 97-111

Costa, S.B., Steiner, A., Correia, L.C., Empis, J. and Martins, M.M. 2006. Effects of maturity stage

and mild heat treatments on quality of minimally processed kiwifruit. Journal of Food

Engineering. 76: 616–625

Debersaques, F. and Mekers, O. 2007. Growing and production of kiwifruit and kiwiberry. Soils,

Plant Growth and Crop Production. (Abstract).

Esteve, M.J., Frigola, A., Rodrigo, C. and Rodrigo, D. 2005. Effect of storage period under variable

conditions on the chemical and physical composition and colour of spanish refrigerated orange

juices. Food and Chemical Toxicology. 43: 1413–1422.

Fallik, E. 2004. Prestorage hot water treatments (immersion, rinsing and brushing). Postharvest

Biology and Technology. 32: 125–134


Fisk, C.L., Silver, A.M., Strik, B.C. and Zhao, Y. 2008. Postharvest quality of hardy kiwifruit

(Actinidia arguta Ananasnaya) associated with packaging and storage conditions. Postharvest

Biology and Technology. 47: 338-345.

Hardan, K., Al-Masri, M. and Barakat, R. 2005. Ethylene production by Botrytis cinerea (causal

organism of gray mold disease) and influence of the exogenously applied growth regulators

and thier inhibitor on disease development. Hebron University Research Journal. 2: 1-5.

Ippolito, A. 1994. Improvement of kiwifruit resistance to Botrytis storage rot by curing. Phytopathologia

Mediterranea. 33, 2: 132-136. (Abs).

Irving, D.E., Pallesen, J.C. and Cheah, L.H. 1991. Respiration and ethylene production in kiwifruit

following hot water dips. Postharvest Biology and Technology 1: 137-142.

Janisiewicz, W.J., Leverentz, B., Conway, W.S., Saftner, R.A., Reed, A. and Camp, M. 2003. Control

of bitter rot and blue mold of apples by integrated heat and antagonist treatment on 1-MCP

treated fruit stored under control atmosphere conditions. Postharvest Technology. 29 (2):

129-143.

Karabulut, O.A., Gabler, F.M., Mansour, M. and Smilanick, J.L. 2004. Postharvest ethanol and

hot water treatment of table grapes to control gray mold. Postharvest Biology and Tecnology.

34 (2): 169-177.

Kou, L., Liu, X., Zhang, C. and Geng, X. 2006. Effects of respiratory intensity and storage quality

of fresh-cut 'Kyoho' grape in hot water treatment. Food Fermentation Industries. 32: 143-146

(Abstract).

Kou, U., Lao, Y., Ding, W. and Liu, X. 2007. Effects of mild heal treatment on microbial growth

and product quality of packaged fresh-cut table grapes. Journal of Food Sciences. 72:5567-5573.

Kulakiotu, E., Constantine, K., Thanassoulopoulos, C., Evangelos, M. and Sfakiotakis, S. 2004.

Postharvest biological control of Botrytis cinerea on kiwifruit by volatiles of ‘Isabella’

grapes. Vol. 94, No. 12.

Lurie S. 1998. Postharvest treatment. Postharvest Biology and Technology. 14: 257-269.

Marsh, K., Attanayake, S., Walker, S., Gunson, A., Boldingh, H. and MacRae, E. 2004. Acidity

and taste in kiwifruit. Postharvest Biology and Technology. 32: 159-168.

Paull, R.E. and Chen N.J. 2000. Heat treatment and fruit ripening. Postharvest Biology and Technology.

21: 21-37.

Poole, P.R. and McLeod, L.C. 1994. Development of resistance to picking wound entry Botrytis cinerea storage rots in kiwifruit. 22: 387-392.

Qadir, A., Hewett, E.W. and Long, P.G. 1997. Ethylene production by Botrytis cinerea. Postharvest


Ranganna, S. 1977. Manual of analysis of fruit and vegetable products. McGrawHill, New Delhi.

Wurms, K.V., Long, P.G., Sharrock, K.R. and Greenwood, D.R. 1999. The potential for resistance

to Botrytis cinerea by kiwifruit. Crop Protection. 18: 427-435.


Table 1. Interaction effects of dipping time and water temperature on some quality parameters of kiwifruit.

*Means followed by a different letter are significantly different (p <0.05)

Tables

dipping

time (min.)

water tempera-

ture (◦C)

L* value

(peel)

L* value

(pulp)

Chroma

(pulp)

Firmness Depth of con-

tamination

pH TSS/TA

2

4

8

45

50

55

control

45

50

55

control

45

50

55

control

32.4 bcd*

34.0 abc

35.0 a

32.0 cd

33.4 abcd

32.8 d

34.1 abc

35.1 a

34.5 ab

34.2 ab

34.2 ab

34.2 ab

55.7 a

55.0 a

56.0 a

54.0 a

44.2 c

43.3 c

42.9 c

45.2 bc

42.5 c

42.6 c

44.2 c

47.7 b

34.7 a

34.6 a

33.6 a

31.3 b

19.0 cde

18.0 de

17.6 e

18.7 de

19.3 cde

19.7 cd

19.7 cd

20.8 c

1.3 a

1.6 a

1.4 a

0.9 a

1.6 a

1.0 a

1.6 a

0.6 a

0.7 a

0.6 a

0.6 a

0.5 a

0.0 b

0.0 b

0.0 b

1.2 b

0.4 b

0.7 b

0.2 b

2.1 b

3.0 a

1.6 b

0.0 b

6.4 b

3.6 b

3.6 b

3.6 b

3.6 b

3.6 b

3.6 b

3.6 b

3.7 a

3.5 b

3.6 b

3.6 b

3.5 b

20.9 b

21.4 ab

26.5 a

22.2 ab

20.5 b

21.0 b

19.6 b

20.3 b

22.8 ab

22.8 ab

22.1 ab

22.8 ab

Table 2. Interaction effects of dipping time, water temperature and storage time on electrical conductivity of kiwifruit

juice in cool storage.


Storage

time

(Week)

Water

temper-

ature

(◦C)

Dipping

time

(min.)

EC

(ms)

Storage

time

(Week)

Water

temper-

ature

(◦C)

Dipping

time

(min.)

EC (ms) Storage

time

(Week)

Water

tempera-

ture (◦C)

Dipping

time

(min.)

EC (ms)

6 45

50

55

control

2

4

8

2

4

8

2

4

8

2

4

8

3.4 f*

3.21 f

3.36 f

3.52 f

3.34 f

3.14 f

3.21 f

3.36 f

2.95 f

2.8 f

3.05 f

3.25 f

12 45

50

55

control

2

4

8

2

4

8

2

4

8

2

4

8

10.84 bcde

9.86 e

10.35 bcde

10.07 de

10.04 de

10.2 de

10.24 cde

10.57 bcde

9.91 e

8.85 e

9.7 e

9.83 e

18 45

50

55

control

2

4

8

2

4

8

2

4

8

2

4

8

12.01 bcd

12.27 bc

11.5 bcde

10.81 bcde

12.34 b

10.82 bcde

10.01 de

11.78 bcde

14.46 a

10.8 bcde

11.25 bcde

11.4 bcde


Table 3. Interaction effects of dipping time, water temperature and storage time on ascorbic acid of kiwifruit juice in

cool storage.


Storage

time

(Week)

Water

temper-

ature

(◦C)

Dipping

time

(min.)

Ascorbic

acid

(mg/100g

FW)

Storage

time

(Week)

Water

temper-

ature

(◦C)

Dipping

time

(min.)

Ascorbic

acid

(mg/100g

FW)

Storage

time

(Week)

Water

tempera-

ture (◦C)

Dipping

time

(min.)

Ascorbic

acid

(mg/100g

FW)

6 45

50

55

control

2

4

8

2

4

8

2

4

8

2

4

8

27.95 hij*

26.06 ijk

25.18 ijk

26.8 ijk

24.89 ijkl

23.32 ijkl

28.61 ghij

22.06 jkl

24.4 ijkl

25.5 ijk

26.36 ijk

25.76 ijk

12 45

50

55

control

2

4

8

2

4

8

2

4

8

2

4

8

33.87 fgh

27.04 ijk

20.27 kl

49.09 bc

29.77 fghi

25.59 ijk

35.18 efg

34.87 efg

35.63 ef

42.7 de

40.72 de

39. 6 de

18 45

50

55

control

2

4

8

2

4

8

2

4

8

2

4

8

66.13 a

54.43 b

36.23 def

18.16 l

42.81 cd

53.44 b

54.48 b

48.73 bc

54.53 b

52.09 b

52.29 b

51.69 b


Figures

Fig. 1. Effects of different water temperature on weight loss rate.

Fig. 2. Effects of different storage time on decay rate.

Fig. 3. Effects of different storage time on peel chroma.

Fig. 4. Effects of different storage time on titratable acidity.


Molecular Cloning and Analysis of Two Flowering

Related Genes from Apple (Malus × domestica)

Apple (Malus × domestica Borkh.) is the fourth fruit in importance and

Iran ranks fifth in apple production in the world. Longevity of juvenility in

apple extends breeding cycles and makes its breeding a tough job. To alleviate

this barrier via genetic engineering, the genes involved in flowering and floral

development of apple and their function must be identified and characterized.

Most of these genes fall in a class of transcription factors named MADS-box

genes. In the present research, we cloned and analysed the sequences and

features of two of these genes, MdMADS1 and MdMADS3, from apple ‘Golden

Delicious’ for a deeper functional analysis in the near future. They were found

to be homologs of SEP genes belonging to the class E genes involved in

flower development and lied in the AGL2 clade of MADS-box genes in the

phylogenetic tree made for apple and Arabidopsis MADS-box proteins. Insilico studies exemplified that both genes had eight exons and seven introns

with a long first intron of about 4 Kb and 3 Kb for MdMADS1 and MdMADS3,respectively. The results showed that the structure of both genes has noticeably

differed from other SEP-like genes in evolution.

Keywords: Flowering genes, Gene isolation, MADS-box genes, Malus × domestica, Phylogenetic tree.

N. Mahna1* and B. Baghban Kohneh Rouz 2

1Department of Horticultural Sciences, Faculty of Agriculture, University of Tabriz, 5166614761

Tabriz, Iran.2Department of Agronomy and Plant Breeding, Faculty of Agriculture, University of Tabriz,

5166614761, Tabriz, Iran.


Abstract

Abbreviations: AG, AGAMOUS; AGL, AGAMOUS-LIKE; AP1, APETALA1; bp, base pair; CAL,CAULIFLOWER; EST, expressed sequence tag; FBP, FLORAL BINDING PROTEIN; FLC, FLOW-ERING LOCUS C; FUL, FRUITFULL; Md-, Malus × domestica; PI, PISTILLATA; SEP, SEPALATA;SHP, SHATTERPROOF; STK, SEEDSTICK; SOC1, SUPRESSOR OF CONSTANS 1; TM5, TomatoMADS-box gene 5.


INTRODUCTION

Apple (Malus × domestica Borkh.) is the fourth fruit in importance after citrus, bananas

and grapes and Iran with a production of 2.43 million metric tons ranks fifth after China, the United

States, Turkey and Poland (FAO, 2012). Improvement of this plant is a difficult job due to the

longevity of its juvenility which extends breeding cycles up to decades. To alleviate this major

breeding barrier, genetic manipulation of the juvenility can be a prominent alternative to classic

methods; however, it requires the genes controlling the transition from vegetative phase to repro-

ductive phase to be identified and functionally characterized. Most of these genes and also the ma-

jority of the genes active in the determination of meristem identity and the development of floral

organs lie in a class of transcription factors named MADS-box genes. Although a few studies have

demonstrated that the MADS domain of MADS-box proteins in fruit trees plays a similar role as in

grasses (Sundstrom and Engstrom, 2002), there is little information about the features of this domain

in trees (Sung and An, 1997). Moreover, SEP genes functioning as members of the class E genes in

the ABCDE model of flower development are among MADS-box genes. It has been demonstrated

that SEP genes have expression in all floral whorls (Sun and An, 1997; Sung et al., 2000; Ditta etal., 2004). The overexpression of one of SEP homologs in apple, MdMADS1, has not caused any

change in the flowering time of tobacco (Sung and An, 1997); nevertheless, it seems that the function

of the gene can be further investigated through antisense or co-suppression methods.

In the present research, our aim was to clone and characterize the sequences and the features

of two homologs of SEP genes from the ‘Golden Delicious’ cultivar of apple namely, MdMADS1and MdMADS3 to further analyse their function via gene knockdown approaches.


Plant tissues needed for RNA extraction were collected from the leaves of five–year old

apple ‘Golden Delicious’ trees and frozen using liquid nitrogen. RNA extraction was performed

from buds and leaves using LiCl method. The quantity and quality of extracted RNA was verified

using spectrophotometer and agarose gel electrophoresis. All solutions were DEPC-treated. Suit-

able amount of RNA used in RT reaction by means of the enzyme SuperScript II® (Invitrogen)

using manufacturer’s protocols. The forward and reverse primers employed to clone these genes

are listed in table 1. From RT reaction, 1 µl was added to the PCR mixture (Table 2) to amplify the

fragments. The thermal program for PCR reaction was as table 3.

To clone the RT-PCR fragments, pGEM-T Easy kit (Promega) was exploited using manu-

facturer’s protocols. Sequencing was carried out through sequencing facilities of VIB-UGent (Bel-

gium). Sequence analysis and alignments were performed via Mega 5 (Tamura et al., 2011). The

sequences were downloaded from diverse databases and used for constructing a phylogenetic tree

(Table 4) using neighbour-joining algorithm (Saitou and Nei, 1987).


In this study, we provide the report of two MADS-box genes, MdMADS1 and MdMADS3,

which were isolated from Malus domestica based on RT-PCR. The genes found to be homologous

to Arabidopsis SEP-like genes. The isolated sequences for MdMADS1 and MdMADS3 were cloned

in pGEM-T Easy vector and the resulted vectors designated pNM101 and pNM102, respectively.

The RT-PCR and colony-PCR results of the isolated genes have been demonstrated in Fig.1.

MdMADS1 gene was first isolated and cloned by Sung and An (1997) from apple cv. Fuji.

The cDNA of this gene being 992 bp has an ORF which is 738 bp, a 5’-UTR of 29 bp long and a

3’-UTR with a length of 222 bp. In the present study, the coding region of the gene with a length

of 741 bp was isolated and cloned. This region encodes a 246 amino acid long polypeptide which

belongs to MADS-box family. The gene MdMADS1 isolated in this research had a 99.9% similarity

to the original MdMADS1 with the only difference in the nucleotide position 218 being G in Md-


MADS1 and T in MdMADS1 from ‘Golden Delicious’ which makes a shift in amino acid 63 re-

placing Methionine with Isoleucine. This little difference makes the isolated MdMADS1 gene iden-

tical to MdMADS8 instead of the original MdAMDS1. Another possible explanation can be the

error of Taq DNA polymerase in RT-PCR reaction which might have replaced G with T in the iso-

lated MdMADS1. This sequence was isolated using RNA extracted from the buds, while it has

been reported that this gene expresses in the floral organs (Sung and An, 1997). The amino acid

sequence of this protein had a similarity of 93% with MdMADS9, 79% with SEP1/AGL2 and 74%

with SEP2/AGL4 (Sung et al., 1999). Therefore, it lied in the AGL2 clade of MADS-box proteins

(Fig. 2). Furthermore, the expression pattern of MdMADS1 is comparable to that of AGL2. During

first and middle stages of flower development, AGL2 shows a high expression in all floral whorls.

While the flower development continues, AGL2 expression undergoes a dramatic decrease. The

expression of AGL2 in ovules, embryos and seed coat has been also high (Flanagan and Ma, 1994).

AGL2 expression has been recognized in the leaves (Ma et al., 1991); however, MdMADS1 tran-

scripts have not been detected in the vegetative organs (Sung and An, 1997).

MdMADS3 was first isolated from ‘Fuji’ apple (Sung et al., 2000), the cDNA of which has

a length of 1104 bp and contains an ORF encoding a protein with 248 amino acids, a 5’-UTR of

81 bp long and a 3’-UTR of 276 bp long. It was isolated in this research from ‘Golden Delicious’

being 98.9% similar to MdMADS3 from ‘Fuji’. The 5’-UTR of the former had 6 times less repe-

tition of GA than that of the latter. Perhaps, this type of dissimilarity can be used in distinguishing

of the two cultivars through SSR marker development. The amino acid sequence of this gene was

as 99% similar as that of MdMADS7 (Yao et al., 1999). In the amino acid 181, there is substitution

of histidine in MdMADS7 for glycine in MdMADS3. Further analysis revealed that MdMADS3 had

83% similarity with MdMADS6. Upon drawing phylogenetic tree, MdMADS3 stood along with

AGL2 (Fig. 2). In comparison with Arabidopsis genes, it showed the highest similarities with

SEP1/AGL2 (63%), SEP2/AGL4 (61%) and SEP3/AGL9 (59%).

Plant MADS box genes were realized to be transcription factors that regulate floral organ

identity; nevertheless, several reports have since been issued about their regulation of other devel-

opmental processes, such as flowering time, fruit ripening, root growth, dehiscence, ovule and fe-

male gametophyte development and the determination of meristem identity of vegetative,

inflorescence, and floral meristems (Zhang and Forde, 1998; Ng and Yanofsky, 2001; Giovannoni,

2004; Whipple et al., 2004; L. Colombo et al., 2008; Liu et al., 2009). Researches on model species

such as Antirrhinum majus, Arabidopsis thaliana, Petunia hybrida, Oryza sativa, and Zea mays

have been shown that these functions are mostly conserved among angiosperms (Schwarz-Sommer

et al., 2003; Vandenbussche et al., 2003; Kater et al., 2006).

Genetic researches have also exemplified that closely related family members MADS-box

genes have redundant or overlapping functions. For example, the closely related SEPALLATA

(SEP) genes, SEP1, SEP2, and SEP3, act redundantly to specify petal, stamen, and carpel identity.

Single sep mutants have no phenotype, and a sep1 sep2 sep3 triple mutant was required to establish

the developmental role of these genes (Pelaz et al., 2000). The closely related SHATTERPROOF1

(SHP1) and SHP2 genes act redundantly to regulate the formation of the silique dehiscence zone

(Liljegren et al., 2000). Furthermore, SHP1 and SHP2 act redundantly with AGAMOUS (AG),

which specifies stamen and carpel identity, and SEEDSTICK (STK), which controls the develop-

ment of the funiculus, to specify ovule identity (Pinyopich et al., 2003). Moreover, several phylo-

genetic studies of the MADS domain family have revealed that related genes within a phylogenetic

clade tend to share similar expression patterns (Purugganan et al., 1995; TheiBen et al., 1996;

Riechmann and Meyerowitz, 1997; Alvarez-Buylla et al., 2000b). These findings suggest that re-

dundant functions might be a noticeable characteristic of closely related members in the MADS-

box gene family.

SEP-like genes are generally encoded by multigene families and it has been supposed that


the gene duplications occurred along angiosperm evolution, and that the number of SEP-like genes

was diverse in different species (Theissen et al., 2000; Becker et al., 2000; Zahn et al., 2005). Four

genes in the A. thaliana genome (Ma et al., 1991; TheiBen; 2001 and Ditta et al., 2004), six in

both petunia (Zahn et al., 2005) and wheat (Paolacci et al., 2007), five in both rice (Nam et al.,2004) and oil palm (Adam et al., 2006), three in Asparagus sp. (Kanno et al., 2006), two in peach

(Tani et al., 2009) and one in Alpinia hainanensis (Song et al., 2010), Zostera japonica (Kakinuma

et al., 2011) and Fragaria ananassa (Seymour et al., 2011) are derived from cDNA or gDNA se-

quences. Genome-wide analysis indicates that the M. domestica genome contains several MADS-

box genes including at least seven SEP-like genes (Fig. 2), suggesting that the process of floral

specification in M. domestica could be similar to its relatives.

