vol 18 8 2014

The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS.

Atlas of Genetics and Cytogenetics in Oncology and Haematology

INIST-CNRS

OPEN ACCESS JOURNAL

Volume 18 - Number 8 August 2014

The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS.


INIST-CNRS

OPEN ACCESS JOURNAL

Scope

The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It presents structured review articles (“cards”) on genes, leukaemias, solid tumours, cancer-prone diseases, and also more traditional review articles (“deep insights”) on the above subjects and on surrounding topics. It also present case reports in hematology and educational items in the various related topics for students in Medicine and in Sciences.

Editorial correspondance

Jean-Loup Huret Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France tel +33 5 49 44 45 46 or +33 5 49 45 47 67 [email protected] or [email protected]

Staff Mohammad Ahmad, Mélanie Arsaban, Marie-Christine Jacquemot-Perbal, Vanessa Le Berre, Anne Malo, Carol Moreau, Catherine Morel-Pair, Laurent Rassinoux, Alain Zasadzinski. Philippe Dessen is the Database Director, and Alain Bernheim the Chairman of the on-line version (Gustave Roussy Institute – Villejuif – France).

The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 12 times a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of the French National Center for Scientific Research (INIST-CNRS) since 2008. The Atlas is hosted by INIST-CNRS (http://www.inist.fr)

http://AtlasGeneticsOncology.org

© ATLAS - ISSN 1768-3262

Atlas Genet Cytogenet Oncol Haematol. 2014 18(8)


INIST-CNRS

OPEN ACCESS JOURNAL

Editor Jean-Loup Huret (Poitiers, France)

Editorial Board Sreeparna Banerjee (Ankara, Turkey) Solid Tumours Section Alessandro Beghini (Milan, Italy) Genes Section Anne von Bergh (Rotterdam, The Netherlands) Genes / Leukaemia Sections Judith Bovée (Leiden, The Netherlands) Solid Tumours Section Vasantha Brito-Babapulle (London, UK) Leukaemia Section Charles Buys (Groningen, The Netherlands) Deep Insights Section Anne Marie Capodano (Marseille, France) Solid Tumours Section Fei Chen (Morgantown, West Virginia) Genes / Deep Insights Sections Antonio Cuneo (Ferrara, Italy) Leukaemia Section Paola Dal Cin (Boston, Massachussetts) Genes / Solid Tumours Section Brigitte Debuire (Villejuif, France) Deep Insights Section François Desangles (Paris, France) Leukaemia / Solid Tumours Sections Enric Domingo-Villanueva (London, UK) Solid Tumours Section Ayse Erson (Ankara, Turkey) Solid Tumours Section Richard Gatti (Los Angeles, California) Cancer-Prone Diseases / Deep Insights Sections Ad Geurts van Kessel (Nijmegen, The Netherlands) Cancer-Prone Diseases Section Oskar Haas (Vienna, Austria) Genes / Leukaemia Sections Anne Hagemeijer (Leuven, Belgium) Deep Insights Section Nyla Heerema (Colombus, Ohio) Leukaemia Section Jim Heighway (Liverpool, UK) Genes / Deep Insights Sections Sakari Knuutila (Helsinki, Finland) Deep Insights Section Lidia Larizza (Milano, Italy) Solid Tumours Section Lisa Lee-Jones (Newcastle, UK) Solid Tumours Section Edmond Ma (Hong Kong, China) Leukaemia Section Roderick McLeod (Braunschweig, Germany) Deep Insights / Education Sections Cristina Mecucci (Perugia, Italy) Genes / Leukaemia Sections Fredrik Mertens (Lund, Sweden) Solid Tumours Section Konstantin Miller (Hannover, Germany) Education Section Felix Mitelman (Lund, Sweden) Deep Insights Section Hossain Mossafa (Cergy Pontoise, France) Leukaemia Section Stefan Nagel (Braunschweig, Germany) Deep Insights / Education Sections Florence Pedeutour (Nice, France) Genes / Solid Tumours Sections Elizabeth Petty (Ann Harbor, Michigan) Deep Insights Section Susana Raimondi (Memphis, Tennesse) Genes / Leukaemia Section Mariano Rocchi (Bari, Italy) Genes Section Alain Sarasin (Villejuif, France) Cancer-Prone Diseases Section Albert Schinzel (Schwerzenbach, Switzerland) Education Section Clelia Storlazzi (Bari, Italy) Genes Section Sabine Strehl (Vienna, Austria) Genes / Leukaemia Sections Nancy Uhrhammer (Clermont Ferrand, France) Genes / Cancer-Prone Diseases Sections Dan Van Dyke (Rochester, Minnesota) Education Section Roberta Vanni (Montserrato, Italy) Solid Tumours Section Franck Viguié (Paris, France) Leukaemia Section José Luis Vizmanos (Pamplona, Spain) Leukaemia Section Thomas Wan (Hong Kong, China) Genes / Leukaemia Sections Adriana Zamecnikova (Kuwait) Leukaemia Section



INIST-CNRS

OPEN ACCESS JOURNAL

Volume 18, Number 8, August 2014

Table of contents

Gene Section

ABCC11 (ATP-binding cassette, sub-family C (CFTR/MRP), member 11) 540 Akimitsu Yamada, Kazuaki Takabe, Krista P Terracina, Takashi Ishikawa, Itaru Endo

DGKA (diacylglycerol kinase, alpha 80kDa) 545 Isabel Merida, Antonia Avila-Flores

EPAS1 (Endothelial PAS Domain Protein 1) 550 Sofie Mohlin, Arash Hamidian, Daniel Bexell, Sven Påhlman, Caroline Wigerup

INGX (inhibitor of growth family, X-linked, pseudogene) 556 Audrey Mouche, Rémy Pedeux

MIR107 (MicroRNA 107) 559 Priyanka Sharma, Rinu Sharma

MYO1A (myosin IA) 565 Diego Arango del Corro, Rocco Mazzolini

NR1H4 (nuclear receptor subfamily 1, group H, member 4) 571 Oscar Briz, Elisa Herraez, Jose JG Marin

PRND (Prion Protein 2 (Dublet)) 576 Gabriele Giachin, Giuseppe Legname

WNT1 (wingless-type MMTV integration site family, member 1) 581 Irini Theohari, Lydia Nakopoulou

EGR1 (Early Growth Response 1) 584 Young Han Lee

HDAC2 (histone deacetylase 2) 594 Hyun Jin Bae, Suk Woo Nam

PF4 (platelet factor 4) 598 Katrien Van Raemdonck, Paul Proost, Jo Van Damme, Sofie Struyf

Leukaemia Section

t(9;13)(p12;q21) PAX5/DACH1 605 Jean-Loup Huret

t(X;9)(q21;p13) PAX5/DACH2 608 Jean-Loup Huret

Deep Insight Section

Th17 cells: inflammation and regulation 611 Kazuya Masuda, Tadamitsu Kishimoto



INIST-CNRS

OPEN ACCESS JOURNAL

Case Report Section

T-cell acute lymphoblastic leukemia with t(7;14)(p15;q11.2)/HOXA-TCRA/D 624 and biallelic deletion of CDKN2A. Case report and literature review Jonathon Mahlow, Salah Ebrahim, Anwar N Mohamed

Gene Section Review

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8) 540


INIST-CNRS

OPEN ACCESS JOURNAL

ABCC11 (ATP-binding cassette, sub-family C (CFTR/MRP), member 11) Akimitsu Yamada, Kazuaki Takabe, Krista P Terracina, Takashi Ishikawa, Itaru Endo

Department of Breast and Oncological Surgery, Yokohama City University School of Medicine, Kanagawa, Japan (AY, IE), Department of Surgery, Virginia Commonwealth University, Richmond, Virginia, USA (AY, KT, KPT), Department of Breast and Thyroid Surgery, Yokohama City University Medical Center, Yokohama, Kanagawa, Japan (TI)

Published in Atlas Database: December 2013

Online updated version : http://AtlasGeneticsOncology.org/Genes/ABCC11ID538ch16q12.html DOI: 10.4267/2042/54005

This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Review on ABCC11, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

Identity Other names: EWWD, MRP8, WW

HGNC (Hugo): ABCC11

Location: 16q12.1

DNA/RNA Note In 2001, three research groups independently cloned two novel ATP-binding cassette transporters named ABCC11 and ABCC12 from the cDNA library of human adult liver (Bera et al., 2001; Tammur et al., 2001; Yabuuchi et al., 2001). These two genes have been found to be located at human chromosome 16q12.1. Phylogenetic analysis determined that ABCC11 and ABCC12 are derived by duplication, and are closely related to the ABCC5 gene (Tammur et al., 2001). ABCC11 has overall 42% identity and 51% similarity with the MRP5 sequence and the predicted amino acid sequences of gene products show high similarity to those of ABCC5 (Bera et al., 2001). Thus these two

genes were classified into the multidrug resistant-associated protein (MRP) family.

Description The ABCC11 gene is encoded by a 68 kb gene consisting of 30 exons (Yabuuchi et al., 2001). According to the August 2013, NCBI database, there are three ABCC11 variants. Variant 1 consists of 4576 bp (NM_032583.3) while variant 2 consists of 4862 bp (NM_033151.3). Both variant 1 and 2 genes encode an ABCC11 protein (isoform a) consisting of 1382 amino acids. Variant 3 (isoform b) consists of 4462 bp (NM_145186.2) and encodes a protein consisting of 1344 amino acids. This variant 3 lacks an alternate in-frame exon compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a.

Transcription Transcript analyses suggest that human ABCC11 mRNA is ubiquitously expressed in human adult and fetal tissues (Tammur et al., 2001; Yabuuchi et al., 2001). ABCC11 mRNA has been detected in several tissues including breast, testis, liver, placenta, and brain (Bera et al., 2001; Tammur et al., 2001; Yabuuchi et al., 2001). Transcripts of ABCC11 genes have been observed in cell lines of carcinoma and adenocarcinoma originating from breast, lung, colon and prostate (Yabuuchi et al., 2001).

ABCC11 (ATP-binding cassette, sub-family C (CFTR/MRP), member 11) Yamada A, et al.


Schematic illustration of ABCC11 protein structure. ABCC11 has a total of 12 transmembrane (TM) regions and two intracellular ATP-binding cassettes.

Protein Note ABCC11, a plasma membrane ATP-binding cassette transporter, has been implicated in the drug resistance of breast cancer due to its ability to confer resistance to fluoropyrimidines (5-FU), and to efflux methotrexate, and has been found to be expressed in breast cancer tumors. One of the single nucleotide polymorphisms (SNPs) of this gene, 538G>A, determines wet vs. dry earwax type and it also likely has a key role in the function of ceruminous apocrine glands.

Description The calculated molecular weight of the protein encoded by the ORF is about 150 kDa. The N-linked glycosylated form of ABCC11 is 180 kDa (Toyoda et al., 2009). Structure: ABCC11 is a full transporter and has two conserved nucleotide binding domains and 12 putative transmembrane domains (Kruh et al., 2007).

Expression ABCC11 wild type protein with Gly180 is expressed in the cerumen gland, which is one of the apocrine glands (Toyoda et al., 2009). ABCC11 has also been identified as an axonal protein of the central nervous system and peripheral nervous system (Bortfeld et al., 2006).

Localisation ABCC11 wild type with Gly180 is an N-linked glycosylated protein, which is localized within intracellular granules and large vacuoles as well as at the luminal membrane of secretory cells in the cerumen apocrine gland. As opposed to the wild type, the SNP variant Arg180 lacks N-linked glycosylation and readily undergoes proteosomal degradation, most probably via ubiquitination. As a consequence, no granular

or vacuolar localization is detected in the cerumen apocrine glands of people homozygous for the SNP variant (Toyoda et al., 2009). When ABCC11 wild type protein was transfected exogenously into Madin-Darby canine kidney cells stain II (MDCK II) cells, the protein was found to be preferentially sorted to the apical membrane of these polarized cells, a finding with a known association to axonal localization within the neuron (Bortfeld et al., 2006).

Function ABCC11 has been identified as an efflux pump for variety of lipophilic anions including the cyclic nucleotides cAMP and cGMP, glutathione conjugates such as leukotriene C4 (LTC4) and S-(2,4-dinitrophenyl)-glutathione (DNP-SG), steroid sulfates such as estrone 3-sulfate (E13S) and dehydroepiandrosterone 3-sulfate (DHEAS), glucuronides such as estradiol 17-β-D-glucuronide (E217βG), the monoanionic bile acids glycocholate and taurocholate, as well as folic acid and its analog methotrexate (MTX) (Guo et al., 2003; Chen et al., 2005; Bortfeld et al., 2006). ABCC11 is directly involved in 5-FU resistance by the efflux transport of the active metabolite 5-fluoro-2'-deoxyuridine 5'-monophosphate (FdUMP) (Oguri et al., 2007). ABCC11 polymorphisms have strong associations with earwax type (Yoshiura et al., 2006), axillary osmidrosis (Yabuuchi et al., 2001; Nakano et al., 2009; Toyoda et al., 2009; Inoue et al., 2010; Martin et al., 2010), and apocrine colostrum secretion from mammary gland (Miura et al., 2007). Human earwax type is determined by a single nucleotide polymorphism (SNP), 538G>A (re17822931; Gly180Alg), in ABCC11 (Yoshiura et al., 2006; Toyoda et al., 2009). The G/G and G/A genotypes correspond to the wet type of earwax, whereas A/A corresponds to the dry type (Toyoda et al., 2009).



Frequencies of this allele are known to vary dramatically depending on ethnicity. For example, in Mongoloid populations in Asia, the frequency of the 538A allele is predominantly high, whereas the frequency of this allele is low among Caucasians and Africans. Consequently, earwax type also varies between populations (Yoshiura et al., 2006). In addition to its association with earwax type, the ABCC11 wild type (G/G and G/A) allele is also intimately associated with axillary osmidrosis, and several studies have already concluded that the genotype at ABCC11 538G>A would be a useful biomarker for the diagnosis of axillary osmidrosis (Yabuuchi et al., 2001; Nakano et al., 2009; Toyoda et al., 2009; Inoue et al., 2010; Martin et al., 2010). Axillary osmidrosis patients (538G/G homozygote or G/A heterozygote) have significantly more numerous and larger-sized axillary apocrine glands compared to those with A/A homozygote. Lastly, there is a strong association between human earwax-type according to 538G>A and apocrine colostrum secretion from the mammary gland. In a study in 225 Japanese women, the frequency of women without colostrum among dry-type women was significantly higher than that among wet-type women and the measurable colostrum volume in dry type women was significantly smaller than that found in wet-type women (Miura et al., 2007).

Homology No gene orthologous to human ABCC11 has been found in mammals except for primates (Shimizu et al., 2003).

Mutations Note More than 10 non-synonymous single-nucleotide polymorphisms (SNPs) have been reported in the ABCC11 gene, including R19H, G180R, A317E, T546M, R630W, V648I, V687I, K735R, M970V, and H1344R. There is also a rare deletion mutation, ∆27 (Toyoda et al., 2008; Toyoda et al., 2009). Among those SNPs, one SNP (rs17822931; 538G>A, Gly180Arg) located on exon 4 is thought to be a clinically important polymorphism described as above. Further, the wild type allele of the ABCC11 gene (G/G or G/A) is associated with breast cancer risk in the Japanese population (Ota et al., 2010). However, this has not been found to be the case in women of European or Caucasian descent (Beesley et al., 2011; Lang et al., 2011). Thus it remains controversial whether the 518G allele contributes to a risk factor of breast cancer or not. A deletion mutation, ∆27, has also been linked to the formation of dry-type earwax (Ishikawa et al., 2012).

Implicated in Breast cancer Note Several studies have reported that ABCC11 mRNA is highly expressed in breast tumors and breast cancer cell lines (Bera et al., 2001; Yabuuchi et al., 2001; Bièche et al., 2004; Park et al., 2006, Szakács et al., 2004). ABCC11 expression is regulated directly or indirectly by estrogen receptor α, and the prolonged exposure of breast cancer cells to tamoxifen has been associated with up-regulation of ABCC11 (Honorat et al., 2008). In a study by Park et al., the mRNA of ABCC11 was shown to be increased in the breast tumors of patients with residual disease compared to those who have achieved a complete response from neoadjuvant chemotherapy. However, ABCC11, in the analysis, was not found to be the ABCC transporter protein most predictive of failure of neoadjuvant chemotherapy (Park et al., 2006). A tissue microarray analysis of 281 breast cancer samples revealed that high expression of ABCC11 in breast cancer is associated with aggressive subtypes such as HER2 type or triple negative type, and is associated with low disease free survival (Yamada et al., 2013). The mechanism underlying this association with breast cancer patients' survival remains unknown.

Leukemia Note Some of the histone deacetylase inhibitors such as SAHA are known to induce the expression of ABC transporters including the ABCC11 gene to make acute myeloid leukemia (AML) cells resistant to a broad-spectrum of drugs (Hauswald et al., 2009). The efflux of the nucleoside analogue cytosine arabinoside (AraC) metabolite by ABCC11 is one of the mechanisms contributing to resistance of AML. The expression of ABCC11 WT is an important factor affecting AML patient survival (Guo et al., 2009).

Paroxysmal kinesigenic choreoathetosis (PKC) and infantile convulsions with paroxysmal choreoathetosis (ICCA). Note ABCC11 and ABCC12 have been mapped to a region harboring genes for paroxysmal kinesigenic choreoathetosis (PKC) (Tomita et al., 1999), and infantile convulsions with paroxysmal choreoathetosis (ICCA) (Lee et al., 1998). The two genes were thought to be represent positional candidates for this disorder; however, it has since



been reported that ABCC11 has been ruled out as the cause of PKC (Du et al., 2008).

Breakpoints Note ABCC11 is in a relatively early stage of investigation. The SNP (538G>A) in the ABCC11 gene determines both ear wax phenotype and axillary osmidrosis and plays a key role in the function of apocrine glands. Though ABCC11 transports a variety of organic anions, the endogenous natural substrates for this transporter have not yet been identified that might explain the association between ABCC11 expression in breast cancer and poor prognosis.

References Lee WL, Tay A, Ong HT, Goh LM, Monaco AP, Szepetowski P. Association of infantile convulsions with paroxysmal dyskinesias (ICCA syndrome): confirmation of linkage to human chromosome 16p12-q12 in a Chinese family. Hum Genet. 1998 Nov;103(5):608-12

Tomita Ha, Nagamitsu S, Wakui K, Fukushima Y, Yamada K, Sadamatsu M, Masui A, Konishi T, Matsuishi T, Aihara M, Shimizu K, Hashimoto K, Mineta M, Matsushima M, Tsujita T, Saito M, Tanaka H, Tsuji S, Takagi T, Nakamura Y, Nanko S, Kato N, Nakane Y, Niikawa N. Paroxysmal kinesigenic choreoathetosis locus maps to chromosome 16p11.2-q12.1. Am J Hum Genet. 1999 Dec;65(6):1688-97

Bera TK, Lee S, Salvatore G, Lee B, Pastan I. MRP8, a new member of ABC transporter superfamily, identified by EST database mining and gene prediction program, is highly expressed in breast cancer. Mol Med. 2001 Aug;7(8):509-16

Tammur J, Prades C, Arnould I, Rzhetsky A, Hutchinson A, Adachi M, Schuetz JD, Swoboda KJ, Ptácek LJ, Rosier M, Dean M, Allikmets R. Two new genes from the human ATP-binding cassette transporter superfamily, ABCC11 and ABCC12, tandemly duplicated on chromosome 16q12. Gene. 2001 Jul 25;273(1):89-96

Yabuuchi H, Shimizu H, Takayanagi S, Ishikawa T. Multiple splicing variants of two new human ATP-binding cassette transporters, ABCC11 and ABCC12. Biochem Biophys Res Commun. 2001 Nov 9;288(4):933-9

Guo Y, Kotova E, Chen ZS, Lee K, Hopper-Borge E, Belinsky MG, Kruh GD. MRP8, ATP-binding cassette C11 (ABCC11), is a cyclic nucleotide efflux pump and a resistance factor for fluoropyrimidines 2',3'-dideoxycytidine and 9'-(2'-phosphonylmethoxyethyl)adenine. J Biol Chem. 2003 Aug 8;278(32):29509-14

Shimizu H, Taniguchi H, Hippo Y, Hayashizaki Y, Aburatani H, Ishikawa T. Characterization of the mouse Abcc12 gene and its transcript encoding an ATP-binding cassette transporter, an orthologue of human ABCC12. Gene. 2003 May 22;310:17-28

Bièche I, Girault I, Urbain E, Tozlu S, Lidereau R. Relationship between intratumoral expression of genes coding for xenobiotic-metabolizing enzymes and benefit from adjuvant tamoxifen in estrogen receptor alpha-positive postmenopausal breast carcinoma. Breast Cancer Res. 2004;6(3):R252-63

Szakács G, Annereau JP, Lababidi S, Shankavaram U, Arciello A, Bussey KJ, Reinhold W, Guo Y, Kruh GD, Reimers M, Weinstein JN, Gottesman MM. Predicting drug sensitivity and resistance: profiling ABC transporter genes in cancer cells. Cancer Cell. 2004 Aug;6(2):129-37

Chen ZS, Guo Y, Belinsky MG, Kotova E, Kruh GD. Transport of bile acids, sulfated steroids, estradiol 17-beta-D-glucuronide, and leukotriene C4 by human multidrug resistance protein 8 (ABCC11). Mol Pharmacol. 2005 Feb;67(2):545-57

Bortfeld M, Rius M, König J, Herold-Mende C, Nies AT, Keppler D. Human multidrug resistance protein 8 (MRP8/ABCC11), an apical efflux pump for steroid sulfates, is an axonal protein of the CNS and peripheral nervous system. Neuroscience. 2006;137(4):1247-57

Park S, Shimizu C, Shimoyama T, Takeda M, Ando M, Kohno T, Katsumata N, Kang YK, Nishio K, Fujiwara Y. Gene expression profiling of ATP-binding cassette (ABC) transporters as a predictor of the pathologic response to neoadjuvant chemotherapy in breast cancer patients. Breast Cancer Res Treat. 2006 Sep;99(1):9-17

Yoshiura K, Kinoshita A, Ishida T, Ninokata A, Ishikawa T, Kaname T, Bannai M, Tokunaga K, Sonoda S, Komaki R, Ihara M, Saenko VA, Alipov GK, Sekine I, Komatsu K, Takahashi H, Nakashima M, Sosonkina N, Mapendano CK, Ghadami M, Nomura M, Liang DS, Miwa N, Kim DK, Garidkhuu A, Natsume N, Ohta T, Tomita H, Kaneko A, Kikuchi M, Russomando G, Hirayama K, Ishibashi M, Takahashi A, Saitou N, Murray JC, Saito S, Nakamura Y, Niikawa N. A SNP in the ABCC11 gene is the determinant of human earwax type. Nat Genet. 2006 Mar;38(3):324-30

Kruh GD, Guo Y, Hopper-Borge E, Belinsky MG, Chen ZS. ABCC10, ABCC11, and ABCC12. Pflugers Arch. 2007 Feb;453(5):675-84

Miura K, Yoshiura K, Miura S, Shimada T, Yamasaki K, Yoshida A, Nakayama D, Shibata Y, Niikawa N, Masuzaki H. A strong association between human earwax-type and apocrine colostrum secretion from the mammary gland. Hum Genet. 2007 Jun;121(5):631-3

Oguri T, Bessho Y, Achiwa H, Ozasa H, Maeno K, Maeda H, Sato S, Ueda R. MRP8/ABCC11 directly confers resistance to 5-fluorouracil. Mol Cancer Ther. 2007 Jan;6(1):122-7

Du T, Feng B, Wang X, Mao W, Zhu X, Li L, Sun B, Niu N, Liu Y, Wang Y, Chen B, Cai X, Liu Y. Localization and mutation detection for paroxysmal kinesigenic choreoathetosis. J Mol Neurosci. 2008 Feb;34(2):101-7

Honorat M, Mesnier A, Vendrell J, Guitton J, Bieche I, Lidereau R, Kruh GD, Dumontet C, Cohen P, Payen L. ABCC11 expression is regulated by estrogen in MCF7 cells, correlated with estrogen receptor alpha expression in postmenopausal breast tumors and overexpressed in tamoxifen-resistant breast cancer cells. Endocr Relat Cancer. 2008 Mar;15(1):125-38

Toyoda Y, Hagiya Y, Adachi T, Hoshijima K, Kuo MT, Ishikawa T. MRP class of human ATP binding cassette (ABC) transporters: historical background and new research directions. Xenobiotica. 2008 Jul;38(7-8):833-62

Guo Y, Köck K, Ritter CA, Chen ZS, Grube M, Jedlitschky G, Illmer T, Ayres M, Beck JF, Siegmund W, Ehninger G, Gandhi V, Kroemer HK, Kruh GD, Schaich M. Expression of ABCC-type nucleotide exporters in blasts of adult acute myeloid leukemia: relation to long-term survival. Clin Cancer Res. 2009 Mar 1;15(5):1762-9



Hauswald S, Duque-Afonso J, Wagner MM, Schertl FM, Lübbert M, Peschel C, Keller U, Licht T. Histone deacetylase inhibitors induce a very broad, pleiotropic anticancer drug resistance phenotype in acute myeloid leukemia cells by modulation of multiple ABC transporter genes. Clin Cancer Res. 2009 Jun 1;15(11):3705-15

Nakano M, Miwa N, Hirano A, Yoshiura K, Niikawa N. A strong association of axillary osmidrosis with the wet earwax type determined by genotyping of the ABCC11 gene. BMC Genet. 2009 Aug 4;10:42

Toyoda Y, Sakurai A, Mitani Y, Nakashima M, Yoshiura K, Nakagawa H, Sakai Y, Ota I, Lezhava A, Hayashizaki Y, Niikawa N, Ishikawa T. Earwax, osmidrosis, and breast cancer: why does one SNP (538G>A) in the human ABC transporter ABCC11 gene determine earwax type? FASEB J. 2009 Jun;23(6):2001-13

Inoue Y, Mori T, Toyoda Y, Sakurai A, Ishikawa T, Mitani Y, Hayashizaki Y, Yoshimura Y, Kurahashi H, Sakai Y. Correlation of axillary osmidrosis to a SNP in the ABCC11 gene determined by the Smart Amplification Process (SmartAmp) method. J Plast Reconstr Aesthet Surg. 2010 Aug;63(8):1369-74

Martin A, Saathoff M, Kuhn F, Max H, Terstegen L, Natsch A. A functional ABCC11 allele is essential in the biochemical formation of human axillary odor. J Invest Dermatol. 2010 Feb;130(2):529-40

Ota I, Sakurai A, Toyoda Y, Morita S, Sasaki T, Chishima T, Yamakado M, Kawai Y, Ishidao T, Lezhava A, Yoshiura K, Togo S, Hayashizaki Y, Ishikawa T, Ishikawa T, Endo I, Shimada H. Association between breast cancer risk and the wild-type allele of human ABC transporter ABCC11.

Anticancer Res. 2010 Dec;30(12):5189-94

Beesley J, Johnatty SE, Chen X, Spurdle AB, Peterlongo P, Barile M, Pensotti V, Manoukian S, Radice P, Chenevix-Trench G. No evidence for an association between the earwax-associated polymorphism in ABCC11 and breast cancer risk in Caucasian women. Breast Cancer Res Treat. 2011 Feb;126(1):235-9

Lang T, Justenhoven C, Winter S, Baisch C, Hamann U, Harth V, Ko YD, Rabstein S, Spickenheuer A, Pesch B, Brüning T, Schwab M, Brauch H. The earwax-associated SNP c.538G>A (G180R) in ABCC11 is not associated with breast cancer risk in Europeans. Breast Cancer Res Treat. 2011 Oct;129(3):993-9

Ishikawa T, Toyoda Y, Yoshiura K, Niikawa N. Pharmacogenetics of human ABC transporter ABCC11: new insights into apocrine gland growth and metabolite secretion. Front Genet. 2012;3:306

Yamada A, Ishikawa T, Ota I, Kimura M, Shimizu D, Tanabe M, Chishima T, Sasaki T, Ichikawa Y, Morita S, Yoshiura K, Takabe K, Endo I. High expression of ATP-binding cassette transporter ABCC11 in breast tumors is associated with aggressive subtypes and low disease-free survival. Breast Cancer Res Treat. 2013 Feb;137(3):773-82

This article should be referenced as such:

Yamada A, Takabe K, Terracina KP, Ishikawa T, Endo I. ABCC11 (ATP-binding cassette, sub-family C (CFTR/MRP), member 11). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):540-544.

Gene Section Review



INIST-CNRS

OPEN ACCESS JOURNAL

DGKA (diacylglycerol kinase, alpha 80kDa) Isabel Merida, Antonia Avila-Flores

Department of Immunology and Oncology, National Center for Biotechnology (CNB/CSIC). Darwin 3, Campus Autonoma/CSIC, Madrid 28049, Spain (IM, AAF)


Online updated version : http://AtlasGeneticsOncology.org/Genes/DGKAID40299ch12q13.html DOI: 10.4267/2042/54006


Abstract Review on DGKA, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

Identity Other names: DAGK, DAGK1, DGK-alpha

HGNC (Hugo): DGKA

Location: 12q13.2

Local order GSTP1-WIBG-DGKA -PMEL-CDK2.