Based on in silico studies performed in this research, the genomic locus of MdMADS1 was

5748 bp long at about 5 Mb from the beginning of the chromosome 17 and that of MdMADS3 was

5260 bp at about 27 Mb from the beginning of the chromosome 14 of apple. Both genes had eight

exons and seven introns with a long first intron of about 4 Kb and 3 Kb for MdMADS1 and Md-MADS3, respectively. The exon–intron structure of MIKC-type MADS-box genes is well con-

served (Henschel et al., 2002; Tanabe et al., 2005). In the plants studied, the ORF of the MIKC-type

MADS-box genes is interrupted by six (e.g., A. thaliana SEP1 and SEP2 in SEP1/2 subclade) to

seven (e.g., SEP3 and SEP4 in AGL2 clade, AGL6 and AGL13 in AGL6 clade, and AP1, CAL, and

FUL in FUL clade) introns. In the former type, lengths of ORF coding region in Es1–7 are 185,

82, 62, 100, 84, 146–149, and 94–127 bp, respectively, and those in Es1–8 in the later type are

182–185, 73–85, 62–71, 100, 42, 36–42, 128–173, and 34–115 bp, respectively (Johansen et al.,2002). The exon–intron structure of MdMADS1 and MdMADS3 genes is more similar to those of

the SEP3 and SEP4 than those of the SEP1 and SEP2 in the AGL2 clade; while in terms of amino

acid sequence, MdMADS1 protein was more similar to SEP1/2 subclade and MdMADS3 found to

be a little different from SEP1, SEP2, SEP3 and SEP4 (Fig. 2). These results exemplify that the

structure of both genes has noticeably differed from other SEP-like genes in evolution.

According to the ABCDE model proposed to explain floral organ formation, the individual

and combined activities of five classes (A, B, C, D, and E) of homeotic genes (Theiβen, 2001,

Becker and Theiβen, 2003, Ditta et al., 2004, Adam et al., 2007a, Adam et al., 2007b and Liu etal., 2010). In A. thaliana, A-function is provided by the AP1 and AP2 genes, B-function by the

AP3 and PI genes, C-function by the AG gene, D-function by the STK gene, and E-function by

the SEP genes (i.e., SEP1, SEP2, SEP3, and SEP4). The four SEP genes in A. thaliana, SEP1–SEP4, are well characterized, all of which play important roles for specifying the identity of all

four whorls of the floral organ and for floral meristem identity (Ditta et al., 2004), and the similar

functions of SEP-like genes have been shown not only in other dicot species (Vandenbussche etal., 2003b and Rijpkema et al., 2009) but also in monocot species (Adam et al., 2007b, Paolacci

et al., 2007 and Song et al., 2010). In the case of M. domestica, the expression of the MdMADS1gene, which is a member of SEP1/2 subclade (Fig. 2), was in all floral organs and young fruits but

not in leaves. The expression was higher at the early stages of flower and fruit development, sug-

gesting that MdMADSl plays a major role in the initiation of reproductive organ developments.

The MdMADS1 gene expression pattern is similar to that of AGL2 of Arabidopsis. During the early

and intermediate stages of flower development, AGL2 is expressed at a high level in all four whorls

of the flower. As the flower organs undergo the final elongation and maturation phase of develop-

ment, AGL2 expression is dramatically reduced. Reduction of the AGL2 expression occurs first in

the sepals and then in stamen and the petals of mature flowers. AGL2 expression is also high in

developing ovules, embryos and seed coats (Flanagan and Ma, 1994). However, the AGL2 tran-

script was detectable in leaves (Ma et al., 1991) whereas the MdMADS1 transcript was not found

in the vegetative organ. Unfortunately, the exact role of AGL2 genes are not elucidated yet, but,

the studies on their homologs in petunia and tomato have revealed a role for these genes as medi-


ators between floral meristem identity genes and floral organ identity genes (Angenent et al., 1992;

Pnueli et al., 1994).

Taken together, it appears that MdMADS1 is a member of the AGL2 subfamily. Unfortu-

nately, the function of the AGL2 subfamily is largely unknown, transgenic phenotypes of FBP2

and TM5 deficient plants suggest a role in mediating between meristem and organ identity genes

(Angenent et al., 1994; Pnueli et al. 1991). Ectopically expressed MdMADS1 gene under the con-

trol of 35S promoter in tobacco did not cause any alteration of flower or seed development (Sung

and An, 1997). In order to reveal the functional role of MdMADS1, it may be necessary to employ

either antisense or co-suppression approaches in the homologous apple plant to achieve reduction

of the gene expression. The expression of MdMADS3 was first detected at the stage 3 in three in-

ternal whorls of floral primordia; nevertheless, no expression was observed in the younger floral

primordia and/or in the inflorescence meristem (Sung et al., 1999).The expression pattern of Md-MADS3 is similar to those of FBP2 from petunia, TM5 from tomato, and AGL9 from Arabidopsis,

which are expressed in petals, carpels, and stamens (Angenent et al., 1992; Pnueli et al., 1994;

Mandel and Yanofsky, 1998). The genes FBP2, TM5, and AGL9 are expressed after the onset of

the meristem-identity genes, but before the activation of organ-identity genes, suggesting a possible

role as mediators between the floral meristem and floral organ-identity genes. The egm1 and egm3

genes from eucalypt and the DEFH49 gene from Antirrhinum majus are also expressed in the inner

three whorls of the flower (Davies et al., 1996; Southerton et al., 1998).

With complementation of genome sequencing and expressed sequence tag (EST) assem-

bling in some model plants such as Arabidopsis, rice, and wheat, 107, 73, and 45 MADS-box genes

have been annotated, respectively (Kofuji et al., 2003, Pařenicová et al., 2003, Nam et al., 2004,

Zhao et al., 2006a and Paolacci et al., 2007), demonstrating that the MADS-box genes in plants

form a large family that plays distinct roles in flower development and organ differentiation, and

that fully understanding the molecular mechanisms for M. domestica reproductive organ formation,

in which MADS-box genes may be involved, will be needed. Recently, EST databases for apple

have been provided and its genome has been fully sequenced (Velasco et al., 2010). Further ex-

periments for isolation and functionally characterization of apple MADS-box genes related to its

flowering time and reproductive organs development are currently being carried out.

ACKNOWLEDGEMENTS

We would like to acknowledge the Ministry of Science, Research and Technology of Iran

for providing a visiting research scholarship for NM.

Literature Cited

Adam, H., Jouannic, S., Morcillo, F., Richaud, F., Duval, Y. and Tregear, J.W. 2006. MADS box

genes in oil palm (Elaeis guineensis): patterns in the evolution of the SQUAMOSA,

DEFICIENS, GLOBOSA, AGAMOUS, and SEPALLATA subfamilies. J. Mol. Evol. 62:

15–31.

Adam, H., Jouannic, S., Morcillo, F., Verdeil, J.L., Duval, Y. and Tregear, J.W. 2007a. Determination

of flower structure in Elaeis guineensis: do palms use the same homeotic genes as other

species? Ann. Bot. 100: 1-12.

Adam, H., Jouannic, S., Orieux, Y., Morcillo, F., Richaud, F., Duval, Y. and Tregear, J.W. 2007b.

Functional characterization of MADS box genes involved in the determination of oil palm

flower structure. J. Exp. Bot. 58: 1245-1259.

Alvarez-Buylla, E.R., Pelaz, S., Liljegren, S.J., Gold, S.E., Burgeff, C., Ditta, G.S., Ribas de Pouplana,

L., Martı´nez-Castilla, L., and Yanofsky, M.F. 2000. An ancestral MADS-box gene duplication

occurred before the divergence of plants and animals. Proc. Natl. Acad. Sci. USA 97: 528–5333.

Alvarez-Buylla , E.R., Liljegren , S.J., Pelaz, S., Gold , S.E., Burgeff, C., Ditta, G.S., Vergara-Silva,


F. and Yanofsky, M.F. 2000b. MADS-box gene evolution beyond flowers: expression in

pollen, endosperm, guard cells, roots and trichomes. Plant J. 24: 457–466.

Angenent, G.C., Busscher, M., Franken, J., Mol, J.N. and Van Tunen, A.J. 1992. Differential

expression of two MADS box genes in wild-type and mutant Petunia flowers. Plant Cell 4:

983-993.

Angenent, G.C., Franken, J., Busscher, M., Weiss, D. and van Tunen, A.J. 1994. Co-suppression

of the Petunia homeotic gene fbp2 affects the identity of the generative meristem. Plant J. 5: 33-44.

Becker, A. and Theissen, G. 2003. The major clades of MADS-box genes and their role in the

development and evolution of flowering plants. Mol. Phylogenet. Evol. 29: 464-489.

Becker, A., Winter, K.U., Meyer, B., Saedler, H. and Theiβen, G. 2000. MADS-box gene diversity

in seed plants 300 million years ago. Mol. Biol. Evol. 17: 1425–1434.

Borner, R., Kampmann, G., Chandler, J., Gleißner, R., Wisman, E., Apel, K. and Melzer, S. 2000.

A MADS domain gene involved in the transition to flowering in Arabidopsis. Plant J. 24: 591–599.

Colombo, M., Masiero, S., Vanzulli, S., Lardelli, P., Kater, M.M. and Colombo, L. 2008. AGL23,

a type I MADS-box gene that controls female gametophyte and embryo development in

Arabidopsis. Plant J. 54: 1037–1048.

Cseke, L.J. and Podila, G.K. 2004. MADS-box genes in dioecious aspen II: a review of MADS-box

genes from trees and their potential in forest biotechnology. Physiol. Mol. Biol. Plants 10(1): 7-28.

Davies, B., Di Rosa, A., Eneva, T., Saedler, H. and Sommer, H. 1996. Alteration of tobacco floral

organ identity by expression of combinations of Antirrhinum MADS-box genes. Plant J.

10: 663-677.

de Folter, S., Immink, R.G., Kieffer, M., Parenicova´ , L., Henz, S.R., Weigel, D., Busscher, M.,

Kooiker, M., Colombo, L., Kater, M.M., Davies, B., and Angenent, G.C. 2005. Comprehensive

interaction map of the Arabidopsis MADS Box transcription factors. Plant Cell 17: 1424–1433.

Ditta G., Pinyopich A., Robles P., Pelaz S., and Yanofsky, M.F. 2004. The SEP4 gene of Arabidopsis thaliana functions in floral organ and meristem identity. Curr. Biol. 14: 1935–1940.

Ferra´ ndiz, C., Liljegren, S.J. and Yanofsky, M.F. 2000. Negative regulation of the SHATTERPROOF

genes by FRUITFULL during Arabidopsis fruit development. Science 289: 436–438.

Flanagan, C.A. and Ma, H. 1994. Spatially and temporally regulated expression of the MADS-box

gene AGL2 in wild-type and mutant Arabidopsis flowers. Plant Mol. Biol. 26: 581-595.

Food and Agricultural Organization. 2012. < http://faostat.fao.org/>

Giovannoni, J.J. 2004. Genetic regulation of fruit development and ripening. Plant Cell 16 (suppl.):

S170–S180.

Gu, Q., Ferra´ ndiz, C., Yanofsky, M.F. and Martienssen, R. 1998. The FRUITFULL MADS-box

gene mediates cell differentiation during Arabidopsis fruit development. Development 125:

1509–1517.

Hartmann, U., Hohmann, S., Nettesheim, K., Wisman, I., Saedler, H. and Huijser, P. 2000. Molecular

cloning of SVP: a negative regulator of the floral transition in Arabidopsis. Plant J. 21: 351–360.

Henschel, K., Kofuji, R., Hasebe, M., Saedler, H., Munster, T. and Theissen, G. 2002. Two ancient

classes of MIKC-type MADS-box genes are present in the moss Physcomitrella patens.

Mol. Biol. Evol. 19: 801-814.

Jack T. 2001. Relearning our ABCs: new twists on an old model. Trends Plant Sci. 6(7): 310-316.

Johansen, B., Pedersen, L.B., Skipper, M. and Frederiksen, S. 2002. MADS-box gene evolution-structure

and transcription patterns. Mol. Phylogenet. Evol. 23: 458-480.

Kakinuma, M., Inoue, M., Morita, T., Tominaga, H., Maegawa, M., Coury, D.A. and Amano, H.

2011. Isolation and characterization of a SEPALLATA-like gene, ZjMADS1, from marine

angiosperm Zostera japonica. Mar. Environ. Res.

Kanno, A., Hienuki, H., Ito, T., Nakamura, T., Fukuda, T., Yun, P.Y., Song, I.J., Kamimura, T.,

Ochiai, T., Yokoyama, J., Maki, M. and Kameya, T. 2006. The structure and expression of


SEPALLATA-like genes in Asparagus species (Asparagaceae). Sex. Plant Reprod. 19: 133–144.

Kater, M.M., Dreni, L. and Colombo, L. 2006. Functional conservation of MADS-box factors

controlling floral organ identity in rice and Arabidopsis. J. Exp. Bot. 57: 3433–3444.

Kofuji, R., Sumikawa, N., Yamasaki, M., Kondo, K., Ueda, K., Ito, M. and Hasebe, M. 2003.

Evolution and divergence of the MADS-box gene family based on genome-wide expression

analyses. Mol. Biol. Evol. 20: 1963-1977.

Lee, H., Suh, S.S., Park, E., Cho, E., Ahn, J.H., Kim, S.G., Lee, J.S., Kwon, Y.M. and Lee, I. 2000.

The AGAMOUSLIKE 20 MADS domain protein integrates floral inductive pathways in

Arabidopsis. Genes Dev. 14: 2366–2376.

Liljegren, S.J., Ditta, G.S., Eshed, Y., Savidge, B., Bowman, J.L. and Yanofsky, M.F. 2000.

SHATTERPROOF MADSbox genes control seed dispersal in Arabidopsis. Nature 404:

766–770.

Liu, C., Thong, Z., and Yu, H. 2009. Coming into bloom: The specification of floral meristems.

Development 136: 3379–3391.

Liu, C., Zhang, J., Zhang, N., Shan, H., Su, K., Meng, Z., Kong, H. and Chen, Z. 2010. Interactions

among proteins of floral MADS-box genes in basal eudicots: implications for evolution of

the regulatory network for flower development. Mol. Biol. Evol. 27: 1598-1611.

Ma, H., Yanofsky, M.F. and Meyerowitz, E.M. 1991. AGL1-AGL6, an Arabidopsis gene family

with similarity to floral homeotic and transcription factor genes. Genes Dev. 5: 484-495.

Mandel, M.A. and Yanofsky, M.F. 1998. The Arabidopsis AGL9 MADS box gene is expressed in

young flower primordial. Sexual Plant Reproduction 11: 22-28.

Michaels, S.D, Amasino, R.M. 1999. FLOWERING LOCUS C encodes a novel MADS domain

protein that acts as a repressor of flowering. Plant Cell 11:949–956.

Michaels, S.D., Ditta, G., Gustafson-Brown, C., Pelaz, S., Yanofsky, M. and Amasino, R.M. 2003.

AGL24 acts as a promoter of flowering in Arabidopsis and is positively regulated by vernalization.

Plant J. 33: 867–874.

Nam, J., Kim, J., Lee, S., An, G., Ma, H., and Nei, M. 2004. Type I MADS-box genes have experienced

faster birth-and-death evolution than type II MADS-box genes in angiosperms. Proc. Natl.

Acad. Sci. USA 101: 1910–1915.

Nesi, N., Debeaujon, I., Jond, C., Stewart, A.J., Jenkins, G.I., Caboche, M. and Lepiniec, L. 2002.

The TRANSPARENT TESTA16 locus encodes the ARABIDOPSIS BSISTER MADSdomain

protein and is required for proper development and pigmentation of the seed coat. Plant

Cell 14: 2463–2479.

Ng, M., and Yanofsky, M.F. 2001. Function and evolution of the plant MADS-box gene family.

Nat. Rev. Genet. 2: 186–195.

Paolacci, A.R., Tanzarella, O.A., Porceddu, E., Varotto, S. and Ciaffi, M. 2007. Molecular phylogenetic

analysis of MADS-box genes of MIKC type and chromosome location of SEP-like genes

in wheat (Triticum aestivum L.). Mol. Genet. Genomics 278: 689–708.

Parenicova´ , L., de Folter, S., Kieffer, M., Horner, D.S., Favalli, C., Busscher, J., Cook, H.E., Ingram,

R.M., Kater, M.M., Davies, B., Angenent, G.C., and Colombo, L. 2003. Molecular and

phylogenetic analyses of the complete MADS-box transcription factor family in Arabidopsis:

New openings to the MADS world. Plant Cell 15: 1538–1551.

Pelaz, S., Ditta, G.S., Baumann, E., Wisman, E. and Yanofsky, M.F. 2000. B and C floral organ

identity functions require SEPALLATA MADS-box genes. Nature 405: 200–203.

Pinyopich, A., Ditta, G.S., Savidge, B., Liljegren, S.J., Baumann, E., Wisman, E. and Yanofsky,

M.F. 2003. Assessing the redundancy of MADS-box genes during carpel and ovule

development. Nature 424: 85–88.

Pnueli, L., Abu-Abeid, M., Zamir, D., Nacken, W., Schwarz-Sommer, Z. and Lifschitz, E. 1991.

The MADS box gene family in tomato: temporal expression during floral development,


conserved secondary structures and homology with homeotic genes from Antirrhinum and

Arabidopsis. Plant J. 1: 255-266.

Pnueli, L., Hareven, D., Rounsley, S.D., Yanofsky, M.F. and Lifschitz, E. 1994. Isolation of the

tomato AGAMOUS gene TAG1 and analysis of its homeotic role in transgenic plants. Plant

Cell 6(2): 163–173.

Purugganan, M.D., Rounsley, S.D., Schmidt, R.J. and Yanofsky, M.F. 1995. Molecular evolution

of flower development: diversification of the plant MADS-box regulatory gene family.

Genetics 140: 345–356.

Ratcliffe, O.J., Kumimoto, R.W., Wong, B.J. and Riechmann, J.L. 2003. Analysis of the Arabidopsis MADS AFFECTING FLOWERING Gene Family: MAF2 prevents vernalization by short

periods of cold. Plant Cell 15: 1159–1169.

Riechmann, J.L. and Meyerowitz, E.M. 1997. MADS-domain protein in plant deveiopment. Biol.

Chem. 378:1079–1101.

Rijpkema, A.S., Zethof, J., Gerats, T. and Vandenbussche, M. 2009. The petunia AGL6 gene has

a SEPALLATA-like function in floral patterning. Plant J. 60: 1-9.

Saitou, N. and Nei, M. 1987. The neighbor-joining method: a new method for reconstructing guide

trees. Mol. Biol. Evol. 4: 406-425.

Schwarz-Sommer, Z., Davies, B., and Hudson, A. 2003. An everlasting pioneer: The story of

Antirrhinum research. Nat. Rev. Genet. 4: 657–666.

Scortecci, K.C., Michaels, S.D. and Amasino, R.M. 2001. Identification of a MADS-box gene,

FLOWERING LOCUS M, that represses flowering. Plant J. 26: 229–236.

Seymour, G.B., Ryder, C.D., Cevik, V., Hammond, J.P., Popovich, A., King, G.J., Vrebalov, J.,

Giovannoni, J.J. and Manning, K. 2011. A SEPALLATA gene is involved in the development

and ripening of strawberry (Fragaria x ananassa Duch.) fruit, a non-climacteric tissue. J.

Exp. Bot. 62: 1179-1188.

Shore, P., and Sharrocks, A.D. 1995. The ETS-domain transcription factors Elk-1 and SAP-1 exhibit

differential DNA binding specificities. Nucleic Acids Res. 23: 4698–4706.