Note Diacylglycerol kinase alpha (DGKA) is a lipid kinase that phosphorylates the lipid diacylglycerol (DAG), transforming it into phosphatidic acid (PA). DGKA is classified as a type I DGK, characterized by possessing EF-hand motifs, which allow calcium mediated regulation. DGKA has been characterized

as a negative regulator of Ras-MAPK pathway in T lymphocytes. DGKA has a dual role in cancer; it exhibits properties similar to a tumor suppressor and has also a positive role in the maintenance of cancerous states. DGKA function might be crucial in the genesis and development of several pathologies.

DNA/RNA Note DGKA gene is highly expressed in thymus, spleen, testis and lung (Sanjuan et al., 2001). DGKA displays alternative splicing; numerous splice variants are predicted, including truncated forms of the protein as well as RNAs with introns retained (Martínez-Moreno et al., 2012). The expression of some of these transcripts might be related to certain pathologies (Batista et al., 2013).

Figure 1. The DGKA gene is located at chromosome 12. It contains 24 exons and the translation initiator ATG is located at Exon 2.

DGKA (diacylglycerol kinase, alpha 80kDa) Merida I, Avila-Flores A


Figure 2. Putative regulatory elements in the DGKA gene. Transcription initiation sites are indicated (arrows). The +1 position was assigned in the Inr element. Putative binding sites for transcription factors are indicated by rectangles; FoxO sites are gray (Adapted from Martinez-Moreno et al., 2012).

Transcription The DGKA gene encodes a protein of 80 KDa. Presence of regulatory regions in the gene was early suggested to restrain the expression of DGKA to certain tissues (Fujikawa et al., 1993). DGKA gene displays alternative use of promoter regions, in homology with the mouse gene at least two alternative promoters likely exist. The regulatory gene region contain several binding motifs for transcription factors including FoxO, p53, Egr, Smad, etc, which allow the coupling of DGKA expression with several signaling pathways. Identification of DGKA as a gene regulated by FoxO has contributed to explain its transcriptional downregulation in response to antigen stimulation and interleukin 2 (IL2) (Martinez-Moreno et al., 2012).

Protein Note The protein encoded by the DGKA gene (2.7.1.107) belongs to the eukaryotic diacylglycerol kinase family. It attenuates the second messenger diacylglycerol, that activates C1-containing proteins like members of the classical and novel PKCs, PKD, RasGRP and chimaerin families. It also produces phosphatidic acid, another lipid mediator that participates in the resynthesis of

phosphatidylinositols and activates different proteins like mTOR or atypical PKCs.

Description - The diacylglycerol kinases (DGK) are a family of signaling proteins that modulate diacylglycerol levels by catalyzing its conversion to phosphatidic acid (Merida et al., 2008). DGK belongs to a superfamily that also includes the recently identified bacterial DgkB as well as the sphingosine kinase (SPK) and ceramide kinase (CERK) families. Proteins in this superfamily share a common catalytic domain (DAGKc: Pfam00781). - In addition to the catalytic region, all DGK family members have at least two protein kinase C-like type 1 (C1) domains that, except for the first C1 domain in DGKB and DGKG, lack the key residues that define a canonical phorbol ester/DAG-binding C1 domain (Shindo et al., 2003). - Mammals express ten DGK isoforms grouped into five subtypes; each DGK subtype has distinct regulatory motifs that suggest the existence of diverse regulatory mechanisms and/or participation in different signaling complexes. - Diacylglycerol Kinase alpha (DGKA) together with the beta (DGKB) and gamma (DGKG) isoforms represent the type I DGK, whose signature is the presence at the N-terminal region of a recoverin-like domain (RVH) and a tandem of EF hand motifs, characteristic of Ca2+-binding proteins.

Figure 3. Distribution of conserved and specific regions in DGKA. C1, conserved protein kinase C-type 1 regions. Y218, Tyrosine phosphorylated by c-Abl. Y335, Tyrosine phosphorylated by Src and Lck. PPP Pro-rich region proposed to interact with Src.



Expression - DGKA is the only DGK isoform particularly enriched in the thymus and peripheral T lymphocytes. DGKA levels are tightly coupled to the differentiation and proliferation state of T lymphocytes. Quiescent, naïve T lymphocytes express high levels of DGKA that decrease rapidly in response to antigenic and IL2-derived signals (Martinez-Moreno et al., 2012). DGKA was identified as an anergy-induced gene (Macian et al., 2002). Anergy represents an unresponsive state in T cells that is vital in immune system homeostasis and constitutes a means for avoiding response to self and thus, for preventing autoimmunity. Tumors also induce anergic-non responsive states in T cells. In agreement with this finding, DGKA-overexpressing lymphocytes are "anergic" and no longer respond to antigenic stimuli (Zha et al., 2006). On the contrary, T cells from DGKA deficient mice are resistant to anergy induction (Olenchock et al., 2006). - Recent studies have characterized miR-297 as a highly cytotoxic microRNA expressed in glioblastoma, with minimal cytotoxicity to normal astrocytes. DGKA is shown to be a miR-297 target with a critical role in miR-297 toxicity. These studies identify miR-297 as a novel and physiologic regulator of cancer cell survival, largely through targeting of DGKA (Kefas et al., 2013).

Localisation - DGKA is a cytosolic enzyme that translocates to the membrane to phosphorylate diacylglycerol. The N-terminal region of DGKA, encompassing the Ca2+ regulatory elements has a negative regulatory

role in enzyme activation and receptor-induced membrane localization, as shown by enhanced activity and constitutive plasma membrane localization of a mutant lacking this region (Sanjuan et al., 2001). In addition to Ca2+ generation, activation of Tyr kinases is required for membrane stabilization of DGKA (Sanjuan et al., 2001). Tyr335 in the human sequence, located at the hinge between the C1 and the catalytic domains, was recently identified as an Lck-dependent DGKA phosphorylation site in T lymphocytes (Merino et al., 2008). - Membrane localization of DGKA in non-T cells requires Src-family tyrosine kinase activity and involves the association of DGKA with Src via a proline-rich sequence (Baldanzi et al., 2008). DGKA membrane localization and activation is required for cell motility, proliferation and angiogenesis, acting as a rheostat that sets the thresholds required for growth factor-induced migratory signals. - Recent reports have suggested nuclear localization for DGKA following serum starvation and demonstrated that DGKA relocates back to the cytosol in response to serum re-addition. Serum-induced export requires c-Abl mediated Tyr-218 phosphorylation (Matsubara et al., 2012).

Function - The best characterized function for DGKA as a negative modulator of diacylglycerol-based signaling has been demonstrated in T lymphocytes. DGKA acts as a "switch-off" signal for Ras activation, mediated by localization to the membrane of Ras-GRP1 a GDP-exchanger for Ras



with a DAG-binding domain (Sanjuan et al., 2001; Sanjuan et al., 2003). - Contrary to its negative contribution to T cell responses, high DGKA expression in tumors appears to have a positive role in neoplastic transformation. DGKA-dependent PA generation contributes to melanoma survival through activation of the NFKB pathway (Yanagisawa et al., 2007). - DGKA mediated PA generation has been reported to participate in tumor migration and invasion. Generation of PA downstream of DGKA is essential to facilitate the Rab coupling protein (RCP)- mediated integrin recycling that is required for tumor cell invasion (Rainiero et al., 2012).

Mutations Note V379I mutation in DGKA identified as a putative driver mutation for pancreatic cancer.

Implicated in Lymphoma Note DGKA was found to be constitutively activated in nucleophosmin/anaplastic lymphoma kinase (NPM / ALK) fusion in malignant lymphomas, where inhibition of DGKA significantly reduced tumor growth (Bacchiocchi et al., 2005).

Melanoma Note DGKA has been implicated in suppression of TNF-alpha induced apoptosis of human melanoma cells via NF-KB (Yanagisawa et al., 2005).

Hepatocellular carcinoma Note DGKA is absent in hepatocytes but it is expressed in different hepatocellular carcinoma cell lines. DGKA is found expressed in cancerous tissue but not in the adjacent non-cancerous hepatocytes. High DGKA expression associates with high Ki67 expression and a high rate of HCC recurrence (p=0.033) following surgery. In multivariate analyses, high DGKA expression is found as an independent factor for determining HCC recurrence after surgery (Takeishi et al., 2012).

Pancreatic carcinoma Note Using CHASM (Cancer-specific High-throughput Annotation of Somatic Mutations) V379I mutation in DGKA was found as a putative driver mutation for pancreatic cancer (Carter et al., 2010).

Glioblastoma Note Recent studies have described DGKA as an important component of malignant transformation in glioblastoma (Dominguez et al., 2013). Impaired DGKA activity through siRNA targeting or the use of small-molecule inhibitors induced caspase-mediated apoptosis in glioblastoma cells, but lacked toxicity in noncancerous cells.

Lung cancer Note Survival trees in a study involving the expression profiles of 3588 genes in 211 lung adenocarcinoma patients identified DGKA as a marker for good survival in a group of advanced-stage patients with remarkably good survival outcome (Berrar et al., 2005).

X-linked proliferative disease Note Studies have reported DGKA inhibition by the adaptor protein SAP (Baldanzi et al., 2011). Loss-of-function SAP mutations cause X-linked lymphoproliferative disease (XLP), an immune disorder characterized by a deregulated immune response to Epstein-Barr virus, susceptibility to lymphoma and defective antibody production. Impaired regulation of DGKA activity in SAP-deficient lymphocytes may contribute to their defective TCR-induced responses, suggesting that pharmacological inhibition of DGKA could be useful in the treatment of certain manifestations of XLP.

CD8 tumor infiltrates Note DGKA was found to be more highly expressed in CD8-tumor infiltrates T cells (TILs) in renal carcinoma that in circulating CD8 cells (Prinz et al., 2012). Low dose treatment of TILs with IL2 reduced DGKA protein levels, improved stimulation-induced ERK and AKT phosphorylation, and increased the number of degranulating CD8-TILs. DGKA inhibition could be a novel strategy to enhance anti-tumor CD8 T cells response and may help prevent inactivation of adoptively transferred T cells improving therapeutic efficacy.

Localized aggressive periodontitis (LAP) Note Localized aggressive periodontitis (LAP) is a familial disorder characterized by destruction of the supporting structures of dentition. Microarray and kinetic-PCR analysis revealed



diminished RNA expression of DGKA in neutrophils from LAP patients compared with asymptomatic individuals (Gronert et al., 2004).

References Fujikawa K, Imai S, Sakane F, Kanoh H. Isolation and characterization of the human diacylglycerol kinase gene. Biochem J. 1993 Sep 1;294 ( Pt 2):443-9

Sanjuán MA, Jones DR, Izquierdo M, Mérida I. Role of diacylglycerol kinase alpha in the attenuation of receptor signaling. J Cell Biol. 2001 Apr 2;153(1):207-20

Macián F, García-Cózar F, Im SH, Horton HF, Byrne MC, Rao A. Transcriptional mechanisms underlying lymphocyte tolerance. Cell. 2002 Jun 14;109(6):719-31

Sanjuán MA, Pradet-Balade B, Jones DR, Martínez-A C, Stone JC, Garcia-Sanz JA, Mérida I. T cell activation in vivo targets diacylglycerol kinase alpha to the membrane: a novel mechanism for Ras attenuation. J Immunol. 2003 Mar 15;170(6):2877-83

Shindo M, Irie K, Masuda A, Ohigashi H, Shirai Y, Miyasaka K, Saito N. Synthesis and phorbol ester binding of the cysteine-rich domains of diacylglycerol kinase (DGK) isozymes. DGKgamma and DGKbeta are new targets of tumor-promoting phorbol esters. J Biol Chem. 2003 May 16;278(20):18448-54

Gronert K, Kantarci A, Levy BD, Clish CB, Odparlik S, Hasturk H, Badwey JA, Colgan SP, Van Dyke TE, Serhan CN. A molecular defect in intracellular lipid signaling in human neutrophils in localized aggressive periodontal tissue damage. J Immunol. 2004 Feb 1;172(3):1856-61

Bacchiocchi R, Baldanzi G, Carbonari D, Capomagi C, Colombo E, van Blitterswijk WJ, Graziani A, Fazioli F. Activation of alpha-diacylglycerol kinase is critical for the mitogenic properties of anaplastic lymphoma kinase. Blood. 2005 Sep 15;106(6):2175-82

Berrar D, Sturgeon B, Bradbury I, Downes CS, Dubitzky W. Survival trees for analyzing clinical outcome in lung adenocarcinomas based on gene expression profiles: identification of neogenin and diacylglycerol kinase alpha expression as critical factors. J Comput Biol. 2005 Jun;12(5):534-44

Olenchock BA, Guo R, Carpenter JH, Jordan M, Topham MK, Koretzky GA, Zhong XP. Disruption of diacylglycerol metabolism impairs the induction of T cell anergy. Nat Immunol. 2006 Nov;7(11):1174-81

Zha Y, Marks R, Ho AW, Peterson AC, Janardhan S, Brown I, Praveen K, Stang S, Stone JC, Gajewski TF. T cell anergy is reversed by active Ras and is regulated by diacylglycerol kinase-alpha. Nat Immunol. 2006 Nov;7(11):1166-73

Yanagisawa K, Yasuda S, Kai M, Imai S, Yamada K, Yamashita T, Jimbow K, Kanoh H, Sakane F. Diacylglycerol kinase alpha suppresses tumor necrosis factor-alpha-induced apoptosis of human melanoma cells through NF-kappaB activation. Biochim Biophys Acta. 2007 Apr;1771(4):462-74

Baldanzi G, Cutrupi S, Chianale F, Gnocchi V, Rainero E, Porporato P, Filigheddu N, van Blitterswijk WJ, Parolini O, Bussolino F, Sinigaglia F, Graziani A. Diacylglycerol kinase-alpha phosphorylation by Src on Y335 is required for activation, membrane recruitment and Hgf-induced cell motility. Oncogene. 2008 Feb 7;27(7):942-56

Mérida I, Avila-Flores A, Merino E. Diacylglycerol kinases: at the hub of cell signalling. Biochem J. 2008 Jan 1;409(1):1-18

Merino E, Avila-Flores A, Shirai Y, Moraga I, Saito N, Mérida I. Lck-dependent tyrosine phosphorylation of diacylglycerol kinase alpha regulates its membrane association in T cells. J Immunol. 2008 May 1;180(9):5805-15

Carter H, Samayoa J, Hruban RH, Karchin R. Prioritization of driver mutations in pancreatic cancer using cancer-specific high-throughput annotation of somatic mutations (CHASM). Cancer Biol Ther. 2010 Sep 15;10(6):582-7

Baldanzi G, Pighini A, Bettio V, Rainero E, Traini S, Chianale F, Porporato PE, Filigheddu N, Mesturini R, Song S, Schweighoffer T, Patrussi L, Baldari CT, Zhong XP, van Blitterswijk WJ, Sinigaglia F, Nichols KE, Rubio I, Parolini O, Graziani A. SAP-mediated inhibition of diacylglycerol kinase α regulates TCR-induced diacylglycerol signaling. J Immunol. 2011 Dec 1;187(11):5941-51

Martínez-Moreno M, García-Liévana J, Soutar D, Torres-Ayuso P, Andrada E, Zhong XP, Koretzky GA, Mérida I, Ávila-Flores A. FoxO-dependent regulation of diacylglycerol kinase α gene expression. Mol Cell Biol. 2012 Oct;32(20):4168-80

Matsubara T, Ikeda M, Kiso Y, Sakuma M, Yoshino K, Sakane F, Merida I, Saito N, Shirai Y. c-Abl tyrosine kinase regulates serum-induced nuclear export of diacylglycerol kinase α by phosphorylation at Tyr-218. J Biol Chem. 2012 Feb 17;287(8):5507-17

Prinz PU, Mendler AN, Masouris I, Durner L, Oberneder R, Noessner E. High DGK-α and disabled MAPK pathways cause dysfunction of human tumor-infiltrating CD8+ T cells that is reversible by pharmacologic intervention. J Immunol. 2012 Jun 15;188(12):5990-6000

Rainero E, Caswell PT, Muller PA, Grindlay J, McCaffrey MW, Zhang Q, Wakelam MJ, Vousden KH, Graziani A, Norman JC. Diacylglycerol kinase α controls RCP-dependent integrin trafficking to promote invasive migration. J Cell Biol. 2012 Jan 23;196(2):277-95

Takeishi K, Taketomi A, Shirabe K, Toshima T, Motomura T, Ikegami T, Yoshizumi T, Sakane F, Maehara Y. Diacylglycerol kinase alpha enhances hepatocellular carcinoma progression by activation of Ras-Raf-MEK-ERK pathway. J Hepatol. 2012 Jul;57(1):77-83

Batista EL Jr, Kantarci AI, Hasturk H, Van Dyke TE. Alternative Splicing Generates a Diacylglycerol Kinase α (DGKα) Transcript That Acts as a Dominant Negative Modulator of Superoxide Production in Localized Aggressive Periodontitis. J Periodontol. 2013 Oct 30;

Dominguez CL, Floyd DH, Xiao A, Mullins GR, Kefas BA, Xin W, Yacur MN, Abounader R, Lee JK, Wilson GM, Harris TE, Purow BW. Diacylglycerol kinase α is a critical signaling node and novel therapeutic target in glioblastoma and other cancers. Cancer Discov. 2013 Jul;3(7):782-97

Kefas B, Floyd DH, Comeau L, Frisbee A, Dominguez C, Dipierro CG, Guessous F, Abounader R, Purow B. A miR-297/hypoxia/DGK-α axis regulating glioblastoma survival. Neuro Oncol. 2013 Dec;15(12):1652-63


Merida I, Avila-Flores A. DGKA (diacylglycerol kinase, alpha 80kDa). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):545-549.

Gene Section Review



INIST-CNRS

OPEN ACCESS JOURNAL

EPAS1 (Endothelial PAS Domain Protein 1) Sofie Mohlin, Arash Hamidian, Daniel Bexell, Sven Påhlman, Caroline Wigerup

Lund University, Center for Translational Cancer Research, Department of Laboratory Medicine, Medicon Village, Building 404, C3, SE-223 81 Lund, Sweden (SM, AH, DB, SP, CW)


Online updated version : http://AtlasGeneticsOncology.org/Genes/EPAS1ID44088ch2p21.html DOI: 10.4267/2042/54007


Abstract Review on EPAS1, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

Identity Other names: ECYT4, HIF2A, HLF, MOP2, PASD2, bHLHe73

HGNC (Hugo): EPAS1

Location: 2p21

Local order: RPL26P15 - RPL36AP14 - uncharacterized LOC101926974 - EPAS1 - uncharacterized LOC101805491 - TMEM247 - ATP6V1E2.

DNA/RNA Description Genomic size: Starts at 46524541 and ends at 46613842.

Transcription Transcript length: The gene is comprised of 16 exons, constituting one main transcript of 5184 base pairs.

Pseudogene None described.

Protein Description The HIF-2α protein is 870 amino acids long and consists of a basic-helix-loop-helix domain, two PER-ARNT-SIM domains (A and B), an oxygen-dependent degradation domain (ODDD) and two transcriptional-activation domains (N-TAD and C-TAD). Two proline residues (P405 in ODDD and P531 in N-TAD) and an asparaginyl residue (N847 in C-TAD) are subjected to hydroxylation during physiologic oxygen tensions, regulating the stability and activity of the HIF-2α protein.

Representation of the EPAS1/HIF2A protein with its specific domains specified. Critical hydroxylation sites are indicated.

EPAS1 (Endothelial PAS Domain Protein 1) Mohlin S, et al.


Phosphorylation of HIF-2α at T844 has been reported as necessary for its transcriptional activation function (Gradin et al., 2002).

Expression In adult human tissue, HIF-2α protein is mainly expressed in cells experiencing low oxygen levels, and the HIF-2α mRNA has been shown to be predominantly expressed in highly vascularized tissues (Tian et al., 1997). During human embryonic and fetal development, HIF-2α is transiently but specifically expressed in cells of the developing sympathetic nervous system (SNS) (Nilsson et al., 2005; Mohlin et al., 2013). In embryonic and adult mouse tissue, the expression of HIF-2α mRNA is more or less restricted to endothelial cells (Tian et al., 1997; Jain et al., 1998). In a zebrafish model, the HIF-2α transcript is expressed early in brain tissue and blood vessels, and later on HIF-2α replaces HIF-1α transcription in the notochord (Rojas et al., 2007).

Localisation HIF-2α is part of a transcriptional complex and is hence localized mainly in the nucleus upon hypoxic induction. However, HIF-2α protein can also be detected in the cytoplasm, at hypoxic conditions and foremost at more physiological oxygen conditions, as demonstrated in cultured cells in vitro and in tumor specimens in vivo (Holmquist-Mengelbier et al., 2006). These findings were recently strengthened by the demonstration of a role for HIF-2α as part of an oxygen-regulated translation initiation complex and presence of HIF-2α in the cellular polysome fraction (Uniacke et al., 2012).

Function At lower oxygen tensions, the hydroxylation of HIF-2α by prolyl hydroxylases (PHDs) and Factor Inhibiting HIF (FIH) is prevented, and the HIF-2α subunit relocates to the nucleus where it forms a transcriptional complex together with its binding partner ARNT (also known as HIF-1β) and co-factors such as p300 and CBP. By binding to hypoxia response elements (HREs) in the promoter of target genes, the HIF complex initiates transcription of numerous genes involved in a variety of tumorigenic cellular processes, including angiogenesis, invasion and metastasis, growth, dedifferentiation, and apoptosis (Semenza, 2003). As mentioned under the Localization section, HIF-2α has also been demonstrated to be part of a hypoxia-regulated translation initiation complex. Hypoxia induces HIF-2α to form a complex together with RNA-binding protein RBM4 and cap-binding eIF4E2, and this complex is then recruited to a wide variety of mRNAs, promoting active translation at polysomes (Uniacke et al., 2012). In a

recent report, HIF-2α was further shown to protect human hematopoietic stem/progenitor cells from endoplasmic reticulum (ER) stress-induced apoptosis and to enhance the long-term repopulating ability of these cells (Rouault-Pierre et al., 2013).

Homology HIF-2α is part of the basic helix-loop-helix-PAS family of proteins and is structurally related to the HIF-1α and HIF-3α subunits. While HIF-3α is believed to negatively regulate the other two alpha subunits (Makino et al., 2001; Maynard et al., 2007), HIF-1α and HIF-2α share both sequence similarity and target genes. However, despite 48% primary amino acid sequence homology between HIF-1α and HIF-2α (Tian et al., 1997), it is becoming increasingly evident that these two proteins also function at distinct sites and during differential cellular conditions.

Mutations Germinal Functional mutations in human EPAS1 are associated with variations in hemoglobin and red blood cell concentration (Percy et al., 2008b; Beall et al., 2010; Yi et al., 2010). Percy et al. described a gain of function mutation in a family with high hemoglobin concentrations and erythrocytosis (Percy et al., 2008b). Similar mutations, all associated with small amino acid substitutions leading to protein stabilization, have been reported in other clinical cases (Gale et al., 2008; Martini et al., 2008; Percy et al., 2008a; van Wijk et al., 2010). In contrast, EPAS1 mutations associated with a loss of function and low hemoglobin concentrations have been described in healthy individuals living at high altitudes. Extensive analysis of genome-wide sequence variations and exome sequencing in Tibetans have shown that EPAS1 is a key gene mutated in Tibetan populations (Beall et al., 2010; Simonson et al., 2010; Yi et al., 2010; Peng et al., 2011). The functional consequence of EPAS1 SNPs associated with low hemoglobin concentrations is described as adaptation to low oxygen without elevated red blood cell production, thereby avoiding high blood viscosity creating cardiovascular risks.

Somatic Several studies have recently identified the first mutations in any of the HIF alpha subunits in cancer. Somatic gain-of-function mutations in exon 12 of the EPAS1 gene in two patients with paraganglioma and associated erythrocytosis results in an amino acid substitution in proximity to the PHD hydroxylation site and increased protein half-life and HIF-2α activity (Zhuang et al., 2012).



Additional mutations in EPAS1 have also been identified in patients with paraganglioma and pheochromocytoma without associated erythrocytosis (Comino-Mendez et al., 2013), and in patients with somatostatinoma and paraganglioma (Yang et al., 2013).

Implicated in Renal clear cell carcinoma Note The predominant loss of von Hippel Lindau in clear cell renal cell carcinoma (ccRCC), results in defective targeting of HIF-α proteins for degradation at normoxia (Gnarra et al., 1994). Therefore, both HIF-1α and HIF-2α accumulate irrespective of oxygen levels in VHL-defective cells and are abundantly expressed in cells of ccRCC origin (Krieg et al., 2000). For unknown reasons, the expression of HIF-2α is more prominent than that of HIF-1α in RCC cell lines and tumors and HIF-1α expression is often lost in RCC cell lines (Maxwell et al., 1999; Krieg et al., 2000). Regulation of HIF target genes in RCC cell lines are more dependent on HIF-2α than on HIF-1α and silencing of HIF-2α in VHL-deficient cells suppress tumor growth, suggesting an important role for HIF-2α in renal carcinoma (Kondo et al., 2003; Carroll et al., 2006).

Paraganglioma/pheochromocytoma Note Paraganglioma and pheochromocytoma derive from the chromaffin cell lineage of the sympathetic nervous system, and notably, genes involved in the hypoxic response (e.g. VHL and SDH genes) are frequently mutated in these tumors (Neumann et al., 2002). Recently, somatic mutations in the EPAS1 gene itself were discovered in two paraganglioma patients, describing the first cases of EPAS1 mutations in any cancer type (Zhuang et al., 2012). These gain-of-function mutations lead to increased protein half-life and HIF-2α activity, in turn resulting in up-regulation of HIF-2α downstream target genes, presumably explaining the clinical presentation in these patients. In a follow-up study, two additional EPAS1 mutations were discovered in patients presenting with polycythemia and somatostatinoma or paraganglioma (Yang et al., 2013). These novel mutations lead to disruption of the ODD domain-PHD2 interaction and thereby result in less ubiquitination and higher activity of the HIF-2α protein. In another study, 7 out of 41 examined patients with pheochromocytoma or paraganglioma presented with somatic EPAS1 mutations, and interestingly, three of these cases were also accompanied by an exclusive gain of chromosome 2p (Comino-Mendez et al., 2013).

Neuroblastoma Note In the childhood tumor neuroblastoma, HIF-2α positive tumor cells have been identified in a perivascular niche, suggesting a non-hypoxic driven expression (Pietras et al., 2008). The HIF-2α positive cells display an immature tumor stem cell-like phenotype and their presence in neuroblastoma specimens correlate to poor overall survival (Holmquist-Mengelbier et al., 2006; Noguera et al., 2009). In neuroblastoma cell lines, HIF-2α is expressed at hypoxic conditions (1% oxygen) and at near end-capillary physiological oxygen levels (5% oxygen) (Jogi et al., 2002; Holmquist-Mengelbier et al., 2006). At prolonged hypoxic conditions, HIF-2α is continuously expressed in contrast to its homologue HIF-1α. In addition, overexpression of HIF-2α in a mouse neuroblastoma cell line promoted in vivo tumor angiogenesis, while mutant HIF-2α cells formed tumors that were highly necrotic (Favier et al., 2007).

Glioma Note Knockdown of HIF-2α expression can reduce vascularization but accelerate tumor growth of human glioblastoma cells pointing to a role for HIF-2α as a tumor suppressor in glioblastoma (Acker et al., 2005). In contrast, recent work has focused on HIF-2α as a putative glioblastoma cancer stem cell (CSC) marker. Specifically, HIF-2α protein expression co-localizes with CD133 in a fraction of tumor cells (McCord et al., 2009) and with cancer stem cell markers in glioma specimens (Li et al., 2009). Glioblastoma putative CSCs respond to hypoxia by induction of HIF2-α (Li et al., 2009; Seidel et al., 2010), and inhibiting HIF2-α in glioblastoma CSCs decreases self-renewal, proliferation and survival in vitro and tumor-initiating capacity in vivo (Li et al., 2009). In addition, elevated HIF2A mRNA levels are associated with poor prognosis in glioma patients (Li et al., 2009).

Breast cancer Note HIF-2α is expressed and associates with high vascular density, high c-erbB-2 expression and extensive nodal metastasis in breast cancer (Giatromanolaki et al., 2006). In a slightly larger study, HIF-2α was associated with ABCG2 expression, histology grade and Ki67 expression in invasive ductal carcinoma (Xiang et al., 2012). Importantly, in two separate breast cancer cohorts, HIF-2α correlate to reduced recurrence-free survival, breast-cancer specific survival and presence of distal metastasis (Helczynska et al., 2008).



Acute myeloid leukemia Note Knockdown of HIF-2α in CD34+ acute myeloid leukemia (AML) cells reduce engraftment ability in irradiated mice (Rouault-Pierre et al., 2013). The HIF-2α deficient cells are more susceptible to apoptosis as a result of increased ROS and ER-induced stress indicating that HIF-2α is important for AML cell survival.