Song, J., Chen, Z. and Liao, J. 2010. Isolation and characterization of a SEP- like gene from Alpiniahainanensis (Zingiberaceae). Mol. Biol. Rep. 37: 917-922.

Sommer, H., Beltra´ n, J.P., Huijser, P., Pape, H., Lo¨ nnig, W.E., Saedler, H., and Schwarz-Sommer,

Z. 1990. Deficiens, a homeotic gene involved in the control of flower morphogenesis in

Antirrhinum majus: The protein shows homology to transcription factors. EMBO J. 9: 605–613.

Southerton, S.G., Marshall, H., Mouradov, A. and Teasdale, R.D. 1998. Eucalypt MADS-box genes

expressed in developing flowers. Plant Physiol. 118: 365-372.

Sundstrom, J. and Engstrom, P. 2002. Conifer reproductive development involves B-type MADS-box

genes with distinct and different activities in male organ primordial. Plant J. 31: 161-169.

Sung, S.K. and An, G. 1997. Molecular cloning and characterization of a MADS-box cDNA clone

of the ‘Fuji’ apple. Plant Cell Physiol. 38(4): 484-9.

Sung, S.K., Yu, G.H. and An, G. 1999. Characterization of MdMADS2 a member of the

SQUAMOSA subfamily of genes, in apple. Plant Physiol. 120: 969-978.

Sung, S.K., Yu, G.H., Nam, J., Jeong, D.H. and An, G. 2000. Developmentally regulated expression

of two MADS-box genes, MdMADS3 and MdMADS4, in the morphogenesis of flower buds

and fruits in apple. Planta 210(4): 519-28.

Tanabe, Y., Hasebe, M., Sekimoto, H., Nishiyama, T., Kitani, M., Henschel, K., Munster, T., Theissen,

G., Nozaki, H. and Ito, M. 2005. Characterization of MADS-box genes in charophycean

green algae and its implication for the evolution of MADS-box genes. Proc. Natl. Acad.

Sci. USA. 102: 2436-2441.

Tani, E., Polidoros, A.N., Flemetakis, E., Stedel, C., Kalloniati, C., Demetriou, K., Katinakis, P.

and Tsaftaris, A.S. 2009. Characterization and expression analysis of AGAMOUS-like,


SEEDSTICK-like, and SEPALLATA-like MADS-box genes in peach (Prunus persica) fruit.

Plant Physiol. Biochem. 47: 690-700.

Tamura K., Peterson D., Peterson N., Stecher G., Nei M., and Kumar S. 2011. MEGA5: Molecular

evolutionary genetics analysis using maximum likelihood, evolutionary distance, and

maximum parsimony methods. Mol. Biol. Evol. (In Press). doi: 10.1093/molbev/msr121.

Theiβen, G. 2001. Development of floral organ identity: stories from the MADS house. Curr. Opin.

Plant Biol. 4: 75–85.

Theißen,G., Becker, A., Rosa, A.D., Kanno, A., Kim, J.T., Münster, T., Winter, K.U. and Saedler,

H. 2000. A short history of MADS-box genes in plants. Plant Mol. Biol. 42: 115–149.

Theißen, G., Kim, J.T. and Saedler, H. 1996. Classification and phylogeny of the MADS-box multigene

family suggest defined roles of MADS-box gene subfamilies in the morphological evolution

of eukaryotes. J. Mol. Evol. 43: 484–516.

Vandenbussche, M., Theissen, G., Van de Peer, Y. and Gerats, T. 2003. Structural diversification

and neo-functionalization during floral MADS-box gene evolution by C-terminal frameshift

mutations. Nucleic Acids Res. 31: 4401-4409.

Vandenbussche, M., Zethof, J., Souer, E., Koes, R., Tornielli, G.B., Pezzotti, M., Ferrario, S.,

Angenent, G.C., and Gerats, T. 2003. Toward the analysis of the Petunia MADS box gene

family by reverse and forward transposon insertion mutagenesis approaches: B, C, and D

floral organ identity functions require SEPALLATA-like MADS box genes in petunia. Plant

Cell, 15, 2680-2693.

Velasco, R., Zharkikh, A., Affourtit, J., Dhingra, A., Cestaro, A., Kalyana-raman, A., Fontana, P.,

Bhatnagar, S.K., Troggio, M. and Pruss, D. 2010. The genome of the domesticated apple

(Malus x domestica Borkh.). Nat Genet, 42, 833-839.

Whipple, C.J., Ciceri, P., Padilla, C.M., Ambrose, B.A., Bandong, S.L., and Schmidt, R.J. 2004.

Conservation of B-class floral homeotic gene function between maize and Arabidopsis.

Development 131: 6083–6091.

Yao, J.L., Dong, Y.H., Kvarnheden, A. and Morris, B. 1999. Seven MADS-box genes in apple are

expressed in different parts of the fruit. J. Amer. Hort. Sci. 124: 8-13.

Zhang, H. and Forde, B.G 1998. An Arabidopsis MADS-box gene that controls nutrient-induced

changes in root architecture. Science 279:407–409.

Zhao, T., Ni, Z., Dai, Y., Yao, Y., Nie, X. and Sun, Q. 2006. Characterization and expression of 42

MADS-box genes in wheat (Triticum aestivum L.). Mol. Genet. Genomics, 276: 334-350.

Zahn, L.M., Kong, H., Leebens-Mack, J.H., Kim, S., Soltis, P.S., Landherr, L.L., Soltis, D.E., de

Pamphilis, C.W. and Ma, H. 2005. The evolution of the SEPALLATA subfamily of MADS-box

genes: a preangiosperm origin with multiple duplications throughout angiosperm history.

Genetics, 169: 2209–2223.

Zuckerkandl, E. and Pauling, L. 1965. Evolutionary divergence and convergence in proteins.

Edited in Evolving Genes and Proteins by V. Bryson and H.J. Vogel, pp. 97-166. Academic

Press, New York.


Table 1. Forward and reverse primers used for cloning MADS-box genes in RT-PCR reaction.

Tables

Gene Forward primer Reverse primer

MdMADS1MdMADS3

GGCGGATCCATGGGGAGAGGAAGAGTG

GCAGGATCCCAGTTTGTCTACCTCTGA

CGCATGGATCCTCAAAGCATCCATCCAG

CGCGGATCCGTATATACAAATTGGTCTC

Ingredients Amount

PCR water

Forward primer of the gene of interest (20 uM)

Reverse primer of the gene of interest (20 uM)

Actin-5P primer (20 uM)

Actin-3P primer (20 uM)

10 mM dNTPs

10x Platinum buffer

Platinum Taq DNA Polymerase

38.5 µl

1 µl

1 µl

1 µl

1 µl

1 µl

5 µl

0.5 µl

Table 2. Polymerase chain reaction mixture for amplification of the genes from RT reaction.

Temperature Time duration

94 °C

32 cycles:

94 °C

Taa (50/55/60°C)

72 °C

Final extension:

72 °C

2 min

30 sec

30 sec

30 sec per 0.5 kb

10 min

Table 3. Thermal programming of the PCR reaction.


Malus × domesticaGene name GI number

Arabidopsis thalianaGene name GI number

MdMADS3

MdMADS1

MdMADS2

MdMADS4

MdMADS5

MdMADS6

MdMADS7

MdMADS8

MdMADS9

MdMADS10

MdMADS11

MdMADS11.1

MdMADS12

MdMADS13

MdMADS14.1

MdMADS14

MdMADS15

MdMADS16

MdMADS16.1

MdMADS17

MdMADS18

MdMADS19

MdMADS20

MdMADS21

MdJOINTLESS

MdPI

MdAGL

MdSOC1a

MdSOC1ak

MdSOC1c

5777904

3290209

3947985

5777906

110681903

351602211

302398909

3646334

3646336

3646326

3646340

302398915

32452882

16973294

302398885

16973296

16973298

189339107

302398887

302398889

302398891

302398893

302398897

302398899

122056647

12666535

33308109

114386386

268327050

295684203

SEP1/AGL2

SEP2/AGL4

SEP3/AGL9

SEP4/AGL3

AP1/AGL7

AP3

AG

FLC

PI

AGL8/FUL

AGL1/SHP1

AGL5/SHP2

AGL6

CAL/AGL10

AGL11/STK

AGL12

AGL13

AGL14

AGL15

AGL16

AGL17

AGL18

AGL19

SOC1/AGL20

AGL24

AGL71

AGL72

AGL79

52548008

52548054

334182820

330250646

332196766

332645695

3915597

332004118

332005434

1004365

113511

113515

330255488

259016368

12229648

332197095

332646637

332657662

332004558

332646109

330252237

332646129

332659284

17433202

332659522

332008757

32402406

32402440

Table 4. The genes (proteins) used in this research in making phylogenetic tree and their gi-numbers in the public

databases GeneBank/EMBL/DDJB.


Figures

Fig. 1. Agarose (1%) gel electrophoresis of RT-PCR and colony-

PCR of the isolated genes. A. RT-PCR of MdMADS1-Golden, B.

Colony-PCR of MdMADS1-Golden, C. RT-PCR of MdMADS3-

Golden, D. Colony-PCR of MdMADS3-Golden.

Fig. 2. Evolutionary relationships of apple and Arabidopsis MADS-

box genes. AGL2 clade of MADS-box genes comprises Md-

MADS1 and MdMADS3 genes isolated in this research. The genes

with “Md-“ prefix are from apple and the others are from Arabidop-

sis. The evolutionary history was inferred using the Neighbor-Join-

ing method (Saitou and Nei, 1987). The optimal tree with the sum

of branch length = 10.01153205 is shown. The tree is drawn to

scale, with branch lengths in the same units as those of the evolu-

tionary distances used to infer the phylogenetic tree. The evolu-

tionary distances were computed using the Poisson correction

method (Zuckerkandl and Pauling, 1965) and are in the units of

the number of amino acid substitutions per site. The analysis in-

volved 55 amino acid sequences. All positions containing gaps and

missing data were eliminated. There were a total of 122 positions

in the final dataset. Evolutionary analyses were conducted in

MEGA5 (Tamura et al., 2011).


Copper Effects on Growth Parameters of Hollyhock

(Althaea rosea L.)

Copper is an essential micronutrient for plant growth which is involved

in many metabolic processes. However excessive amounts of copper may

cause environmental pollution. With an increase in the contamination of urban

areas with heavy metals, more attention should be paid to the role of ornamental

plants in removing pollutants from the soils. The effects of heavy metals on

the growth parameters of plants also should be determined. In this research the

effects of four levels of Cu (CuSO4.5 H2O) including 0, 20, 40 and 80mg Cu

kg soil on growth parameters of hollyhock plants were investigated. Results

showed that in treated plants root and shoot elongation, root dry weight and

shoot fresh weight were not significantly differentiate from control. However,

a significant decrease in Chl.a, Chl.b and total chlorophyll content was

observed by increasing the cu level in the soil. Proline content in the leaf

tissues reached to the highest values when plants were treated with 80 mg Cu

kg soil. Electrolyte leakage of treated plant with 20 mg Cu kg soil was not sig-

nificant differentiate from control. The concentration of Cu in the shoots and

roots significantly increased with increasing the Cu level in the soil. Translocation

factor at all Cu concentrations significantly decreased in compared to the

control. Generally, results showed that A.rosea is a suitable alternative for

phytoremediation of copper contaminated area.

Keywords: Althaea rosea, Copper, Growth parameter.

M. Kamali1*, M. Sarcheshme Pour2 and A.A. Maghsoudi Moud3

1Graduate Student, Department of Horticultural Sciences, Factually of Agriculture, Shahid Bahonar

University, Kerman, Iran.2Assistant Professor, Department of Soil Science, Factually of Agriculture, Shahid Bahonar University,

Kerman, Iran.3 Associate Professor, Department of Agronomy and Plant Breeding, Factually of Agriculture, Shahid

Bahonar University, Kerman, Iran.


Abstract


INTRODUCTION

Soil and irrigation water contamination with heavy metals is one of the most serious envi-

ronmental problems to limit plant production and threat human health. The major sources of con-

tamination in urban areas are industrial wastes, home applications which are disposed in correctly

and municipal sewage sludge (Prabha et al., 2007;Qian et al., 2005).

For plants, copper (Cu) is an essential micronutrient. It plays a structural and catalytic role

as it is a component of several proteins and enzymes involved in electron transfer chain, oxidation

and reduction reactions, charge accumulations and for phytosystem II activity(Ducic and Polle.,

2005). Cu is normally present in plant tissues at 10 µg g-1 plant dry weight (Ducic and Polle.,

2005). However, excessive amount of Cu affects nitrogen and protein metabolism, causes chlorosis

of leaves, inhibits photosynthesis and disturbs mineral uptake (Wei et al., 2008). Cu interferes with

the biosynthesis of photosynthetic machinery and decreases net photosynthetic rate (Qian et al.,2005). In the nature, Cu contamination usually results from human activities, such as mining,

smelting, industrial waste disposal, sewage sludge application to agricultural soils, and the use of

some types of fertilizers and pesticides (Ducic and Polle., 2005; Wei et al., 2008).

Up to now, many plants have been found as remediation plants, but there was little report

about ornamental plants that can remedy contaminated soils. In fact, ornamental resources are very

abundant, and they can indicate and monitor atmospheric pollutants. Especially for urban areas,

ornamentals can beautify the environment and also resolve heavy metal pollution at the same time.

Phytoremediation has received more attentions in recent years since it has been shown to be cost

effective and more easy to apply than other conventional technologies for removing contaminates

from the soils (Moteshare zadeh et al., 2008). Generally, phytoremediation is the use of green

plants to remove contaminants from soils (Moteshare zadeh et al., 2008). There are many plants

species currently used in phytoremediation, such as Ammania baccifere which can accumulate up

to 1000 mg cu kg root dry weight(Mukhopadhyay and Maiti., 2010).

To our knowledge, there are few reports about ornamental plants that can absorb Cu from

contaminated soils. The aim of this study was to identify the capability of A. rosea to remove Cu

from contaminated soils by application of a concentration gradient of Cu, and also to evaluate the

effects of different concentration levels of copper on growth parameters of A. rosea.

MATERIAL AND METHODS

An experiment was conducted in Shahid Bahonar University of Kerman Agricultural re-

search station in 2010. Seeds of A.rosaea were sterilized in 0.5% (w/v) NaClO3 for 5 min and

rinsed four times in deionized water. In April 2010, soil samples were collected from the 0-30 cm

depth of university landscape and were analyzed to determine the level of Cu. The samples without

contamination were selected and sieved through a 4 mm sieve and filled into 1:2000 wagner pots.

Copperic sulfate (CuSO4.5H2O) solution was added to the soil in each experimental pot at 20, 40

and 80 mg Cu kg soil. Soils were then completely mixed and rested to be completely equilibrated

for 40 days. Seedlings of A.rosea all at similar growth stage were transplanted into the pots. Pots

were then arranged in a completely randomized design with four replications. Number of seedlings

per pots was reduced to 3 as one experimental plot and pots were replicated 3 times to minimize

the experimental errors. Growing conditions was adjusted as follows: light intensity 150 µmol

photon m-2 s-1; maximum temperature 35 ̊C, minimum temperature 15 ̊C, photoperiod 16h/8h

light/night and 60% relative humidity. Water lost by each pot was measured regularly by weighing

out the pots every other days and sufficient amount of water applied to maintain soil water content

at 85% of soil water holding capacity. Plants were harvested after 120 days.

Estimation of chlorophyll content

Chlorophyll content in the leaf tissues was determined according to the method described


by Arnone (1949). Briefly 0.1 g of fresh leaf samples were extracted with 10 ml of ethanol and

then absorbance of the extract was measured by spectrophotometer (SPUV-26) at 663 and 645 nm

(Arnone, 1949).

Estimation of proline content

Proline content was determined by the method of Bates et al. (1973). Leaf samples were

homogenized in 3% aqueous sulfosalicylic acid, and the homogenate was centrifuged (Universal

320R) at 10,000 rpm. The supernatant was used for estimation of the proline content. The ab-

sorbance was read by a Spectrophotometer (SPUV-26 ) at 520 nm (Bates et al., 1973).

Estimation of electrolyte leakage

One gram of tissue was cut to in 2cm segments, rinsed in deionized water for 24 h at 24 ̊C.

The electrical conductivity of the solution was determined using a conductivity meter (Winlab).

Tubs were then air thighted and placed in boiling water bath for 20 min to disrupt the tissues and

cells, and then cooled to 24 ̊C. The electrical conductivity was again measured. Membrane ion

leakage was calculated as the ratio of the conductivity after 12 h to the conductivity after boiling

(Pang et al., 2003).

Estimation of copper content

Plants were rinsed, cut and separated into the shoots and roots. Each part was dried in an

oven at 65 ̊C for 72 h. Samples dry weight were recorded. All dried parts were grounded using a

morter and pistel , mixed thoroughly and digested with HCl (0.1 N). After filtration extracts were

analyzed for copper content by an ICP set (AAS varian BV model) (Rothery, 1988).

Estimation of number and length of stomat

Leaf samples imprints prepared by nail polish and used to estimate of number and length

stomata. Epidermis were viewed with a light microscope (40X Objective, 10X ocular,). Observa-

tions were made on an average of 10 fields. Measurements were made with a calibrated eyepiece

micrometer. All data were then converted to μm.

Estimation of translocation factor

The ratio of metal concentrations in shoot to root is defined as translocation factor (TF)

which refers to the ability of plant to translocate metals from the root to the shoot. (Roongtanakiat,

2009).

All data were subjected to the analysis of variance using one-way ANOVA model (SAS

program version 9 for Windows) and tested at 1% level of significance.


Morphological parameters

Values of stem length, stem fresh weight and root dry weight of plants treated with different

levels of Cu were not significantly different from what were found in untreated ones. Even though

the highest values of root fresh weight and shoot dry weight were found in plants treated with 20

mg Cu kg soil, these values were significantly different from those of untreated plants. Increasing

levels of Cu in the soil significantly increased the stomatal number and length. However, root

length significantly decreased in treated Cu compared to the control plants (Table 1).

It has been shown that root growth of Elsholtzia haichowensis had more sensitive to high

Cu levels than shoot growth (Qian et al., 2005). Root elongation and biomass reduction were re-

ported to be the most sensitive parameter in plants exposed to heavy metals (Wei et al., 2008). The

inhibitory effect of Cu on root growth supposed to be due to reduction in cell division and retar-


dation of normal root cell growth (Wei et al., 2008).

Chlorophyll content

Increasing the Cu levels in the soil significantly decreased chl.a, chl.b and total chlorophyll

content of plant leaves. Lowest amount of photosynthetic pigments was found in plants grown in

the soil containing 80 mg Cu kg soil (Table 2).

It has been shown that at lower Cu concentrations, the central Mg2+ ion of the chlorophyll

is replaced by Cu2+(Singh et al., 2010). The loss of photosynthetic pigment content is generally

due to the direct peroxidative breakdown of pigments and chloroplast membrane lipids by the re-

active oxygen species (Singh et al., 2010). Chlorophyll content in Chrysanthemum coronarium L.

has shown to decrease with increasing the level of Cu, significantly (Wei et al., 2008).

Proline content

Highest level of proline content was found in plants treated with 80 mg Cu kg soil. The

amount of Cu absorbed by plants treated with different levels of Cu was significantly higher than

that of untreated ones (Table 2). Proline can play an important protective role against heavy metal

stress. Proline has shown to improve Cu tolerance of chickpea genotypes effectively by controlling

oxidative stress, an important cause of copper toxicity(Singh et al., 2010).

Electrolyte leakage

Ion leakage in plants treated with 20 mg Cu kg soil was not significantly different from

untreated plants. However, increasing the level of Cu in the soil to 40 and 80 mg Cu kg soil, sig-

nificantly increased ion leakage of the leaf tissues (Table 2).