Other tumor types Note Expression of the HIF-2α protein has also been reported in other solid tumor types including colorectal cancer (Yoshimura et al., 2004), prostate cancer (Boddy et al., 2005), non-small cell lung cancer (Giatromanolaki et al., 2001), squamous cell head-and-neck cancer (Koukourakis et al., 2002), nodular malignant melanoma (Giatromanolaki et al., 2003) and endometrial adenocarcinoma (Sivridis et al., 2002).

Inflammation Note Sites of inflammation are often hypoxic due to vascular damage and large infiltration of cells. In order to operate under this condition, cells of the innate immunity adapt by expressing the HIF proteins (Fang et al., 2009; Imtiyaz and Simon, 2010). HIF-2α has been directly coupled to the regulation of proinflammatory cytokine expression in activated macrophages (Fang et al., 2009; Imtiyaz et al., 2010). Furthermore, HIF-2α has been detected in bone marrow-derived macropahges (BMDMs) and tumor associated macrophages (TAMs) of various human cancers (Talks et al., 2000). Importantly, HIF-2α is essential for TAM migration into tumor lesions (Imtiyaz et al., 2010), which in turn will promote progression and metastasis of tumor cells (Pollard, 2004).

Disease Erythrocytosis, see section on germinal mutations.

Development Note The four available HIF2A knockout mice display substantial differences in phenotype, presumably due to strain background. The first knockout mouse was created on a 129/SvJ background, and resulted in embryonic lethality due to circulatory failure during midgestation (Tian et al., 1997). Two of the following knockout studies demonstrated a role for HIF-2α in vascular development. HIF2A deficient embryos from an ICR/129Sv background die in utero and display severe post-vasculogenic defects (Peng et al., 2000), while HIF2A deficient mice on 129/Sv x Swiss background display lowered VEGF

levels (Compernolle et al., 2002). The latter mice are embryonically lethal due to respiratory distress syndrome and cardiac failure (Compernolle et al., 2002). HIF-2α is also important in normal hematopoiesis, as demonstrated by creating adult HIF2A knockout mice by crossing of heterozygous 129S6/SvEvTac EPAS1 and heterozygous C57BL/6J EPAS1 knockout mice (Scortegagna et al., 2003b). These adult HIF2A deficient mice suffer from cardiac hypertrophy, hepatomegaly, oxidative stress and pancytopenia (Scortegagna et al., 2003a). In summary, HIF2A knockout studies demonstrate important roles for HIF-2α in catecholamine synthesis, reactive oxygen species (ROS) homeostasis and vascular remodeling during development.

References Gnarra JR, Tory K, Weng Y, Schmidt L, Wei MH, Li H, Latif F, Liu S, Chen F, Duh FM. Mutations of the VHL tumour suppressor gene in renal carcinoma. Nat Genet. 1994 May;7(1):85-90

Tian H, McKnight SL, Russell DW. Endothelial PAS domain protein 1 (EPAS1), a transcription factor selectively expressed in endothelial cells. Genes Dev. 1997 Jan 1;11(1):72-82

Jain S, Maltepe E, Lu MM, Simon C, Bradfield CA. Expression of ARNT, ARNT2, HIF1 alpha, HIF2 alpha and Ah receptor mRNAs in the developing mouse. Mech Dev. 1998 Apr;73(1):117-23

Maxwell PH, Wiesener MS, Chang GW, Clifford SC, Vaux EC, Cockman ME, Wykoff CC, Pugh CW, Maher ER, Ratcliffe PJ. The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature. 1999 May 20;399(6733):271-5

Krieg M, Haas R, Brauch H, Acker T, Flamme I, Plate KH. Up-regulation of hypoxia-inducible factors HIF-1alpha and HIF-2alpha under normoxic conditions in renal carcinoma cells by von Hippel-Lindau tumor suppressor gene loss of function. Oncogene. 2000 Nov 16;19(48):5435-43

Peng J, Zhang L, Drysdale L, Fong GH. The transcription factor EPAS-1/hypoxia-inducible factor 2alpha plays an important role in vascular remodeling. Proc Natl Acad Sci U S A. 2000 Jul 18;97(15):8386-91

Talks KL, Turley H, Gatter KC, Maxwell PH, Pugh CW, Ratcliffe PJ, Harris AL. The expression and distribution of the hypoxia-inducible factors HIF-1alpha and HIF-2alpha in normal human tissues, cancers, and tumor-associated macrophages. Am J Pathol. 2000 Aug;157(2):411-21

Giatromanolaki A, Koukourakis MI, Sivridis E, Turley H, Talks K, Pezzella F, Gatter KC, Harris AL. Relation of hypoxia inducible factor 1 alpha and 2 alpha in operable non-small cell lung cancer to angiogenic/molecular profile of tumours and survival. Br J Cancer. 2001 Sep 14;85(6):881-90

Makino Y, Cao R, Svensson K, Bertilsson G, Asman M, Tanaka H, Cao Y, Berkenstam A, Poellinger L. Inhibitory PAS domain protein is a negative regulator of hypoxia-inducible gene expression. Nature. 2001 Nov 29;414(6863):550-4

Compernolle V, Brusselmans K, Acker T, Hoet P, Tjwa M, Beck H, Plaisance S, Dor Y, Keshet E, Lupu F, Nemery B,



Dewerchin M, Van Veldhoven P, Plate K, Moons L, Collen D, Carmeliet P. Loss of HIF-2alpha and inhibition of VEGF impair fetal lung maturation, whereas treatment with VEGF prevents fatal respiratory distress in premature mice. Nat Med. 2002 Jul;8(7):702-10

Gradin K, Takasaki C, Fujii-Kuriyama Y, Sogawa K. The transcriptional activation function of the HIF-like factor requires phosphorylation at a conserved threonine. J Biol Chem. 2002 Jun 28;277(26):23508-14

Jögi A, Øra I, Nilsson H, Lindeheim A, Makino Y, Poellinger L, Axelson H, Påhlman S. Hypoxia alters gene expression in human neuroblastoma cells toward an immature and neural crest-like phenotype. Proc Natl Acad Sci U S A. 2002 May 14;99(10):7021-6

Koukourakis MI, Giatromanolaki A, Sivridis E, Simopoulos C, Turley H, Talks K, Gatter KC, Harris AL. Hypoxia-inducible factor (HIF1A and HIF2A), angiogenesis, and chemoradiotherapy outcome of squamous cell head-and-neck cancer. Int J Radiat Oncol Biol Phys. 2002 Aug 1;53(5):1192-202

Neumann HP, Bausch B, McWhinney SR, Bender BU, Gimm O, Franke G, Schipper J, Klisch J, Altehoefer C, Zerres K, Januszewicz A, Eng C, Smith WM, Munk R, Manz T, Glaesker S, Apel TW, Treier M, Reineke M, Walz MK, Hoang-Vu C, Brauckhoff M, Klein-Franke A, Klose P, Schmidt H, Maier-Woelfle M, Peçzkowska M, Szmigielski C, Eng C. Germ-line mutations in nonsyndromic pheochromocytoma. N Engl J Med. 2002 May 9;346(19):1459-66

Sivridis E, Giatromanolaki A, Gatter KC, Harris AL, Koukourakis MI. Association of hypoxia-inducible factors 1alpha and 2alpha with activated angiogenic pathways and prognosis in patients with endometrial carcinoma. Cancer. 2002 Sep 1;95(5):1055-63

Giatromanolaki A, Sivridis E, Kouskoukis C, Gatter KC, Harris AL, Koukourakis MI. Hypoxia-inducible factors 1alpha and 2alpha are related to vascular endothelial growth factor expression and a poorer prognosis in nodular malignant melanomas of the skin. Melanoma Res. 2003 Oct;13(5):493-501

Kondo K, Kim WY, Lechpammer M, Kaelin WG Jr. Inhibition of HIF2alpha is sufficient to suppress pVHL-defective tumor growth. PLoS Biol. 2003 Dec;1(3):E83

Scortegagna M, Ding K, Oktay Y, Gaur A, Thurmond F, Yan LJ, Marck BT, Matsumoto AM, Shelton JM, Richardson JA, Bennett MJ, Garcia JA. Multiple organ pathology, metabolic abnormalities and impaired homeostasis of reactive oxygen species in Epas1-/- mice. Nat Genet. 2003a Dec;35(4):331-40

Scortegagna M, Morris MA, Oktay Y, Bennett M, Garcia JA. The HIF family member EPAS1/HIF-2alpha is required for normal hematopoiesis in mice. Blood. 2003b Sep 1;102(5):1634-40

Semenza GL. Targeting HIF-1 for cancer therapy. Nat Rev Cancer. 2003 Oct;3(10):721-32

Pollard JW. Tumour-educated macrophages promote tumour progression and metastasis. Nat Rev Cancer. 2004 Jan;4(1):71-8

Yoshimura H, Dhar DK, Kohno H, Kubota H, Fujii T, Ueda S, Kinugasa S, Tachibana M, Nagasue N. Prognostic impact of hypoxia-inducible factors 1alpha and 2alpha in colorectal cancer patients: correlation with tumor angiogenesis and cyclooxygenase-2 expression. Clin Cancer Res. 2004 Dec 15;10(24):8554-60

Acker T, Diez-Juan A, Aragones J, Tjwa M, Brusselmans K, Moons L, Fukumura D, Moreno-Murciano MP, Herbert JM, Burger A, Riedel J, Elvert G, Flamme I, Maxwell PH, Collen D, Dewerchin M, Jain RK, Plate KH, Carmeliet P. Genetic evidence for a tumor suppressor role of HIF-2alpha. Cancer Cell. 2005 Aug;8(2):131-41

Boddy JL, Fox SB, Han C, Campo L, Turley H, Kanga S, Malone PR, Harris AL. The androgen receptor is significantly associated with vascular endothelial growth factor and hypoxia sensing via hypoxia-inducible factors HIF-1a, HIF-2a, and the prolyl hydroxylases in human prostate cancer. Clin Cancer Res. 2005 Nov 1;11(21):7658-63

Nilsson H, Jögi A, Beckman S, Harris AL, Poellinger L, Påhlman S. HIF-2alpha expression in human fetal paraganglia and neuroblastoma: relation to sympathetic differentiation, glucose deficiency, and hypoxia. Exp Cell Res. 2005 Feb 15;303(2):447-56

Carroll VA, Ashcroft M. Role of hypoxia-inducible factor (HIF)-1alpha versus HIF-2alpha in the regulation of HIF target genes in response to hypoxia, insulin-like growth factor-I, or loss of von Hippel-Lindau function: implications for targeting the HIF pathway. Cancer Res. 2006 Jun 15;66(12):6264-70

Giatromanolaki A, Sivridis E, Fiska A, Koukourakis MI. Hypoxia-inducible factor-2 alpha (HIF-2 alpha) induces angiogenesis in breast carcinomas. Appl Immunohistochem Mol Morphol. 2006 Mar;14(1):78-82

Holmquist-Mengelbier L, Fredlund E, Löfstedt T, Noguera R, Navarro S, Nilsson H, Pietras A, Vallon-Christersson J, Borg A, Gradin K, Poellinger L, Påhlman S. Recruitment of HIF-1alpha and HIF-2alpha to common target genes is differentially regulated in neuroblastoma: HIF-2alpha promotes an aggressive phenotype. Cancer Cell. 2006 Nov;10(5):413-23

Favier J, Lapointe S, Maliba R, Sirois MG. HIF2 alpha reduces growth rate but promotes angiogenesis in a mouse model of neuroblastoma. BMC Cancer. 2007 Jul 26;7:139

Maynard MA, Evans AJ, Shi W, Kim WY, Liu FF, Ohh M. Dominant-negative HIF-3 alpha 4 suppresses VHL-null renal cell carcinoma progression. Cell Cycle. 2007 Nov 15;6(22):2810-6

Rojas DA, Perez-Munizaga DA, Centanin L, Antonelli M, Wappner P, Allende ML, Reyes AE. Cloning of hif-1alpha and hif-2alpha and mRNA expression pattern during development in zebrafish. Gene Expr Patterns. 2007 Jan;7(3):339-45

Gale DP, Harten SK, Reid CD, Tuddenham EG, Maxwell PH. Autosomal dominant erythrocytosis and pulmonary arterial hypertension associated with an activating HIF2 alpha mutation. Blood. 2008 Aug 1;112(3):919-21

Helczynska K, Larsson AM, Holmquist Mengelbier L, Bridges E, Fredlund E, Borgquist S, Landberg G, Påhlman S, Jirström K. Hypoxia-inducible factor-2alpha correlates to distant recurrence and poor outcome in invasive breast cancer. Cancer Res. 2008 Nov 15;68(22):9212-20

Martini M, Teofili L, Cenci T, Giona F, Torti L, Rea M, Foà R, Leone G, Larocca LM. A novel heterozygous HIF2AM535I mutation reinforces the role of oxygen sensing pathway disturbances in the pathogenesis of familial erythrocytosis. Haematologica. 2008 Jul;93(7):1068-71

Percy MJ, Beer PA, Campbell G, Dekker AW, Green AR,



Oscier D, Rainey MG, van Wijk R, Wood M, Lappin TR, McMullin MF, Lee FS. Novel exon 12 mutations in the HIF2A gene associated with erythrocytosis. Blood. 2008a Jun 1;111(11):5400-2

Percy MJ, Furlow PW, Lucas GS, Li X, Lappin TR, McMullin MF, Lee FS. A gain-of-function mutation in the HIF2A gene in familial erythrocytosis. N Engl J Med. 2008b Jan 10;358(2):162-8

Pietras A, Gisselsson D, Ora I, Noguera R, Beckman S, Navarro S, Påhlman S. High levels of HIF-2alpha highlight an immature neural crest-like neuroblastoma cell cohort located in a perivascular niche. J Pathol. 2008 Mar;214(4):482-8

Fang HY, Hughes R, Murdoch C, Coffelt SB, Biswas SK, Harris AL, Johnson RS, Imityaz HZ, Simon MC, Fredlund E, Greten FR, Rius J, Lewis CE. Hypoxia-inducible factors 1 and 2 are important transcriptional effectors in primary macrophages experiencing hypoxia. Blood. 2009 Jul 23;114(4):844-59

Li Z, Bao S, Wu Q, Wang H, Eyler C, Sathornsumetee S, Shi Q, Cao Y, Lathia J, McLendon RE, Hjelmeland AB, Rich JN. Hypoxia-inducible factors regulate tumorigenic capacity of glioma stem cells. Cancer Cell. 2009 Jun 2;15(6):501-13

McCord AM, Jamal M, Shankavaram UT, Lang FF, Camphausen K, Tofilon PJ. Physiologic oxygen concentration enhances the stem-like properties of CD133+ human glioblastoma cells in vitro. Mol Cancer Res. 2009 Apr;7(4):489-97

Noguera R, Fredlund E, Piqueras M, Pietras A, Beckman S, Navarro S, Påhlman S. HIF-1alpha and HIF-2alpha are differentially regulated in vivo in neuroblastoma: high HIF-1alpha correlates negatively to advanced clinical stage and tumor vascularization. Clin Cancer Res. 2009 Dec 1;15(23):7130-6

Beall CM, Cavalleri GL, Deng L, Elston RC, Gao Y, Knight J, Li C, Li JC, Liang Y, McCormack M, Montgomery HE, Pan H, Robbins PA, Shianna KV, Tam SC, Tsering N, Veeramah KR, Wang W, Wangdui P, Weale ME, Xu Y, Xu Z, Yang L, Zaman MJ, Zeng C, Zhang L, Zhang X, Zhaxi P, Zheng YT. Natural selection on EPAS1 (HIF2alpha) associated with low hemoglobin concentration in Tibetan highlanders. Proc Natl Acad Sci U S A. 2010 Jun 22;107(25):11459-64

Imtiyaz HZ, Simon MC. Hypoxia-inducible factors as essential regulators of inflammation. Curr Top Microbiol Immunol. 2010;345:105-20

Imtiyaz HZ, Williams EP, Hickey MM, Patel SA, Durham AC, Yuan LJ, Hammond R, Gimotty PA, Keith B, Simon MC. Hypoxia-inducible factor 2alpha regulates macrophage function in mouse models of acute and tumor inflammation. J Clin Invest. 2010 Aug;120(8):2699-714

Seidel S, Garvalov BK, Wirta V, von Stechow L, Schänzer A, Meletis K, Wolter M, Sommerlad D, Henze AT, Nistér M, Reifenberger G, Lundeberg J, Frisén J, Acker T. A hypoxic niche regulates glioblastoma stem cells through hypoxia inducible factor 2 alpha. Brain. 2010 Apr;133(Pt 4):983-95

Simonson TS, Yang Y, Huff CD, Yun H, Qin G, Witherspoon DJ, Bai Z, Lorenzo FR, Xing J, Jorde LB, Prchal JT, Ge R. Genetic evidence for high-altitude adaptation in Tibet. Science. 2010 Jul 2;329(5987):72-5

van Wijk R, Sutherland S, Van Wesel AC, Huizinga EG,

Percy MJ, Bierings M, Lee FS. Erythrocytosis associated with a novel missense mutation in the HIF2A gene. Haematologica. 2010 May;95(5):829-32

Yi X, Liang Y, Huerta-Sanchez E, Jin X, Cuo ZX, Pool JE, Xu X, Jiang H, Vinckenbosch N, Korneliussen TS, Zheng H, Liu T, He W, Li K, Luo R, Nie X, Wu H, Zhao M, Cao H, Zou J, Shan Y, Li S, Yang Q, Asan, Ni P, Tian G, Xu J, Liu X, Jiang T, Wu R, Zhou G, Tang M, Qin J, Wang T, Feng S, Li G, Huasang, Luosang J, Wang W, Chen F, Wang Y, Zheng X, Li Z, Bianba Z, Yang G, Wang X, Tang S, Gao G, Chen Y, Luo Z, Gusang L, Cao Z, Zhang Q, Ouyang W, Ren X, Liang H, Zheng H, Huang Y, Li J, Bolund L, Kristiansen K, Li Y, Zhang Y, Zhang X, Li R, Li S, Yang H, Nielsen R, Wang J, Wang J. Sequencing of 50 human exomes reveals adaptation to high altitude. Science. 2010 Jul 2;329(5987):75-8

Peng Y, Yang Z, Zhang H, Cui C, Qi X, Luo X, Tao X, Wu T, Ouzhuluobu, Basang, Ciwangsangbu, Danzengduojie, Chen H, Shi H, Su B. Genetic variations in Tibetan populations and high-altitude adaptation at the Himalayas. Mol Biol Evol. 2011 Feb;28(2):1075-81

Uniacke J, Holterman CE, Lachance G, Franovic A, Jacob MD, Fabian MR, Payette J, Holcik M, Pause A, Lee S. An oxygen-regulated switch in the protein synthesis machinery. Nature. 2012 May 6;486(7401):126-9

Xiang L, Liu ZH, Huan Q, Su P, Du GJ, Wang Y, Gao P, Zhou GY. Hypoxia-inducible factor-2a is associated with ABCG2 expression, histology-grade and Ki67 expression in breast invasive ductal carcinoma. Diagn Pathol. 2012 Mar 27;7:32

Zhuang Z, Yang C, Lorenzo F, Merino M, Fojo T, Kebebew E, Popovic V, Stratakis CA, Prchal JT, Pacak K. Somatic HIF2A gain-of-function mutations in paraganglioma with polycythemia. N Engl J Med. 2012 Sep 6;367(10):922-30

Comino-Méndez I, de Cubas AA, Bernal C, Álvarez-Escolá C, Sánchez-Malo C, Ramírez-Tortosa CL, Pedrinaci S, Rapizzi E, Ercolino T, Bernini G, Bacca A, Letón R, Pita G, Alonso MR, Leandro-García LJ, Gómez-Graña A, Inglada-Pérez L, Mancikova V, Rodríguez-Antona C, Mannelli M, Robledo M, Cascón A. Tumoral EPAS1 (HIF2A) mutations explain sporadic pheochromocytoma and paraganglioma in the absence of erythrocytosis. Hum Mol Genet. 2013 Jun 1;22(11):2169-76

Mohlin S, Hamidian A, Påhlman S. HIF2A and IGF2 expression correlates in human neuroblastoma cells and normal immature sympathetic neuroblasts. Neoplasia. 2013 Mar;15(3):328-34

Rouault-Pierre K, Lopez-Onieva L, Foster K, Anjos-Afonso F, Lamrissi-Garcia I, Serrano-Sanchez M, Mitter R, Ivanovic Z, de Verneuil H, Gribben J, Taussig D, Rezvani HR, Mazurier F, Bonnet D. HIF-2α protects human hematopoietic stem/progenitors and acute myeloid leukemic cells from apoptosis induced by endoplasmic reticulum stress. Cell Stem Cell. 2013 Nov 7;13(5):549-63

Yang C, Sun MG, Matro J, Huynh TT, Rahimpour S, Prchal JT, Lechan R, Lonser R, Pacak K, Zhuang Z. Novel HIF2A mutations disrupt oxygen sensing, leading to polycythemia, paragangliomas, and somatostatinomas. Blood. 2013 Mar 28;121(13):2563-6


Mohlin S, Hamidian A, Bexell D, Påhlman S, Wigerup C. EPAS1 (Endothelial PAS Domain Protein 1). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):550-555.

Gene Section Short Communication



INIST-CNRS

OPEN ACCESS JOURNAL

INGX (inhibitor of growth family, X-linked, pseudogene) Audrey Mouche, Rémy Pedeux

INSERM U917, Microenvironnement et Cancer, Rennes, France and Universite de Rennes 1, Rennes, France (AM, RP), Etablissement Francais du Sang, Rennes, France (RP)


Online updated version : http://AtlasGeneticsOncology.org/Genes/INGXID40976chXq13.html DOI: 10.4267/2042/54008


Abstract Review on INGX, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

Identity Other names: ING1-like, ING2

HGNC (Hugo): INGX

Location: Xq13.1

DNA/RNA

Chromosomal localization of the INGX gene in Homo sapiens.

Description The sex chromosome linked INGX gene, homolog to ING1 has been cloned for the first time by Jäger et al., 1999. The five human ING genes and the pseudogene INGX have been mapped to six different chromosomes. In addition, ING genes are located close to the telomeric region except for ING3 and INGX. This gene has been localised on the human X chromosome at locus Xq13.1 close to the centromeric region (He et al., 2005).

Transcription INGX gene has three transcripts and a unique exon. The sequence of this exon shares 72% of identity with exon 2 of ING1. RT-PCR analysis shows that INGX mRNA is expressed in normal tissue (brain, colon, testis, kidney, liver and breast). However, some tumor cell lines like melanoma or breast cancer showed a loss of INGX mRNA (Jäger et al., 1999).

Pseudogene INGX is the pseudogene of ING1 (He et al., 2005).

Protein Description The amino acid sequence alignment of human ING proteins revealed several conserved regions: a leucine-zipper-like-region (LZL), a novel conserved region (NCR), a nuclear localization signal (NLS), a plant homeo domain (PHD) and a polybasic region (PBR).

INGX (inhibitor of growth family, X-linked, pseudogene) Mouche A, Pedeux R


A schematic representation of the different domain of ING1b, ING2 and INGX protein.

Amino acid sequences alignment of ING1b, ING2 and INGX. Plant homeo domain (PHD) is indicated by box.

The ING proteins are characterized by the presence of a highly conserved PHD in their C-terminal part. This domain is commonly found in proteins involved in chromatin modification (Bienz, 2006; Mellor, 2006). ING proteins are characterized by their PHD domain which is highly conserved. The longest ORF in INGX gene is only 129 bp length and would encode a predicted amino acid sequence of 42 amino acids, but there is no report about an INGX protein produced from a transcript. This INGX sequence has a high homology degree with the PHD amino acid sequence. INGX protein would have a partial PHD domain (He et al., 2005).

Localisation At present, there is no proof about the existence of the production of an INGX protein. Moreover, the predicted protein would not have a nuclear localization sequence (NLS) like the other members of the ING family. It could thus be located in the cytoplasm unlike the other ING proteins (for review, Guérillon et al., 2013).

Function The tumor suppressor ING genes are lost or misregulated in different types of human tumors. Unfortunately, few data about INGX are available. We actually know that INGX, unlike the other ING, is highly truncated. So it would be interesting to determine if it has the potential to act in a dominant negative manner (He et al., 2005).

Homology In databanks, INGX is also referred as ING1-like.

Implicated in Melanoma and breast cancer Note Several studies have shown that ING proteins are involved in critical cellular processes such as senescence, apoptosis, DNA repair, growth regulation, cell migration (for review, Guérillon et al., 2013). In tumor, ING expression is mostly lost at mRNA level (For review: Guérillon et al., 2013 and Ythier et al., 2008). Jäger et al., 1999 have shown a loss of INGX mRNA in some tumor cell lines like melanoma or breast cancer.

References Jäger D, Stockert E, Scanlan MJ, Güre AO, Jäger E, Knuth A, Old LJ, Chen YT. Cancer-testis antigens and ING1 tumor suppressor gene product are breast cancer antigens: characterization of tissue-specific ING1 transcripts and a homologue gene. Cancer Res. 1999 Dec 15;59(24):6197-204

He GH, Helbing CC, Wagner MJ, Sensen CW, Riabowol K. Phylogenetic analysis of the ING family of PHD finger proteins. Mol Biol Evol. 2005 Jan;22(1):104-16

Bienz M. The PHD finger, a nuclear protein-interaction domain. Trends Biochem Sci. 2006 Jan;31(1):35-40

Mellor J. It takes a PHD to read the histone code. Cell. 2006 Jul 14;126(1):22-4

INGX (inhibitor of growth family, X-linked, pseudogene) Mouche A, Pedeux R


Ythier D, Larrieu D, Brambilla C, Brambilla E, Pedeux R. The new tumor suppressor genes ING: genomic structure and status in cancer. Int J Cancer. 2008 Oct 1;123(7):1483-90

Guérillon C, Larrieu D, Pedeux R. ING1 and ING2: multifaceted tumor suppressor genes. Cell Mol Life Sci. 2013 Oct;70(20):3753-72

Guérillon C, Bigot N, Pedeux R. The ING tumor suppressor genes: status in human tumors. Cancer Lett. 2014 Apr 1;345(1):1-16


Mouche A, Pedeux R. INGX (inhibitor of growth family, X-linked, pseudogene). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):556-558.

Gene Section Review



INIST-CNRS

OPEN ACCESS JOURNAL

MIR107 (MicroRNA 107) Priyanka Sharma, Rinu Sharma

Research Scholar, University School of Biotechnology, Guru Gobind Singh Indraprastha University, New Delhi-110078, India (PS), University School of Biotechnology, Guru Gobind Singh Indraprastha University, Sector 16 C Dwarka, New Delhi-110078, India (RS)


Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR107ID51325ch10q23.html DOI: 10.4267/2042/54009


Abstract Review on MIR107, with data on DNA/RNA and where the gene is implicated.

Identity Other names: MIRN107, miR-107

HGNC (Hugo): MIR107

Location: 10q23.31

DNA/RNA Description miR-107 is located on the 10th chromosome. miR-107 gene is of 87 bp and starts from 91352500 bp from pter and ends at 91352586 bp from pter on minus strand. Total number of exon present is one and coding exon is 0. miR-107 paralogs include miR-103(1), miR103(2)

and miR107 which reside in three homologous PANK genes - PANK3, PANK2 and PANK1 respectively. miR-103 is in a PANK gene intron but miR-107 is located intergenically (Finnerty et al., 2010).

Transcription hsa-miR-107 is a product of gene ENSG00000198997 and has 1 transcript ENST00000362127 of 87 bp. Precursor miRNA transcribed by this gene is of 81 base pairs (location: complement (91352504..91352584) on DNA and 1:81 on RNA) while mature miRNA is of 23 bp transcribed from sequence located at (91352513..91352535)bp on minus strand of DNA and 50:72 bp on RNA. Transcript is intron-less.

Pseudogene Paralogs: hsa-miR-107 has two paralogs: 1) hsa-miR-103-1 HGNC: 31490 2) hsa-miR-103-2 HGNC: 31491

Figure 1.

Table 1. Overlapping transcripts.

MIR107 (MicroRNA 107) Sharma P, Sharma R


Table 2.



Protein Note No protein product.

Mutations Note SNP 1) rs377494950 GCAACACTGTAAAGAAGCTGAAAGCA[A/G]GAGAATATCGAATATTGCAAGTCGA AllelePos=51; totalLen=101; snpclass=1; alleles='A/G'. (NCBI dbSNP) 2) rs199975460 CCCTGTACAATGCTGCTTGAACTCCA[C/T]GCCACAAGGCAACACTGTAAAGAAG AllelePos=101; totalLen=201; snpclass=1; alleles='C/T'. (NCBI dbSNP) - SNP Loc relative to pre-miR 40 - Primary miRNA Eenergy: -29.6 kcal/mol - SNP-miRNA Eenergy: -30.3kcal/mol - ∆∆G: -0.7kcal/mol (microRNA-related Single Nucleotide Polymorphims) For miRNA-107 NCBI Reference Sequence NR_029524.1 (Contig NT_030059.13) following 56 SNPs have been reported in dbSNP (NCBI dbSNP).