The accumulation of Cu2+ ions may induce the formation of reactive oxygen species (ROS),

H2O2 and HO and a subsequent decrease of antioxidants to avoid cell damages due to ROS accu-

mulation. Additionally, Cu2+ ions can interact with S and N groups in cell proteins and cause an

alteration of the ionic channels of the membrane, which promotes a higher flow of ions in the leaf

cells (Bakor et al., 2007). Cu-induced stress has been shown to causes membrane damage in Azolla

accession during the first hours after exposure (Sanchez- viveros et al., 2010).

Cu content in A.roseaIncreasing the concentration of the Cu in the soil, increasing the Cu absorbed by roots and

shoot parts. The maximum concentration of Cu in the roots and shoot parts of plants were 152 and

85 ppm in experimental pots with 80 mg Cu kg-1 soil, respectively. Generally the amount of Cu

was higher in the roots compared to the shoot parts (Fig. 1 and 2).

The level of Cu in the cell wall fractions in roots and shoots of Chrysanthemum coronariumL. also showed an increasing trend with the increase of Cu concentration in nutrient solution (Wei

et al., 2008). It was suggested that Cu transportation over the tonolplast and final storing in the

vacuole plays a roll in the detoxification process (Wei et al., 2008).

It is obvious that copper accumulation may also be affected by soil properties such soil pH

and soil moisture and the changing environmental individual genotypic variability and varying de-

grees of soil contamination affected Cu accumulation in plants (Ariyakanon and Winaipanich.,

2006 ).

Translocation factor

Translocation factor was found to be highest in untreated plants. Increasing the Cu level to

20, 40 and 80 mg-1Cu kg soil significantly decreased the Cu translocation factor compared to the

control plants. However, the difference among all treated plants were not significant (Table 2).

The heavy metal translocation ability of vetiver grass grown in industrial wastewaters varied


depending on the characteristic of growth media and metal types (Roongtanakiat, 2009). This

factor in amaranthus was much better than that in sunflower and amaranthus had more successful

phytoremediation (Ducic and Polle., 2005).

CONCLUSION

The results from the present investigation show that this plant could not be classified as a

Cu hyperaccumulator because the Cu concentration in the roots was greater than that in the shoots,

it was tolerant to Cu because it grew well in soils with 80 mg kg-1 Cu. Thus A. rosea has great po-

tential to be used for phytostabilization remediation of contaminated soils by Cu. What was more

significant was A. rosea could remedy contaminated soils while beautifying the environment at

the same time, especially in urban areas this has an important and practical significance.

Literature Cited

Ariyakanon, N. and Winaipanich, B. 2006. Phytoremediation of copper contaminated soil by Brassicajuncea L. and Bidens alba L. Dc. var. Radiate. J. Sci. Res. Chula. Univ. 31(1):49-56.

Arnone, D. I. 1949. Copper enzymes in isolated chloroplasts polyphenol oxidase in beta vulgalisL. Plant Physiol. 24: 1-15.

Bakor, M., Vaczi, P., Bartak, M., Budova, J. and Dzubaj, A. 2007. Uptake, photosynthetic characteristics

and membrane lipid peroxidation levels in the lichen photobiont Trebouxia erici exposed

to copper and cadmium. Bryologist. 110: 100-107.

Bates, L.S., Waldren, R.P. and Tears, I.D. 1973. Rapid determination of free proline for water stress

studies. Plant Soil. 39: 205-207.

Ducic, T. and Polle, A. 2005. Transport and detoxification of manganese and copper in plants.

Braz. J. Plant Physiol. 17(1):103-112.

Moteshare Zadeh, B., Firozabadi, G.R., Alikhani, H.A. and Mirseyed Hosseini, H. 2008. Effect of

sunflower and Amaranthus culture and application of inoculants on phytoremediation of

the soil contaminated with cadmium. American-Eurasian J. Agric. Environ. Sci.4(1): 93-103.

Mukhopadhyay, S. and Maiti, S.K. 2010. Phytoremediation of metal mine waste. Appl. Ecol.

Environ. Res. 8(3): 207-222.

Pang, J. G., Chan, S. Y., Zhang, J., Liang, J. and Wong, M.H. 2003. Physiological aspects of vitiver

grass for rehabilitation in abandoned metalliferous mine wastes. Chemosphera. 52:1559-1570.

Prabha, K., Marathiamma, P. and Li, L. 2007. Phytoremediation technology: hyper-accumulation

metals in plant. Water Air Soil Pollut. 184: 105-126.

Qian, M., Li, X. and Shen, Z. 2005. Adaptive copper tolerance in Elsholtzia haichowensis involves

production of Cu- induced thiol peptides. Plant Growth Regul. 47:66-73.

Roongtanakiat, N. 2009. Vitiver phytoremediation for heavy metal decontamination. Tech. B. 1-20.

Rothery, E. 1988. Analatical methods for graphite tube atomizer, Pty Ltd. Mulgrave, Victor. 99-102.

Sanchez-Viveros, G., Gonzales Mendoza, D., Alarcon, A. and Ferrera Crrato, R. 2010. Copper effects

on photosynthetic activity and membrane leakage of Azolla filiculoides and A. caroliniania.

Int. J. Agr. Biol. 12(3):365-368.

Singh, V., Bhatt, I., Aggarwal, A., Tripathi, B. N., Munjal, A. K. and Sharma, V. 2010. Proline improves

copper tolerance in chickpea (Cicer arieyinum). Protoplasma. 245: 173-181.

Wei, L., Luo, C., Li, X and Shen, Z. 2008. Copper accumulation and tolerance in Chrysanthemum coronarium L. and Sorghum sudanense L. Arch. Environ. Contam. Toxical. 55:238- 246.


Cu level

(mg/kg)

Stomata

length

(µm)

stomata

number

Root dry

weight(g)

Shoot dry

weight (g)

Root fresh

weight (g)

Shoot

fresh

weight (g)

Root

length

(cm)

Shoot

length(cm)

0

20

40

80

15.75d

18.93c

22.12b

24.31a

11.75c

14.5b

17.33a

18.6a

5.68a

5.87a

5.91a

5.67a

6.1b

7.24a

6.61ab

6.31ab

14.16b

16.74a

15.28ab

14.58ab

13.12a

13.56a

13.63a

13.09a

20.59a

18.63ab

15.34bc

13.06c

20.29a

20.71a

21.83a

19.25a

Table 1. Mean values of growth characteristics of hollyhock plants treated with different levels of copper con-

centrations.

Differences between means which are followed by the same letter are not significantly different at 1% level

of significance.

Cu

level(mg/kg)

Translocation

factor(Tf)

Proline

(µm/l)

Electrolyt

leakage (ds)

Total

chlorophyll

Chlorophyll b

(mg/g fresh weight)

Chlorophyll a (mg/g

fresh weight)

0

20

40

80

0.85a

0.59b

0.56b

0.55b

65.71c

76.68c

119.97b

172.95a

26.63b

26.85b

36.85a

37.16a

42.26a

36.77b

35.13cb

31.66c

19.04a

15.4b

14.37cb

11.92c

23.22a

21.07ab

20.76ab

19.90b

Table 2. Mean values of physiological characteristics of hollyhock plants treated with different levels of copper

concentrations.

Differences between means which are followed by the same letter are not significantly different at 1% level

of significance.

Tables


Figures

Fig.1. Effect of Cu concentration on the accumulation of Cu in the

roots of A. rosea

Fig.2. Effect of Cu concentration on the accumulation of Cu in the

shoots of A. rosea

www.jornamental.com


Controlling Ornamental Cabbage and Kale (Brassicaoleracea) Growth via Cycocel

Chlormequat (cycocel or CCC), the plant growth retardant, was evaluated

for its ability to control plant height in Brassica oleracea cultivar ‘Kamome

White’ and ‘Nagoya Red’. Different concentrations of CCC (0, 500, 1000 and

1500 mg/L) were sprayed and drenched on plants 40 days after transplanting.

Data were recorded the 60 and 90 days after transplanting. The 1500 mg/L of

CCC resulted in about 50 and 20% shorter plants than the control plants, 60

and 90 days after transplant, respectively. The growth of Brassica oleraceacultivar ‘Kamome White’ and ‘Nagoya Red’ decreased with increasing the

concentration of CCC. Foliar sprays of CCC controlled plant height of both

cultivars. The least record of plant height was obtained by application of 1500

mg/L CCC via spraying method in cultivar ‘Kamome White’ after 60 and 90

days (9.94 and 11.59 cm, respectively). The effect of cultivar type has been

significant at p≤0.01 level on all measured traits.

Keywords: Brassicaceae, Chlormequat, Drench, Plant height, Spray.

A. Gholampour1, D. Hashemabadi2*, Sh. Sedaghathoor2 and B. Kaviani2

1MSc. Student, Department of Horticultural Science, Rasht Branch, Islamic Azad University, Rasht,

Iran. 2Department of Horticultural Science, Rasht Branch, Islamic Azad University, Rasht, Iran.


Abstract


INTRODUCTION

Ornamental cabbage and kale (Brassica oleracea) (Brassicaceae) is an important landscape

plant for fall, winter and spring gardens and parks. This attractive plant is resistant to the cold.

Due to excessive stem elongation of ornamental cabbage and kale in the fall and early winter, there

is a challenge for maintaining a short, yet robust plant that will look proportional to the proper

size. Shorter plants are more attractive and easier to handle during marketing and planting. Com-

mercial value of ornamental cabbage and kale depends on its height.

Plant growth regulators are commonly applied to limit stem elongation and produce a more

compact plant (Tayama et al., 1992). To counteract excessive stem elongation, plant growth retar-

dants like CCC are usually used (Messinger and Holcomb, 1986; Sachs and Hackett, 1972). These

compounds can delay cell division and elongation of plant aerial parts as well restrict gibberellins

biosynthesis, resulted in reduces internodes length and vegetative growth (Cosgrove and Sovon-

ick-Dunford, 1989; Catchey, 1964; Sanderson, 1973; Magnitskiy et al., 2006). Gibberellins play

an important role in the growth and development of plants. Type of species and cultivar, time and

method of application, concentration, and type of target organ as well physiological and environ-

mental conditions are some important factors affecting on the influence of growth retardants on

plants (Hojjati et al., 2009; Khangoli, 2001; Holcomb and White, 1970; James et al., 1999; Pobud-

kiewicz and Nowak, 1994). CCC is applied as foliar spray and drench (Shekari et al., 2004). De-

termining the optimal CCC foliar spray or drench rates would offer other options for controlling

ornamental cabbage and kale plant growth (Gibson and Whipker, 2000). Proper doses need to be

assessed because they can either inhibit or promote growth and development depending on amount.

Recommended stage and doses for CCC application are 3-4 true leaf and 500-3000 mg/L (Shekari

et al., 2004). Adding CCC has also proven to be effective in controlling growth of some other

plants (Holcomb and White, 1970; Al-Khassawneh et al., 2006; Leclerc et al., 2006; Hojjati et al.,2009; Karlovic et al., 2004; Rossini Pinto et al., 2005).

The purpose of this study was to evaluate the effect of different concentrations of CCC on

some growth characters especially plant height in Brassica oleracea cultivars ‘Kamome White’

and ‘Nagoya Red’.


Seeds of ornamental cabbage and kale (Brassica oleracea) cultivars ‘Kamome White’ and

‘Nagoya Red’ were prepared from Takii and Sakata Company (Japan), respectively. Investigation

was carried out on experimental field in Rudesar city located in the northern part of Iran (N 38.8°

and S 50.19°; altitude, -22 m above sea level; mean annual rainfall, 958.6 mm; mean annual tem-

perature, 17.3°C; mean annual relative humidity, 78%; mean annual evaporation, 1044.2 mm;

mean annual sunlight radiation, 2146.0 h). Seeds were sown in pots filled with 50% cocopeat, 30%

perlite and 20% sand on August 23 2010. Uniform size seedlings (approximately 3-4 true leaf)

were potted 40 days after seeding in plastic pots filled with clay, manure, compost and sand

(1:1:1:1). Plants were treated with a foliar and drench application at rate of 500, 1000 and 1500

mg/L CCC, 40 days after potting. Control plants were sprayed and drenched only with 6 mL/pot

and 60 mL/plant water, respectively. First data were calculated the 60 days after transplanting.

Then plants were transferred to the same pots and same soils. Second data were calculated the 90

days after transplanting. Plant height, stem length (measured from crown to the first leaf), leaf

chlorophyll content and leaf brix degree (°B) were recorded the 60 days after potting. Plant height,

stem length, leaf chlorophyll content, leaf brix degree (°B), leaf number and diameter, and plant

dry weight were recorded the 90 days after potting. Plant height, stem length and leaf diameter by

ruler, brix degree by refractometer Atago (N-1α) and plant dry weight by digital balance were

measured. To obtain the plant dry weight, they were cut from crown and dried at 105°C for 24 h.

The experimental design was a randomized completely blocks design (RCBD) with a factorial


arrangement of treatments containing of four CCC concentrations × two treatments methods (spray

and drench) × two cultivars (‘Kamome White’ and ‘Nagoya Red’) × sixteen treatments totally ×

four replications, 64 plots and 256 pots). Data were subjected to analysis of variance (ANOVA)

using MSTATC statistical software. Mean comparison were carried out by employing Duncan’s

Multiple Range test at α = 5%.

RESULTS

The overall results of the effect of different concentrations of CCC on plant height stem

length, leaf chlorophyll content and leaf brix degree (°B) in Brassica oleracea cultivars ‘Kamome

White’ and ‘Nagoya Red’ after 60 and 90 days are summarized in Table 2.

Plant height

Based on analysis of variance (Table 3), the effect of different treatments and their interac-

tion on the plant height after 60 and 90 days was significant at 0.01 level of probability. There is

no significant difference in the effect of cultivar + kind of method on plant height after 60 days

but was significant after 90 days. The interaction effect of cultivar + method + concentration on

the plant height after 60 and 90 days was significant at 0.01 and 0.05 level of probability, respec-

tively. The effect of cultivar on the plant height was significant after 60 and 90 days (Table 3), and

‘Kamome White’ was better than ‘Nagoya Red’. Also, spray method had better effect on the plant

height after 60 and 90 days and caused shorter plant height than drench method. Plant height de-

creased linearly with increasing the CCC concentration (Fig. 1). The effect of CCC concentration

on plant height in both time of measurement (60 and 90 days was significant). Brassica oleraceacultivars ‘Kamome White’ and ‘Nagoya Red’ plants treated with CCC were shorter than the control

plants (Table 1). 1500 mg/L CCC treatment produced the shortest plants (10.79 cm after 60 days

and 12.56 cm after 90 days) than the control plants (15.20 cm after 60 days and 16.66 cm after 90

days). Among all treatments, interaction effects of ‘Kamome White’ + spray method + 1500 mg/L

of CCC had the least plant height (9.94 cm after 60 days and 11.59 after 90 days) (Table 1, Fig. 1).

Stem length

The effect of different treatments on the stem length after 60 days was no significant, but

the effect of cultivar, method, different concentrations of CCC, interaction between cultivars +

concentration and method + concentration on the stem length after 90 days was significant at 0.01

level of probability (Table 3). ‘Kamome White’ cultivar with 2.32 cm length was better than

‘Nagoya Red’ with 2.62 cm (Table 2). Also, spray method with 2.41 cm had better effect on the

stem length than drench method with 2.53 cm. Like plant height, stem length decreased linearly

to increasing the CCC concentration. 1500 mg/L CCC treatment produced the shortest stem length

(2.03 cm) than the control plants (2.85 cm). Interaction effect of cultivar and method with concen-

tration on stem length was significant (Table 3). Among all treatments, least stem length (1.90 cm)

and highest stem length (3.07 cm) were obtained in treatment of drench method + concentration

of 1500 mg/L of CCC and control, respectively (Table 2).

Leaf chlorophyll content

The effect of cultivar, as well as interaction effect of cultivar with method and concentration

was significant. Based on analysis of variance (Table 3), the effect of cultivar on the leaf chloro-

phyll content after 60 and 90 days was significant at 0.01 level of probability. Chlorophyll index

in ‘Nagoya Red’ showed significant superiority than that of ‘Kamome White’ after 60 and 90 days

(Tables 1 and 2). Interaction effect of cultivar + method, cultivar + CCC concentration and cultivar

+ method + CCC concentration on chlorophyll index was significant based on mean comparison

not based on analysis of variance (Tables 1, 2 and 3). The most chlorophyll index was calculated


in treatments of ‘Kamome White’ + drench method + 1000 mg/L CCC (18.50) after 60 days and

‘Nagoya Red’ + drench method + 1500 mg/L CCC (20.14) after 90 days (Tables 1 and 2).

Leaf brix degree (°B)

The effect of cultivar, as well as interaction effect of cultivar with method and concen-

tration was significant on leaf brix degree after 60 and 90 days (Table 3). Reciprocity of cultivar

in interaction effect with concentration and method was no significant but its difference was sig-

nificant (Table 3). Leaf brix degree of ‘Nagoya Red’ (7.39) had significant superiority than that of

‘Kamome White’ (6.00) after 90 days (Table 2). Interaction effect of cultivar + method, cultivar +

concentration and cultivar + method + concentration had better effect in ‘Nagoya Red’ than

‘Kamome White’. Totally, leaf brix degree after 90 days was more than that of 60 days (Tables 1

and 2). After 90 days, the most leaf brix degree (7.45) and the least of that (5.86) was obtained in

treatments of ‘Nagoya Red’ + spray method + 1500 mg/L CCC and ‘Kamome White’ + drench

method + 500 mg/L CCC, respectively (Table 2).

DISCUSSION

One of the most important applications of plant growth retardant is elevation of plant qual-

ity, especially ornamental plant by reduction of vegetative growth. Plant growth retardants decrease

the internodes length and eliminate the apical dominance (Khangoli, 2001; Lee et al., 1999). CCC

is an important plant growth retardant. CCC caused transport of carbohydrates to the roots via de-

creasing shoot length (Leclerc et al., 2006). Study of Hojjati et al. (2009) on Zinnia showed that

the 2000 mg/L CCC caused the least amount of shoot carbohydrate. Plant growth retardants in-

crease cytokinins which resulted in enhance the amount of leaf chlorophyll (Dole and Wilkins,

2005; Rossini Pinto et al., 2005). Some of the most important factors concerning plant growth re-

tardants are type, time, number, application method and concentration of growth retardant (Cramer

and Bridgen, 1998). In current study, CCC caused decreasing of plant height in ornamental cabbage

and kale (Brassica oleracea) cultivars ‘Kamome White’ and ‘Nagoya Red’. Decreasing the plant

height by CCC was observed in many species (Olivera and Browning, 1993; Garner, 2004;

Karlovic et al., 2004; Rossini Pinto et al., 2005; Hashemabadi and Zarchini, 2010). Karlovic et al.

(2004) reported decreasing height in Chrysanthemum by 2000, 3000 and 4000 mg/L CCC.

Hashemabadi and Zarchini (2010) showed that the least stem length (29.93 cm) was obtained

by using 1500 mg/L CCC in rose, poison. The stem length was 35.7 cm in control plant. These

researchers showed a significant decrease in stem length under CCC application. Saffari et al.

(2004) sprayed the Rosa damascena with CCC and revealed that 3000 mg/L CCC decreased

stem length about 5 cm relative to control. Studies of Karlsson et al. (1992) on Begonia × tuber-

hybrida showed that the CCC (500 mg/L) resulted in 23% shorter plants than the control plants

15 weeks after transplanting. Increased application rates did not positively impact plant devel-

opment when compared to the lower rates used in the study. CCC (1000 and 2000 mg/L) de-

creased Zinnia plant height (Hojjati et al., 2009). Studies on several ornamental plants revealed

that the maximum concentration of CCC for reduction of plant height is 1500 mg/L (Cathey,

1975; Schwartz et al., 1985; Hedayat, 2001; Joyce et al., 2004). Current study conforms to these

studies. This growth retardant, also, reduced plant height in Euphorbia and Bougeinvillia

(Shekari et al., 2004), Rosa (Saffari et al., 2004) and Pelargonium (Latimor and Beden, 1994).