Implicated in Breast cancer Oncogenesis miR-107 was reported to be over expressed in malignant tissues from patients with advanced breast cancer, and its expression showed an inverse correlation with let-7 expression in tumors and in cancer cell lines Ectopic expression of miR-107 in human cancer cell lines led to destabilization of mature let-7, increased expression of let-7 targets, and increased malignant phenotypes (Chen et al., 2011).

Colon cancer Oncogenesis P53-induced miR-107 inhibited HIF-1 and tumor angiogenesis in colon cancer specimens. Furthermore, overexpression of miR-107 in tumor cells suppresses tumor angiogenesis, tumor growth, and tumor VEGF expression in mice (Yamakuchi et al., 2010).

Colorectal cancer Oncogenesis miR-103/107 targeted the known metastasis suppressors death-associated protein kinase (DAPK) and Krüppel-like factor 4 (KLF4) in colorectal cancer cells, resulting in increased cell motility and cell-matrix adhesion and decreased

cell-cell adhesion and epithelial marker expression. miR-103/107 expression was increased in the presence of hypoxia, thereby potentiating DAPK and KLF4 downregulation and hypoxia-induced motility and invasiveness (Chen et al., 2012).

Esophageal cancer Oncogenesis Circulating and tissue miR-107 was found to be downregulated in esophageal cancer tissues and sera samples as compared to matched non-malignant tissues and healthy controls respectively (Sharma et al., 2013).

Gastric cancer Prognosis miR-107 expression in gastric cancer tissues was demonstrated as an independent prognostic factor for overall survival rates (OS) and disease-free survival rates (DFS). OS and DFS of patients with high miR-107 expression were significantly worse than those of patients with low miR-107 expression (Inoue et al., 2012).

Oncogenesis Its ectopic expression reduced both mRNA and protein expression levels of CDK6, inhibited proliferation, blocked invasion of gastric cancer cells and also induced G1 cell cycle arrest (Feng et al., 2012). miR-107 expression showed significant association with depth of tumor invasion, lymph node metastasis and stage. Moreover, significant inverse correlation was found between miR-107 and DICER1 mRNA (Inoue et al., 2012) and it was demonstrated that miR107 regulates tumor invasion and metastasis in gastric cancer by targeting DICER1 (Li et al., 2011).

Glioma Oncogenesis miR-107 inhibited proliferation of Glioma cells (Chen et al., 2013a), downregulated expression of CDK6 and notch-2 and also inhibited glioma cell migration and invasion by modulating notch-2 expression (Chen et al., 2013b). He et al., (2013) reported that upregulation of miR-107 suppressed glioma cell growth through directly targeting SALL4, leading to the activation of FADD/caspase-8/caspase-3/caspase-7 signaling pathway of cell apoptosis.

Head and neck squamous cell carcinoma Oncogenesis microRNA-107 functions as a candidate tumor-suppressor gene in head and neck squamous cell carcinoma by downregulation of protein kinase Cε. Treatment with miR-107 significantly blocked cell proliferation, DNA replication, colony formation and invasion in head and neck squamous cell



carcinoma (HNSCC) cell lines (Datta et al., 2012). Moreover, Lipid-based nanoparticle delivery of Pre-miR-107 inhibits the tumorigenicity of HNSCC (Piao et al., 2012).

B-cell chronic lymphocytic leukemia Oncogenesis Down-regulation of miRNA-107 due to epigenetic transcriptional silencing results in overexpression of its target gene PLAG1 (pleomorphic adenoma gene 1), a well known oncogenic transcription factor (Pallasch, 2009).

Lung cancer Oncogenesis MiR-107 suppressed cell proliferation in human non-small cell lung cancer cell lines (Takahashi et al., 2009) and induced G1 cell cycle arrest.

Neuroblastoma Oncogenesis miR-103 and miR-107 regulate CDK5R1 expression and their overexpression, as well as CDK5R1 silencing, caused a reduction in migration ability of neuroblastoma cells (Moncini et al., 2011).

Pancreatic cancer Oncogenesis Lee et al. (2009) reported that epigenetic silencing of miR-107 regulates CDK6 expression in pancreatic cancer.

Pituitary adenomas Oncogenesis miR-107 is overexpressed in Pituitary adenomas and may act as tumor suppressor. Pituitary tumor suppressor gene AIP (aryl hydrocarbon receptor-interacting protein) is a miR-107 target and both may have roles in tumorigenesis (Trivellin et al., 2012). Recent studies have demonstrated regulation of miR-107 by P53 tumor suppressor.

Prostate cancer Oncogenesis Multiple members of the miR-107 gene group repress mitogen and growth factor granulin (GRN) protein levels when transfected into prostate cancer cells (Wang et al., 2010a). GRN is dysregulated via miR-15/107 gene group in multiple human cancers, which may provide a potential common therapeutic target.

Various cancers Cytogenetics - Entrez Gene cytogenetic band: 10q23.31 - Ensembl cytogenetic band: 10q23.31 - HGNC cytogenetic band: 10q23.31

- Type: Cytoband, Source: UCSC, Length: 3300000, Stain: gpos75 (Database of Genomic Variants)

Hypoxia and angiogenesis Note miR-107 mediates p53 regulation of hypoxic signaling and tumor angiogenesis in colon cancer. It regulates hypoxia signaling by suppressing expression of hypoxia inducible factor-1β (HIF-1β). Moreover, overexpression of miR-107 in tumor cells suppresses tumor angiogenesis, tumor growth and tumor VEGF expression in mice (Yamakuchi et al., 2010).

Metabolism Note miR-107 has been implicated in metabolism of cellular lipids (Wilfred et al., 2007) and in regulation of insulin sensitivity. Caveolin-1, a critical regulator of insulin receptor has been identified as a direct target of miR-103/107 (Trajkovski et al., 2011). Human CYP2C8, a member of CYP2C subfamily of cytochrome P450 enzymes is also post-transcriptionally regulated by microRNAs 103 and 107 in human liver (Zhang et al., 2012).

Alzheimer's Note Expression of miR-107 decreases early in Alzheimer's disease and may accelerate disease progression through regulation of beta-site amyloid precursor protein-cleaving enzyme 1 (Wang et al., 2008). Moreover, miR-107 expression tended to correlate in a negative fashion with neuritic plaque(NPs) and neurofibrillary tangle (NFTs) (Nelson and Wang, 2010) microRNAs-107/miR-103 represse translation of actin-binding protein cofilin, and their reduced levels are associated with elevated cofilin protein levels and formation of rod-like structures in a transgenic mouse model of Alzheimer's disease (Yao et al., 2010).

Brain injury and neurodegenerative disease Note miR-107 contributes to regulation of granulin/progranulin with implications for traumatic brain injury and neurodegenerative disease (Wang et al., 2010b).

Schizophrenia Note Increased levels of miR-107 contribute to the marked loss of cortical CHRM1 in schizophrenia which may be a differentiating pathophysiology (Scarr et al., 2013).



Table 3. LOH and homozygous deletion on chromosome 10q (10q22-10q23) in primary hepatocellular carcinoma (Zhu et al., 2004). See Supplementary Table S1.

Breakpoints See Table 3.

References Zhu GN, Zuo L, Zhou Q, Zhang SM, Zhu HQ, Gui SY, Wang Y. Loss of heterozygosity on chromosome 10q22-10q23 and 22q11.2-22q12.1 and p53 gene in primary hepatocellular carcinoma. World J Gastroenterol. 2004 Jul 1;10(13):1975-8

Wilfred BR, Wang WX, Nelson PT. Energizing miRNA research: a review of the role of miRNAs in lipid metabolism, with a prediction that miR-103/107 regulates human metabolic pathways. Mol Genet Metab. 2007 Jul;91(3):209-17

Wang WX, Rajeev BW, Stromberg AJ, Ren N, Tang G, Huang Q, Rigoutsos I, Nelson PT. The expression of microRNA miR-107 decreases early in Alzheimer's disease and may accelerate disease progression through regulation of beta-site amyloid precursor protein-cleaving enzyme 1. J Neurosci. 2008 Jan 30;28(5):1213-23

Lee KH, Lotterman C, Karikari C, Omura N, Feldmann G, Habbe N, Goggins MG, Mendell JT, Maitra A. Epigenetic silencing of MicroRNA miR-107 regulates cyclin-dependent kinase 6 expression in pancreatic cancer. Pancreatology. 2009;9(3):293-301

Pallasch CP, Patz M, Park YJ, Hagist S, Eggle D, Claus R, Debey-Pascher S, Schulz A, Frenzel LP, Claasen J, Kutsch N, Krause G, Mayr C, Rosenwald A, Plass C, Schultze JL, Hallek M, Wendtner CM. miRNA deregulation by epigenetic silencing disrupts suppression of the oncogene PLAG1 in chronic lymphocytic leukemia. Blood. 2009 Oct 8;114(15):3255-64

Takahashi Y, Forrest AR, Maeno E, Hashimoto T, Daub CO, Yasuda J. MiR-107 and MiR-185 can induce cell cycle arrest in human non small cell lung cancer cell lines. PLoS One. 2009 Aug 18;4(8):e6677

Finnerty JR, Wang WX, Hébert SS, Wilfred BR, Mao G, Nelson PT. The miR-15/107 group of microRNA genes: evolutionary biology, cellular functions, and roles in human diseases. J Mol Biol. 2010 Sep 24;402(3):491-509

Nelson PT, Wang WX. MiR-107 is reduced in Alzheimer's disease brain neocortex: validation study. J Alzheimers Dis. 2010;21(1):75-9

Wang WX, Kyprianou N, Wang X, Nelson PT. Dysregulation of the mitogen granulin in human cancer through the miR-15/107 microRNA gene group. Cancer Res. 2010a Nov 15;70(22):9137-42

Wang WX, Wilfred BR, Madathil SK, Tang G, Hu Y, Dimayuga J, Stromberg AJ, Huang Q, Saatman KE, Nelson PT. miR-107 regulates granulin/progranulin with implications for traumatic brain injury and neurodegenerative disease. Am J Pathol. 2010b Jul;177(1):334-45

Yamakuchi M, Lotterman CD, Bao C, Hruban RH, Karim B, Mendell JT, Huso D, Lowenstein CJ. P53-induced microRNA-107 inhibits HIF-1 and tumor angiogenesis. Proc Natl Acad Sci U S A. 2010 Apr 6;107(14):6334-9

Yao J, Hennessey T, Flynt A, Lai E, Beal MF, Lin MT. MicroRNA-related cofilin abnormality in Alzheimer's disease. PLoS One. 2010 Dec 16;5(12):e15546

Chen PS, Su JL, Cha ST, Tarn WY, Wang MY, Hsu HC, Lin MT, Chu CY, Hua KT, Chen CN, Kuo TC, Chang KJ, Hsiao M, Chang YW, Chen JS, Yang PC, Kuo ML. miR-107 promotes tumor progression by targeting the let-7 microRNA in mice and humans. J Clin Invest. 2011 Sep;121(9):3442-55

Li X, Zhang Y, Shi Y, Dong G, Liang J, Han Y, Wang X, Zhao Q, Ding J, Wu K, Fan D. MicroRNA-107, an oncogene microRNA that regulates tumour invasion and metastasis by targeting DICER1 in gastric cancer. J Cell Mol Med. 2011 Sep;15(9):1887-95

Moncini S, Salvi A, Zuccotti P, Viero G, Quattrone A, Barlati S, De Petro G, Venturin M, Riva P. The role of miR-103 and miR-107 in regulation of CDK5R1 expression and in cellular migration. PLoS One. 2011;6(5):e20038

Trajkovski M, Hausser J, Soutschek J, Bhat B, Akin A, Zavolan M, Heim MH, Stoffel M. MicroRNAs 103 and 107 regulate insulin sensitivity. Nature. 2011 Jun 8;474(7353):649-53

Chen HY, Lin YM, Chung HC, Lang YD, Lin CJ, Huang J, Wang WC, Lin FM, Chen Z, Huang HD, Shyy JY, Liang JT, Chen RH. miR-103/107 promote metastasis of colorectal cancer by targeting the metastasis suppressors DAPK and KLF4. Cancer Res. 2012 Jul 15;72(14):3631-41

Datta J, Smith A, Lang JC, Islam M, Dutt D, Teknos TN, Pan Q. microRNA-107 functions as a candidate tumor-suppressor gene in head and neck squamous cell carcinoma by downregulation of protein kinase Cɛ. Oncogene. 2012 Sep 6;31(36):4045-53

Inoue T, Iinuma H, Ogawa E, Inaba T, Fukushima R. Clinicopathological and prognostic significance of microRNA-107 and its relationship to DICER1 mRNA expression in gastric cancer. Oncol Rep. 2012 Jun;27(6):1759-64

Piao L, Zhang M, Datta J, Xie X, Su T, Li H, Teknos TN, Pan Q. Lipid-based nanoparticle delivery of Pre-miR-107 inhibits the tumorigenicity of head and neck squamous cell carcinoma. Mol Ther. 2012 Jun;20(6):1261-9

Trivellin G, Butz H, Delhove J, Igreja S, Chahal HS, Zivkovic V, McKay T, Patócs A, Grossman AB, Korbonits M. MicroRNA miR-107 is overexpressed in pituitary adenomas and inhibits the expression of aryl hydrocarbon receptor-interacting protein in vitro. Am J Physiol Endocrinol Metab. 2012 Sep 15;303(6):E708-19

Zhang SY, Surapureddi S, Coulter S, Ferguson SS, Goldstein JA. Human CYP2C8 is post-transcriptionally regulated by microRNAs 103 and 107 in human liver. Mol Pharmacol. 2012 Sep;82(3):529-40



Chen L, Chen XR, Zhang R, Li P, Liu Y, Yan K, Jiang XD. MicroRNA-107 inhibits glioma cell migration and invasion by modulating Notch2 expression. J Neurooncol. 2013a Mar;112(1):59-66

Chen L, Zhang R, Li P, Liu Y, Qin K, Fa ZQ, Liu YJ, Ke YQ, Jiang XD. P53-induced microRNA-107 inhibits proliferation of glioma cells and down-regulates the expression of CDK6 and Notch-2. Neurosci Lett. 2013b Feb 8;534:327-32

He J, Zhang W, Zhou Q, Zhao T, Song Y, Chai L, Li Y. Low-expression of microRNA-107 inhibits cell apoptosis in glioma by upregulation of SALL4. Int J Biochem Cell Biol. 2013 Sep;45(9):1962-73

Scarr E, Craig JM, Cairns MJ, Seo MS, et al.. Decreased cortical muscarinic M1 receptors in schizophrenia are associated with changes in gene promoter methylation, mRNA and gene targeting microRNA. Transl Psychiatry. 2013 Feb 19;3:e230

Sharma P, Saraya A, Gupta P, Sharma R. Decreased levels of circulating and tissue miR-107 in human esophageal cancer. Biomarkers. 2013 Jun;18(4):322-30


Sharma P, Sharma R. MIR107 (MicroRNA 107). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):559-564.

Gene Section Review



INIST-CNRS

OPEN ACCESS JOURNAL

MYO1A (myosin IA) Diego Arango del Corro, Rocco Mazzolini

Group of Molecular Oncology, CIBBIM-Nanomedicine, Vall d'Hebron University Hospital Research Institute, 08035 Barcelona, Spain (DAdC, RM)


Online updated version : http://AtlasGeneticsOncology.org/Genes/MYO1AID47246ch12q13.html DOI: 10.4267/2042/54010


Abstract Review on MYO1A, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

Identity Other names: BBMI, DFNA48, MIHC, MYHL

HGNC (Hugo): MYO1A

Location: 12q13.3

Note Orientation: minus strand.

DNA/RNA Description There are several transcripts described for MYO1A. The two transcripts better characterized contain 28 and 29 exons spanning over 21 kb and both code for an identical protein of 1043 amino acids.

Figure 1. Diagram of DNA/RNA.

MYO1A (myosin IA) Arango del Corro D, Mazzolini R


Figure 2. Protein structure of MYO1A.

Protein Description The protein encoded by the MYOSIN-IA gene belongs to the myosin superfamily. Like all myosin-1 isoforms, MYO1A contain these three core domains (figure 2): an N-terminal motor domain that coordinates ATP hydrolysis with actin binding and force generation; a central neck region made up of varying numbers of IQ motifs, which bind calmodulin or calmodulin-like proteins; and a tail region, which includes a highly basic C-terminal tail homology 1 (TH1) domain that is responsible for membrane binding (Coluccio and Bretscher, 1990; Krendel and Mooseker, 2005; McConnell and Tyska, 2010; Nambiar et al., 2010).

Expression Myo1a is highly expressed in the enterocytes that line the mucosa of the small intestine (Matsudaira and Burgess, 1979; Skowron and Mooseker, 1999). Expression of MYO1A has also been observed at relatively high levels in gastric epithelium when compared to other organs such as endometrium, myometrium, ovary and prostate (figure 3). In tumor samples, MYO1A mRNA expression in human gastric adenocarcinomas is comparable to intestinal adenocarcinomas, and significantly higher than in other tumor types (Mazzolini et al., 2013) (figure 4). Myo1a transcripts are also present in rodent inner ear at low level (Dumont et al., 2002).

Localisation Myo1a localizes to the cellular membrane through to the C-terminal tail domain. In the enterocytes that line the mucosa of the small intestine, MYO1A localizes to the apical brush border membrane (Matsudaira and Burgess, 1979; Collins and Borysenko, 1984; Skowron and Mooseker, 1999) (figure 5).

Function Myosin Ia (MYO1A) is a major component of the cytoskeleton that underlies and supports the apical

brush border of the enterocytes. MYO1A forms a spiral array of bridges that links the microvillar actin core to the membrane (Chantret et al., 1988; West et al., 1988; Beaulieu et al., 1990). Here, Myosin-1a plays a critical role in maintaining the brush border composition, structure, and regulating the microvillar membrane tension (Tyska et al., 2005; Nambiar et al., 2009), Myo1a also plays a role in powering the release of vesicles from the tips of the microvilli (McConnell et al., 2009).

Figure 3. Relative MYO1A mRNA levels in human normal tissues. MYO1A mRNA levels in human normal and tumor samples were obtained from a collection of 667 normal human samples from different tissues (Gene Expression Omnibus: GSE7307) and 10000 normal and tumor samples from GeneSapiens.org (Kilpinen et al., 2008).



Figure 4. Relative MYO1A mRNA levels in human tumors of different origin. Box-whisker plot of the gene's expression in cancer tissues. The bottom of the box is the 25th percentile of the data, the top of the box is the 75th percentile, and the vertical red line is the median. The whiskers extend to 1.5 times the interquartile range from the edges of the box, and any data points beyond this are considered outliers, marked by hollow circles. Filled grey bars are gastrointestinal carcinomas.



Figure 5. MYO1A localizes to the apical membrane of intestinal epithelial cells. MYO1A-GFP was transfected into the colon cancer cell line Caco-2. The image was taken by confocal microscopy and represents an orthogonal stuck of a monolayer of cells. (A) Actin staining with rhodamine-phalloidin shows the apical and baso-lateral membtanes of the cells. (B) EGFP-MYO1A localizing in the apical membrane. (C) Overlay (modified from Mazzolini et al., 2012).

Mutations Germinal The following germinal mutations have been reported in eight unrelated patients coming from central and southern Italy and affected by sensorineural bilateral hearing loss of variable degree: one nonsense mutation, one trinucleotide insertion leading to an additional amino acid, and six missense mutations (Donaudy et al., 2003) (table 1).

Somatic Mazzolini et al. reported frequent frame-shift somatic mutations in colorectal and gastric cancer. These mutations were found with the following frequencies: 44,4% (16 of 36) in microsatellite-

instable colorectal cancer cell lines; 31,3% (42 of 134) in primary colon tumors; 46,8% (22/47) in gastric microsatellite-instable primary tumors. No mutations were observed in the matching healthy intestinal mucosa. All the mutations observed were insertions or deletions in an A8 microsatellite tract located in exon 28. The most frequent mutation is the deletion of one A (MYO1AA7MUT). All the mutations found appeared to be heterozygous as the wild type allele was also visible in all cases (figure 6, panel A). The MYO1AA7MUT mutation causes sub-cellular mislocalization (figure 6, panel B) and decreased stability of Myosin-1a (Mazzolini et al., 2012; Mazzolini et al., 2013). Additional mutations have been found in colorectal tumors without microsatellite instability (TCGA; figure 6, panel C).

Table 1. MYO1A mutations related to sensorineural bilateral hearing loss (Donaudy et al., 2003).



Figure 6. Somatic mutations of MYO1AA7MUT. (A) Frameshift mutations in the A8 track in Exon 28 of MYO1A. (B) Co-transfection of wild type EGFP-MYO1Awt and mutant ERFP-MYO1AA7MUT demonstrated that the mutant protein mislocalized to the cytoplasm of undifferentiated Caco2 cells (modified from Mazzolini et al., 2012). (C) Localization of additional mutations found in colorectal tumors without microsatellite instability.

Implicated in Colorectal cancer Note The brush border protein Myosin Ia (MYO1A) has been demonstrated to be important for polarization and differentiation of colon cancer cells and is frequently inactivated in colorectal tumors by genetic and epigenetic mechanisms. Mazzolini et al. reported MYO1A frame-shift mutations in 32% (37 of 116) of the colorectal tumors with microsatellite instability. Evidence of promoter methylation was observed in a significant proportion of colon cancer cell lines and primary colorectal tumors. The loss of polarization/differentiation resulting from MYO1A inactivation is associated with higher tumor growth in soft agar and in a xenograft model. In addition, the progression of genetically and carcinogen initiated intestinal tumors was significantly accelerated in Myo1a knockout mice compared with Myo1a wild-type animals. Moreover, MYO1A tumor expression was found to be an independent prognostic factor for colorectal cancer patients. Patients with low MYO1A tumor protein levels had significantly shorter disease-free

and overall survival compared with patients with high MYO1A (logrank test P = 0.004 and P = 0.009, respectively). The median time-to-disease recurrence in patients with low MYO1A was 1 y, compared with >9 y in the group of patients with high MYO1A. These results identified MYO1A as a tumor-suppressor gene in colorectal cancer and demonstrate that the loss of structural brush border proteins involved in cell polarity are important for tumor development (Mazzolini et al., 2012).

Gastric cancer Note Frame-shift somatic mutations have been reported in 46,8% (22/47) of gastric microsatellite-instable primary tumors. Frequent MYO1A promoter hypermethylation was also found in gastric tumors (Mazzolini et al., 2013).

Endometrial cancer Note Rare mutations have been reported in 6,2% (3/48) of endometrial microsatellite-instable primary tumors (Mazzolini et al., 2013). The low frequency of this mutation in endometrial tumor is likely to



reflect the background mutation rate occurring in endometrial MSI tumors.

Nonsyndromic hearing loss Note MYO1A, which is located within the DFNA48 locus, was the first myosin I family member found to be involved in causing deafness and may be a major contributor to autosomal dominant-hearing loss. Several mutations in the MYO1A gene were found to be associated with hearing loss (table 1) (Donaudy et al., 2003). In particular, the substitution E385D has been characterized to disrupt the mechanochemical coupling and subcellular targeting of Myosin-1a (Yengo et al., 2008).

References Matsudaira PT, Burgess DR. Identification and organization of the components in the isolated microvillus cytoskeleton. J Cell Biol. 1979 Dec;83(3):667-73

Collins JH, Borysenko CW. The 110,000-dalton actin- and calmodulin-binding protein from intestinal brush border is a myosin-like ATPase. J Biol Chem. 1984 Nov 25;259(22):14128-35

Chantret I, Barbat A, Dussaulx E, Brattain MG, Zweibaum A. Epithelial polarity, villin expression, and enterocytic differentiation of cultured human colon carcinoma cells: a survey of twenty cell lines. Cancer Res. 1988 Apr 1;48(7):1936-42

West AB, Isaac CA, Carboni JM, Morrow JS, Mooseker MS, Barwick KW. Localization of villin, a cytoskeletal protein specific to microvilli, in human ileum and colon and in colonic neoplasms. Gastroenterology. 1988 Feb;94(2):343-52

Beaulieu JF, Weiser MM, Herrera L, Quaroni A. Detection and characterization of sucrase-isomaltase in adult human colon and in colonic polyps. Gastroenterology. 1990 Jun;98(6):1467-77

Coluccio LM, Bretscher A. Mapping of the microvillar 110K-calmodulin complex (brush border myosin I). Identification of fragments containing the catalytic and F-actin-binding sites and demonstration of a calcium ion dependent conformational change. Biochemistry. 1990 Dec 18;29(50):11089-94

Skowron JF, Mooseker MS. Cloning and characterization of mouse brush border myosin-I in adult and embryonic intestine. J Exp Zool. 1999 Feb 15;283(3):242-57

Dumont RA, Zhao YD, Holt JR, Bähler M, Gillespie PG. Myosin-I isozymes in neonatal rodent auditory and vestibular epithelia. J Assoc Res Otolaryngol. 2002 Dec;3(4):375-89

Donaudy F, Ferrara A, Esposito L, Hertzano R, Ben-David

O, Bell RE, Melchionda S, Zelante L, Avraham KB, Gasparini P. Multiple mutations of MYO1A, a cochlear-expressed gene, in sensorineural hearing loss. Am J Hum Genet. 2003 Jun;72(6):1571-7

Krendel M, Mooseker MS. Myosins: tails (and heads) of functional diversity. Physiology (Bethesda). 2005 Aug;20:239-51

Tyska MJ, Mackey AT, Huang JD, Copeland NG, Jenkins NA, Mooseker MS. Myosin-1a is critical for normal brush border structure and composition. Mol Biol Cell. 2005 May;16(5):2443-57

Kilpinen S, Autio R, Ojala K, Iljin K, Bucher E, Sara H, Pisto T, Saarela M, Skotheim RI, Björkman M, Mpindi JP, Haapa-Paananen S, Vainio P, Edgren H, Wolf M, Astola J, Nees M, Hautaniemi S, Kallioniemi O. Systematic bioinformatic analysis of expression levels of 17,330 human genes across 9,783 samples from 175 types of healthy and pathological tissues. Genome Biol. 2008;9(9):R139

Yengo CM, Ananthanarayanan SK, Brosey CA, Mao S, Tyska MJ. Human deafness mutation E385D disrupts the mechanochemical coupling and subcellular targeting of myosin-1a. Biophys J. 2008 Jan 15;94(2):L5-7

McConnell RE, Higginbotham JN, Shifrin DA Jr, Tabb DL, Coffey RJ, Tyska MJ. The enterocyte microvillus is a vesicle-generating organelle. J Cell Biol. 2009 Jun 29;185(7):1285-98

Nambiar R, McConnell RE, Tyska MJ. Control of cell membrane tension by myosin-I. Proc Natl Acad Sci U S A. 2009 Jul 21;106(29):11972-7

McConnell RE, Tyska MJ. Leveraging the membrane - cytoskeleton interface with myosin-1. Trends Cell Biol. 2010 Jul;20(7):418-26

Nambiar R, McConnell RE, Tyska MJ. Myosin motor function: the ins and outs of actin-based membrane protrusions. Cell Mol Life Sci. 2010 Apr;67(8):1239-54

Mazzolini R, Dopeso H, Mateo-Lozano S, Chang W, Rodrigues P, Bazzocco S, Alazzouzi H, Landolfi S, Hernández-Losa J, Andretta E, Alhopuro P, Espín E, Armengol M, Tabernero J, Ramón y Cajal S, Kloor M, Gebert J, Mariadason JM, Schwartz S Jr, Aaltonen LA, Mooseker MS, Arango D. Brush border myosin Ia has tumor suppressor activity in the intestine. Proc Natl Acad Sci U S A. 2012 Jan 31;109(5):1530-5

Mazzolini R, Rodrigues P, Bazzocco S, Dopeso H, Ferreira AM, Mateo-Lozano S, Andretta E, Woerner SM, Alazzouzi H, Landolfi S, Hernandez-Losa J, Macaya I, Suzuki H, Ramón y Cajal S, Mooseker MS, Mariadason JM, Gebert J, Hofstra RM, Reventós J, Yamamoto H, Schwartz S Jr, Arango D. Brush border myosin Ia inactivation in gastric but not endometrial tumors. Int J Cancer. 2013 Apr 15;132(8):1790-9


Arango del Corro D, Mazzolini R. MYO1A (myosin IA). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):565-570.