In ornamental cabbage and kale and many ornamental plants, spraying was the better than

drenching for decreasing the plant height (Schwartz et al., 1985; Garner, 2004; Hedayat, 2001).

These results are consistent with our findings. Other plant growth retardants such as prohexa-

dione-Ca, uniconazole, paclobutrazol, bayleton and daminozide are applied for decreasing the

plants growth as spray or drench (Karlsson et al., 1992; Gibson and Whipker, 2000; Bazzocchi

and Giorgioni, 2003; Hojjati et al., 2009).


ACKNOWLEDGEMENTS

The authors would like to thank the Islamic Azad University, Rasht Branch, especially Dr.

Amirteimouri for their financial supports.

Literature Cited

Al-Khassawneh, N.M., Karam, N.S. and Shibli, R.A. 2006. Growth and flowering of black iris

(Iris nigricans Dinsm.) following treatment with plant growth regulators. Sci. Hort. 107:

187-193.

Bazzocchi, R. and Giorgioni, M.E. 2003. Effect of prohexadione-Ca, uniconazole and paclobutrazol

on ornamental kale growth and performance under high temperature. Acta Hort. 614: 499-505.

Catchey, H.M. 1964. Physiology of growth retarding chemicals. Ann. Rev. Plant Physiol. 15: 271-302.

Cathey, H.M. 1975. Comparative plant growth retarding activites of ancymidol with ACPC, phosphon,

chlormequat and SADH on ornamental plant species. Hort. Sci. 10: 204-216.

Cosgrove, D.L. and Sovonick-Dunford, S.A. 1989. Mechanism of gibberellin dependent stems

elongation in peas. Plant Physiol. 89: 184-191.

Garner, W. 2004. PGR general uses and overview. Technical Service, 800: 4556-4647.

Gibson, B. and Whipker, B.E. 2000. Research progress report: the effect of B9, bonzi and sumagic

on the growth of ornamental cabbage and kale. North Carolina Flower Growers Bulletin,

44: 6-9.

Hashemabadi, D. and Zarchini, M. 2010. Effect of some plant growth regulators on growth and

flowering of Rosa hybrida "Poison". Plant Omics J. 3 (6): 167-171.

Hedayat, M. 2001. Application of growth retardants in greenhouse. First National Scientific and

Practical Symposium on Flowers and Ornamental Plants of Iran. Jahad-e-Keshavarzi, Iran

(In Persian).

Hojjati, M., Etemadi, N. and Baninasab, B. 2009. Effect of paclobutrazol and cycocel on vegetative

growth and flowering of Zinnia elegans. Agricultural Sciences and Technologies and

Natural Resources. 47: 649-656 (In Persian).

Holcomb, E.J. and White, J.W. 1970. A technique for soil application of growth retardant. HortSci.

5: 16-17.

James, L., Gibson, B. and Whipker, E. 1999. The effect of B9 + cycocel on the growth of Brassica juncea var. ‘Rugosa Red Giant’. SNA Research Conference, 44: 284-287.

Joyce, G., Latimer, H., Scoggins, L. and Thomas, J. 2004. Using plant growth regulators on containerized

herbaceous perennials. Virginia State University.

Karlovic, K., Vrsek, I., Sindrak, Z. and Zidovec, V. 2004. Influence of growth regulators on the

height and number of inflorescence shoots in the chrysanthemum cultivar Revert. Agric.

Conspec. Sci. 69: 63-66.

Karlsson, M.G., Werner, J.W. and Hanscom, J.T. 1992. Growth regulator effect in seed propagated

Begonia × tuberhybrida. University of Alaska Fairbank. Circular, 90. July 1992.

Khangoli, S. 2001. Potential of growth regulators on height and flowering control in ornamental

plants. First National Scientific and Practical Symposium on Flowers and Ornamental Plants

of Iran. Jahad-e-Keshavarzi, Iran (In Persian).

Latimer, J.G. and Beden, S.A. 1994. Persistent effect of plant growth regulators on landscape

performance of seed geraniums. J. Environ. Hort. 12 (3): 150-154.

Leclerc, M., Caldwell, C.D. and Lade, R.R. 2006. Effect of plant growth regulators on propagule

formation in Hemerocallis spp. and Hosta spp. HortSci. 47: 651-653.

Lee, J.H., Jin, E.S. and Kim, W.T. 1999. Inhibition of auxin-induced ethylene production by SA in

mungbean hypocotyls. J. Plant Biol. 42: 1-7.

Magnitskiy, S.V., Pasian, C.C., Bennett, M.A. and Metzger, J.D. 2006. Controlling plug height of

verbena, celosia, and pansy by treating seeds with paclobutrazol. HortSci. 47: 158-167.


Messinger, N.L. and Holcomb, E.J. 1986. The effect of chlormequat chloride, ancymidol, BAS

106 and SD 8339 on selected Dianthus cultivars. HortSci. 21: 1397-1400.

Olivera, C.M. and Browning, G. 1993. Studies on the induction of flowering in juvenile Prunus

avium L. J. Hort. Sci. 68: 731-739.

Pobudkiewicz, A.K. and Nowak, J. 1994. The influence of florprimidol and uniconazole on growth

of the CMM draft Dianthus caryophyllus L. ‘Snowmass’. J. Fruit and Ornamental Plant

Res. 2 (4): 135-142.

Rossini pinto, A.C., Rodrigues, T.D.J.D., Leits, C.I. and Barbosa, J.C. 2005. Growth retardants on

development and ornamental quality of potted. ‘Liliput’ Zinnia elegans JACQ. Sci. Agric.

62: 337-345.

Sachs, R.M. and Hackett, W.P. 1972. Chemical inhibition of plant height. HortSci. 7: 440-447.

Saffari, V.R., Khalighi, A., Lesani, H., Babalar, M. and Obermaier, J.F. 2004. Effect of different

plant growth regulators and time of pruning on yield components of Rosa damascena Hill.

Int. J. Agric. Biol. 6 (6): 1040-1042.

Sanderson, K.C. 1973. Screening chemicals for controlling growth and flowering of Forsythia

intermedia Zabel. HortSci. 8: 477-479.

Schwartz, M.A., Payne, R.N. and Sites, G. 1985. Residual effect of chlormequat on garden

performance in sun and shade of seed and cutting-propagated cultivars of geraniums.

HortSci. 20: 368-370.

Shekari, F., Ebrahimzadeh, A. and Esmaeilpour, B. 2005. Plant growth regulators in agriculture

and horticulture. Zanjan University Press, Iran (In Persian).

Tayama, H.K., Larson, R.A., Hammer, P.A. and Rolls, T.J. (eds.) 1992. Tips on the use of chemical

growth regulators on floriculture crops. Ohio Florists’ Assn., Columbus, Ohio.


Traits

Treatment

Plant height (cm) Stem height (cm) Chlorophyll index Brix degree

Kamome White (A1)

Nagoya Red (A2)

Spray (B1)

Drench (B2)

Control (C1)

500 mgL-1 (C2)

1000 mgL-1 (C3)

1500 mgL-1 (C4)

A1B1

A1B2

A2B1

A2B2

A1C1

A1C2

A1C3

A1C4

A2C1

A2C2

A2C3

A2C4

B1C1

B1C2

B1C3

B1C4

B2C1

B2C2

B2C3

B2C4

A1B1C1

A1B1C2

A1B1C3

A1B1C4

A1B2C1

A1B2C2

A1B2C3

A1B2C4

A2B1C1

A2B1C2

A2B1C3

A2B1C4

A2B2C1

A2B2C2

A2B2C3

A2B2C4

12.96b

13.55a

12.99b

13.52a

15.29a

13.88b

13.08c

10.79d

12.73c

13.19b

13.26b

13.85a

15.23a

13.61c

12.46d

10.57f

15.35a

14.15b

13.71c

11.02e

15.29a

13.65c

12.95e

10.11g

15.29a

14.10b

13.22d

11.47f

15.27a

13.52c

12.22e

9.94h

15.19a

13.69c

12.70d

11.19g

15.31a

13.79c

13.68c

10.29h

15.39a

14.50b

13.75c

11.75f

2.05a

2.03a

2.05a

2.03a

2.09a

2.03a

2.03a

2.01a

2.07a

2.04a

2.04a

2.03a

2.12a

2.07a

2.02a

2.00a

2.07a

2.00a

2.04a

2.02a

2.08a

1.97a

2.07a

2.09a

2.11a

2.10a

1.99a

1.93a

2.13a

1.99a

2.06a

2.08a

2.12a

2.14a

1.97a

1.93a

2.04a

1.95a

2.08a

2.09a

2.09a

2.06a

2.01a

1.94a

11.24b

17.75a

14.31a

14.68a

14.37a

14.27a

14.38a

14.96a

10.80b

11.69b

17.83a

17.67a

11.63c

10.93cd

10.72cd

11.69c

17.11ab

17.61ab

18.04a

18.23a

14.23a

14.32a

13.90a

14.79a

14.50a

14.22a

14.86a

15.13a

11.61d

10.18e

10.23e

11.19d

11.64d

11.69d

11.22d

12.19c

16.86b

18.47b

17.58ab

18.39a

17.39ab

16.75b

18.50a

18.07a

5.04b

6.05a

5.55a

5.54a

5.56a

5.53a

5.54a

5.54a

5.05b

5.03b

6.05a

6.04a

5.06b

5.03b

5.01b

5.05b

6.06a

6.03a

6.07a

6.04a

5.61a

5.53a

5.54a

5.52a

5.51a

5.53a

5.53a

5.57a

5.10b

5.05b

5.02b

5.02b

5.03b

5.01b

5.00b

5.08b

6.12a

6.01a

6.07a

6.01a

6.00a

6.04a

6.07a

6.06a

Table 1. Mean comparison of the effect of different concentrations of cycocel, application method and type

of variety on plant height, stem height, chlorophyll index and brix degree of ornamental cabbage and kale

(Brassica oleracea) after 60 days.

Tables

Means sharing same letter in a column are statistically similar not significantly.


Traits

Treatment

Plant height (cm) Stem height (cm) Chlorophyll index Brix degree

Kamome White (A1)

Nagoya Red (A2)

Spray (B1)

Drench (B2)

Control (C1)

500 mgL-1 (C2)

1000 mgL-1 (C3)

1500 mgL-1 (C4)

A1B1

A1B2

A2B1

A2B2

A1C1

A1C2

A1C3

A1C4

A2C1

A2C2

A2C3

A2C4

B1C1

B1C2

B1C3

B1C4

B2C1

B2C2

B2C3

B2C4

A1B1C1

A1B1C2

A1B1C3

A1B1C4

A1B2C1

A1B2C2

A1B2C3

A1B2C4

A2B1C1

A2B1C2

A2B1C3

A2B1C4

A2B2C1

A2B2C2

A2B2C3

A2B2C4

14.61b

15.41a

14.78b

15.24a

16.66a

15.89b

14.92c

12.56d

14.34d

14.87c

15.21b

15.61a

14.44b

15.40c

14.48d

12.09f

16.89a

16.37b

15.37c

13.02e

16.65a

15.68c

14.70e

12.07g

16.68a

16.09b

15.15d

13.04f

16.41b

15.08d

14.26f

11.59i

16.48b

15.73c

14.70e

12.59h

16.89a

16.29b

15.13d

12.54h

16.88a

16.45b

15.60c

13.49g

2.32b

2.62a

2.41b

2.53a

2.85a

2.63b

2.38c

2.03d

2.28cd

2.37c

2.55b

2.69a

2.65bc

2.52c

2.13d

2.00d

3.04a

2.73b

2.64bc

2.07d

2.86a

2.58b

2.31de

1.90f

2.84a

2.67b

2.45cd

2.17e

2.65b

2.49c

2.08e

1.89f

2.66b

2.54c

2.17d

2.11e

3.07a

2.68b

2.54c

1.91f

3.02a

2.79b

2.73b

2.23c

15.28b

18.23a

16.49a

17.03a

16.90a

16.44a

16.66a

17.02a

14.94b

15.62b

18.04a

18.43a

15.09c

15.11c

15.55c

15.37c

18.72a

17.78ab

17.76ab

18.68a

16.86ab

15.50b

17.48ab

16.11ab

16.95ab

17.37ab

15.83ab

17.94a

14.56g

14.44g

15.76e

15.00g

15.62e

15.78e

15.34f

15.73e

19.16b

16.56e

19.21b

17.22d

18.28c

18.99b

16.32e

20.14a

6.00b

7.39a

6.72a

6.67a

6.71a

6.66a

6.72a

6.71a

6.05b

5.96b

7.39a

7.38a

6.03b

5.94b

6.05b

5.99b

7.38a

7.37a

7.38a

7.42a

6.70a

6.69a

6.76a

6.72a

6.71a

6.62a

6.68a

6.69a

6.08b

6.04b

6.08b

5.99b

5.98b

5.84b

6.03b

5.99b

7.33a

7.35a

7.44a

7.45a

7.44a

7.39a

7.32a

7.39a

Table 2. Mean comparison of the effect of different concentrations of cycocel, application method and type

of variety on plant height, stem height, chlorophyll index and brix degree of ornamental cabbage and kale

(Brassica oleracea) after 90 days.

Means sharing same letter in a column are statistically similar not significantly.


Mean square

After 90 days After 60 days

df Source of

variations

30.664**

0.035 ns

0.012 ns

0.023 ns

0.010 ns

0.007 ns

0.028 ns

0.025

-

2.36

139.831**

4.623 ns

1.075 ns

0.316 ns

1.630 ns

11.319*

5.161 ns

3.879

-

11.75

1.433**

0.217**

1.946**

0.012 ns

0.147**

0.059**

0.006 ns

0.007

-

3.42

10.36**

3.446**

50.876**

0.086**

0.232**

0.602**

0.052*

0.013

-

0.77

16.301**

0.003 ns

0.003 ns

0.00 ns

0.005 ns

0.016 ns

0.003 ns

0.006

-

1.37

677.333**

2.141 ns

1.581 ns

4.319 ns

2.308 ns

0.773 ns

2.717 ns

2.102

-

10

0.006 ns

0.007 ns

0.021 ns

0.001 ns

0.009 ns

0.059 ns

0.002 ns

0.035

-

9.13

5.581**

4.332**

56.666**

0.066 ns

0.901**

1.398**

0.158**

0.019

-

1.04

1

1

3

1

3

3

3

45

63

-

Cultivars (A)

Methods (B)

Concentrations (C)

A × B

A × C

B × C

A × B × C

Errors

Total

c.v.

Table 3. Analysis of variance (ANOVA) for the effect of different concentrations of Cycocel, application

method and type of variety on plant height, stem height, chlorophyll index and brix degree of ornamental cab-

bage and kale (Brassica oleracea).

Brix

degree

Stem

height

Plant

height

Chlorophyll

Index

Brix

degree

Stem

height

Plant

height

Chlorophyll

Index

**: Significant at α = 1%, *: Significant at α = 5%, ns=Not significant


Figures

Fig. 1. The effect of different concentrations of CCC on plant

height of Brassica oleracea cultivar ‘Kamome White’. Left to right;

0, 500, 1000 and 1500 mg/L CCC.

Fig. 2. The effect of different concentrations of CCC on plant

height of Brassica oleracea cultivar ‘Nagoya Red’. Left to right; 0,

500, 1000 and 1500 mg/L CCC.


Susceptibility Assessments of Tomato Genotypes to Root-

Knot Nematodes, Meloidogyne javanica

Root-knot nematodes, Meloidogyne spp., are one of the important plant

parasitic nematodes of tomato in the world. The most suitable control method

of plant parasitic nematodes is the use of resistance sources and tolerant

cultivars. In the earlier studies, the results showed thatonly 2% (19 out of 537

varieties) were resistant and tolerant to the root knot nematodes. In the supple-

mentary studies, the susceptibility of these 19 tomato cultivars were reassessed

again, against M. javanica, in the two completely randomized design experiments

in the greenhouse and field conditions for the two continuous years. The

tomato plants were evaluated 70 days after inoculation on the basis of the gall

indexes (GI), final populations (Pf), reproduction factors (Rf) and the root and

or the stem weights. The results showed that, the cultivars No. 136 and 109

with GI=2, Rf=4.68 and GI=2.25, Rf=28.4 are tolerant cultivars to the

nematode, M. javanica in the greenhouse respectively. Also, the cultivar No.

100 was considered to be a susceptible one, with GI= 3.25 and Rf= 0.97.

Whereas, in the field conditions, the cultivars 136 and 109 proved to be

tolerant with GI, 1.9 and 1.6 respectively.

Keywords: Cultivars, Resistance, Root- knot nematode, Tomato, Susceptibility.

M. Nasr Esfahani1*, A.R. Ahmadi2 and K. Shirazi3

1Plant Pests and Diseases Research Division, Agriculture and Natural Recourse Research Center,

Isfahan, Iran2Plant Pests and Diseases Research Division, Agriculture and Natural Recourse Research Center,

Ahvaz, Iran3Plant Pests and Diseases Research Division, Agriculture and Natural Recourse Research Center,

Isfahan, Iran.


Abstract


INTRODUCTION

Tomato (Lycopersicon esculentum Miller, 1768) is one of the vegetable crops, which

is used in various ways, such as souse and or etc. Tomatoes are planted in 110,229 hectares in

Iran and have 27 tone/hectare average yields. Root-knot nematodes, Meloidogyne spp., are

the most important tomato parasitic nematodes in Iran and the world. Seven species and five

races of these nematodes have already been identified in Iran. M. javanica is the most and

well distributed one in tomato and other field crops (Akhiyani et al., 1984; Mehdikhani et al.,2003; Janar Dhanan, 2002; Mojtahedi and Santo, 1994; Razaz Hashemi, 2005; Razaz Hashemi,

2006). The infection of the tomato cultivar, Red Cloud VF was reported to be 37% with 20

eggs and larva, as the primary inoculums per gram of soil, in the micro plot in Isfahan. Re-

sistance and susceptible cultivars, offer effective control against these nematodes (Webster,

1972). So, different cultivars of tomatoes were offered to farmer in different countries. Gold

set, Nematex and Small Early cultivars were reported as resistant sources to M. incognita inCanada. In USA VFN-8, Rossel, Patirot, Healani, Atkinson, Anaha, Nemared were resistant

cultivars to M .incognita and M. javanica (Taylor and Sasser, 1978). In Italy Roma VFN,

VFN-77-177-1, VFN-77-92-2, Stumae Ronita were resistant cultivars to root knot nematode

(Vito and Lamberti, 1976). In Egypt, Small Early VFN-8 and Ronita were reported as resistant

cultivars to root knot nematodes (Akhiyani and Mortazavi, 1992). In India, Pusa-120 and CLL

303-BCI were reported as resistant cultivars to M. javanica and race 1 to 4 of M. incognita(Prasad et al., 1964). Pelican cultivar was resistant to race 1, 2 and 4 and was susceptible to

race 3 of M. incognita (Rao et al., 1975). Bush-VFN and VFN-8 were resistant to all races of

M. incognita and M. javanica (Singh and Choudhury, 1974). Kaur et al. (1994) studied the

reaction of 25 F1 generation hybrid of tomato, which were resistant to M. incognita in Lud-

hiana area in India. Hybrid cultivars which were gained from Castly Roch* 1792 and Ronita

* Rio Grande were highly resistant, Ronita* F24-C8 and EC 119192* KF15 was resistant too.

Hybrid of Rio Grand * Ronita and Pujab Chhuhara* Ronita were moderately resistance to M.

incognita. Akhiyani (1981) examined 72 seeds from 1982 to find resistant or moderately re-

sistant tomatoes during 1982-1986. Akhiyani selected 19 lines and collected seed. Also, 91

tomato cultivars were sent by Gene bank. Akhiyani and Mortazavi (1992), evaluated 537 cul-

tivars of tomato in order to find resistant cultivars to M. javanica based on international project

standard of root knot nematodes. Out of these cultivars, 98 % were susceptible, and also some

of the cultivars, which were reported as resistant to M. javanica, were found to be susceptible.

Out of 11 cultivars in final tests, 7 cultivars were determined to be resistant and others were

susceptible.

In the present studies, the reaction of 19 tomato cultivars with the high quantity and quality

properties were evaluated against M. javanica in comparison to the controls, for the two continuous

years in the green house and the field conditions.


Evaluation of the cultivars reaction to nematode in the greenhouse conditions

The 20 tomato cultivars were planted in plastic pots filled with 1.5 lit of soils, with the mix-

ture of sand and pasteurized peat with 1:2:1 ratio. Cultivars reaction to M. javanica was rated on

each tomato plant, infected with the numbers of 5000 eggs and larva as the primary inoculum.

Pots were placed in greenhouse at about 25°c for 70 days. Plants were uprooted and gall indexes,

number of nematodes per root and soil, reproduction factors and growth conditions of the plant,

including root and stem weights were assessed in the complete block designs, indicating 20 treat-

ments and 4 replicates each. The average means were compared based on Duncan Multiple Test

Ranges (DMRT).


Planting tomato seeds in micro plots

Tomato seeds were planted in the micro plots, and after rising of the seedlings, the even

size and strong ones were transferred in to the field.

Selecting infested field to nematode

The fields which were highly infested to M. javanica with the mean numbers of 30 eggs

and larva per gram of soil selected in the regions, Vilashahr, Najafabad, in Isfahan province, which

then, divided into plots, according to the numbers of treatments and replicates.

Evaluation of tomato cultivars reaction to nematode in infested fields

Tomato seedlings were transferred into the infected fields. Sampling was done from 0 to

30 cm depths in order to determine the primary inoculum of nematodes. After, 4 months, all the

plants, 30 plants from each replicates were uprooted and assessed based on 0 to 5 scoring scales

(Tayler and Sasser, 1978). Nematode numbers in the roots and the soils from every plot were cal-

culated, in order to determine reproductive factor (RF) (Oostenbrink, 1966). Evaluation of resist-

ance, tolerance, susceptible and hypersensitive reactions of the tomato cultivars were assessed

based on Canto-Sanz (1983) method. Tolerance cultivars with the RF >1 and GI <2, the resistant

ones RF <1 and GI <2, susceptible cultivars GI>2 and RF >1 and hypersensitive RF<1 and GI>2

(Canto-Saenz, 1983).


The experiments were based on the complete block designs with 20 treatments, tomato

cultivars and 4 replicates each. Average mean comparisons were performed based on Duncan

tests. Statistical analysis of variance was done with MSTATC computer software (SAS In-

stitute. 1996).

RESULTS

Evaluation of tomato cultivars reaction to nematode in greenhouse conditions

The means of gall indexes, nematode populations, reproduction factors, root and stem

weights of the 20 tomato cultivars to the root knot nematodes have been presented in table1and 2,

along with the means of statistical grouping, based on Duncan tests.

The means of gall indexes showed 9 different significant groups. Variations in gall indexes

were between 2 (cultivar No. 134) to 5 (control). Dornus X New gaeker and cultivars No. 20, 14,

109 and 178 had gall indexes of 2.5, 2.75, 2, 2.25 and 2.75, respectively. Control cultivar had gall

index 5 (Table 1). Cormello T.M.V.F.N.S. X Tina, Delta X Chef, Delta X Chef and 140 had gall

indexes of over 4. So, these results indicating that, these cultivars are susceptible to the root knot

nematodes in these experiments (Table1).

The nematode populations in the roots and related soils of the 20 tomato cultivar were di-

vided into the six distinct and significant statistical groups. Cultivar No. 100 had the least egg and

second stage of larvae populations. Delta X Chef cultivar had the maximum No. of eggs and second

stage larvae populations. Delta X Chef and Cormellxo T.M.V.F.N.S. X Tina had more nematode

populations in comparison to control treatments (Table1). Means of nematode reproductions also,

showed five significant statistical groups. Cultivar No. 100, Dornus X New gaeker, cultivar No.

136 and Dornus X New gaeker had RF 0.97, 2.32, 4.68 and 4.96, respectively. Cultivar No. 100

had RF <1. This scale in Delta X Chef, Cormello T.M.V.F.N.S. X Tina and cultivar No. 140 was

more than control treatment. So, these results showed that, these cultivars are highly susceptible

to these nematodes.

Means of root weights showed six variable and different statistical groups. Control and

cultivar No. 182, 26 had the most root weights respectively. Whereas, the means of stem weights


divided the cultivars into eight distinct and significantly different statistical groups. Cultivars No.

182, 27 and 136 had the maximum stem weights respectively (Table1).

Evaluation of tomato cultivars reaction to nematode in infested fields

Gall indexes, nematode populations per root and soil and reproduction factors of 20 tomato

cultivars with the treatments and replications in the field have already been summarized in table

2. Variance analysis showed that, here also the tomato cultivars are significantly different. And,

there are differences when, the cultivars are compared with each others and or with the controls.

Mean comparison of the gall indexes, nematode populations per root and soil and reproduction

factors of the tomato cultivars root and statistical grouping of the means are also presented, based

on Duncan tests. Here, the mean comparison of the gall indexes showed nine different group and

the range of variations in the gall index was 1.6 (cultivar No. 109) and 4.25 (control). Cultivar No.

109 and 136 had the least gall index, 1.6 and 1.9 respectively, whereas control had gall index 4.25

(Table 2).

Mean comparison of reproduction factors showed 4 different and significant groups. Cul-

tivar No. 136 and 26 had the least reproduction factors in comparison to control which had the

most reproduction factors (Table 2).

Reaction of the cultivar No. 100, 136 and 109 in greenhouse and field conditions show

that, the cultivar No. 100 was highly susceptible in greenhouse and susceptible in field. Cultivar

No. 136 was tolerance in greenhouse and field. Cultivar No. 109 was susceptible in greenhouse

and tolerance in field.

DISCUSSION

Resistance in tomato cultivars to root-knot nematodes has the same genetic origins and is

controlled by a dominant gene, Mi, which located on the chromosome No. 6 (Harada, 1996; Gilbert

and McGurive, 1956; Liharska, 1998). This gene was transferred from the wild tomato (L. peruvianum)

to some commercial cultivars, and it can be used efficiently against M. incognita, M .arenaria and

M. javanica (Canto-Saenz, 1983; Canto-Saenz, 1985, Fassuliotis, 1979). In this study, without

considering, Mi genes in view, the reactions of 19 tomato cultivars were evaluated against M. ja-vanica in which, the different characters, such as the potentiality of the reproduction factors were

taken into accounts by several workers (Khan and Khan, 1991; Oostenbrink, 1966). Here also, the

potentiality of the reproduction factors in the tomato cultivars were compared with the potentiality

of the reproduction factors in susceptible ones (Taylor, 1967) and also, egg mass indexes and or

gall indexes (Taylor and Sasser, 1978), complexes of nematode reproductions and crop losses were

taken into considerations (Canto-Saenz 1983; Castagnon-Sereno et al., 1994) . Based on recent

factors in greenhouse tests, about 85% of the cultivars were susceptible to nematode with GI > 2

and R > 1 indexes. Cultivar No.136 with GI= 2 and R= 4.68 was tolerant and cultivar No. 100

with GI= 3.25 and R= 0.97 was hypersensitive. In this cultivar RF < 1 and GI >2, indicating that,

the nematode arrives to the tomato root system, but the resistance of the host prevents the repro-

ductively of the nematodes. Cultivar No. 109 (wild tomato) was comparatively tolerant (Table 1).

Cultivars 136 and 109 were introduced tolerant cultivar in the field conditions. About 85-90% of

the tomato cultivars were susceptible to M. javanica, which is unlike the Akhiyani’s report, that

they were tolerant and resistant cultivars. Probably different factors had already interfered in this

case. Nematode populations influenced the decrease in resistance of the tomato cultivars to root

knot nematodes. Economic threshold level of root knot nematode is 0.005-2 egg and larvae per gr

of soil (Araujo et al., 1982; Barker, 1976; Ferris, 1978). In the field experiments, the limitations

to select the nematode infested soil could be a factor, because the initial population's density of

nematode was 30 eggs and larvae per gr soil. Therefore, reproduction in the large scale caused the


breaking of the resistance in some cultivars. Cultivar No. 109 was susceptible in greenhouse and

tolerant in the field conditions. This cultivar is a wild one, and it grows with a well developed root

in the field. So, this character having a great affect on the reaction of this cultivar (Hashemi and

Winstead, 1959).

Cultivar No. 136, which was tolerant to M. javanica in the field and greenhouse conditions,

could be planted in some regions where, the temperatures reach to and or below 28°C. Usually, in

these regions tomatoes are planted in winter and fall where, the temperatures are less than 28°C

(Araujo, et al., 1982; Dropkin, 1969; Netscher, 1977). Cultivar No. 136 can be introduced as a tol-

erant cultivar.

Involving mechanisms in resistant plants could be the production of toxic from the root ex-

udates, the lack of an attractant or the hatching factor in the exudates, a barrier for penetration or

the failure of nematodes to develop within plant tissues, the production of lignin and synthesis

toxin including phytoalexines (Jenkins and Taylor, 1967; Favery et al., 2001; Jaubert et al., 2002).

Ascorbic acid is generally considered to provide resistance in plants to various pathogens.

Low levels of ascorbic acid in tomato cultivars were associated with their susceptibility to M.incognita attack. The results showed that, ascorbic acid increase production of hydroxy prolin

which lead to increase activity of resistant respiratory Cyanide (Arrigoni et al., 1979; Brueske,

1980). All evidences have shown that, the root cells of resistant plant react against nematode via

increase in NADPH oxidase activity. The production of superoxidase in plant cells directly or in-

directly may cause the death in hypersensitive cells and as a subsequent to these reactions, establish

resistance in plants. Previous studies have indicated that, respiratory resistant cyanide and super-

oxidase induce the phytoalexin synthesis, then establish resistance in plant during infection process

(Favery et al., 2001; Semblat et al., 2001; Semblat and Castagnone-Sereno, 2001).

Literature Cited

Akhiyani, A., 1981. Studies on the root-knot nematode. Annul Report of Plant Pests and Diseases

Research Division of Esfahan Agricultural Research Center. 110-120.

Akhiyani, A., Bagheri, F. and Ahmadi, A.R. 1992. Distribution and identification of root knot

Nematodes in Tomato and Brinjal Fields of Hormozgan Province. Proc. 1 st. Vegetable Research

Seminar, Karaj, Iran: 7-8.

Akhiyani, A., Akhiyani, A., Mojtahedi. H. and Naderi, A. 1984. Speceis and physiological races

of root-knot nematodes in Iran. Iran. J. Plant Pathol. 20: 57-71.

Araujo, M. T., Dickson, D. W., Augustine, J. J. and Bassett, M. J. 1982. Optimum initial inoculum

levels for evaluation of resistance in tomato to Meloidogyne spp. at two different soil temperatures.

J. Nematol. 14: 536-540.

Barker, K. R., Shoemaker, P. B. and Nelson, L. A. 1976. Relationships of initial population densities

of Meloidogyne incognita and Meloidogyne hapla to yield of tomato. J. Nematol. 8: 282.

Brueske, G. H. 1980. Phenlalanine ammonia lyase activity in tomato root infected and resistant to

the root-knot nematode, Meloidogyne incognita. Physiol. Plant Pathol. 16: 409-414.

Canto-Saenz, M. 1983. The nature of resistance to Meloidogyne incognita (Kofoid & White, 1919)

Chitwood. 1949, PP. 160, In proc. Third Res.& Plann. Conf. On Root-Knot Nematodes,

Meloidogyne spp., March 22-26, 1982, ed C.C. Carter. International Meloidogyne Project,

Lima, Peru. 233. Be corrected.

Canto-Saenz, M. 1985. The nature of resistance to Meloidogyne incognita (Kofoid & White, 1919)

Chitwood. 1949, PP. 225-231, In J. N. Sasser and C. C. Carter(eds.). An. Advanced Treatise

on Meloidogyne Vol.1 Biology and Control. North Carolina State University Graphics.

Raleigh, North Carolina. Be corrected.

Castagnon-Sereno, P., Bangiovanni, M. and Dalmasso, A. 1994. Reproduction of virulent isolates


of Meloidogye incognita on susceptible and Mi-resistant tomato. J. Nematol. 26: 324-328.

Dropkin, V. 1969. The necrotic of tomato and other plants resistant to Meloidogyne reversed by

temperature. Phytopathol. 59: 1632-1637.

Fassuliotis, G. 1979. Plant breeding for root-knot nematode resistance. PP. 425-453, In F. Lamberti

and C. E. Taylor (eds.). Root-knot nematodes (Meloidogyne species). Systemics, biology

and control. Academic Press. New York. USA. Be corrected

Favery, B., Ryan, E., Foreman, J., Linstead, P., Boudonck, K., Shaw, P., Steer, M. and Dolan, L. 2001.

KOJAK is a cellulose synthase-like gene required for root hair cell morphogenesis in Arabidopsis.

Genes Dev. 15: 79-89. Be Corrected

Ferris, H. 1978. Development of nematode damage functions and economic threshold using

Meloidogyne incognita on tomatoes and sweet potatoes. J. Nematol. 10: 286-287.

Gilbert, J. C. and Mcguire, D. C. 1956. Inheritance of resistance to severe root-knot from Meloidogyneincognita in commertial type tomatoes. Proc. Am. Soc. Hort. Sci. 68: 437-442.

Harada, S., Nakata, K., Tanaka, H., Ishiguro, Y., Ito, T., and Takagi, M. 1996. PCR- based selection

for the root—knot nematode resistance in tomato. Breeding Science. 46: 133-136.

Hashemi, S.R.D. and Winstead, N.M. 1959. Studies on resistance in tomato to root-knot nematodes

and/or the occurrence of pathogenic biotypes. Phytopathol. 49: 716- 724.

Janar Dhanan, K. 2002. Diseases of major medicinal plants. Daya Publishing House. Delhi. 202 pp.

Jaubert, S., Ledger, T.N., Piotte, C., Abad, P., and Rosso, M.N. 2002. Direct identification of stylet

secreted proteins from root-knot nematodes by a proteomic approach. Molecular and Biochemical

Parasitology, 121, 205-211.

Kaur, S., Padmanabhan, S. Y. and Kaur, P. 1994. Screening of some F1 hybrids of tomato against

root-knot nematode, Meloidogyne incognita. Pest management and Economic Zoology. 2: 95-96.

Khan, A.A. and Khan M.W. 1991. Response of tomato cultigens to Meloidogyne javanica and

races of Meloidogyne incognita. J. Nematol. 45: 598-603.

Liharska, T.B. 1998. Genetic and molecular analysis of the tomato root-knot nematode resistance

Locas Mi-1. Wageningen Agricultural University, Wageningen, the Netherlands: 95 P.

Mehdikhani, E., Kheiri, A., Eshtiaghi, H. and Okhovvat, M. 2003. Three new records of Meloidogyne

species for Iran. J. Plant Pathol. 39: 69-71.

Mojtahedi, H. and Santo, G.S. 1994. A new host of Meloidogyne chitwoodi from California. Plant

Dis. 18: 1010(Abstr.).

Mortazavi Bac, A. 1992. Resistance sources of tomato varieties to root- knot nematodes in Iran.

Proc.1 st. Vegetable Research Seminar, Karaj, Iran:4.

Netscher, C. 1977. Observation and preliminary studies on the occurrence of resistance breaking

biotypes of Meloidogyne spp. on tomato. Cah ORSTOM Ser. Biol. 11: 173-178.

Oostenbrink, M. 1966. Major characteristics of the relation between nematodes and plants. Medd.

Land Bouwhogesch. Wageningen. 66: 4(Abstr).

Prasad, S.K. and Das Gupta, D.R. 1964. Varietal susceptibility of commercial tomatoes to the

attack of root-knot nematodes, Meloidogyne spp. Indian Journal of Entomology, 26(2):235238.

Rao, V.R. and Tikoo, S.K. 1975. Resistance of tomato cultivars to the root-knot nematode,

Meloidogyne incognita. Current Science 44(8): 282 - 283.

Razaz Hashemi, S.R. 2005. Identification of root-knot nematode from Calendula medicinal plant.

Proc. National Congress in Sustainable Development of Medicinal Plants. 271-272.

Razzaz Hashemi, S.R. 2006. Identification of main parasitic nematodes in Ricinus medicinal plant

in Qazvin Province. Proc. 17 th. Plant Prot. Cong. 276.

SAS Institute. 1996. SAS/STAT user’s guide. Ver.6.4. SAS Inc. Cary, NC.

Semblat, J.P. and Castagnone-Sereno, P. 2001. Lack of correlation between (a) virulence and phylogenetic

relationships in root-knot nematodes (Meloidogyne spp.) as inferred from RAPD and AFLP

analysis. Genet. Sci. Evol. 33: 545-557.


Singh, B. and Choudhury, B. 1974. Screening tomato cultivars for resistance to Meloidogynespecies. Pest Articles and News Summaries 20(3):3l9-322.

Taylor, A. L. 1967. Introduction to research on plant nematology. FAO. UN, Pub. No. PL: CP/5.

Taylor, A.L. and Sasser, J.N.1978. Biology, identification and control of root – knot nematodes

(Meloidogne spp.) IMP Publication, Raleigh, North Carolina.

Vito, N.D. and Lamberti, F.1976. Reaction of tomato varieties to populations of Meloidogyne spp.

in the glass-house. Nematologia Mediterranea. 4(2): 21l-2l5.


Table 1. Means of gall index, nematode population, reproduction factor of M. javanica, root and stem weight of

tomato in greenhouse conditions

Tables

Treatment1 Gall index Nematode popula-

tion per g. of root

& soil

Reproduction

factor2

Stem

weight (g)

Root

weight (g)

Reaction

Ricraude X SP-100

Delta X Chef

Delta X Chef

Cormello T.M.V.F.N.S.X Tina

SP-100 X Castlerd (1-13)

Delta X Chef

Dornus X New geaker

Dornus X New geaker

Dornus X New geaker

20

26

66

100

136

140

170

109

178

182

Control

3.75abcde3

4.75ab

4.25ab

4.5abc

3.5abcd

3.75abcde

3.5abcde

2.5de

3bcde

2.75cde

3.5abcde

3.75abcde

3.25abcde

2e

4.25abcd

3bcde

2.25e

2.75cde

3.5abcde

5a

234920c

246875c

552257a

537960a

127430d

123951d

24826e

11257e

72743de

67144de

123181d

124168d

4861e

23409e

441927b

93056de

142014d

57625de

265503c

326389c

46.98abc

49.37abc

107.95a

107.59a

25.48c

24.79c

4.96c

2.32c

14.45c

12.93c

14.23c

24.83c

0.97c

4.68c

88.38ab

18.61c

28.4bc

15.12c

53.1abc

65.28abc

43.75de

49cde

46.75cde

60abcde

63.5abcde

64.5abcde

42.75de

43.25de

40.5e

54.25bcde

79.5ab

63.75abcde

58.25abcde

75.5ab

69abc

77ab

71abc

67abcd

83a

67.25abcd

20bc

19.5bc

22.25bc

31ab

14.5c

25.25abc

20.5bc

12.75c

23.5bc

18.25bc

26.75abc

25.5abc

23bc

25.75abc

25.25abc

26abc

22.5bc

17.5bc

31.25ab

29a

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Hypersensetive

Tolerant

Susceptible

Susceptible

Tolerant

Susceptible

Susceptible

Susceptible

1 Data are means of four replicates. 2 Initial population was 500 egg & second stage juveniles.3 Means in columns followed by a similar letter are not significantly different at 5% level by DMRT.