Gene Section Review



INIST-CNRS

OPEN ACCESS JOURNAL

NR1H4 (nuclear receptor subfamily 1, group H, member 4) Oscar Briz, Elisa Herraez, Jose JG Marin

Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), Biomedical Research Institute of Salamanca (IBSAL), University of Salamanca, Salamanca, Spain and National Institute of Health, Carlos III, Center for the Study of Liver and Gastrointestinal Diseases (CIBERehd), Madrid, Spain (OB, EH, JJGM), Department of Physiology and Pharmacology, University of Salamanca, Campus Miguel de Unamuno E.D. S-09, 37007 - Salamanca, Spain (JJGM)


Online updated version : http://AtlasGeneticsOncology.org/Genes/NR1H4ID46032ch12q23.html DOI: 10.4267/2042/54011


Abstract Review on NR1H4, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

Identity Other names: BAR, FXR, HRR-1, HRR1, RIP14

HGNC (Hugo): NR1H4

Location: 12q23.1

DNA/RNA Description In humans, FXR is encoded by the NR1H4 gene, consisted of 11 exons and 10 introns.

Transcription 4 alternatively spliced transcript variants encoding different isoforms have been described for this gene. Variants 3 and 4 contain an alternate 5'-terminal exon resulting in isoforms FXRα2 longer than FXRα1, coding by variants 2 and 5, with a distinct N-terminus due to translation initiation from an alternate in-frame start codon in the exon 3. Use of an alternate in-frame donor splice site at exon 5 results in FXRα1(-) and FXRα2(-) variants that miss a 4 amino acid segment compared to FXRα1(+) and FXRα2(+) isoforms.

Pseudogene A pseudogene of FXR has been located on chromosome 1 (1p13.1-1p13.3) (Pseudogene.org).

A. NR1H4 gene structure. Schematic representation of the NR1H4 gene into 11 exons showing the alternative splicing and the start triplets that generate the 4 known isoforms. These have been classified according to the difference in the initial region of mRNA (α1 and α2) and the presence (+) or absence (-) of a 12-bp insert in the exon 5.

NR1H4 (nuclear receptor subfamily 1, group H, member 4) Briz O, et al.


B. NCBI reference sequences for FXR variants and isoforms. Variants 1 and 6, and variants 2 and 5 encode the same isoforms.

Protein Note FXR is a ligand-activated transcription factor belonging to the nuclear receptor superfamily.

Description FXR shares the typical structure of other nuclear receptors, including the N-terminal DNA binding domain (DBD) and the C-terminal ligand binding domain (LBD) (Modica et al., 2010). DBD contains two zinc fingers motifs involved in DNA binding and dimerization with RXRα. Hinge region connects the DBD with the LBD, and contains the insert of the amino acid sequence MYTG in the FXRα1/2(+) isoforms. Ligand-independent (AF-1) and -dependent (AF-2) transactivation domains involved in the interaction with co-repressors and co-activators are located in N- and C-termini, respectively.

Expression FXR is expressed at high levels in the liver, small

intestine, kidney and adrenal gland (Huber et al., 2002). Lower FXR levels can be detected in other organs forming the gastrointestinal tract, pancreas, breast and endothelial cells. The liver predominantly expresses FXRα1(+/-), whereas FXRα2(+/-) are the most abundant isoforms in kidney and intestine. In all cases, the proportion of FXRα(1/2)(+) and FXRα(1/2)(-) isoforms is approximately 50% (Vaquero et al., 2013b).

Localisation When activated FXR translocates to the nucleus.

Function Binding of bile acids, the natural ligands of FXR, to the receptor leads its translocation to the cell nucleus, formation of a heterodimer RXRα and binding to FXR response elements on DNA, which activates the transcription of its target genes. Among FXR target genes are those encoding most of the proteins involved in bile acid metabolism and transport (Modica et al., 2010).

FXR isoforms. Schematic representation of FXR isoforms classified based on the presence of the exons 1 and 2 (FXRα1) or 3 (FXRα2) in the initial region of the mRNA and the presence (+) or the absence (-) of the amino acid sequence MYTG in exon 5. AF1 and AF2: ligand-independent and -dependent transactivation domains, respectively; DBD: DNA binding domain; H: hinge region; LBD: ligand binding domain.



Definition, nomenclature, and allelic frequency of clinically relevant NR1H4 genetic variants. MAF refers to the frequency at which the less common allele occurs in a given population according to the NCBI SNP database. Nucleotide positions refer to the ORF of the NM_005123 sequence. Amino acid positions refer to the NP_005114 (FXRα1(-)) or NP_001193921 (FXRα2(-)) proteins. AF-1, ligand-independent transactivation domain. Additional target genes have recently been described to be involved in FXR-mediated regulation of several body functions, such as prevention of hepatic and intestinal carcinogenesis, liver regeneration, intestinal barrier, attenuation of adverse effects of cholestasis, prevention of gallstone formation, and chemoprotection (Vaquero et al., 2013a). Some of the effects of FXR are mediated by the induction of the small heterodimer partner (SHP), a negative regulator encoded by the NR0B2 gene. This transcription factor interacts with other nuclear receptors blocking its activation. Glucocorticoids are able to directly activate FXR but they also antagonize the expression of FXR and its target genes (Rosales et al., 2013).

Homology DBD domain is a highly conserved domain, whereas LBD domain is moderately conserved in sequence and highly conserved in structure between the various nuclear receptors (Modica et al., 2010). According to sequence homology NR1H4 has been included into the liver-X-receptor-like group of genes belonging to the thyroid hormone receptor-like subfamily of nuclear receptors, together with NR1H2 (liver X receptor-β) and NR1H3 (liver X receptor-α).

Mutations Note The presence of missense mutations in the NR1H4 gene is unusual, suggesting an important role of this gene in the maintenance of organ function and cellular homeostasis.

Somatic c.-1G>T is a common variation resulting in reduced translation efficiency (Marzolini et al., 2007) that might predispose to inflammatory bowel diseases (Attinkara et al., 2012) and intrahepatic cholestasis of pregnancy (Van Mil et al., 2007). c.-189-1174G>A and c.-190+7064C>T are intronic SNP that have been associated with an altered glucose

and lipid metabolism (Heni et al., 2013). c.1A>G and c.518T>C are two rare mutations in the coding sequence of FXR whose consequence is a reduction of the function of the protein. Both predispose to intrahepatic cholestasis of pregnancy (Van Mil et al., 2007).Implicated in

Hepatocellular carcinoma and cholangiocarcinoma Note FXR is reduced in liver cancer suggesting that FXR is rather working as a tumour suppressor. Knockout mice for FXR spontaneously developed liver tumours after several months. A potential contribution of FXR in tumour suppression can be attributed to its anti-fibrogenic properties in liver. It has also been proposed a role of FXR in prevention of hepatocarcinogenesis by inhibiting the expression of gankyrin (PSMD10), which is activated in liver cancer and modifies the expression of tumour suppressor genes, including Rb, p53, C/EBPα, HNF4α, and p16.

Colon cancer Note Emerging evidences support an important role for FXR in intestinal carcinogenesis. FXR mRNA expression is decreased in colonic polyps, and even more pronounced in colonic adenocarcinoma. Even before carcinomas have formed, FXR loss led to extensive mucosal infiltration of neutrophils and macrophages along with increased TNF-α mRNA expression and nuclear β-catenin accumulation. FXR deficiency led to increased susceptibility to tumour development by promoting WTN-β-catenin signalling through TNF-α released by infiltrated macrophages. In contrast to this indirect oncosupressive role of FXR, by maintaining intestinal epithelium integrity, FXR also carries out a direct oncosupressor activity. Thereby, several data suggest that FXR activation enhances apoptosis and inhibits cell proliferation by increasing the expression of proapoptotic genes



including p21, BAK1, FADD, and repressing antiapoptotic genes, such as BCL-2.

Chemoresistance Note Ligand-dependent and independent activation of FXR and/or its signalling pathway is involved in the chemoprotective response of liver cells. This is due in part to changes in the expression of several genes (ABCB4, TCEA2, CCL14, CCL15 and KRT13) accounting for different MOC, mainly these involved in drug efflux (MOC-1b), DNA repair (MOC-4) and cell survival (MOC-5b). Moreover, this characteristic is shared by healthy and tumour cells, and hence may play an important role in enhancing the chemoprotection of healthy hepatocytes against genotoxic compounds and reducing the response of liver tumour cells to certain pharmacological treatments.

Disease The development of chemoresistance depends on the expression of the genes involved in a variety of mechanisms of chemoresistance (MOC), which are present in both healthy tissues, where they are involved in the defence against the chemical stress caused by potentially toxic compounds, and in cancer cells, where they account for the poor response to antitumour drugs.

Cholestasis Note FXR has a crucial role in maintaining bile acid homeostasis, especially during cholestasis. Upon activation by enhanced bile acid levels FXR mediates responses that partially protect the hepatocyte from the deleterious effect of accumulation of toxic bile acids. FXR inhibits bile acid synthesis in liver, through down-regulation of key enzymes in bile acid biosynthesis, such as CYP7A1 and CYP8B1. It also diminishes bile acid uptake by hepatocytes by repressing the expression of Na+-taurocholate cotransporting polypeptide or NTCP (gene symbol SLC10A1), and increases bile acid efflux by inducing the expression of ABC proteins at the canalicular membrane, such as including BSEP (ABCB11) and MDR3 (ABCB4) involved in bile acid-dependent phospholipid secretion. FXR up-regulates the phase II enzymes uridine 5'-diphosphate-glucuronosyltransferase 2B4 (UGT2B4) and sulphotransferase 2A1 (SULT2A1), which glucuronidate or sulphate bile acids to render them more hydrophilic, less biologically active, and more easily to be eliminated from the body. In the intestine FXR-induced reduction of bile acid uptake by enterocytes due to transcriptional repression of ASBT (SLC10A2), which enhances bile acid faecal loss. Moreover, FXR increases the transcription of FGF19 in the ileum, triggering a signalling pathway

that represses hepatic CYP7A1 expression, and hence down-regulation of bile acid synthesis.

Disease Cholestasis, which is characterized by the accumulation of bile acids in liver and is associated with reduced detoxification capacity.

Cirrhosis Note FXR is expressed in hepatic stellate cells, and its activation reduces the expression of extracellular matrix proteins by these cells, preventing liver fibrosis.

Disease Cirrhosis is a result of advanced liver disease that is characterized by replacement of liver tissue by fibrosis and regenerative nodules, leading loss of liver function.

Cholelithiasis Note FXR prevents gallstone formation by up-regulation of ABC proteins accounting for canalicular secretion of bile acids (BSEP) and phospholipids (MDR3), resulting in enhanced mixed micelle formation capability and, hence prevention of cholesterol crystallization in bile.

Disease Cholelithiasis is a pathological situation characterized by presence in the gallbladder, of stones, a crystalline concretion formed by accretion of bile components.

Hepatic regeneration Note FXR participates in bile acid-induced liver repair by promoting regeneration through regulation of the FoxM1b expression, a Forkhead Box transcription factor, which regulates cell cycle progression during liver regeneration. Moreover, FXR helps restoration of organ homeostasis.

Disease Liver regeneration after loss of hepatic tissue is an adaptive response to repair injury consisting of induction of proliferative factors that activate the quiescent hepatocytes, followed by re-establishment of normal liver size and renewed hepatocyte quiescence.

Intestinal diseases Note FXR plays an important role in the protection against bacterial overgrowth and the maintenance of intestinal barrier function, and it has recently been involved in the pathogenesis of idiopathic inflammatory bowel disease. FXR activation in the intestinal tract decreases the production of proinflammatory cytokines such as IL1-β, IL-2, IL-



6, tumour necrosis factor-alpha (TNF-α) and interferon-gamma (IFN-γ), thus contributing to a reduction of inflammation and epithelial permeability. In addition, intestinal FXR activation induces the expression of genes with antibacterial properties involved in enteroprotection and prevention of bacterial translocation in the intestinal tract, including angiogenin, carbonic anhydrase 12 or inducible nitric oxide synthase.

Disease Intestinal bacterial proliferation and translocation, chronic diarrhoea and inflammatory bowel disease.

Breakpoints Note NR1H4 gene is not involved in breakpoint regions.

References Huber RM, Murphy K, Miao B, Link JR, Cunningham MR, Rupar MJ, Gunyuzlu PL, Haws TF, Kassam A, Powell F, Hollis GF, Young PR, Mukherjee R, Burn TC. Generation of multiple farnesoid-X-receptor isoforms through the use of alternative promoters. Gene. 2002 May 15;290(1-2):35-43

Marzolini C, Tirona RG, Gervasini G, Poonkuzhali B, Assem M, Lee W, Leake BF, Schuetz JD, Schuetz EG, Kim RB. A common polymorphism in the bile acid receptor farnesoid X receptor is associated with decreased hepatic target gene expression. Mol Endocrinol. 2007 Aug;21(8):1769-80

Van Mil SW, Milona A, Dixon PH, Mullenbach R, Geenes VL, Chambers J, Shevchuk V, Moore GE, Lammert F, Glantz AG, Mattsson LA, Whittaker J, Parker MG, White R, Williamson C. Functional variants of the central bile acid

sensor FXR identified in intrahepatic cholestasis of pregnancy. Gastroenterology. 2007 Aug;133(2):507-16

Modica S, Gadaleta RM, Moschetta A. Deciphering the nuclear bile acid receptor FXR paradigm. Nucl Recept Signal. 2010 Nov 19;8:e005

Attinkara R, Mwinyi J, Truninger K, Regula J, Gaj P, Rogler G, Kullak-Ublick GA, Eloranta JJ. Association of genetic variation in the NR1H4 gene, encoding the nuclear bile acid receptor FXR, with inflammatory bowel disease. BMC Res Notes. 2012 Aug 28;5:461

Heni M, Wagner R, Ketterer C, Böhm A, Linder K, Machicao F, Machann J, Schick F, Hennige AM, Stefan N, Häring HU, Fritsche A, Staiger H. Genetic variation in NR1H4 encoding the bile acid receptor FXR determines fasting glucose and free fatty acid levels in humans. J Clin Endocrinol Metab. 2013 Jul;98(7):E1224-9

Rosales R, Romero MR, Vaquero J, Monte MJ, Requena P, Martinez-Augustin O, Sanchez de Medina F, Marin JJ. FXR-dependent and -independent interaction of glucocorticoids with the regulatory pathways involved in the control of bile acid handling by the liver. Biochem Pharmacol. 2013 Mar 15;85(6):829-38

Vaquero J, Briz O, Herraez E, Muntané J, Marin JJ. Activation of the nuclear receptor FXR enhances hepatocyte chemoprotection and liver tumor chemoresistance against genotoxic compounds. Biochim Biophys Acta. 2013a Oct;1833(10):2212-9

Vaquero J, Monte MJ, Dominguez M, Muntané J, Marin JJ. Differential activation of the human farnesoid X receptor depends on the pattern of expressed isoforms and the bile acid pool composition. Biochem Pharmacol. 2013b Oct 1;86(7):926-39


Briz O, Herraez E, Marin JJG. NR1H4 (nuclear receptor subfamily 1, group H, member 4). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):571-575.

Gene Section Review



INIST-CNRS

OPEN ACCESS JOURNAL

PRND (Prion Protein 2 (Dublet)) Gabriele Giachin, Giuseppe Legname

Laboratory of Prion Biology, Department of Neuroscience, Scuola Internazionale Superiore di Studi Avanzati (SISSA), via Bonomea 265, Trieste, Italy (GG, GL)


Online updated version : http://AtlasGeneticsOncology.org/Genes/PRNDID44172ch20p13.html DOI: 10.4267/2042/54012


Abstract Review on PRND, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

Identity Other names: DOPPEL, DPL, PrPLP, dJ1068H6.4

HGNC (Hugo): PRND

Location: 20p13

Local order: PRND lies 27 kb downstream the human prion protein gene (PRNP). PRNP starts at 4702556 and ends at 4709106 bps.

Note: PRND and PRNP genes form the prion gene complex and are regulated by their own promoter. Doppel is an acronym derived from downstream prion protein-like gene (Moore et al., 2001). PRNP and PRND are believed to arise through duplication of a single ancestral gene (Mastrangelo and Westaway, 2001).

DNA/RNA Note The Prnd gene was originally identified in mice during DNA sequencing of the cosmid clone isolated from the I/LnJ inbred mice strain (Lee et al., 1998).

This gene was discovered in transgenic (Tg) mice where the Prnp gene was ablated (Prnp0/0 mice strains) resulting in a diseased phenotype characterized by loss of Purkinje cells in the cerebellum. Interestingly, Prnp deletion in these mouse lines resulted in the formation of a chimeric Prnd transcript under the control of the strong Prnp promoter. Thus, these studies have shown that only the ectopic expression of Dpl, rather than the absence of the Prnp gene, caused neurodegeneration (Li et al., 2000).

Description The PRND gene includes two exons separated by one intron. Exon 2 encodes for the Doppel protein.

Transcription Prnd RNA transcription has been reported in different tissues of adult wild-type (WT) mice including testis, heart, spleen and skeletal muscle (Li et al., 2000). In neonatal mice up to 3 weeks, Prnd RNA has been detected in brain blood vessel endothelial cells (Li et al., 2000).

Pseudogene Prnd pseudogenes have been identified in non-mammalian organisms as Anolis (lizard) and Xenopus (frog) (Harrison et al., 2010).

Schematic structural representation of the human PRN locus on chromosome 20p13 containing PRNP, PRND and the putative testis-specific prion protein (PRNT) genes.

PRND (Prion Protein 2 (Dublet)) Giachin G, Legname G


Schematic representation of the PRND gene. Exon 1 starts at 4705556 bp and ends at 4702615 bp. Exon 2 containing the Doppel open reading frame (ORF) starts at 4705187 bp and ends at 4709106 bp. The sequence surrounding the splice acceptor site is shown with intronic nucleotides in lower case, exonic nucleotides in capital letters and Met start codon ATG underlined.

Protein Note Doppel tertiary structure has a fold similar to that of the cellular prion protein, PrPC (encoded by PRNP or Prnp genes) although it shares approximately 25% of aminoacidic sequence identity with PrPC.

Description The immature form of human Doppel includes 176 residues with two N- and C-terminal signal peptides cleaved during protein maturation. The mature sequence includes 126 amino acids spanning from residues 27 to 152, with a molecular weight of approximately 14.5 kDa. Tryptic digestion and mass spectroscopy studies have identified two distinct disulfide bridges (Cys109-Cys143 and Cys95-Cys148) which strongly stabilize the Doppel folding (Baillod et al., 2013; Silverman et al., 2000; Whyte et al., 2003). PNGase F digestion and immunoblots have reported two N-linked glycosylation sites at codons 99 and 111. The GPI anchor targets the protein at the extracellular membrane. NMR structures of recombinant human and mouse Dopple have been solved (Luhrs et al., 2003; Mo et al., 2001). The NMR structures of the N-terminal murine and ovine signal peptides (residues 1-30) have also been determined (Papadopoulos et al., 2006). The human Doppel NMR structure features a short flexible N-terminal segment comprising residues 24-51 and a globular domain including four α-helices (α1: residues 72-80; α2a: residues 101-115; α2b: residues 117-121; α3: residues 127-141) and a short two-stranded anti-parallel β-sheet (β1: residues 58-60; β2: residues 88-90) (Luhrs et al., 2003).

Expression Under physiological conditions Doppel is mostly expressed in testis and, in particular, in spermatozoa and Sertoli cells (Behrens et al., 2002; Peoc'h et al., 2002). Additionally, Doppel is expressed with PrPC in spleen cells, notably B

lymphocytes, granulocytes and dendritic cells (Cordier-Dirikoc et al., 2008).

Localisation Doppel is attached to the cell membrane through its GPI anchor (Silverman et al., 2000). A study has shown Doppel localization in detergent-resistant membranes or lipid rafts (Caputo et al., 2010).

Function The Doppel expression in spermatozoa and Sertoli cells infers a role in spermatogenesis. Male Tg mice knock-out for Prnd were sterile, clearly indicating that Doppel plays a role in male reproduction as critical regulator of spermatogenesis and sperm-egg interaction (Behrens et al., 2002). Doppel may enhance in vitro ovine spermatozoa fertilizing ability (Pimenta et al., 2012). Doppel has been implicated in early testis differentiation (Kocer et al., 2007). The detection of Prnd mRNA in brain blood vessel endothelial cells might indicate a possible role in the development of brain blood vessels (Li et al., 2000). The observation that Doppel is expressed with PrPC in B lymphocytes, granulocytes and dendritic cells argues for a role in cell-cell interaction in the immunosystem (Cordier-Dirikoc et al., 2008). Several evidence showed that Doppel is able to coordinate in vitro the binding of copper ions with high affinity (Cereghetti et al., 2004; La Mendola et al., 2010; Qin et al., 2003).

Mutations Note Different polymorphic variants have been identified in PRND. The effect of polymorphisms in Doppel function and their implication in the diseases have not been fully clarified.

Germinal S6I, S22P, T26P, H31R, P56L, F70L, L149S, T174M (Clark et al., 2003; Moore et al., 1999; Peoc'h et al., 2000; Schroder et al., 2001).



A) Primary sequence alignment between human PrPC (GenBank: BAG32277.1) and human Doppel (NCBI Reference Sequence: NP_036541.2). B) Secondary structure motives of human PrPC and Doppel. Highlighted: signal peptides, N-linked glycosylation sites (CHO), disulfide bridges (S-S) and Glycosylphosphatidylinisotol (GPI) anchor. C) Tertiary NMR structures of Doppel (pdb id 1LG4) and PrPC (2LSB).



Implicated in Ectopic Doppel expression associated with Purkinje cell neurodegeneration in transgenic mouse models. Note Beside its role in male reproductive system, Doppel has attracted interest for its neurotoxic properties when ectopically expressed in the brain of Tg mice knock-out for the prion protein gene (Prnp0/0 mice). In these mice, denoted as Ngsk PrP-/-, the Doppel-encoding exon was expressed as chimeric mRNA due to the intergenic splicing taking place between Prnp and Prnd. As a result, Prnd became abnormally regulated under the control of Prnp promoter and ectopically expressed in the brain and, in particular, in neurons and glial cells (Li et al., 2000). Similar non-physiological Doppel expression was reported in other Tg mouse lines knock-out for Prnp such as Rcm0 and Zrch mice (Moore et al., 2001; Rossi et al., 2001). Doppel expression in the brain is neurotoxic and causes Purkinje cell degeneration in these mouse models. Doppel neurotoxicity is antagonized by the PrPC N-terminal domain (Atarashi et al., 2003; Yamaguchi et al., 2004). The neuroprotective PrPC role against ectopic Doppel expression has been reported also in human neuronal SH-SY5Y cells (Li et al., 2009) confirming the dominant-negative effects of the PrPC N-terminal region (Yoshikawa et al., 2008). The molecular mechanisms leading to Doppel-induced neurodegeneration in Purkinje and granular cells are still controversial. An earlier study has reported that the chimeric form of Doppel fused to a Fc domain binds specifically granule cells and causes neurodegeneration, raising the possibility that these specific cells expressed a still unidentified protein that mediates the Doppel-induced neurotoxicity (Legname et al., 2002). Oxidative stress may play a role in Doppel-induced neuronal death since NOS activity is induced by Doppel in vitro and in vivo (Cui et al., 2003; Wong et al., 2001). Two independent groups have reported that BAX contributes to Doppel-induced apoptosis (Didonna et al., 2012; Heitz et al., 2007) and that BCL-2 antagonizes Doppel neurotoxicity (Heitz et al., 2008). Another work has observed that ectopic Doppel expression in the brain elicits neurodegeneration through the binding of two metalloproteinase namely the alpha-1-inhibitor-3 (α1I3) and the alpha-2-macroglobin (α2M) (Benvegnu et al., 2009).

Abnormal Doppel expression levels in human astrocytomas and other non-glial brain tumor specimens Note Doppel is aberrantly expressed in astrocytic tumors where it displays cytoplasmic, nuclear and lysosomal localization and molecular properties (i.e. altered glycosilation pattern) different from Doppel as normally expressed in testis (Azzalin et al., 2006; Azzalin et al., 2008; Comincini et al., 2006; Comincini et al., 2004; Comincini et al., 2007; Rognoni et al., 2010; Sbalchiero et al., 2008).

References Lee IY, Westaway D, Smit AF, Wang K et al.. Complete genomic sequence and analysis of the prion protein gene region from three mammalian species. Genome Res. 1998 Oct;8(10):1022-37

Moore RC, Lee IY, Silverman GL et al.. Ataxia in prion protein (PrP)-deficient mice is associated with upregulation of the novel PrP-like protein doppel. J Mol Biol. 1999 Oct 1;292(4):797-817

Li A, Sakaguchi S, Atarashi R, Roy BC et al.. Identification of a novel gene encoding a PrP-like protein expressed as chimeric transcripts fused to PrP exon 1/2 in ataxic mouse line with a disrupted PrP gene. Cell Mol Neurobiol. 2000 Oct;20(5):553-67

Peoc'h K, Guérin C, Brandel JP et al.. First report of polymorphisms in the prion-like protein gene (PRND): implications for human prion diseases. Neurosci Lett. 2000 Jun 2;286(2):144-8

Silverman GL, Qin K, Moore RC, Yang Y et al.. Doppel is an N-glycosylated, glycosylphosphatidylinositol-anchored protein. Expression in testis and ectopic production in the brains of Prnp(0/0) mice predisposed to Purkinje cell loss. J Biol Chem. 2000 Sep 1;275(35):26834-41

Mastrangelo P, Westaway D. The prion gene complex encoding PrP(C) and Doppel: insights from mutational analysis. Gene. 2001 Sep 5;275(1):1-18

Mo H, Moore RC, Cohen FE, Westaway D et al.. Two different neurodegenerative diseases caused by proteins with similar structures. Proc Natl Acad Sci U S A. 2001 Feb 27;98(5):2352-7

Moore RC, Mastrangelo P, Bouzamondo E et al.. Doppel-induced cerebellar degeneration in transgenic mice. Proc Natl Acad Sci U S A. 2001 Dec 18;98(26):15288-93

Rossi D, Cozzio A, Flechsig E et al.. Onset of ataxia and Purkinje cell loss in PrP null mice inversely correlated with Dpl level in brain. EMBO J. 2001 Feb 15;20(4):694-702

Schröder B, Franz B, Hempfling P, Selbert M et al.. Polymorphisms within the prion-like protein gene (Prnd) and their implications in human prion diseases, Alzheimer's disease and other neurological disorders. Hum Genet. 2001 Sep;109(3):319-25

Wong BS, Liu T, Paisley D, Li R, Pan T et al.. Induction of HO-1 and NOS in doppel-expressing mice devoid of PrP: implications for doppel function. Mol Cell Neurosci. 2001 Apr;17(4):768-75

Behrens A, Genoud N et al.. Absence of the prion protein homologue Doppel causes male sterility. EMBO J. 2002



Jul 15;21(14):3652-8

Legname G, Nelken P, Guan Z, Kanyo ZF, DeArmond SJ, Prusiner SB. Prion and doppel proteins bind to granule cells of the cerebellum. Proc Natl Acad Sci U S A. 2002 Dec 10;99(25):16285-90

Peoc'h K, Serres C, Frobert Y, Martin C et al.. The human "prion-like" protein Doppel is expressed in both Sertoli cells and spermatozoa. J Biol Chem. 2002 Nov 8;277(45):43071-8

Atarashi R, Nishida N et al.. Deletion of N-terminal residues 23-88 from prion protein (PrP) abrogates the potential to rescue PrP-deficient mice from PrP-like protein/doppel-induced Neurodegeneration. J Biol Chem. 2003 Aug 1;278(31):28944-9

Clark HF, Gurney AL, Abaya E, Baker K et al.. The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. Genome Res. 2003 Oct;13(10):2265-70

Cui T, Holme A, Sassoon J, Brown DR. Analysis of doppel protein toxicity. Mol Cell Neurosci. 2003 May;23(1):144-55

Lührs T, Riek R, Güntert P, Wüthrich K. NMR structure of the human doppel protein. J Mol Biol. 2003 Mar 7;326(5):1549-57

Qin K, Coomaraswamy J et al.. The PrP-like protein Doppel binds copper. J Biol Chem. 2003 Mar 14;278(11):8888-96

Whyte SM, Sylvester ID, Martin SR, Gill AC et al.. Stability and conformational properties of doppel, a prion-like protein, and its single-disulphide mutant. Biochem J. 2003 Jul 15;373(Pt 2):485-94

Cereghetti GM, Negro A et al.. Copper(II) binding to the human Doppel protein may mark its functional diversity from the prion protein. J Biol Chem. 2004 Aug 27;279(35):36497-503

Comincini S, Facoetti A, Del Vecchio I et al.. Differential expression of the prion-like protein doppel gene (PRND) in astrocytomas: a new molecular marker potentially involved in tumor progression. Anticancer Res. 2004 May-Jun;24(3a):1507-17

Yamaguchi N, Sakaguchi S et al.. Doppel-induced Purkinje cell death is stoichiometrically abrogated by prion protein. Biochem Biophys Res Commun. 2004 Jul 9;319(4):1247-52

Azzalin A, Del Vecchio I, Ferretti L, Comincini S. The prion-like protein Doppel (Dpl) interacts with the human receptor for activated C-kinase 1 (RACK1) protein. Anticancer Res. 2006 Nov-Dec;26(6B):4539-47

Comincini S, Chiarelli LR, Zelini P et al.. Nuclear mRNA retention and aberrant doppel protein expression in human astrocytic tumor cells. Oncol Rep. 2006 Dec;16(6):1325-32

Papadopoulos E, Oglecka K, Mäler L et al.. NMR solution structure of the peptide fragment 1-30, derived from unprocessed mouse Doppel protein, in DHPC micelles. Biochemistry. 2006 Jan 10;45(1):159-66

Comincini S, Ferrara V, Arias A et al.. Diagnostic value of PRND gene expression profiles in astrocytomas: relationship to tumor grades of malignancy. Oncol Rep. 2007 May;17(5):989-96

Heitz S, Lutz Y, Rodeau JL, Zanjani H et al.. BAX contributes to Doppel-induced apoptosis of prion-protein-deficient Purkinje cells. Dev Neurobiol. 2007 Apr;67(5):670-86

Kocer A, Gallozzi M, Renault L, Tilly G et al.. Goat PRND expression pattern suggests its involvement in early sex differentiation. Dev Dyn. 2007 Mar;236(3):836-42

Azzalin A, Sbalchiero E, Barbieri G, Palumbo S, Muzzini C, Comincini S. The doppel (Dpl) protein influences in vitro migration capability in astrocytoma-derived cells. Cell Oncol. 2008;30(6):491-501

Cordier-Dirikoc S, Zsürger N, Cazareth J, Ménard B, Chabry J. Expression profiles of prion and doppel proteins and of their receptors in mouse splenocytes. Eur J Immunol. 2008 Aug;38(8):2131-41

Heitz S, Gautheron V, Lutz Y, Rodeau JL et al.. BCL-2 counteracts Doppel-induced apoptosis of prion-protein-deficient Purkinje cells in the Ngsk Prnp(0/0) mouse. Dev Neurobiol. 2008 Feb 15;68(3):332-48

Sbalchiero E, Azzalin A, Palumbo S et al.. Altered cellular distribution and sub-cellular sorting of doppel (Dpl) protein in human astrocytoma cell lines. Cell Oncol. 2008;30(4):337-47

Yoshikawa D, Yamaguchi N, Ishibashi D et al.. Dominant-negative effects of the N-terminal half of prion protein on neurotoxicity of prion protein-like protein/doppel in mice. J Biol Chem. 2008 Aug 29;283(35):24202-11

Benvegnù S, Franciotta D, Sussman J et al.. Prion protein paralog doppel protein interacts with alpha-2-macroglobulin: a plausible mechanism for doppel-mediated neurodegeneration. PLoS One. 2009 Jun 18;4(6):e5968

Caputo A, Sarnataro D, Campana V, Costanzo M, Negro A, Sorgato MC, Zurzolo C. Doppel and PrPC co-immunoprecipitate in detergent-resistant membrane domains of epithelial FRT cells. Biochem J. 2009 Dec 23;425(2):341-51

Li P, Dong C, Lei Y, Shan B, Xiao X et al.. Doppel-induced cytotoxicity in human neuronal SH-SY5Y cells is antagonized by the prion protein. Acta Biochim Biophys Sin (Shanghai). 2009 Jan;41(1):42-53

Harrison PM, Khachane A, Kumar M. Genomic assessment of the evolution of the prion protein gene family in vertebrates. Genomics. 2010 May;95(5):268-77

La Mendola D, Magrì A, Campagna T et al.. A doppel alpha-helix peptide fragment mimics the copper(II) interactions with the whole protein. Chemistry. 2010 Jun 1;16(21):6212-23

Rognoni P, Chiarelli LR, Comincini S et al.. Biochemical signatures of doppel protein in human astrocytomas to support prediction in tumor malignancy. J Biomed Biotechnol. 2010;2010:301067

Didonna A, Sussman J, Benetti F, Legname G. The role of Bax and caspase-3 in doppel-induced apoptosis of cerebellar granule cells. Prion. 2012 Jul 1;6(3):309-16

Pimenta J, Dias FM, Marques CC et al.. The prion-like protein Doppel enhances ovine spermatozoa fertilizing ability. Reprod Domest Anim. 2012 Apr;47(2):196-202

Baillod P, Garrec J, Tavernelli I, Rothlisberger U. Prion versus doppel protein misfolding: new insights from replica-exchange molecular dynamics simulations. Biochemistry. 2013 Nov 26;52(47):8518-26


Giachin G, Legname G. PRND (Prion Protein 2 (Dublet)). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):576-580.