Treatment Gall index Nematode population per g. of

root & soil

Reproduction

factor

Reaction

Ricraude X SP-100

Delta X Chef

Delta X Chef

Cormello T.M.V.F.N.S.X Tina

SP-100 X Castlerd (1-13)

Delta X Chef

Dornus X New geaker

Dornus X New geaker

Dornus X New geaker

20

26

66

100

136

140

170

109

178

182

Control

3.85ab

3.9ab

3.45ab

4.02ab

4.02ab

4.1ab

3.92ab

3.47abc

3.7ab

4.07ab

2.93bcd

4ab

4.02ab

1.9de

4.25a

2.42cde

1.6e

3.52abc

3bc

4.25a

4902cd

8669bcd

7669bcd

15458bcd

21745b

8943bcd

12941bcd

16110bcd

7651bcd

8775bcd

2362cd

8061bcd

9626bcd

1588d

23703bc

5088bcd

3162cd

6171bcd

6703bcd

38583a

163c

289bc

256bc

515bc

724b

248bc

431bc

537bc

255bc

293bc

79c

326bc

321bc

53c

378bc

169c

105c

206c

223c

1286a

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Susceptible

Tolerant

Susceptible

Susceptible

Tolerant

Susceptible

Susceptible

Susceptible

1Data are mean of four replicates. 2 Initial population was 30 egg & larvae per gr. of soil.3 Means in columns followed by a similar letter are not significant at 5% level.

Table 2. Means of gall index, nematode population and reproduction factor of M. javanica in the field conditions.


Variable sources CV SS MS F Prob

Gall index (G.H)

Reproduction factor (G.H)

Nematode. population * (G.H)

Root weight

Stem weight

Gall index (F)

Repro duction factor (F)

(F) Nematode. population

31.37

10.38

89.69

37.83

24.41

20.22

82.76

24.46

50.638

85679.79

215904.6

2755

13358.8

45.19

5789027.7

5893.01

2.665

4509.46

113634.7

145

703.09

2.38

304685.7

31015.1

2.59**

3.16**

3.15**

1.83**

3.16**

4.69**

3.78**

3.25**

0.01

0.0005

0.001

0.042

0.0004

0.005

0.0001

0.0004

G- Green house. F- Field. *- Nematode population per gr. of root & soil.

- The df, for blocks, treatments and the error are the same for all, i.e. 3, 19 and 52 respectively.

**- Significant at 1% level of probability.

Table 3. Analysis of variance of tomato cultivars to root knot nematodes, M javanica.

www.jornamental.com


Effect of Pre-Treated Chemicals on Keeping Quality and

Vase Life of Cut Rose (Rosa hybrida cv.‘ Yellow Island’)

Nanosilver of nanometer-sized silver (Ag+) particles (2-5 nm diam) are

used in various applications as an anti-microbial. Boric acid (H3BO3) is water

soluble (pH=7). Boric acid is ethylene synthese inhibitor and reduce ethylene

production through reducing the ACC synthase and ACC oxidase delays

senescence of flower. In this study of different concentrations of boric acid

and nano-silver was evaluated and vase life, fresh weight loss, flower opening

index and the number of bacteria in preservative solution were measured. The

highest cut rose flower ‘Yellow Island’ longevity was obtained in pulse-treated

flowers with 100 mg l-1 boric acid (4 days).

Keywords: Boric acid, Nanosilver, Rose, Senescence, Vase life.

M. B. Hoseinzadeh Liavali1* and M. Zarchini2

1Department of Horticultural Science, Rasht Branch, Islamic Azad University, Rasht, Iran.2Young Researchers Club, Rasht Branch, Islamic Azad University, Rasht, Iran.


Abstract


INTRODUCTION

Rose (Rosa hybrida L.) (Rosaceae) is the most exports of the cut flowers in the worlds

(Chamani et al., 2004). A major from of deterioration in cut flowers is the blockage of xylem

vessels by air and microorganisms that cause xylem occlusion (Elgimabi and Ahmed, 2009).

Symptom for end of vase life petal wilting that is more clear in cut rose (Solomos et al.,1997). Hosseina et al., (2005) belived that before senescence in cut roses, abscission and

wilting are two common symptoms. Also, one of most important index for senescence is sig-

nificant reduction in water uptake and fresh weight of petals. Water balance is a major factor

determining quality and longevity of cut flowers. It is influenced by water uptake and tran-

spiration, being the balance between these two processes (Da Silva, 2003). Fructose, glucose

and sucrose were the main soluble carbohydrates in petals and stems of cut roses. Fructose

was the major component in the petals as well as in stems but, generally, its value was higher

than in stems. Sucrose contents in petals and stems were lower than those of glucose (El-

gimabi and Ahmed, 2009). Flower opening in cut roses has also been shown to be dependent

on carbohydrate levels in petals (van Doorn et al., 1991). In senescing petals, carbohydrate

content of petals reduced (Ley-Yee et al., 1992). Ichimura et al., (2003) showed that reduction

in soluble carbohydrate in petals, is more important that stem end blockage in longevity of

cut rose ‘Sonis’.

Nowadays, some of these compounds, such as silver nitrate and silver thiosulfate less

applied because it causes blacking of the flower stem and is dangerous for humans and envi-

ronment (Damunupola and Joyce, 2006). NS is a relatively new antimicrobial compound which

is applied as a pulse and preservative solution treatment for cut flowers (Solgi et al., 2009).

Nanometer-sized silver (Ag+) particles (NS) are considered to more strongly inhibit bacteria and

other microorganisms than Ag in various oxidation states; Ag0, Ag+, Ag2+, Ag3+ (Furno et al.,2004). Boric acid inhibits ethylene production through reducing the ACC synthase and ACC ox-

idase activities. Used to improve vase life of cut flowers carnations, may be a good competitor

as far as price is concerned (Serrano et al., 2001). The present study has investigated the effects

of nano-silver and boric acid on improving the quality and extending the vase life of cut rose

(Rosa hybrida L. cv. ‘Yellow Island’).


Cut roses (Rosa hybrida L. cv. ‘Yellow Island’) were obtained at their optimum de-

velopmental stage. They were immediately stood in buckets and transported to the posthar-

vest laboratory. At the laboratory, stems were re-cut under deionized water to ~50 cm length.

Re-cutting was to ensure no air blockage of the stem end. The flowers were selected for

uniformity of size, color and freedom from any defects. The upper three leaves were retained

on each stem.

The experimental design was a randomized completely blocks design (RCBD) with a

factorial arrangement of treatments containing four boric acid concentrations (0, 100, 200 and

300 mg/L) × four SNP concentrations (0, 5, 10 and 20 mg/L) × three replications × five cut

flowers per treatment. In each experiment, cut rose stems were weighted and pulse-treated for

24 h with 250 mL of preservative solutions (PS) including aforementioned compounds. Then,

cut roses were placed individually into the vases filled with 500 mL of preservative solutions

containing 3% sucrose and 600 mg/L hydroxy quinoline sulfate. Distilled water was used as a

control. The mouths of the vases were covered with a sheet of low density polyethylene film to

minimize evaporation and to prevent contamination. Re-cutting was carried out each four days.

The flowers were kept in a controlled room under the following conditions: 20 ± 2°C, relative

humidity of 60-70%, 12µmol m-2s-1 light intensity (cool white flourescent tubes) and a daily

light period of 12 h.


Vase life

Criterion for the end of vase life was the time that flowers were showing symptoms of petals

wilting or curling. Vase life was the period from the time of putting the cut flowers into the second

preservative solution until the end of vase life.

Fresh weight loss

Loss of fresh weight (ml g-1 F.W.) was calculated by the following equation:

[(initial fresh weight (g) + amount of water uptake (ml)] – [(final fresh weight (g) + weight

of recuts (g)].

Flower opening index

Flower opening was calculated in stage four by digital caliper. For this purpose, the biggest

flower diameter plus vertical diameter was calculated and their mean was obtained. Then, flower

opening index was calculated from the following formula: (stage 4/stage 3) + (stage 3/stage 2) +

(stage 2/stage 1).

Bacterial counts

150 μl of pulse solution culture on nutrient agar plates and bacterial colonies were enumer-

ated after incubation for 24 h at 25°C. All bacteria counts were made on triplicate sub-samples.


Data were analyzed by SAS software and means were compared by the Tukey’s test.


Based on analysis of variance, significant (p≤0.01) differences were found among various

concentrations of NS and boric acid in extending vase life, fresh weight loss and the number of

bacteria. NS and boric acid in the preservative solution had a significant (p≤0.05) effect on flower

opening index.

Boric acid at 100 mg/L significantly extended the vase life of cut rose cv. ‘Yellow Island’

(Fig. 1). The NS and boric acid pulse treatment at highest concentration (20 mg/L and 300 mg/L,

respectively) caused the shortest vase life and resulted in a 0.8 day vase life to the control. De-

creasing the vase life of cut flowers held in the highest concentration of NS and boric acid is due

to the toxic effects of these materials. Positive effect of NS on extending of vase life in other

flowers such as rose, gerbera and lily has been demonstrated (Lu et al., 2010; Liu et al., 2009;

Solgi et al., 2009; Kim et al., 2005). Serrano et al., (2001) revealed that a 24-h pulse treatment

with the preservative solution containing 50, 75 or 100 mM boric acid or continuous treatment

with 1 mM boric acid resulted in significantly increasing cut carnation flowers longevity.

In control plants, the reduction of fresh weight is more considerable. The loss fresh weight

is lower in 100 and 200 mg/L boric acid. Interaction between BA and SNP significant on loss of

fresh weight (p≤0.01) and 300 mg/L BA + 10 mg/L SNP had the lowest loss of fresh weight. With

increasing of BA concentration, the loss of fresh weight was slower and 10 mg/L SNP had lower

loss of fresh weight in comparison to 5 and 20 mg/L, SNP reduced stem and blockage ( Fig. 2).

van Doorn (1997) suggested that, loss of fresh weight, is one of the symptoms for scenes-

cence. This feature is more clear in cut rose. Changes in relative fresh weight (RFW) of cut roses

showed similar tends for both control and NS pulse treatments, such that RFW increased until day

3 after harvest and decreased thereafter (Lu et al., 2010).

The lowest rate opening of flowers was showed is control flowers. The most important rea-

son for senescence of flowers before full blooming, was ethylene. The highest rate of flower open-

ing was observed in 100 mg/L BA. Effect of SNP not significant on this (Fig. 3). Totally, full


blooming of cut flowers needs to carbohydrates to water uptake and turgidity of cells, increasing

of carbohydrate to preservative solutions, improved water uptake and flower blooming and delayed

senescence.

Since flower opening is a process which needs ATP and the required ATP should be pro-

duced through respiration; therefore, each factor that reduced the plant respiration, can delay the

flower opening process (Hashemabadi and Mostofi, 2007).

Numbers of bacteria on the pulse solution decreased significantly with increasing of NS

and boric acid concentration. There were significant differences in numbers of bacteria on the so-

lution between the 20 mg/L NS along with 300 mg/L boric acid pulse treatment and the control

for the duration of assessment.

The highest concentration of NS and boric acid is due to the toxic effects of these materials.

It is important to note that in pulse-treated flowers with the preservative solutions containing NS

and boric acid, vase life was not increased in line with increasing the boric acid and NS concen-

trations (Fig. 4).

Liu et al. (2009) demonstrated that NS inhibited bacteria growth for the first 2 d of vase

life in stem ends of cut gerbera. Ag+ concentrations in tissues rose with an increase in NS concen-

tration in the pulse solution. Ag+ concentrations of basal stem ends were generally higher than

those of upper stem ends, leaves and petals (Lu et al., 2010).

ACKNOWLEDGEMENTS

The authors would like to thank the Islamic Azad University, Rasht Branch, especially Dr.

Amirteimouri for their financial supports.

Litrature Cited

Chamani, E., Khlighi, A., Joyce, D., Irving, D., Zamani, Z., Mostofi, Y. and Kafi, M. 2004. Effect

of silver thiosulfate and 1- methylcyclopropene on physicochemical characteristics of ‘First

Red’ rose cut flowers. (In Persian).

Damunupola, J.W. and Joyce, D.C. 2006. When is a vase life solution biocide not, or not only,

antimicrobial?// J. Jpn. Soc. Hortic. Sci. Vol. 77. P. 1-18.

Da Silva, J. A. T. 2003. The cut flower: Postharvest considerations. Online J. Biol. Sci. 3: 406-442.

Elgimabi, M. N. and Ahmed, O. K. 2009. Effects of bactericides and sucrose-pulsing on vase life

of rosa cut flower ( Rosa hybrida ). Botany Research International. 2(3): 164-168.

Furno, F., Morley, K.S., Wong, B., Sharp, B.L., Arnold, P.L., Howdle, S. M., Bayston, R., Brown,

P.D., Winship, P.D. and Reid, H.J. 2004. Silver nanoparticles and polymeric medical devices,

a new approach to prevention of infection? J. Antimicrob. Chemother. 54: 1019-1024.

Hashemabadi, D. and Mostofi, Y. 2007. Determination of optimum concentration and treatment

time of 1-MCP (1- methylcyclopropene) on vase life of cut carnation ‘Tempo’. Acta Hort.

755. 297-303.

Hossaina, Z., Kalam, A., Mandala, A., Kumar, S., Dattaa, A. and Krishna, B. 2005. Decline in

ascorbate peroxidase activity- prerequisite factor for tepal senescence in Gladiolus. Journal

of Plant Physiology. 163: 186- 194.

Ichimura, K., Kaeabata, Y., Kishimato, M., Goto, R. and Yamada, K. 2003. Shortage of soluble

carbohydrates is largely responsible for about vase life at ‘Sonia’ rose flowers. J. JP. Soc.

Hort. Sci. 72: 292-298.

Kim,J.H., Lee, A.K. and Suh, J.K. 2005. Effect of certain pre-treatment substances on vase life

and physiological character in Lilium spp. Acta Hort. 673: 307-314.

Ley-Yee, M., Stead, A.D. and Reid M.S. 1992. Flower senescence in daylily (Hemerocallis). Physiol.

Plant. 86: 308-314.

Liu, J., He, S., Zhang, Z., Cao, J., Petaio, L.V., He, S., Cheng, G. and Joyce, D. C. 2009. Nano- silver


pulse treatments inhibit stem-end bacteria on cut gerbera cv. Ruikou flowers. Postharvest


Lu, P., Cao, J., He, S., Liu, J., Li, H., Cheng, G., Ding, Y. and Joyce, D. C. 2010. Nano-silver pulse

treatments improve water relations of cut rosa cv.‘Movie Star’ flowers. Postharvest Biology

and Technology. 57: 196-202.

Serrano, M., Amoros, A., Teresa, P. M., Concepcion Martinez-Madrid, M. and Romoj, F. 2001.

Preservative solutions containing boric acid delay senescence of carnation flowers. Postharvest


Solgi, M., Kafi, M., Taghavi, T. S. and Naderi, R. 2009. Essential oils and silver nanoparticles

(SNP) as novel agents to extend vase life of gerbera (Gerbera jamesonii cv. ‘Dune’) flowers.

Postharvest Biology and Technology. 53: 155-158.

Solomos, T. and Gross, K.C. 1997. Effects of hypoxia on respiration and the onset of senescence

in cut carnation flower (Dianthus caryophyllus L.). Postharvest Biol. Technol. 10: 145- 153.

van Doorn, W. G. 1997. Water relations of cut flowers. Hort. Rev. 18: 1-85.

van Doorn, W.G., Groenewegen, G., Van de Pol, P.A. and Berkholst, C.E.M. 1991. Effects of

carbohydrate and water status on flower opening of cut madelon roses. Postharvest Biol.

Technol. 1: 47-57.


Table 1. Mean comparison of single different concentrations of boric acid and nanosilver on measured

characteristics.

In each column means followed by the same letters are not significantly different at 5 % level of probability

using DMRT.

Tables

Treatments Vase life

(day)

Fresh weight loss

(g)

Flower opening

index

The number of solution bacteria

(Log10 (CFU) ml-1)

B0 (0 mg l-1)

B1 (100 mg l-1)

B2 (200 mg l-1)

B3 (300 mg l-1)

N0 (0 mg l-1)

N1 (5 mg l-1)

N2 (10 mg l-1)

N3 (20 mg l-1)

7.25ab

8.53a

7.02b

7.10ab

8.17a

7.10b

7.62ab

7.01b

4.41a

3.92ab

3.76ab

3.75b

3.40c

4.11ab

3.95b

4.39a

1.09b

2.04a

1.95ab

1.94ab

2.04a

1.91a

1.96a

1.93a

1.25a

1.18a

0.87b

0.81b

1.81a

1.05b

0.82b

0.42c


Figures

Fig. 1. Intraction boric acid and nanosilver on the vase life of cut rose cv. ‘Yellow Island’.

Fig. 2. Intraction boric acid and nanosilver on the fresh weight loss of cut rose cv. ‘Yellow Island’.

Fig. 3. Intraction boric acid and nanosilver on the flower opening index of cut rose cv. ‘Yellow Island’.


Fig. 4. Intraction boric acid and nanosilver on the number of solution bacteria of cut rose cv. ‘Yellow Island’.


Evaluation of Antipyretic Activity of Pedalium murexAgainst Brewer’s Yeast-Induced Pyrexia in Rats

The aqueous and ethanolic extracts of Pedalium murex (Pedaliaceae)

was investigated for antipyretic activity in rats using Brewer’s yeast-induced

pyrexia models. Brewer’s yeast (15%) was used to induce pyrexia in rats. Both

the extract (200 and 400 mg/kg body weight p.o produced a significant

(p<0.05) dose dependent inhibition of temperature elevation compared with

the standard drug Paracetamol (150mg/kg body weight). At doses of 200

mg/kg b.w, the aqueous extract significantly (P<0.001) decreased yeast induced

pyrexia in rats. These results indicate that leaf extracts of Pedalium murex

possesses potent antipyretic effects and thus pharmacologically justifying its

folkloric use in the management of fever.

Keywords: Acute toxicity, Antipyretic, Brewer’s yeast, Prostaglandin, Pedalium murex.

V. Siva1, N.J. Jeffrey Bose1, P. Mehalingam1* and A. Thanga Thirupathi2

1Research Department of Botany, V.H.N.Senthikumara Nadar College, Virudhunagar, Tamil Nadu,

India. Phone: 04562-280154 Fax: 04562-281338.2Department of Pharmacology, SankaralingamBhuvaneswari College of Pharmacy, Sivakasi, Tamil

Nadu, India.


Abstract


INTRODUCTION

Herbal medicines are assumed to be of great importance in the primary health care of indi-

vidual and communities (Sheldon et al., 1997). The World Health Organization has estimated that

80% of the population of developing countries still relies on traditional medicines, mostly plant

drugs, for the primary health care needs. The high degree of efficacy and safety with herbal med-

icines make them more acceptable compared to other therapeutic invention (Chaturvedi et al.,2007). Plant-based traditional knowledge has become a recognized tool in search for new sources

of drugs and neutraceuticals (Ghosh, 2003; Sharma and Mujundar, 2003)

Pedalium murex Linn. (Pedaliaceae) is a diffuse, more or less succulent herb found near

the coastal area of South India (Nadkarani, 1982). Mucilage obtained from leaves, stem as well as

fruits is used to treat gonorrhea (Mhaskar et al., 2000). An infusion or extract prepared from leaves

have diuretic and demulcent properties and also useful in treating disorders of the urinary system

such as odour urine, dysuria, spermatorrhoea and incontinence of urine. As an emmenagogue, the

juice is used in puerperal diseases and also to promote lochial discharge (Chopra et al., 1996). The

mucilage from leaves and young shoots is used as an aphrodisiac in seminal debility (Shukla and

Khanuja, 2004). The aqueous extract of the whole plant has been found to possess analgesic and

anti-inflammatory properties (Muralidharan and Balamurugan, 2008). Pedalium murex is rich in

mucilage (Kirtikar and Basu, 1987), flavonoids (Harborne et al., 1999) and saponin glycosides

(Bhakuni et al., 1992). Extensive phytochemical investigations on the plant have revealed the

presence of Pedalitin and Pedalin (major flavonoids) along with Diosmetin, Dinatin, Dinatin-7-

glucoronide, Quercetin, Quercimeritin and Quercetin-7- glucorhamnoside (Subramanian and Nair,

1972). Triterpenoids such as α amyrin acetate are also reported (Prasad and Thakur, 1983). Steroids

such as β sitosterol (Shukla and Khanuja, 2004), sapogenins (Harvey, 1967) and diosgenin (Mangle

and Jolley, 1998) have also been reported. Lipids (Bhakuni et al., 1992), phenolic acids such as

caffeic acid, ferulic acid, protocathechic acid and vanillic acid (Shukla and Khanuja, 2004) and

amino acids such as aspartic acid, glutamic acid and histidine are other phytoconstituents present

in Pedalium murex (Rastogi et al., 1982).

Fever or pyrexia is the body’s response to the presence of external or internal pyrogen (or-

ganisms causing fever). Pyrexia is caused as a secondary impact of infection, tissue damage, in-

flammation, graft rejection, malignancy or other diseased states. It is the body’s natural defense to

create an environment where infectious agent or damaged tissue cannot survive. Normally the in-

fected or damaged tissue initiates the enhanced formation of pro-inflammatory mediator’s (cy-

tokines like interleukin 1β, α, β and TNF-α), which increase the synthesis of prostaglandin E2 near

preoptic hypothalamus area and thereby triggering the hypothalamus to elevate the body temper-

ature. As the temperature regulatory system is governed by a nervous feedback mechanism, so

when body temperature becomes very high, it dilate the blood vessels and increase sweating to re-

duce the temperature; but when the body temperature becomes very low hypothalamus protect the

internal temperature by vasoconstriction (Chattopadhyay et al., 2005).

The principle rationale behind the use of this plant for the study of antipyretic effects is

that the tribal community of Kumaragiri hills of Salem district of Tamil Nadu has been using the

leaf extract for fever (Alagesboobathy, 2009). However, there is not enough scientific report to

support these supposed antipyretic activities. This has promoted us to study the antipyretic effect

of leaves extract of Pedalium murex to ascertain the authenticity of these important claims of tra-

ditional potency.


Plant Material

The plant specimen used for the study was collected from their natural habitat in Virudhu-

nagar district, Tamil Nadu, India. The identity of the specimen was confirmed as Pedalium murex


using the local flora (Gamble, 1936). A voucher specimen (VHNSNCH A152) was deposited in

the Research Department of Botany, V.H.N.Senthikumara Nadar College, Virudhunagar.

Chemical and drugs

All other chemicals and reagents were procured from authorized suppliers and of analytical

grades.

Preparation of the extract

The fresh leaves of plant were taken and air dried in shade for ten days. Dried materials

were blended into fine powder and extracted by continuous hot extraction process using Soxhlet

apparatus not exceeding 60°C by ethanol. The marc was then extracted with distilled water to ob-

tain aqueous extract. All the extracts were dried at 45°C in rotary evaporator to produce a semisolid

mass. The dried extract was stored at 4°C until use. The aqueous and ethanol extract were dissolved

in normal saline.

Phytochemical analysis

The plant extract was subjected to phytochemical screening through qualitative chemical

analysis for confirmation of the phytoconstituents (Kokate et al., 2004; Odebiyi and Sofowora,

1979).

Animals

In-bred Wistar albino rats weighing 150-200g were procured from the animal house of the

Sangaralingam Bhuvaneswari College of Pharmacy, Sivakasi, Tamil Nadu, India. The animals

were grouped and housed in sanitized polypropylene cages (38 × 23 ×10) containing sterile paddy

husk as bedding with not more than six animals per cage and maintained under standard laboratory

conditions (temperature 25 ± 2°C; RH 60-70% ) with dark and light cycle (12/12 h). The animals

were fed with standard pellet diet supplied by VRK Nutritional Solution, Pune, India and fresh

water ad libitum. All the animals were acclimatized to laboratory condition for a week before com-

mencement of experiment to minimize if any of non-specific stress. All procedures described were

reviewed and approved by the Institutional Animal Ethical Committee of the Sangaralingam Bhu-

vaneswari College of Pharmacy, Sivakasi, Tamil Nadu, India. (Reg. No: 622/02/C/CPCSEA). All

studies were performed in accordance with the guidelines for the care and use of laboratory ani-

mals, as adopted and promulgated by the Institutional Animal Care Committee, CPCSEA, New

Delhi, India.

Acute toxicity study

Albino rats weighting 150-200 g selected by random sampling were used in this study.

Acute oral toxicity was performed as per OECD-423 guidelines (Ecobichon, 1997). The animals

were fasted overnight, provided only with water. Both the aqueous and ethanolic plant extract was

administered orally at the dose level of 5mg/kg body weight by gastric intubations and the drug

treated groups (4 animals each) were observed for 14 days. If mortality was observed in 2 or 3 an-

imals, then the dose administered was identified as a toxic dose. If mortality was observed in one

animal then the same dose was repeated again to confirm the toxic dose. If mortality was not ob-

served, the procedure was repeated for further higher doses such as 50, 300 and 2000 mg/kg body

weight. The animals were observed for toxic symptoms such as behavioral changes, locomotion,

convulsions and mortality for 72 h.

Anti-pyretic activity

Anti-pyretic activity of Pedalium murex was evaluated using Brewer’s yeast-induced


pyrexia in rats (Loux et al., 1972). Rats were weighed and randomized into six groups of four rats

per group. The baseline body temperatures of the rats were taken by inserting a digital tele-ther-

mometer into their anal cavities for about 2 min. The steady temperature readings obtained were

recorded as the pre-temperatures. Pyrexia was induced in the rats by administering 1 ml/kg b.w of

15% aqueous suspension of Brewer’s yeast in normal saline subcutaneously into the animal’s dor-

sum region and 18 h later of yeast administration, the anal temperatures were measured again.

Rats that did not show a minimum increase of 0.5°C were discarded from the study (Mukherjee etal., 2002). Twenty four rats selected were grouped into six groups and treated as follows: Normal

saline 10 ml/kg b.w were administered to group I, while group II were treated with Paraceta-

mol150mg/kg/b.w. Group III and IV were treated with aqueous extract of leaves of Pedalium murex

(200 mg and 400 mg/kg b.w respectively) and group V and VI were treated with ethanolic extract

of leaves of Pedalium murex (200 mg and 400 mg/kg b.w respectively). All the treatments were

administered orally. Anal temperature was then measured after every sixty minutes interval of drug

administration for each rat up to 4 h.


Results were expressed as Mean ± Standard Error of Mean (SEM). The statistical signifi-

cance of differences between groups was analyzed using student’s t-test. Differences of p<0.05

were considered statistically significant.

RESULTS

Phytochemical screening

The aqueous and ethanolic extract of Pedalium murex were subjected to preliminary phy-

tochemical screening revealed the presence of alkaloids, flavonoids, steroids, coumarins, phenols,

saponins, tannins and sugars. (Table1).

Acute oral toxicity study

Both the plant extracts produced no toxic symptoms or mortality up to a dose level of 2000

mg/kg body weight orally in rats, and hence the drug was considered safe for further pharmaco-

logical screening. So 1/10th and 1/5th (200mg and 400mg respectively) of that were selected for

all in vivo experiments as sub maximal and maximal dose.

The percentage yield of the aqueous and ethanolic extract was 5.9% and 3.7% respectively.

Antipyretic study

The effect of aqueous and ethanolic extract of leaves of plant Pedalium murex on Brewer’s

yeast induced pyrexia in rats are depicted (Table 2). Pedalium murex leaf extract produced signif-

icant (P<0.05) antipyretic effect in a dose dependent manner. Both the extract significantly reversed

hyperthermia at either dose (200 & 400 mg/kg body weight). Time of peak effect was obtained

from 2 to 4 h after oral administration of test drugs. The standard drug, Paracetamol suppressed

hyperthermia induced by yeast significantly (p<0.01) during all the observation times when com-

pared with normal saline treated groups. 200 mg/kg of body weight aqueous extract showed ex-

tremely statistically significant (p<0.001) from first hour and extended up to fourth hour after drug

administration and ethanolic extract showed extremely significant (p<0.001) reduction of elevated

body temperature from second hour to consecutive fourth hour. Whereas the normal saline treated

group remained hyperthermia throughout the experimental periods.

DISCUSSION

Search for herbal remedies with potent antipyretic activity received momentum recently

as the available antipyretics, such as Paracetamol, Nimusulide etc. have toxic effect to the various


organs of the body (Guyton and Hall., 1998). The reduction in the Brewer’s yeast induced fever

by the extract in this study suggests some influence on the prostaglandin biosynthesis since it is

believed to be a regulator of body temperature (Dascombe, 1985).

Flavonoids are known to inhibit prostaglandin synthetase (Ramaswamy et al., 1985). The

antipyretic activity observed can be attributed to the presence of flavonoids present in the plant

extracts. Generally, plants showing the antipyretic activity also possess analgesic and anti-inflam-

matory activity (Dewan et al., 2000). In our studies, the plant extract shows significant antipyretic

activity, it may be attributed by its analgesic and anti-inflammatory activity.

CONCLUSION

Therefore, the plant extract of Pedalium murex possesses a significant antipyretic effect in

Brewer’s yeast induced elevation of body temperature in rats. These results support the traditional

use of this plant in fever remedies. However, further studies are necessary to examine underlying

mechanisms of antipyretic activities and to isolate the active compound (s) responsible for these

pharmacological activities.

Acknowledgements

Authors are sincerely thankful to University Grants Commission, New Delhi for providing

financial assistance to carry out this work.

Literature Cited

Alagesboobathy, C. 2009. Ethnomedicinal plants and their utilization by villagers in Kumaragiri

hills of Salem districts of Tamiladu, India. Afr. J. Trad. CAM. 6: 222-227.

Bhakuni, R.S., Shukla, Y.N. and Thakur, R.S. 1992. Flavonoids and other constituents from Pedalium

murex Linn. Phytochemistry 31: 2917-2918.

Chattopadhyay, D., Arunachalam, G., Ghosh, L., Rajendran, K., Mandal, A.B. and Bhattacharya,

S.K. 2005. Antipyretic activity of Alstonia macrophylla Wall ex A. DC: An ethnomedicine

of Andaman Island. J. Pharm. Pharmaceut. Sci. 8:558-564.

Chaturvedi, A., Kumar, M.M., Bhawani, G., Chaturvedi, H., Kumar, M. and Goel, K.R. 2007. Effect

of ethanolic extract of Eugenia jambolana seeds on gastric ulceration and secretion in rats.

Indian J. Physiol. Pharmacol. 51: 131-140.

Chopra, R.N., Nayar, S.L. and Chopra, I.C. 1996. Glossary of Indian medicinal plants. National

Institute of Science Communication (CSIR), New Delhi.

Dascombe, M.J. 1985. The Pharmacology of fever. Progr. Neurobiol. 25: 327-373.

Dewan, S., Kumar, S. and Kumar, V.L. 2000. Antipyretic effect of latex of Calotropis procera. Indian

J. Pharmacol. 32: 252.

Ecobichon, D.J. 1997. The basis of toxicology testing. CRC Press, New York.

Gamble, J.S. 1936. Flora of the presidency of madras. Botanical Survey of India, Calcutta.

Ghosh, A. 2003. Herbal folk remedies of Bankura and Medinipur districts, West Bengal (India).

Indian J. Trad. Knowledge 2: 393-396.

Guyton, A.C. and Hall, J.E. 1998. Textbook of medical physiology. W.B. Saunders Company,

Philadelphia.

Harborne, B.J., Baxter, H. and Moss, P.G. 1999. A handbook of bioactive compounds from plants.

Taylor & Francis Ltd, London.

Harvey, S.K. 1967. A brief comparative pharmacognostic study of certain indigenous drugs. Natural

Medicinal Journal 9: 519.

Kirtikar, K.R. and Basu, B.D. 1987. Indian medicinal plants. International Book Distributors,

Dehradun.

Kokate, C.K., Purohit, A.P. and Gokhale, S.B. 2004. Textbook of pharmacognosy. Nirali Prakasan


Publication, Pune, India.

Loux, J.J., Depalma, P.D. and Yankell, S.L. 1972. Antipyretic testing of aspirin in rats. Toxicol.

Appl. Pharmacol. 22: 672-675.

Mangle, M.S. and Jolley, C.I. 1998. HPTLC studies on Tribulus terrestris (Chota ghokru) and Pedalium

murex (Bada ghokru). Indian Drugs 35: 189-194.

Mhaskar, K.S., Blatter, E. and Caius, J.F. 2000. Kritikar and Basu’s Illustrated Indian Medicinal

Plants, their usage in Ayurveda and Unani medicines. Sri Satguru Publication, Delhi.

Mukherjee, K., Saha, B.P. and Mukherjee, P.K. 2002. Evaluation of antipyretic potential of Leucas

lavandulaefolia (Labiatae) aerial part extract. Phytother. Res. 16:686- 688.

Muralidharan, P. and Balamurugan, G. 2008. Analgesic and anti-inflammatory activities of aqueous

extract of Pedalium murex Linn. Biomedicine 28: 84-87.

Nadkarani, K.M. 1982. Indian materia medica. Popular Prakashan Publications, Bombay.

Odebiyi, O.O. and Sofowora, E.A. 1979. Phytochemical screening of Nigerian medicinal plants.

Lloydia 41: 234-246.

Prasad, T.N.V. and Thakur, R.S. 1983. Heptatriacontan-4-one, tetratriacontanyl octacosanoate and

other constituents from Pedalium murex Linn. Phytochemistry 22: 973-974.

Ramaswamy, S., Pillai, N.P., Gopalkrishnan, V., Parmar, N.S. and Ghosh, M.N. 1985. Analgesic

effect of O (hydroxyl ethyl) rutoside in mice. Indian J. Exp. Biol. 23: 219-220.

Rastogi, J.N., Sharma, O.D. and Loiwal, S.D. 1982. Amino acids in certain medicinal plants. Bull.

Pure Appl. Sci. 1: 11-12.

Sharma, P.P. and Mujundar, A.M. 2003. Traditional knowledge on plants from toranmal plateau

of Maharastra. Indian J. Trad. Knowledge 2: 292-296

Sheldon, J.W., Balick, M.J. and Laird, S.A. 1997. Medicinal plants: can utilization and conservation

coexist? Advances in Economic Botany. Econ. Bot. 12: 1-104.

Shukla, V.N. and Khanuja, S.P.S. 2004. Chemical, pharmacological and botanical studies on Pedalium murex. J. Med. Aromatic Plant Sci. 26: 64-69.

Subramanian, S.S. and Nair, A.G.R. 1972. Flavonoids of the leaves of Pedalium murex Linn.

Phytochemistry 11: 464-465.


Table1. Result of phytochemical constituents analysis of the aqueous and ethanol extract of Pedalium murex.

a (+): Presentb (-): Absent

Tables

Plant Extracts Alkaloids Flavonoids Steroids Coumarins Phenols Saponins Tannins

Aqueous

extract

Ethanolic

extract

+a

+

+

+

+

+

+

+

+

+

+

- b

+

-

Table 2. Anti-pyretic activity of leaf extract of Pedalium murex

a n=4 in each group, b Values are measured mean ± S. E. M and compared with control by Student‘t’ testc*P<0.05, d ** P<0.01e *** P<0.001

Groupa Dose (mg/kg) Pretem-

perature

(°C)

Temp. after

induced

pyrexia (°C)

Temperature after drug administration (°C) (mean ± S. E. M)

I

II

III

IV

V

VI

Saline (10ml/kg)

Paracetamol (150mg/kg)

Aqueous (200mg/kg)

Aqueous (400mg/kg)

Ethanol (200mg/kg)

Ethanol (400mg/kg)

36.38±0.253

35.90±0.082b

35.70±0.135

35.73±0.155

35.85±0.150

36.08±0.229

37.20±0.204

36.95±0.065

36.53±0.095

36.45±0.096

36.85±0.065

36.88±0.278

37.20±0.204

36.95±0.065

36.53±0.095

36.45±0.096

36.85±0.065

36.88±0.278

37.68±0.165

36.23±0.075*** e

36.00±0.071***

35.80±0.292**

36.45±0.087***

36.45±0.185**

37.78±0.165

35.90±0.242***

35.85±0.133***

35.93±0.125***

36.20±0.071***

36.23±0.256**

37.68±0.131

35.75±0.240***

35.73±0.132***

35.70±0.147***

36.00±0.204***

36.20±0.252**

1 hour 2 hours 3 hours 4 hours

www.jornamental.com

www.jornamental.comThe Journal of Ornamental and Horticultural Plants (JOHP), is an open access journal that provides

rapid publication of manuscripts on ornamental and horticultural fields. Journal of Ornamental and

Horticultural Plants (JOHP) is published in English, as a printed journal and in electronic form.

All articles published in Journal of Ornamental and Horticultural Plants (JOHP) are peer-reviewed.

All manuscripts should convey important results that have not been published, nor under consideration

anywhere else. Journal of Ornamental and Horticultural Plants (JOHP) will be available online around

the world free of charge at http://www.jornamental.com. In addition, no page charge are required from

the author(s).The Journal of Ornamental and Horticultural Plants (JOHP) is published quarterly by

Islamic Azad University, Rasht Branch, Rasht, Iran.

Manuscript Submission

Please read the “Instructions to Authors” before submitting your manuscript. Submit manuscripts as

e-mail attachment to Dr. Ali Mohammadi Torkashvand, Executive director of Journal of Ornamental

and Horticultural Plants (JOHP), at [email protected]. Electronic submission of manuscripts

is strongly encouraged, provided that the text, tables, and figures are included in a single Microsoft

Word 2003 file. A manuscript acknowledgment including manuscript number will be emailed to the

corresponding author within 72 hours.

Please do not hesitate to contact meif you have any questions about the journal. We look forward to

your participation in the Journal of Ornamental and Horticultural Plants (JOHP).

Address: Islamic azad University, Rasht Branch

Horticultural Department,

Agriculture Faculty,

Rasht,

Iran.

P.O.Box 41335-3516

Email: [email protected]

URL: http:// www.jornamental.com

Topics and Types of PaperJournal of Ornamental and Horticultural Plants (JOHP) is an international journal to the publication

of original papers and reviews in the horticultural fields. Articles in the journal deal with Floriculture,

Olericulture, Pomology and Landscape. The scope of JOHP includes all horticultural crops even medicinal

plants. The journal is concerned with vegetables, fruits, and ornamental crops, and covers all aspects

of physiology, molecular biology, biotechnology, protected cultivation, and environmental areas of

plants. the journal welcomes the submission of manuscripts that meet the general criteria of significance

and scientific excellence, and will publish:

● Research articles

● Short Communications

● Review

Papers are welcome reporting studies in all aspects of horticultural science including:

Any Novel Approaches Horticulture

Biotechnology

Divers Area of Horticultural Research

Environmental Stress Physiology

Genetices and Breeding

Photosynthesis, Sources-Sink Physiology

Postharvest Biology

Seed Physiology

Soil-Plant-Water Relationships

Modelling

Published by:Islamic Azad University, Rasht Branch, Iran

Vol 2(2), June 2012 - Webs 5/Final - JORNAMEN… · 66 Journal of Ornamental and Horticultural...

Documents

Transcript of Vol 2(2), June 2012 - Webs 5/Final - JORNAMEN… · 66 Journal of Ornamental and Horticultural...