Gene Section Short Communication



INIST-CNRS

OPEN ACCESS JOURNAL

WNT1 (wingless-type MMTV integration site family, member 1) Irini Theohari, Lydia Nakopoulou

1st Department of Pathology, Medical School, University of Athens, Athens, Greece (IT, LN)


Online updated version : http://AtlasGeneticsOncology.org/Genes/WNT1ID462ch12q13.html DOI: 10.4267/2042/54013


Abstract Review on WNT1, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

Identity Other names: BMND16, INT1, OI15

HGNC (Hugo): WNT1

Location: 12q13.12

DNA/RNA Description The WNT1 gene spans a genomic region of 4161 bases on plus strand. The DNA of WNT1 consists of 4 exons and the coding sequence starts in the first exon.

Transcription The WNT1 gene has one protein coding transcript which consists of 370 amino acids.

Protein Description Ligand for members of the frizzled family of seven

transmembrane receptors. In some developmental processes, is also a ligand for the coreceptor RYK, thus triggering Wnt signaling.

Localisation Secreted, extracellular space, extracellular matrix.

Function Probable developmental protein. May be a signaling molecule important in CNS (central nervous system) development. Is likely to signal over only few cell diameters. Has a role in osteoblast function and bone development.

Mutations Somatic There are several WNT1 mutations identified related with osteogenesis imperfecta. Several confirmed somatic mutations of the WNT1 gene have also been reported, according to COSMIC, which are associated with carcinomas of the endometrium, lung, large intestine, prostate and kidney.

Genomic location of WNT1 gene at chromosome 12 (plus strand).

WNT1 (wingless-type MMTV integration site family, member 1) Theohari I, Nakopoulou L


Implicated in Esophageal cancer Note It has been shown, in cell cultures of esophageal cancer, that WNT1 results in cytoplasmic accumulation of beta-catenin and activates TCF-dependent transcription (Mizushima et al., 2002). Overexpression of mRNA and protein levels of WNT1 have been positively associated with lymph node metastasis, advanced pathological stage and prognosis of patients with esophageal squamous cell carcinoma (Lv et al., 2012).

Breast cancer Note WNT1 has been shown to be markedly elevated in grade I tumors, but declined as tumor grade declined (Wong et al., 2002). Ectopic expression of WNT1, triggers the DNA damage response (DDR) and an ensuing cascade of events resulting in tumorigenic conversion of primary human mammary epithelial cells. WNT1-transformed cells have high telomerase activity and compromised p53 and Rb function, grow as spheres in suspension, and in mice form tumors that closely resemble medullary carcinomas of the breast (Ayyanan et al., 2006). siRNA anti-WNT1 has been shown to induce apoptosis in human breast cancer cell lines (Wieczorek et al., 2008). WNT1 immunoreactivity has been found to be inversely related to histological grade, Ki-67 and p53, positively to , HER-2 and caspase-3 and has been correlated with

favorable prognosis of patients with stage II breast cancer (Mylona et al., 2013).

Basal cell carcinoma of head and neck Note Overexpression of WNT1 has been positively associated with cytoplasmic beta-catenin (Lo Muzio et al., 2002).

Sarcoma Note WNT1 blockade by either monoclonal antibody or siRNA induces cell death in sarcoma cells (Mikami et al., 2005).

Non-small cell lung cancer (NSCLC) Note The expression of WNT1 has been positively correlated with c-Myc, cyclin D1, VEGF-A, MMP-7, Ki-67 and intratumoral microvessel density and has been found to negatively influence patients' survival (Huang et al., 2008). WNT1 overexpression has been positively associated with the Ki-67 proliferation index and c-Myc and has been found to exert an unfavorable impact on patients' survival (Nakashima et al., 2008). WNT1 expression has been found to be an independent prognostic factor of poor survival (Xu et al., 2011).

Gastric cancer Note The expression levels of WNT1 are positively correlated with tumor size, tumor invasive depth,

WNT1 (wingless-type MMTV integration site family, member 1) Theohari I, Nakopoulou L


lymph node metastasis, pTNM stage and negatively influences patients' 5-year survival rate (Zhang and Xue, 2008).

Neuroblastoma Note Knockdown of endogenous WNT1 expression results in cell death and inhibits cell growth (Zhang et al., 2009).

Osteogenesis imperfecta (OI) Note This disease is a heritable bone fragiility disorder that is usually due to dominant mutations in COL1A1 or COL1A2 and is characterized by reduced bone mass and recurrent fractures. Genetic variations in WNT1 define the bone mineral density quantitative trait locus 16 (BMND16) [MIM:615221]. Variance in bone mineral density influences bone mass, contributes to size determination in the general population, and is a susceptibility factor for osteoporotic fractures. The disease is caused by mutations affecting the gene of WNT1 (Fahiminiya et al., 2013; Faqeih et al., 2013; Laine et al., 2013; Pyott et al., 2013).

Osteoporosis (OSTEOP) Note A systemic skeletal disorder characterized by decreased bone mass and deterioration of bone microarchitecture without alteration in the composition of bone. The result is fragile bones and an increased risk of fractures, even after minimal trauma. Osteoporosis is a chronic condition of multifactorial etiology and is usually clinically silent until a fracture occurs. Disease susceptibility is associated with variations affecting the gene of WNT1 (Keupp et al., 2013; Laine et al., 2013).

References Lo Muzio L, Pannone G, Staibano S, Mignogna MD, Grieco M, Ramires P, Romito AM, De Rosa G, Piattelli A. WNT-1 expression in basal cell carcinoma of head and neck. An immunohistochemical and confocal study with regard to the intracellular distribution of beta-catenin. Anticancer Res. 2002 Mar-Apr;22(2A):565-76

Mizushima T, Nakagawa H, Kamberov YG, Wilder EL, Klein PS, Rustgi AK. Wnt-1 but not epidermal growth factor induces beta-catenin/T-cell factor-dependent transcription in esophageal cancer cells. Cancer Res. 2002 Jan 1;62(1):277-82

Wong SC, Lo SF, Lee KC, Yam JW, Chan JK, Wendy Hsiao WL. Expression of frizzled-related protein and Wnt-signalling molecules in invasive human breast tumours. J Pathol. 2002 Feb;196(2):145-53

Mikami I, You L, He B, Xu Z, Batra S, Lee AY, Mazieres J, Reguart N, Uematsu K, Koizumi K, Jablons DM. Efficacy of Wnt-1 monoclonal antibody in sarcoma cells. BMC Cancer. 2005 May 24;5:53

Ayyanan A, Civenni G, Ciarloni L, Morel C, Mueller N,

Lefort K, Mandinova A, Raffoul W, Fiche M, Dotto GP, Brisken C. Increased Wnt signaling triggers oncogenic conversion of human breast epithelial cells by a Notch-dependent mechanism. Proc Natl Acad Sci U S A. 2006 Mar 7;103(10):3799-804

Huang CL, Liu D, Ishikawa S, Nakashima T, Nakashima N, Yokomise H, Kadota K, Ueno M. Wnt1 overexpression promotes tumour progression in non-small cell lung cancer. Eur J Cancer. 2008 Nov;44(17):2680-8

Nakashima T, Liu D, Nakano J, Ishikawa S, Yokomise H, Ueno M, Kadota K, Huang CL. Wnt1 overexpression associated with tumor proliferation and a poor prognosis in non-small cell lung cancer patients. Oncol Rep. 2008 Jan;19(1):203-9

Wieczorek M, Paczkowska A, Guzenda P, Majorek M, Bednarek AK, Lamparska-Przybysz M. Silencing of Wnt-1 by siRNA induces apoptosis of MCF-7 human breast cancer cells. Cancer Biol Ther. 2008 Feb;7(2):268-74

Zhang H, Xue Y. Wnt pathway is involved in advanced gastric carcinoma. Hepatogastroenterology. 2008 May-Jun;55(84):1126-30

Zhang L, Li K, Lv Z, Xiao X, Zheng J. The effect on cell growth by Wnt1 RNAi in human neuroblastoma SH-SY5Y cell line. Pediatr Surg Int. 2009 Dec;25(12):1065-71

Xu X, Sun PL, Li JZ, Jheon S, Lee CT, Chung JH. Aberrant Wnt1/β-catenin expression is an independent poor prognostic marker of non-small cell lung cancer after surgery. J Thorac Oncol. 2011 Apr;6(4):716-24

Lv J, Cao XF, Ji L, Zhu B, Wang DD, Tao L, Li SQ. Association of β-catenin, Wnt1, Smad4, Hoxa9, and Bmi-1 with the prognosis of esophageal squamous cell carcinoma. Med Oncol. 2012 Mar;29(1):151-60

Fahiminiya S, Majewski J, Mort J, Moffatt P, Glorieux FH, Rauch F. Mutations in WNT1 are a cause of osteogenesis imperfecta. J Med Genet. 2013 May;50(5):345-8

Faqeih E, Shaheen R, Alkuraya FS. WNT1 mutation with recessive osteogenesis imperfecta and profound neurological phenotype. J Med Genet. 2013 Jul;50(7):491-2

Keupp K, Beleggia F, Kayserili H, Barnes AM, Steiner M, Semler O, Fischer B, Yigit G, Janda CY et al.. Mutations in WNT1 cause different forms of bone fragility. Am J Hum Genet. 2013 Apr 4;92(4):565-74

Laine CM, Joeng KS, Campeau PM, Kiviranta R, Tarkkonen K, Grover M, Lu JT, Pekkinen M, Wessman M, Heino TJ, Nieminen-Pihala V, Aronen M et al.. WNT1 mutations in early-onset osteoporosis and osteogenesis imperfecta. N Engl J Med. 2013 May 9;368(19):1809-16

Mylona E, Vamvakaris I, Giannopoulou I, Theohari I, Papadimitriou C, Keramopoulos A, Nakopoulou L. An immunohistochemical evaluation of the proteins Wnt1 and glycogen synthase kinase (GSK)-3β in invasive breast carcinomas. Histopathology. 2013 May;62(6):899-907

Pyott SM, Tran TT, Leistritz DF, Pepin MG, Mendelsohn NJ, Temme RT, Fernandez BA, Elsayed SM, Elsobky E, Verma I, Nair S, Turner EH, Smith JD, Jarvik GP, Byers PH. WNT1 mutations in families affected by moderately severe and progressive recessive osteogenesis imperfecta. Am J Hum Genet. 2013 Apr 4;92(4):590-7


Theohari I, Nakopoulou L. WNT1 (wingless-type MMTV integration site family, member 1). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):581-583.

Gene Section Review



INIST-CNRS

OPEN ACCESS JOURNAL

EGR1 (Early Growth Response 1) Young Han Lee

Department of Biological Sciences, Konkuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul, South Korea (YHL)

Published in Atlas Database: January 2014

Online updated version : http://AtlasGeneticsOncology.org/Genes/EGR1ID496ch5q31.html DOI: 10.4267/2042/54014

This article is an update of : Bandyopadhyay R, Baron V. EGR1 (early growth response 1). Atlas Genet Cytogenet Oncol Haematol 2011;15(2):150-158. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Review on EGR1, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

Identity Other names: AT225, G0S30, KROX-24, NGFI-A, TIS8, ZIF-268, ZNF225

HGNC (Hugo): EGR1

Location: 5q31.2

DNA/RNA Note The gene is conserved in chimpanzee, dog, cow, mouse, rat, chicken, and zebrafish.

Description Genomic size 3824 bp; 2 exons; + strand of chromosome 5.

Transcription mRNA size: 3132, ORF 271-1902 (1632 nt coding sequence). Rare occurrence of splice variants (2 variants have been described in the brain). The EGR1 promoter contains five SREs (serum response elements). Increased transcription in response to growth factors or stress is most commonly mediated by transcription factors of the Elk-1/SAP-1/SAP-2 family, which are activated by MAP-Kinase family (mitogen activated protein kinase). Elk-1 associates with CBP (CREB binding protein) and SRF (serum response factor) to form

the Ternary Complex Factor, which binds to the SREs. The promoter also contains several SP1 consensus sequences; a putative AP-1 binding site (not conserved); at least one functional CRE (cAMP regulatory element). EGR1 regulates its own transcription by binding to functional EBS (EGR1 binding sites). A functional NFkB (p65/RelA) binding site is contained in the EGR1 promoter that allows NF-kB to increase EGR1 transcription in response to UV (ultra-violet) irradiation. EGR1 is a target of ETS transcription factors that are involved in hematopoiesis, angiogenesis and neoplasia. Finally, EGR1 promoter contains two ATF5 (activating transcription factor 5) consensus sequences at a conserved promoter position and is induced by ATF5 in cancer cell lines.

Protein Description The protein contains 543 amino acids. Its predicted molecular weight is 57.5 kDa, however the protein migrates at an apparent molecular weight of 75-85 kDa in SDS-PAGE. It has a very short half-life of ~30 minutes to 1 hour. EGR1 contains a highly conserved DNA-binding domain composed of three Cys2-His2 type zinc-fingers that bind to the prototype target sequence GCG(G/T)GGGCG; a nuclear localization signal that requires amino acids 361-419 (zinc fingers 2 and 3) and amino acids 315-330; two activator domains; a repressor domain between amino acids 281-314.

EGR1 (Early Growth Response 1) Lee YH


Figure 1.

EGR1 binds to regulatory proteins called NAB-1 (NGFA-I binding protein) and NAB2 through its repressor domain. Post-translational modifications include phosphorylation, acetylation, ubiquitination and sumoylation (figure 1).

Expression Ubiquitous. Exhibits a distinct expression pattern in the brain. Constitutive protein expression is low in many tissues. EGR1 expression is very rapidly and strongly induced by growth factors and mitogens, cytokines, environmental and mechanical stresses, as well as DNA damage (hpr).

Localisation Nuclear. Occasional cytoplasmic localization observed in cancer cells.

Function EGR1 is an early response transcription factor with DNA binding activity that activates the transcription of several hundred genes. Depending on the cell type and the stimulus, EGR1 induces the expression of growth factors, growth factor receptors, extracellular matrix proteins, proteins involved in the regulation of cell growth or differentiation, and proteins involved in apoptosis, growth arrest, and stress responses. EGR1 can compete with transcription factor SP1, which is involved in the constitutive expression of housekeeping genes and other regulatory genes. Because the consensus sequence for SP1 and EGR1 binding overlaps, EGR1 often displaces SP1 from gene promoters. EGR1 transcriptional activity is inhibited by direct interaction with the proteins NAB1 and NAB2. Their expression is also inducible, albeit delayed compared to EGR1 induction. NAB1 and NAB2 impose an early negative feedback and thus ensure

that EGR1 activity is transient, before the protein is degraded. It should be noted that deregulated expression of NAB proteins in disease may contribute to alteration of EGR1 function. For example, elevated expression of NAB2 in endothelial cells reduces angiogenesis, whereas loss of NAB2 in prostate cancer contributes to increased EGR1 activity. EGR1 has various neurocognitive functions. It is involved in the regulation of neuronal activity and may control neuronal plasticity. EGR1 controls tissue repair, wound healing, liver regeneration, atherosclerosis, fibrosis, and other inflammation or stress-related responses. It is considered a key master regulator in cardiovascular pathology by promoting atherosclerosis, intimal thickening following vascular injury, ischemia, allograft rejection and cardiac hypertrophy. Finally, EGR1 regulates cell response to hypoxia, promotes the formation of new blood vessels from the pre-existing vasculature, and triggers tumor angiogenesis. In cancer, EGR1 is traditionally considered a tumor suppressor. However, accumulating evidence now indicates that it can act both as a tumor suppressor and as a tumor promoter, depending on the context. EGR1 protects normal cells from transformation by inducing apoptosis or growth arrest upon DNA damage. A strong evidence for EGR1 pro-apoptotic function is that EGR1-/- mouse embryo fibroblasts are resistant to apoptosis induced by ionizing radiation. Although EGR1-deficient mice do not spontaneously develop tumors, they display accelerated tumor growth in a two-step carcinogenesis model of skin cancer. As an example, UV-B radiation of keratinocytes induces EGR1 expression through activation of NFkB (p65/RelA), which mediates apoptosis and acts as a protection mechanism against the tumorigenic



effect of UV. These observations support the notion that EGR1 participates in the suppression of DNA damage-induced tumors. EGR1 is involved in the chemopreventive or antiproliferative effect of natural compounds such as curcumin, genistein, isoflavone, green tea extracts, and others. It also mediates the anti-proliferative effects of NSAIDs (non-steroid anti-inflammatory drug) and of other chemotherapeutic agents such as cisplatin. In many cancer cells, EGR1 is induced by radiation, chemotherapeutic drugs, steroids and anti-inflammatory drugs, and is required for the growth arrest or apoptotic effect of these treatments. Lack of EGR1 response confers chemoresistance. This may be exploited by restoring EGR1 expression through gene therapy to increase the efficacy of radiotherapy of chemotherapy. At later stages of cancer EGR1 tumor suppressor function is impaired by the frequent inactivation, in human tumors, of two major tumor suppressor targets of EGR1 (namely PTEN and TP53). In addition, EGR1 induction by growth factors or stress is blocked in some types of cancer cells ("resistance" to induction). This has been described in fibrosarcoma, prostate cancer, colon cancer, and RAS-transformed cells. Several mechanisms are involved. For example, RAS-induced transformation of fibroblasts results in the aberrant constitutive activation of PI3-kinase (phosphatidyl inositol 3-kinase), which causes degradation of SRF and prevents Elk-1-mediated induction of EGR1. In colon cancer cells, it is the mutational activation of Wnt-1 that prevents the SRF-mediated induction of EGR1 and other early genes in response to

mitogens. Alternatively, overexpression of phospholipase D in glioma cells attenuates mitogen-induced EGR1 expression through activation of PI3-kinase. On the other hand, EGR1 overexpression in some cancer types directly promotes cancer progression and tumor growth by increasing the expression and secretion of growth factors and cytokines, extracellular matrix proteins (Barbolina et al., 2007; Shin et al., 2010) and proteases. Egr-1 mediates growth factor-induced downregulation of E-cadherin by inducing an E-cadherin transcription repressor, Snail or Slug, which contributes to tumor invasion (Grotegut et al., 2006; Cheng et al., 2013). Mechanisms that can cause EGR1 overexpression in tumor cells include p53 mutations (observed in gliomas and prostate cancer). Mutant p53 upregulates EGR1 in prostate cancer cells by activating ERK (extracellular regulated kinase) through undefined mechanism. Constitutive activation of the ERK pathway in tumor cells appears to be a consistent cause of EGR1 expression and is often due to genetic defects affecting upstream regulators of the ERK pathway. For example, a mutation of EGFR (epidermal growth factor receptor) commonly found in lung cancer cells causes EGR1 overexpression and activation through activation of the ERK pathway. Similarly, a mutation of B-RAF present in a high percentage of melanoma results in constitutive activation of ERK and up-regulation of EGR1.

Homology Three other family members: EGR2, EGR3 and EGR4 (see figure 2).

Figure 2. Image designed by Melody W Lin.



Mutations Note Mutations in the EGR1 gene have not been found; altered expression level is the most common contributor to tumorigenesis. Chromosome loss/deletions: - The long arm of chromosome 5 in which EGR1 is located is consistently deleted in myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). Loss of chromosome 5 or deletion in 5q is the most common karyotypic abnormality in MDS, occurring in 10% of new MDS/AML patients and in 40% of patients with therapy-related MDS or AML. Mice lacking at least one allele of EGR1 develop symptoms similar to that of MDS after they are exposed to a carcinogen (i.e. mono- or bi-allelic loss of EGR1 accelerates the development of pre-leukemic disorders). - Loss of 5q is consistently associated with estrogen receptor-negative (ER-) breast carcinoma and is seen in 86% of breast carcinomas carriers of BRCA1 (breast cancer 1) and BRCA2 mutations. Fluorescence in situ hybridization confirmed the association of EGR1 loss with ER- breast carcinoma; loss of EGR1 correlated with high grade. - In mouse model with a deletion of chromosome 5, loss of Tp53 activity in cooperation with EGR1 and adenomatous polyposis coli (APC) haploinsufficiency, accelerates the development of AML (Stoddart et al., 2013).

Implicated in Various cancers Note EGR1 (protein and/or mRNA) is downregulated in colon cancer, lung cancer, esophageal carcinoma, astrocytomas, glioblastomas, breast cancer, compared to non-cancer tissue. EGR1 expression is sharply decreased in leiomyoma compared to normal myometrium (reduction in 100% of tumors). Transfection of EGR1 into myometrial cells decreases cell proliferation. In some types of cancers EGR1 expression is high in the adjacent tissue of the tumors, but low in the tumor cells. In esophageal carcinoma, EGR1 expression is higher in the dysplastic tissue, whereas no expression is detected in the tumor tissue. This may reflect the existence of a reactive stroma, and possibly inflammation. Early observations indicated that in v-sis-transformed NIH-3T3 cells, transfection of EGR1 inhibits colony formation and growth in soft agar. It also delays tumorigenicity in nude mice.

Conversely, EGR1 antisense accelerates cell growth and colony formation. EGR1 expression is upregulated in human diffuse large B cell lymphoma because of constitutively active ERK and JNK (Jun N-terminal kinase) pathways and promotes cancer cells survival. Overexpression of EGR1 (both mRNA and protein) is observed in gastric cancer and in prostate cancer. It is also seen in the "normal" tissue adjacent to the tumors, but it is not expressed in the normal tissues from healthy patients. The mRNA expression is higher in metastatic cases of gastric cancer. EGR1 is much higher expressed in cervical cancer tissues than in the normal cervix.

Leukemia Note In myeloblastic leukemia, upregulation of oncogene E2F-1 blocks the myeloid terminal differentiation program, resulting in proliferation of immature cells in the presence of interleukin-6. EGR1 abrogates the E2F-1-driven block in myeloid terminal differentiation, decreases the tumorigenic potential of leukemia cells in vivo and their aggressiveness. EGR1 also abrogates the block in terminal myeloid differentiation imparted by oncogenic c-myc.

Fibrosarcoma Note Human fibrosarcoma cells express almost no EGR1 and are "resistant" to EGR1 induction in response to growth factors or stress. Forced expression of EGR1 inhibits cell growth and suppresses xenograft tumor growth in athymic mice. Conversely, silencing EGR1 using antisense increases the transformed character of these cells. The effect of EGR1 in HT-1080 fibrosarcoma cells is mediated by increased secretion of active TGFbeta-1 (transforming growth factor-beta1), a direct target of EGR1. TGFbeta-1 strongly inhibits cell growth in an autocrine mechanism. Further, EGR1 regulates cell adhesion and migration through increased secretion of fibronectin and plasminogen activator inhibitor-1 (PAI-1). Although fibronectin is a direct target of EGR1, PAI-1 increase is mediated by EGR1-induced TGFbeta-1.

Lung cancer Note EGR1 (RNA and protein) is expressed at higher levels in human normal lung tissue adjacent to non-small cell lung cancer (NSCLC), and is downregulated in the tumor tissue compared with normal lung. Also downregulated in human lung adenocarcinomas and lung squamous cell carcinomas.



High expression of EGR1 in NSCLC patients correlates with high PTEN expression. Low levels of EGR1 after surgical resection are associated with poor outcome.

Brain cancer (astrocytoma/glioblastoma/neuroblastoma) Note EGR1 mRNA and protein are strongly suppressed in astrocytomas and glioblastomas compared to normal brain. Downregulation correlates with grade in human tissue, or with the presence of wild-type p53 in cell cultures. Tumors or primary cell lines that exhibit higher EGR1 expression contain p53 mutations. EGR1 induces growth arrest of glioma cells mediated by increased secretion of TGF-beta1, PAI-1 and fibronectin. EGR1 expression is induced by hypoxia in glioblastoma multiforme and up-regulates tissue factor that promotes plasma clotting. Two EGR1 mRNA variants are detected in astrocytomas, one that contains N-methyl-D-aspartate-receptor (NMDA-R)-responsive element. An increase in the expression of this EGR1 variant is seen in astrocytoma cells following NMDA stimulation. EGR1 expression is restricted to tumor cells expressing NMDA-R, is up-regulated in astrocytomas compared with normal brain, and is associated with enhanced patient survival. In neuroblastoma cells, re-expression of EGR1 induces apoptosis, whereas EGR1 antisense increases cell viability. The apoptotic activity of the EGR1 is mediated by activation of p73 (a member of the p53 family).

Breast cancer Note Breast cancer cell lines and clinical cancer tissues exhibit reduced EGR1 expression while normal mammary tissues express high levels. EGR1 is also downregulated in experimentally induced rat mammary tumors. Downregulation of gelsolin, which is an indicator of breast cancer, is correlated with suppression of EGR1. Some studies have shown that re-expression of EGR1 inhibits human tumor cell growth and suppresses tumorigenicity in mice. However, two other studies found that EGR1 silencing decreases breast cancer cell proliferation, migration, and growth of xenograft tumors in nude mice. In estrogen receptor-positive breast cancer cell lines, EGR1 expression is induced by estrogen through activation of RAF-1 kinase, the MAP-kinase pathway, and Elk-1/SRF.

Hepatocellular carcinoma (liver cancer) Note While one study reports EGR1 overexpression, another one describes the downregulation of EGR1 expression in hepatocellular carcinoma. In the latter study, re-expression of EGR1 decreased cell growth and tumorigenicity in nude mice. There are arguments in favor of a pro-tumorigenic function: HGF (hepatocyte growth factor), a cytokine involved in the progression of hepatocarcinoma, up-regulates EGR1 and increases cell scattering and migration through EGR1-mediated up-regulation of snail. HGF also increases angiogenesis through up-regulation of EGR1-mediated VEGF (vascular endothelial growth factor) and interleukin 8. Of note, EGR1 is crucial for the proliferation of hepatocytes and plays an important role in liver regeneration: liver regeneration following partial hepatectomy is impaired in EGR1-null mice.

Skin cancer/melanoma Note EGR1 expression is decreased in basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) but is elevated in psoriasis. EGR1 inhibits the growth of benign and malignant epidermal cells in vitro. A single topical treatment with the tumor promoter TPA in a multistage carcinogenesis model induces EGR1 mRNA expression both epidermis and dermis of the mice. Primary papillomas and carcinomas generated in these animals contain high EGR1 mRNA compared with normal epidermis. EGR1-null mice reveal an accelerated development of skin tumors in the multistage carcinogenesis model compared to EGR1+ mice. On the other hand, EGR1 may contribute to cancer progression in melanoma. The HGF receptor c-Met induces EGR1 activation via the Ras/ERK1/2 pathway in melanoma cells, which in turn induces fibronectin expression and its extracellular assembly. Fibronectin promotes migration and invasiveness of melanomas and is associated with metastatic potential. About 60% of melanoma contain an activating mutation in the B-RAF gene. In these cells, constitutive up-regulation of EGR1 caused by activation of RAF/ERK signaling results in high fibronectin levels and increases invasiveness.

Prostate cancer Note EGR1 mRNA is expressed at higher levels in prostate tumors compared with normal tissues and



correlates with Gleason score (a measure of prostate cancer stage). EGR1 expression in the primary tumor correlates with complete control of the local tumor by radiation, whereas in post-irradiated tissue EGR1 expression correlates with treatment failure. NAB2 is down-regulated in clinical primary carcinoma. Thus, upregulation of EGR1 and loss of NAB2 both determine the high level of EGR1 activity in human prostate tumors. EGR1 knock-out mice crossed with transgenic mouse models of prostate cancer show significantly impaired tumor growth compared to Egr+/+ mice and increased survival. Although it does not prevent tumor initiation, EGR1 deficiency delays the progression of prostate carcinoma. EGR1 is also overexpressed in the tumors of the transgenic mice, whereas NAB2 expression is decreased. Silencing of EGR1 in prostate cancer cells decreases cell proliferation in vitro, and injection of EGR1 antisense in vivo delays the occurrence of prostate cancer. Alternatively, forced expression of EGR1 in non-cancer cells increases proliferation in vitro. EGR1 up-regulation in prostate cell lines is due to mutation of the TP53 gene. EGR1 is also up-regulated by SV40-T antigen, a viral oncogene that is used very often to immortalize non-transformed cells. In human prostate cancer cells EGR1 stimulates the production of many growth factors and cytokines that are involved in the progression of prostate cancer and of proteins involved in metastasis. A crosstalk between EGR1 and the androgen receptor (AR) may explain the particular role of EGR1 in prostate cancer. EGR1 physically interacts with AR in hormone-sensitive prostate cancer cells and the complex binds to the promoter of endogenous targets of AR. Forcing EGR1 activity in hormone-sensitive cancer cells increases proliferation in vitro. It enhances tumor growth in mice upon castration (which mimics hormone therapy in human patients): EGR1 may be involved in the acquisition of resistance to hormone therapy.

Esophageal carcinoma Note According to some reports, the expression of EGR1 (mRNA and protein) is high in pre-cancerous human lesions of the esophagus and in dysplastic tissue adjacent to esophageal carcinoma, but is very low in cancer tissue. The number of apoptotic cells in EGR1-positive tumors is higher than in EGR1 negative tumors, suggesting that EGR1 promotes apoptosis. In addition, EGR1 is up-regulated in the tumors of patients treated by irradiation compared to the tumor tissue of non-irradiated patients, and EGR1 expression level seems to correlate with better prognosis.

Another study, however, shows overexpression of EGR1 in esophageal tumor tissues and constitutive expression in esophageal cancer cell lines. EGR1 silencing inhibits cell proliferation through G2/M cell cycle block. On the other hand, forced stable expression of EGR1 into esophageal carcinoma cells also decreases cell proliferation in vitro and tumor growth in vivo.

Cervical cancer Note The melanoma growth stimulatory activity/Growth-regulated oncogene α (MGSA/GROα), which is designated as a CXC chemokine ligand 1 (CXCL1), plays an important role in the regulation of inflammation and the progression of tumor development through stimulation of angiogenesis and metastasis. EGR1 mediates ERK and JNK MAPKs-dependent GROα transcription in response to TNFα stimulation in HeLa cervix cancer cells (Shin et al., 2013).

References Lim RW, Varnum BC, Herschman HR. Cloning of tetradecanoyl phorbol ester-induced 'primary response' sequences and their expression in density-arrested Swiss 3T3 cells and a TPA non-proliferative variant. Oncogene. 1987;1(3):263-70

Milbrandt J. A nerve growth factor-induced gene encodes a possible transcriptional regulatory factor. Science. 1987 Nov 6;238(4828):797-9

Christy BA, Lau LF, Nathans D. A gene activated in mouse 3T3 cells by serum growth factors encodes a protein with "zinc finger" sequences. Proc Natl Acad Sci U S A. 1988 Nov;85(21):7857-61

Lemaire P, Revelant O, Bravo R, Charnay P. Two mouse genes encoding potential transcription factors with identical DNA-binding domains are activated by growth factors in cultured cells. Proc Natl Acad Sci U S A. 1988 Jul;85(13):4691-5

Sukhatme VP, Cao XM, Chang LC, Tsai-Morris CH, Stamenkovich D, Ferreira PC, Cohen DR, Edwards SA, Shows TB, Curran T. A zinc finger-encoding gene coregulated with c-fos during growth and differentiation, and after cellular depolarization. Cell. 1988 Apr 8;53(1):37-43

Gashler AL, Swaminathan S, Sukhatme VP. A novel repression module, an extensive activation domain, and a bipartite nuclear localization signal defined in the immediate-early transcription factor Egr-1. Mol Cell Biol. 1993 Aug;13(8):4556-71

Le Beau MM, Espinosa R 3rd, Neuman WL, Stock W, Roulston D, Larson RA, Keinanen M, Westbrook CA. Cytogenetic and molecular delineation of the smallest commonly deleted region of chromosome 5 in malignant myeloid diseases. Proc Natl Acad Sci U S A. 1993 Jun 15;90(12):5484-8

Huang RP, Darland T, Okamura D, Mercola D, Adamson ED. Suppression of v-sis-dependent transformation by the transcription factor, Egr-1. Oncogene. 1994 May;9(5):1367-77



Huang RP, Liu C, Fan Y, Mercola D, Adamson ED. Egr-1 negatively regulates human tumor cell growth via the DNA-binding domain. Cancer Res. 1995 Nov 1;55(21):5054-62

Levin WJ, Press MF, Gaynor RB, Sukhatme VP, Boone TC, Reissmann PT, Figlin RA, Holmes EC, Souza LM, Slamon DJ. Expression patterns of immediate early transcription factors in human non-small cell lung cancer. The Lung Cancer Study Group. Oncogene. 1995 Oct 5;11(7):1261-9

Muthukkumar S, Nair P, Sells SF, Maddiwar NG, Jacob RJ, Rangnekar VM. Role of EGR-1 in thapsigargin-inducible apoptosis in the melanoma cell line A375-C6. Mol Cell Biol. 1995 Nov;15(11):6262-72

Russo MW, Sevetson BR, Milbrandt J. Identification of NAB1, a repressor of NGFI-A- and Krox20-mediated transcription. Proc Natl Acad Sci U S A. 1995 Jul 18;92(15):6873-7

Sells SF, Muthukumar S, Sukhatme VP, Crist SA, Rangnekar VM. The zinc finger transcription factor EGR-1 impedes interleukin-1-inducible tumor growth arrest. Mol Cell Biol. 1995 Feb;15(2):682-92

Ahmed MM, Venkatasubbarao K, Fruitwala SM, Muthukkumar S, Wood DP Jr, Sells SF, Mohiuddin M, Rangnekar VM. EGR-1 induction is required for maximal radiosensitivity in A375-C6 melanoma cells. J Biol Chem. 1996 Nov 15;271(46):29231-7

Liu C, Adamson E, Mercola D. Transcription factor EGR-1 suppresses the growth and transformation of human HT-1080 fibrosarcoma cells by induction of transforming growth factor beta 1. Proc Natl Acad Sci U S A. 1996 Oct 15;93(21):11831-6

Svaren J, Sevetson BR, Apel ED, Zimonjic DB, Popescu NC, Milbrandt J. NAB2, a corepressor of NGFI-A (Egr-1) and Krox20, is induced by proliferative and differentiative stimuli. Mol Cell Biol. 1996 Jul;16(7):3545-53

Thigpen AE, Cala KM, Guileyardo JM, Molberg KH, McConnell JD, Russell DW. Increased expression of early growth response-1 messenger ribonucleic acid in prostatic adenocarcinoma. J Urol. 1996 Mar;155(3):975-81

Huang RP, Fan Y, de Belle I, Niemeyer C, Gottardis MM, Mercola D, Adamson ED. Decreased Egr-1 expression in human, mouse and rat mammary cells and tissues correlates with tumor formation. Int J Cancer. 1997a Jul 3;72(1):102-9

Huang RP, Fan Y, Ni Z, Mercola D, Adamson ED. Reciprocal modulation between Sp1 and Egr-1. J Cell Biochem. 1997b Sep 15;66(4):489-99

Nair P, Muthukkumar S, Sells SF, Han SS, Sukhatme VP, Rangnekar VM. Early growth response-1-dependent apoptosis is mediated by p53. J Biol Chem. 1997 Aug 8;272(32):20131-8

Robinson L, Panayiotakis A, Papas TS, Kola I, Seth A. ETS target genes: identification of egr1 as a target by RNA differential display and whole genome PCR techniques. Proc Natl Acad Sci U S A. 1997 Jul 8;94(14):7170-5

Eid MA, Kumar MV, Iczkowski KA, Bostwick DG, Tindall DJ. Expression of early growth response genes in human prostate cancer. Cancer Res. 1998 Jun 1;58(11):2461-8

Pratt MA, Satkunaratnam A, Novosad DM. Estrogen activates raf-1 kinase and induces expression of Egr-1 in MCF-7 breast cancer cells. Mol Cell Biochem. 1998 Dec;189(1-2):119-25

Liu C, Yao J, de Belle I, Huang RP, Adamson E, Mercola

D. The transcription factor EGR-1 suppresses transformation of human fibrosarcoma HT1080 cells by coordinated induction of transforming growth factor-beta1, fibronectin, and plasminogen activator inhibitor-1. J Biol Chem. 1999 Feb 12;274(7):4400-11

Okumura K, Shirasawa S, Nishioka M, Sasazuki T. Activated Ki-Ras suppresses 12-O-tetradecanoylphorbol-13-acetate-induced activation of the c-Jun NH2-terminal kinase pathway in human colon cancer cells. Cancer Res. 1999 May 15;59(10):2445-50

Horrigan SK, Arbieva ZH, Xie HY, Kravarusic J, Fulton NC, Naik H, Le TT, Westbrook CA. Delineation of a minimal interval and identification of 9 candidates for a tumor suppressor gene in malignant myeloid disorders on 5q31. Blood. 2000 Apr 1;95(7):2372-7

Liu C, Yao J, Mercola D, Adamson E. The transcription factor EGR-1 directly transactivates the fibronectin gene and enhances attachment of human glioblastoma cell line U251. J Biol Chem. 2000 Jul 7;275(27):20315-23

Riggs PK, Rho O, DiGiovanni J. Alteration of Egr-1 mRNA during multistage carcinogenesis in mouse skin. Mol Carcinog. 2000 Apr;27(4):247-51

Svaren J, Ehrig T, Abdulkadir SA, Ehrengruber MU, Watson MA, Milbrandt J. EGR1 target genes in prostate carcinoma cells identified by microarray analysis. J Biol Chem. 2000 Dec 8;275(49):38524-31

Abdulkadir SA, Carbone JM, Naughton CK, Humphrey PA, Catalona WJ, Milbrandt J. Frequent and early loss of the EGR1 corepressor NAB2 in human prostate carcinoma. Hum Pathol. 2001a Sep;32(9):935-9

Abdulkadir SA, Qu Z, Garabedian E, Song SK, Peters TJ, Svaren J, Carbone JM, Naughton CK, Catalona WJ, Ackerman JJ, Gordon JI, Humphrey PA, Milbrandt J. Impaired prostate tumorigenesis in Egr1-deficient mice. Nat Med. 2001b Jan;7(1):101-7

Ahmed MM, Chendil D, Lele S, Venkatasubbarao K, Dey S, Ritter M, Rowland RG, Mohiuddin M. Early growth response-1 gene: potential radiation response gene marker in prostate cancer. Am J Clin Oncol. 2001 Oct;24(5):500-5

Calogero A, Arcella A, De Gregorio G, Porcellini A, Mercola D, Liu C, Lombari V, Zani M, Giannini G, Gagliardi FM, Caruso R, Gulino A, Frati L, Ragona G. The early growth response gene EGR-1 behaves as a suppressor gene that is down-regulated independent of ARF/Mdm2 but not p53 alterations in fresh human gliomas. Clin Cancer Res. 2001 Sep;7(9):2788-96

Das A, Chendil D, Dey S, Mohiuddin M, Mohiuddin M, Milbrandt J, Rangnekar VM, Ahmed MM. Ionizing radiation down-regulates p53 protein in primary Egr-1-/- mouse embryonic fibroblast cells causing enhanced resistance to apoptosis. J Biol Chem. 2001 Feb 2;276(5):3279-86

Virolle T, Adamson ED, Baron V, Birle D, Mercola D, Mustelin T, de Belle I. The Egr-1 transcription factor directly activates PTEN during irradiation-induced signalling. Nat Cell Biol. 2001 Dec;3(12):1124-8

Wu MY, Chen MH, Liang YR, Meng GZ, Yang HX, Zhuang CX. Experimental and clinicopathologic study on the relationship between transcription factor Egr-1 and esophageal carcinoma. World J Gastroenterol. 2001 Aug;7(4):490-5

Bae MH, Jeong CH, Kim SH, Bae MK, Jeong JW, Ahn MY, Bae SK, Kim ND, Kim CW, Kim KR, Kim KW. Regulation of Egr-1 by association with the proteasome component



C8. Biochim Biophys Acta. 2002 Oct 21;1592(2):163-7

Hao MW, Liang YR, Liu YF, Liu L, Wu MY, Yang HX. Transcription factor EGR-1 inhibits growth of hepatocellular carcinoma and esophageal carcinoma cell lines. World J Gastroenterol. 2002 Apr;8(2):203-7

Kobayashi D, Yamada M, Kamagata C, Kaneko R, Tsuji N, Nakamura M, Yagihashi A, Watanabe N. Overexpression of early growth response-1 as a metastasis-regulatory factor in gastric cancer. Anticancer Res. 2002 Nov-Dec;22(6C):3963-70

McDoniels-Silvers AL, Nimri CF, Stoner GD, Lubet RA, You M. Differential gene expression in human lung adenocarcinomas and squamous cell carcinomas. Clin Cancer Res. 2002 Apr;8(4):1127-38

Pambuccian CA, Oprea GM, Lakatua DJ. Reduced expression of early growth response-1 gene in leiomyoma as identified by mRNA differential display. Gynecol Oncol. 2002 Mar;84(3):431-6

Tice DA, Soloviev I, Polakis P. Activation of the Wnt pathway interferes with serum response element-driven transcription of immediate early genes. J Biol Chem. 2002 Feb 22;277(8):6118-23

Wu MY, Liang YR, Wu XY, Zhuang CX. Relationship between Egr-1 gene expression and apoptosis in esophageal carcinoma and precancerous lesions. World J Gastroenterol. 2002 Dec;8(6):971-5

Baron V, De Gregorio G, Krones-Herzig A, Virolle T, Calogero A, Urcis R, Mercola D. Inhibition of Egr-1 expression reverses transformation of prostate cancer cells in vitro and in vivo. Oncogene. 2003a Jul 3;22(27):4194-204

Baron V, Duss S, Rhim J, Mercola D. Antisense to the early growth response-1 gene (Egr-1) inhibits prostate tumor development in TRAMP mice. Ann N Y Acad Sci. 2003b Dec;1002:197-216

Davis S, Bozon B, Laroche S. How necessary is the activation of the immediate early gene zif268 in synaptic plasticity and learning? Behav Brain Res. 2003 Jun 16;142(1-2):17-30

Fahmy RG, Dass CR, Sun LQ, Chesterman CN, Khachigian LM. Transcription factor Egr-1 supports FGF-dependent angiogenesis during neovascularization and tumor growth. Nat Med. 2003 Aug;9(8):1026-32

Krones-Herzig A, Adamson E, Mercola D. Early growth response 1 protein, an upstream gatekeeper of the p53 tumor suppressor, controls replicative senescence. Proc Natl Acad Sci U S A. 2003 Mar 18;100(6):3233-8

Lucerna M, Mechtcheriakova D, Kadl A, Schabbauer G, Schäfer R, Gruber F, Koshelnick Y, Müller HD, Issbrücker K, Clauss M, Binder BR, Hofer E. NAB2, a corepressor of EGR-1, inhibits vascular endothelial growth factor-mediated gene induction and angiogenic responses of endothelial cells. J Biol Chem. 2003 Mar 28;278(13):11433-40

Pignatelli M, Luna-Medina R, Pérez-Rendón A, Santos A, Perez-Castillo A. The transcription factor early growth response factor-1 (EGR-1) promotes apoptosis of neuroblastoma cells. Biochem J. 2003 Aug 1;373(Pt 3):739-46

Recio JA, Merlino G. Hepatocyte growth factor/scatter factor induces feedback up-regulation of CD44v6 in melanoma cells through Egr-1. Cancer Res. 2003 Apr 1;63(7):1576-82

Virolle T, Krones-Herzig A, Baron V, De Gregorio G, Adamson ED, Mercola D. Egr1 promotes growth and survival of prostate cancer cells. Identification of novel Egr1 target genes. J Biol Chem. 2003 Apr 4;278(14):11802-10

Yang SZ, Abdulkadir SA. Early growth response gene 1 modulates androgen receptor signaling in prostate carcinoma cells. J Biol Chem. 2003 Oct 10;278(41):39906-11

Calogero A, Lombari V, De Gregorio G, Porcellini A, Ucci S, Arcella A, Caruso R, Gagliardi FM, Gulino A, Lanzetta G, Frati L, Mercola D, Ragona G. Inhibition of cell growth by EGR-1 in human primary cultures from malignant glioma. Cancer Cell Int. 2004 Jan 7;4(1):1

Chen CC, Lee WR, Safe S. Egr-1 is activated by 17beta-estradiol in MCF-7 cells by mitogen-activated protein kinase-dependent phosphorylation of ELK-1. J Cell Biochem. 2004 Nov 15;93(5):1063-74

Knapska E, Kaczmarek L. A gene for neuronal plasticity in the mammalian brain: Zif268/Egr-1/NGFI-A/Krox-24/TIS8/ZENK? Prog Neurobiol. 2004 Nov;74(4):183-211

Liao Y, Shikapwashya ON, Shteyer E, Dieckgraefe BK, Hruz PW, Rudnick DA. Delayed hepatocellular mitotic progression and impaired liver regeneration in early growth response-1-deficient mice. J Biol Chem. 2004 Oct 8;279(41):43107-16

Mitchell A, Dass CR, Sun LQ, Khachigian LM. Inhibition of human breast carcinoma proliferation, migration, chemoinvasion and solid tumour growth by DNAzymes targeting the zinc finger transcription factor EGR-1. Nucleic Acids Res. 2004;32(10):3065-9

Shin SY, Kim CG, Hong DD, Kim JH, Lee YH. Implication of Egr-1 in trifluoperazine-induced growth inhibition in human U87MG glioma cells. Exp Mol Med. 2004 Aug 31;36(4):380-6

Shozu M, Murakami K, Segawa T, Kasai T, Ishikawa H, Shinohara K, Okada M, Inoue M. Decreased expression of early growth response-1 and its role in uterine leiomyoma growth. Cancer Res. 2004 Jul 1;64(13):4677-84

Wu MY, Zhuang CX, Yang HX, Liang YR. Expression of Egr-1, c-fos and cyclin D1 in esophageal cancer and its precursors: An immunohistochemical and in situ hybridization study. World J Gastroenterol. 2004 Feb 15;10(4):476-80

Yu J, de Belle I, Liang H, Adamson ED. Coactivating factors p300 and CBP are transcriptionally crossregulated by Egr1 in prostate cells, leading to divergent responses. Mol Cell. 2004 Jul 2;15(1):83-94

Ferraro B, Bepler G, Sharma S, Cantor A, Haura EB. EGR1 predicts PTEN and survival in patients with non-small-cell lung cancer. J Clin Oncol. 2005 Mar 20;23(9):1921-6

Gaggioli C, Deckert M, Robert G, Abbe P, Batoz M, Ehrengruber MU, Ortonne JP, Ballotti R, Tartare-Deckert S. HGF induces fibronectin matrix synthesis in melanoma cells through MAP kinase-dependent signaling pathway and induction of Egr-1. Oncogene. 2005 Feb 17;24(8):1423-33

Krones-Herzig A, Mittal S, Yule K, Liang H, English C, Urcis R, Soni T, Adamson ED, Mercola D. Early growth response 1 acts as a tumor suppressor in vivo and in vitro via regulation of p53. Cancer Res. 2005 Jun 15;65(12):5133-43



Ronski K, Sanders M, Burleson JA, Moyo V, Benn P, Fang M. Early growth response gene 1 (EGR1) is deleted in estrogen receptor-negative human breast carcinoma. Cancer. 2005 Sep 1;104(5):925-30

Thyss R, Virolle V, Imbert V, Peyron JF, Aberdam D, Virolle T. NF-kappaB/Egr-1/Gadd45 are sequentially activated upon UVB irradiation to mediate epidermal cell death. EMBO J. 2005 Jan 12;24(1):128-37

Baron V, Adamson ED, Calogero A, Ragona G, Mercola D. The transcription factor Egr1 is a direct regulator of multiple tumor suppressors including TGFbeta1, PTEN, p53, and fibronectin. Cancer Gene Ther. 2006 Feb;13(2):115-24

Grotegut S, von Schweinitz D, Christofori G, Lehembre F. Hepatocyte growth factor induces cell scattering through MAPK/Egr-1-mediated upregulation of Snail. EMBO J. 2006 Aug 9;25(15):3534-45

Ke J, Gururajan M, Kumar A, Simmons A, Turcios L, Chelvarajan RL, Cohen DM, Wiest DL, Monroe JG, Bondada S. The role of MAPKs in B cell receptor-induced down-regulation of Egr-1 in immature B lymphoma cells. J Biol Chem. 2006 Dec 29;281(52):39806-18

Khachigian LM. Early growth response-1 in cardiovascular pathobiology. Circ Res. 2006 Feb 3;98(2):186-91

Rong Y, Hu F, Huang R, Mackman N, Horowitz JM, Jensen RL, Durden DL, Van Meir EG, Brat DJ. Early growth response gene-1 regulates hypoxia-induced expression of tissue factor in glioblastoma multiforme through hypoxia-inducible factor-1-independent mechanisms. Cancer Res. 2006 Jul 15;66(14):7067-74

Sato H, Yazawa T, Suzuki T, Shimoyamada H, Okudela K, Ikeda M, Hamada K, Yamada-Okabe H, Yao M, Kubota Y, Takahashi T, Kamma H, Kitamura H. Growth regulation via insulin-like growth factor binding protein-4 and -2 in association with mutant K-ras in lung epithelia. Am J Pathol. 2006 Nov;169(5):1550-66

Shin SY, Bahk YY, Ko J, Chung IY, Lee YS, Downward J, Eibel H, Sharma PM, Olefsky JM, Kim YH, Lee B, Lee YH. Suppression of Egr-1 transcription through targeting of the serum response factor by oncogenic H-Ras. EMBO J. 2006 Mar 8;25(5):1093-103

Wu MY, Wu XY, Li QS, Zheng RM. Expression of Egr-1 gene and its correlation with the oncogene proteins in non-irradiated and irradiated esophageal squamous cell carcinoma. Dis Esophagus. 2006;19(4):267-72

Yang SZ, Eltoum IA, Abdulkadir SA. Enhanced EGR1 activity promotes the growth of prostate cancer cells in an androgen-depleted environment. J Cell Biochem. 2006 Apr 15;97(6):1292-9

Ahn BH, Park MH, Lee YH, Min do S. Phorbol myristate acetate-induced Egr-1 expression is suppressed by phospholipase D isozymes in human glioma cells. FEBS Lett. 2007 Dec 22;581(30):5940-4

Barbolina MV, Adley BP, Ariztia EV, Liu Y, Stack MS. Microenvironmental regulation of membrane type 1 matrix metalloproteinase activity in ovarian carcinoma cells via collagen-induced EGR1 expression. J Biol Chem. 2007 Feb 16;282(7):4924-31

Fang M, Wee SA, Ronski K, Fan H, Tao S, Lin Q. Evidence of EGR1 as a differentially expressed gene among proliferative skin diseases. Genomic Med. 2007;1(1-2):75-85

Gaggioli C, Robert G, Bertolotto C, Bailet O, Abbe P, Spadafora A, Bahadoran P, Ortonne JP, Baron V, Ballotti

R, Tartare-Deckert S. Tumor-derived fibronectin is involved in melanoma cell invasion and regulated by V600E B-Raf signaling pathway. J Invest Dermatol. 2007 Feb;127(2):400-10

Joslin JM, Fernald AA, Tennant TR, Davis EM, Kogan SC, Anastasi J, Crispino JD, Le Beau MM. Haploinsufficiency of EGR1, a candidate gene in the del(5q), leads to the development of myeloid disorders. Blood. 2007 Jul 15;110(2):719-26

Liu J, Liu YG, Huang R, Yao C, Li S, Yang W, Yang D, Huang RP. Concurrent down-regulation of Egr-1 and gelsolin in the majority of human breast cancer cells. Cancer Genomics Proteomics. 2007 Nov-Dec;4(6):377-85

Yu J, Baron V, Mercola D, Mustelin T, Adamson ED. A network of p73, p53 and Egr1 is required for efficient apoptosis in tumor cells. Cell Death Differ. 2007 Mar;14(3):436-46

Akutagawa O, Nishi H, Kyo S, Terauchi F, Yamazawa K, Higuma C, Inoue M, Isaka K. Early growth response-1 mediates downregulation of telomerase in cervical cancer. Cancer Sci. 2008 Jul;99(7):1401-6

An J, Guo RF, Zhang L, Geng PL, Lü YY. [Alteration of early growth response 1 expression in gastroenterological cancers and its biological significance]. Zhonghua Yi Xue Za Zhi. 2008 May 27;88(20):1384-9

Arora S, Wang Y, Jia Z, Vardar-Sengul S, Munawar A, Doctor KS, Birrer M, McClelland M, Adamson E, Mercola D. Egr1 regulates the coordinated expression of numerous EGF receptor target genes as identified by ChIP-on-chip. Genome Biol. 2008;9(11):R166

Choi BH, Kim CG, Bae YS, Lim Y, Lee YH, Shin SY. p21 Waf1/Cip1 expression by curcumin in U-87MG human glioma cells: role of early growth response-1 expression. Cancer Res. 2008 Mar 1;68(5):1369-77

Gibbs JD, Liebermann DA, Hoffman B. Egr-1 abrogates the E2F-1 block in terminal myeloid differentiation and suppresses leukemia. Oncogene. 2008 Jan 3;27(1):98-106

Lu S, Becker KA, Hagen MJ, Yan H, Roberts AL, Mathews LA, Schneider SS, Siegelmann HT, MacBeth KJ, Tirrell SM, Blanchard JL, Jerry DJ. Transcriptional responses to estrogen and progesterone in mammary gland identify networks regulating p53 activity. Endocrinology. 2008 Oct;149(10):4809-20

Eisenmann KM, Dykema KJ, Matheson SF, Kent NF, DeWard AD, West RA, Tibes R, Furge KA, Alberts AS. 5q- myelodysplastic syndromes: chromosome 5q genes direct a tumor-suppression network sensing actin dynamics. Oncogene. 2009 Oct 1;28(39):3429-41

Gitenay D, Baron VT. Is EGR1 a potential target for prostate cancer therapy? Future Oncol. 2009 Sep;5(7):993-1003

Hoffman MW, Janney S, Batanian JR. Cryptic deletion of EGR1 in association with a novel balanced t(5;22)(q31;q11.2) in a patient with myelodysplastic syndrome. Cancer Genet Cytogenet. 2009 Jun;191(2):106-8

Lee KH, Kim JR. Hepatocyte growth factor induced up-regulations of VEGF through Egr-1 in hepatocellular carcinoma cells. Clin Exp Metastasis. 2009;26(7):685-92

Li G, Li W, Angelastro JM, Greene LA, Liu DX. Identification of a novel DNA binding site and a transcriptional target for activating transcription factor 5 in c6 glioma and mcf-7 breast cancer cells. Mol Cancer Res. 2009 Jun;7(6):933-43



Maegawa M, Arao T, Yokote H, Matsumoto K, Kudo K, Tanaka K, Kaneda H, Fujita Y, Ito F, Nishio K. EGFR mutation up-regulates EGR1 expression through the ERK pathway. Anticancer Res. 2009 Apr;29(4):1111-7

Mittelbronn M, Harter P, Warth A, Lupescu A, Schilbach K, Vollmann H, Capper D, Goeppert B, Frei K, Bertalanffy H, Weller M, Meyermann R, Lang F, Simon P. EGR-1 is regulated by N-methyl-D-aspartate-receptor stimulation and associated with patient survival in human high grade astrocytomas. Brain Pathol. 2009 Apr;19(2):195-204

Wang B, Khachigian LM, Esau L, Birrer MJ, Zhao X, Parker MI, Hendricks DT. A key role for early growth response-1 and nuclear factor-kappaB in mediating and maintaining GRO/CXCR2 proliferative signaling in esophageal cancer. Mol Cancer Res. 2009 May;7(5):755-64

Yu J, Zhang SS, Saito K, Williams S, Arimura Y, Ma Y, Ke Y, Baron V, Mercola D, Feng GS, Adamson E, Mustelin T. PTEN regulation by Akt-EGR1-ARF-PTEN axis. EMBO J. 2009 Jan 7;28(1):21-33

Zagurovskaya M, Shareef MM, Das A, Reeves A, Gupta S, Sudol M, Bedford MT, Prichard J, Mohiuddin M, Ahmed MM. EGR-1 forms a complex with YAP-1 and upregulates Bax expression in irradiated prostate carcinoma cells. Oncogene. 2009 Feb 26;28(8):1121-31

Parra E, Ferreira J. The effect of siRNA-Egr-1 and camptothecin on growth and chemosensitivity of breast

cancer cell lines. Oncol Rep. 2010 Apr;23(4):1159-65

Sauer L, Gitenay D, Vo C, Baron VT. Mutant p53 initiates a feedback loop that involves Egr-1/EGF receptor/ERK in prostate cancer cells. Oncogene. 2010 May 6;29(18):2628-37

Shin SY, Kim JH, Baker A, Lim Y, Lee YH. Transcription factor Egr-1 is essential for maximal matrix metalloproteinase-9 transcription by tumor necrosis factor alpha. Mol Cancer Res. 2010 Apr;8(4):507-19

Cheng JC, Chang HM, Leung PC. Egr-1 mediates epidermal growth factor-induced downregulation of E-cadherin expression via Slug in human ovarian cancer cells. Oncogene. 2013 Feb 21;32(8):1041-9

Shin SY, Lee JM, Lim Y, Lee YH. Transcriptional regulation of the growth-regulated oncogene α gene by early growth response protein-1 in response to tumor necrosis factor α stimulation. Biochim Biophys Acta. 2013 Oct;1829(10):1066-74

Stoddart A, Fernald AA, Wang J, Davis EM, Karrison T, Anastasi J, Le Beau MM. Haploinsufficiency of del(5q) genes, Egr1 and Apc, cooperate with Tp53 loss to induce acute myeloid leukemia in mice. Blood. 2014 Feb 13;123(7):1069-78


Lee YH. EGR1 (Early Growth Response 1). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):584-593.

Gene Section Review



INIST-CNRS

OPEN ACCESS JOURNAL

HDAC2 (histone deacetylase 2) Hyun Jin Bae, Suk Woo Nam

Department of Pathology, College of Medicine and Functional RNomics Research Center, The Catholic University of Korea, Banpo-dong, Seocho-gu, Seoul, Korea (HJB, SWN)


Online updated version : http://AtlasGeneticsOncology.org/Genes/HDAC2ID40803ch6q22.html DOI: 10.4267/2042/54015

This article is an update of : Ropero S, Esteller M. HDAC2 (histone deacetylase 2). Atlas Genet Cytogenet Oncol Haematol 2010;14(10): 966-969. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Review on HDAC2, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

Identity Other names: EC 3.5.1.98, HD2, RPD3, YAF1

HGNC (Hugo): HDAC2

Location: 6q21

DNA/RNA Description The HDAC2 gene is composed of 14 exons that span 35.029 bp of genomic DNA.

Transcription The length of the transcribed mRNA is about 6659 bp.

Pseudogene No pseudogene has been described.

Protein Description There are two proteins variants of 488 and 582 aa due to distinct pre-mRNA splicing events. The N-terminal tail of the protein contains the catalytic domain that comprises most of the protein. The N-terminal domain also has a HDAC association domain (HAD) essential for homo- and heterodimerization. A coiled-coil domain essential for protein-protein interactions is present at the C-terminal tail. It also contains three phosphorylation sites at Ser394, Ser422 and Ser424, and two S-nitrosylation sites at Cys262 and Cys274.

Expression Widely expressed.

HDAC2 (histone deacetylase 2) Bae HJ, Nam SW


Localisation Nucleus.

Function HDAC2 belongs to class I histone deacetylases that also comprise HDAC1, HDAC3 and HDAC8. HDAC2 acts as a transcriptional repressor through the desacetylation of lysine residues present at the N-terminal tail of histone proteins (H2A, H2B, H3 and H4). HDAC2 heterodimerise with HDAC1, but the heterodimer cannot bind to DNA, so they have to be recruited by transcription factors such as YY1, SP1/SP3, the tumor suppressor genes p53 and BRCA1. HDAC2 can also be tethered to DNA as a part of the multiprotein corepressor complexes CoREST, mSin3 and NuRD. These complexes are targeted to specific genomic sequences by interactions with sequence-specific transcription factors. For example, the HDAC2/HDAC1 containing Sin3-SAP corepressor complex is recruited by E2F family of transcription factors to repress transcription. HDAC2 containing complexes are also implicated in gene transcription-regulation mediated by nuclear receptors. These complexes also contain other epigenetic modifier genes, such as methyl-binding proteins (MeCp2), the DNA methyl transferases DNMT1, DNMT3A and DNMT3B, the histone methyl transferases SUVAR39H1 and G9a and histone demethylases (LSD1), providing another way by which HDAC2 regulates gene expression and chromatin remodelling. HDAC2 also regulates gene expression through the deacetylation of specific transcription factors that includes STAT3 and SMAD7. HDAC2 is a key regulator of genes regulating cell cycle, apoptosis, cell adhesion and migration. Together with HDAC1, HDAC2 regulates the transcription of genes implicated in haematopoiesis, epithelial cell differentiation, heart development and neurogenesis. Montgomery et al. (2007) find that HDAC2 and HDAC1 double-null mice show an uncontrolled ventricular proliferation, while Trivedi and collegues (2007) show the lack of cardiac hypertrophy in HDAC2 mutant mice.

HDAC2 is also a key regulator of nervous system function acting as a repressor of synaptic plasticity genes that regulates learning and memory formation. HDAC2-deficient mouse have enhanced memory formation.

Homology The histone deacetylase domain of HDAC2 is highly homologous to other class I HDACs (HDAC1, HDAC3 and HDAC8) showing the greater homology with HDAC1. This domain is also highly conserved between species (from yeast to human).

Mutations Germinal No germinal mutations have been found.

Somatic HDAC2 is mutated in sporadic tumors with microsatellite instability and in tumors arising in individuals with hereditary non-polyposis colorectal carcinoma. This mutation consists in a deletion of a nine adenines repeat present in Exon1 that produce a truncated and inactive form of the protein. The expression of the mutant form of HDAC2 induces resistance to the proapoptotic and antiproliferative effects of HDAC inhibitors. The lack of HDAC2 expression and function produces the up-regulation of tumor-growth promoting genes.

Implicated in Various cancers Note The deregulation of HDAC2 expression and activity has been linked to cancer development. HDAC2 is overexpressed in different tumor types including colon, gastric, cervical, prostate carcinoma, non-small cell lung cancer, and hepatocellular carcinoma. HDAC2 overexpression is implicated in cancer partly through its aberrant recruitment and consequent silencing of tumor suppressor genes. The repression of the tumor



suppressor gene WAF1 ID: 139> is associated with histone hypoacetylation at the promoter region and can be reversed by the treatment with HDAC inhibitors.

Prognosis HDAC2 expression is correlated with poor prognosis and advanced stage disease in colorectal, prostate, gastric and hepatocellular carcinomas.

Colon cancer Note There are a number of studies showing HDAC2 overexpression in colon cancer. The increase of HDAC2 expression has been found at the protein and mRNA level indicating that HDAC2 overexpression is due to transcriptional activation. These studies indicate that in this tumor type HDAC2 transcription is regulated by beta-catenin-TCF-myc signaling pathway that is deregulated in colon cancer. HDAC2 overexpression is correlated with poor prognosis and advanced stage disease in colorectal carcinoma. However, Ropero et al., found an inactivating mutation of HDAC2 in colon cancers with microsatellite instability.

Breast cancer Note Different studies show an important role of HDAC2 in breast cancer. HDAC2 Knockdown induces senescence in breast cancer cells. Moreover the loss of HDAC2 activity potentiates the apoptotic effect of tamoxifen in estrogen/progesterone positive breast cancer cells.

Prostate cancer Note Weichert et al., found that HDAC2 was strongly expressed in more than 70% of prostate cancer cases analyzed. The increase in HDAC2 expression was associated with enhanced tumor cell proliferation and poor prognosis in prostate cancer suggesting HDAC2 as a novel prognostic factor in this tumor type.

Hepatocellular carcinoma Note HDAC2 regulated cell cycle and disruption of HDAC2 caused G1/S arrest in cell cycle. In G1/S transition, targeted-disruption of HDAC2 selectively induced the expression of (INK4A) ID: 146> and p21(WAF1/Cip1), and simultaneously suppressed the expression of cyclin D1, CDK4 and CDK2.

Consequently, HDAC2 inhibition led to the down-regulation of E2F/DP1 target genes through a reduction in phosphorylation status of pRb protein.

Gastric cancer Note HDAC2 is aberrantly up-regulated in gastric cancers. HDAC2 inactivation significantly reduced cell motility, cell invasion, clonal expansion, and tumor growth. HDAC2 knockdown-induced G(1)-S cell cycle arrest and restored activity of p16(INK4a) and the proapoptotic factors.

Lung cancer Note HDAC2 is highly up-regulated in lung cancer. HDAC2 inactivation resulted in regression of tumor cell growth and activation of cellular apoptosis via p53 and Bax activation and Bcl2 suppression. In cell cycle regulation, HDAC2 inactivation caused induction of p21WAF1/CIP1 expression, and simultaneously suppressed the expressions of cyclin E2, cyclin D1, and CDK2, respectively. Consequently, this led to the hypophosphorylation of pRb protein in G1/S transition and thereby inactivated E2F/DP1 target gene transcriptions of A549 cells. HDAC2 directly regulated p21WAF1/CIP1 expression in a p53-independent manner.

Chronic obstructive pulmonary disease (COPD) Note Reduced HDAC2 activity and expression is found in chronic obstructive pulmonary disease (COPD). The reduced activity of HDAC2 produces the upregulation of genes implicated in the inflammatory response and resistance to corticosteroids in COPD.

References Yang WM, Inouye C, Zeng Y, Bearss D, Seto E. Transcriptional repression by YY1 is mediated by interaction with a mammalian homolog of the yeast global regulator RPD3. Proc Natl Acad Sci U S A. 1996 Nov 12;93(23):12845-50

Nan X, Ng HH, Johnson CA, Laherty CD, Turner BM, Eisenman RN, Bird A. Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature. 1998 May 28;393(6683):386-9

Doetzlhofer A, Rotheneder H, Lagger G, Koranda M, Kurtev V, Brosch G, Wintersberger E, Seiser C. Histone deacetylase 1 can repress transcription by binding to Sp1. Mol Cell Biol. 1999 Aug;19(8):5504-11

Yarden RI, Brody LC. BRCA1 interacts with components of the histone deacetylase complex. Proc Natl Acad Sci U S A. 1999 Apr 27;96(9):4983-



Fuks F, Burgers WA, Brehm A, Hughes-Davies L, Kouzarides T. DNA methyltransferase Dnmt1 associates with histone deacetylase activity. Nat Genet. 2000 Jan;24(1):88-91

Juan LJ, Shia WJ, Chen MH, Yang WM, Seto E, Lin YS, Wu CW. Histone deacetylases specifically down-regulate p53-dependent gene activation. J Biol Chem. 2000 Jul 7;275(27):20436-43

Fuks F, Burgers WA, Godin N, Kasai M, Kouzarides T. Dnmt3a binds deacetylases and is recruited by a sequence-specific repressor to silence transcription. EMBO J. 2001 May 15;20(10):2536-44

Rayman JB, Takahashi Y, Indjeian VB, Dannenberg JH, Catchpole S, Watson RJ, te Riele H, Dynlacht BD. E2F mediates cell cycle-dependent transcriptional repression in vivo by recruitment of an HDAC1/mSin3B corepressor complex. Genes Dev. 2002 Apr 15;16(8):933-47

Vaute O, Nicolas E, Vandel L, Trouche D. Functional and physical interaction between the histone methyl transferase Suv39H1 and histone deacetylases. Nucleic Acids Res. 2002 Jan 15;30(2):475-81

Zhu P, Martin E, Mengwasser J, Schlag P, Janssen KP, Göttlicher M. Induction of HDAC2 expression upon loss of APC in colorectal tumorigenesis. Cancer Cell. 2004 May;5(5):455-63

Huang BH, Laban M, Leung CH, Lee L, Lee CK, Salto-Tellez M, Raju GC, Hooi SC. Inhibition of histone deacetylase 2 increases apoptosis and p21Cip1/WAF1 expression, independent of histone deacetylase 1. Cell Death Differ. 2005 Apr;12(4):395-404

Ropero S, Fraga MF, Ballestar E, Hamelin R, Yamamoto H, Boix-Chornet M, Caballero R, Alaminos M, Setien F, Paz MF, Herranz M, Palacios J, Arango D, Orntoft TF, Aaltonen LA, Schwartz S Jr, Esteller M. A truncating mutation of HDAC2 in human cancers confers resistance to histone deacetylase inhibition. Nat Genet. 2006 May;38(5):566-9

Montgomery RL, Davis CA, Potthoff MJ, Haberland M, Fielitz J, Qi X, Hill JA, Richardson JA, Olson EN. Histone deacetylases 1 and 2 redundantly regulate cardiac morphogenesis, growth, and contractility. Genes Dev. 2007 Jul 15;21(14):1790-802

Ropero S, Esteller M. The role of histone deacetylases (HDACs) in human cancer. Mol Oncol. 2007 Jun;1(1):19-25

Saleque S, Kim J, Rooke HM, Orkin SH. Epigenetic regulation of hematopoietic differentiation by Gfi-1 and Gfi-1b is mediated by the cofactors CoREST and LSD1. Mol Cell. 2007 Aug 17;27(4):562-72

Trivedi CM, Luo Y, Yin Z, Zhang M, Zhu W, Wang T, Floss T, Goettlicher M, Noppinger PR, Wurst W, Ferrari VA, Abrams CS, Gruber PJ, Epstein JA. Hdac2 regulates the cardiac hypertrophic response by modulating Gsk3 beta activity. Nat Med. 2007 Mar;13(3):324-31

Xu WS, Parmigiani RB, Marks PA. Histone deacetylase inhibitors: molecular mechanisms of action. Oncogene.

2007 Aug 13;26(37):5541-52

Biçaku E, Marchion DC, Schmitt ML, Münster PN. Selective inhibition of histone deacetylase 2 silences progesterone receptor-mediated signaling. Cancer Res. 2008 Mar 1;68(5):1513-9

Nott A, Watson PM, Robinson JD, Crepaldi L, Riccio A. S-Nitrosylation of histone deacetylase 2 induces chromatin remodelling in neurons. Nature. 2008 Sep 18;455(7211):411-5

Ropero S, Ballestar E, Alaminos M, Arango D, Schwartz S Jr, Esteller M. Transforming pathways unleashed by a HDAC2 mutation in human cancer. Oncogene. 2008 Jun 26;27(28):4008-12

Weichert W, Röske A, Gekeler V, Beckers T, Stephan C, Jung K, Fritzsche FR, Niesporek S, Denkert C, Dietel M, Kristiansen G. Histone deacetylases 1, 2 and 3 are highly expressed in prostate cancer and HDAC2 expression is associated with shorter PSA relapse time after radical prostatectomy. Br J Cancer. 2008 Feb 12;98(3):604-10

Yang XJ, Seto E. The Rpd3/Hda1 family of lysine deacetylases: from bacteria and yeast to mice and men. Nat Rev Mol Cell Biol. 2008 Mar;9(3):206-18

Barnes PJ. Role of HDAC2 in the pathophysiology of COPD. Annu Rev Physiol. 2009;71:451-64

Brunmeir R, Lagger S, Seiser C. Histone deacetylase HDAC1/HDAC2-controlled embryonic development and cell differentiation. Int J Dev Biol. 2009;53(2-3):275-89

Guan JS, Haggarty SJ, Giacometti E, Dannenberg JH, Joseph N, Gao J, Nieland TJ, Zhou Y, Wang X, Mazitschek R, Bradner JE, DePinho RA, Jaenisch R, Tsai LH. HDAC2 negatively regulates memory formation and synaptic plasticity. Nature. 2009 May 7;459(7243):55-60

Weichert W. HDAC expression and clinical prognosis in human malignancies. Cancer Lett. 2009 Aug 8;280(2):168-76

Noh JH, Jung KH, Kim JK, Eun JW, Bae HJ, Xie HJ, Chang YG, Kim MG, Park WS, Lee JY, Nam SW. Aberrant regulation of HDAC2 mediates proliferation of hepatocellular carcinoma cells by deregulating expression of G1/S cell cycle proteins. PLoS One. 2011;6(11):e28103

Jung KH, Noh JH, Kim JK, Eun JW, Bae HJ, Xie HJ, Chang YG, Kim MG, Park H, Lee JY, Nam SW. HDAC2 overexpression confers oncogenic potential to human lung cancer cells by deregulating expression of apoptosis and cell cycle proteins. J Cell Biochem. 2012 Jun;113(6):2167-77

Kim JK, Noh JH, Eun JW, Jung KH, Bae HJ, Shen Q, Kim MG, Chang YG, Kim SJ, Park WS, Lee JY, Borlak J, Nam SW. Targeted inactivation of HDAC2 restores p16INK4a activity and exerts antitumor effects on human gastric cancer. Mol Cancer Res. 2013 Jan;11(1):62-73


Bae HJ, Nam SW. HDAC2 (histone deacetylase 2). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):594-597.

Gene Section Review



INIST-CNRS

OPEN ACCESS JOURNAL

PF4 (platelet factor 4) Katrien Van Raemdonck, Paul Proost, Jo Van Damme, Sofie Struyf

Laboratory of Molecular Immunology, Rega Institute for Medical Research, Department of Microbiology and Immunology, KU Leuven, Leuven, Belgium (KVR, PP, JVD, SS)


Online updated version : http://AtlasGeneticsOncology.org/Genes/PF4ID41693ch4q13.html DOI: 10.4267/2042/54016


Abstract Review on PF4, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

Identity Other names: CXCL4, PF-4, SCYB4

HGNC (Hugo): PF4

Location: 4q13.3

Note The platelet factor CXCL4 is a rather atypical chemokine because its leukocyte chemoattractant activity is not that prominent. However, CXCL4 influences a large range of processes via interaction with a diversity of cellular receptors. These receptors are expressed on leukocytes, endothelial,

epithelial and mesangial cells and also tumor cells and involve classical chemokine receptors as well as glycosaminoglycans (GAG). Its most prominent activity is inhibition of angiogenesis and, consequently, of tumor growth and metastasis. The general biology of CXCL4 has been reviewed elaborately by different groups (Aidoudi and Bikfalvi, 2010; Kasper and Petersen, 2011; Vandercappellen et al., 2011).

DNA/RNA Note The CXCL4 gene is located in the CXC chemokine gene cluster on chromosome 4q, in close proximity of its variant gene PF-4var/PF-4alt/CXCL4L1. The gene and mRNA for CXCL4 are 1300 and 855 bp in length, respectively.

Figure 1. Structure of the human CXCL4 gene. This figure schematically depicts the structure of the human CXCL4 gene as described in the NCBI database (NM_002619). Lines represent the introns, whereas rectangular exons are coloured blue, yellow and green to represent the non-coding domains, the signal peptide and the mature protein, respectively. Grey numbers indicate the basepair numbering in the CXCL4 mRNA. Red numbers apply to the amino acids encoded.

PF4 (platelet factor 4) Van Raemdonck K, et al.


Description The CXCL4 mRNA is encoded by three exons as depicted in figure 1. Alternative splicing of the gene has not been reported.

Transcription The CXCL4 mRNA is predominantly present in platelets, but has also been detected in monocytes, T cells, T cell clones, human aortic smooth muscle cells, the colorectal adenocarcinoma cell line HCT-8.

Pseudogene None.

Protein Note CXCL4 precursor: 101 amino acids (aa), 10844.9 Da; CXCL4 mature: 70 aa, 7765.2 Da; Alternatively spliced signal peptide CXCL4: 74 aa, 8141.5 Da. Several NH2-terminally truncated forms.

Description CXCL4 is a member of the CXC chemokine family of chemoattractant cytokines. CXCL4 is a non-ELR CXC chemokine, meaning that it lacks the sequence glutamic acid-leucine-arginine just in front of the two NH2-terminally located conserved cysteine residues.

Expression CXCL4 is stored in secretory granules and released in response to protein kinase C activation. For example, in platelets the CXCL4 protein is stored in the alpha-granules and released upon activation by e.g. thrombin as a homotetramer bound to chrondroitin-4-sulphate on a carrier protein. Therefore, CXCL4 is present at high concentrations in thrombi and concentrations in serum reach levels of 10 µg/ml. CXCL4 protein has also been detected in mast cells by immunohistochemistry, and is released by monocytes (100 ng/ml), activated T cells, cultured microglia (1 ng/ml) and the colorectal adenocarcinoma cell line HCT-8 (0.5 ng/ml). Finally, prostate cancer cell lines DU-145 and PC-3 were shown to express CXCL4.

Localisation Secreted or stored in intracellular granules.

Function The first extracellular molecules binding CXCL4 were identified to be chrondroitin-sulphate-containing proteoglycans (Figure 2). These GAG

mediate the effects of CXCL4 on monocytes and neutrophils and pass intracellular signals to tyrosine kinases of the Src family, members of the MAP kinase family and monomeric GTPases. CXCL4 also has high affinity for heparin and heparan sulphate. Through its ability to bind and neutralize heparin, CXCL4 influences blood coagulation. More so, the interaction of CXCL4 with heparan sulphate proteoglycans on endothelial cells is responsible for the rapid clearance of CXCL4 from the circulation and prevents degradation of the chemokine. Besides binding to GAG, CXCL4 has also been described to bind several growth factors, such as VEGF and FGF-2, and other chemokines, including CCL2/MCP-1 and possibly CXCL12/SDF-1 (Carlson et al., 2012). This heteromultimerisation, sequestering angiogenic proteins, explains at least in part the anti-angiogenic effect of CXCL4. Heteromer formation of CXCL4 with CCL5/RANTES also affects monocyte recruitment (Koenen et al., 2009), and possibly atherogenesis. Although proteoglycans are mostly considered to be "co- receptors", the high affinity of CXCL4 for GAG was for a long time thought to mediate most, if not all, of its biological functions since no GPCR for CXCL4 was identified. However, Lasagni et al. identified a splice variant of CXCR3, which was named CXCR3B, as a functional GPCR for CXCL4. Currently, CXCL4 is known to activate both CXCR3A and CXCR3B (Figure 2). In general, proliferative and positive migratory effects are supposed to be mediated by CXCR3A, whereas inhibition of chemotaxis, anti-proliferative and apoptotic effects are postulated to be provoked via CXCR3B.

Homology CXCL4 is most closely related to its variant CXCL4L1, a non-allelic variant found only in primates. In men, mature proteins only differ in 3 amino acids.

Mutations Note CXCL4 appears to behave as a tumor suppressor gene. In multiple myeloma, CXCL4 is frequently silenced as a consequence of promoter hypermethylation (Cheng et al., 2007). Furthermore, a subclass of acute lymphoblastic leukemia patients exhibits a common translocation with a breakpoint distal to the CXCL4 gene (Arthur et al., 1982; Griffin et al., 1987).



Figure 2. Signaling pathways activated by CXCL4. A complex signaling network lies at the basis of the functional diversity of CXCL4. This network integrates several cascades initiated by different cellular receptors, including the G-protein-coupled receptors (GPCR) CXCR3A (Gi) and CXCR3B (Gs). CXCL4 also displays an exceptional high affinity for the glycosaminoglycans chains on membrane-embedded proteoglycans, hypothesized to initiate signaling cascades of their own (Kasper and Petersen, 2011). The schematic network depicted here represents a selection of prominent CXCL4-activated pathways and provides insight into the complexity of CXCL4 signaling, yet does not provide an exhaustive list of all signaling molecules implicated. Target cells for CXCL4 include leukocytes (neutrophils, monocytes, activated T cells, dendritic cells, NK cells and mast cells), endothelial cells, airway epithelial cells, hepatic stellate cells, mesangial cells and vascular pericytes.

Implicated in Leukemia and myeloma Prognosis Serum proteome profiling revealed decreased serum levels of CXCL4 as a biomarker for advanced myelodysplastic syndrome (MDS), often progressing to acute myeloid leukemia (AML) (Aivado et al., 2007). Other studies have corroborated involvement of CXCL4 over the course of MDS and AML and have recognized the chemokine as a prognostic, therapy-associated marker indicative of response to therapy, blood count recovery and eventual clinical outcome (Bai et al., 2013; Chen et al., 2010; Kim et al., 2008).

Oncogenesis Evidence in acute lymphoblastic leukemia (ALL), showing a common translocation amongst a subclass of patients, with a breakpoint in 4q21 which was later shown to be distal to the CXCL4 gene, suggested the involvement of CXCL4 in ALL tumorigenesis (Arthur et al., 1982; Griffin et al.,

1987). More recently, decreased serum levels of CXCL4 have also been suggested to serve as a marker for pediatric ALL (Shi et al., 2009). In multiple myeloma CXCL4 was effectively identified as a tumor suppressor gene, frequently silenced as a consequence of promoter hypermethylation (Cheng et al., 2007).

Osteosarcoma Disease The platelet-associated CXCL4 expression was found to be elevated shortly after implantation of human osteosarcoma in mice (Cervi et al., 2008). It has been proposed as a biomarker of early tumor growth. Alternatively, another recent study described plasma levels of CXCL4 to be elevated in pediatric osteosarcoma patients (Li et al., 2011).

Prognosis Not only were plasma levels of CXCL4 in pediatric osteosarcoma patients shown to be significantly higher than those in controls, survival analysis further revealed that higher circulating levels of CXCL4 were associated with a poorer outcome (Li



et al., 2011). CXCL4 may prove to be a promising prognostic factor in osteosarcoma patients in the future.

Liposarcoma Disease The platelet-associated CXCL4 expression, unlike its soluble plasma counterpart, was found to be elevated shortly after implantation of human liposarcoma in mice (Cervi et al., 2008). It has been proposed as a biomarker of early tumor growth.

Mammary adenocarcinoma Disease The platelet-associated CXCL4 expression, unlike its soluble plasma counterpart, was found to be elevated shortly after implantation of human mammary adenocarcinoma in mice (Cervi et al., 2008). It has been proposed as a biomarker of early tumor growth.

Pancreatic adenocarcinoma Prognosis Discovery of a cancer-associated reduction of CXCL4 serum concentrations lead to the identification of CXCL4 as a discriminating marker in pancreatic cancer (Fiedler et al., 2009). Potential of CXCL4 as a diagnostic marker was shortly after confirmed (Poruk et al., 2010). Moreover, serum CXCL4 was also identified as a strong independent predictor of survival in this study, where decreased survival is associated with elevated CXCL4 levels. Finally, as a prognostic marker, CXCL4 may prove to be valuable in identifying patients at risk of complications and thus may benefit from prophylactic antithrombotic therapy (Poruk et al., 2010).

Colorectal cancer Disease Platelet content of CXCL4 in 35 patients with colon cancer was shown to be significantly increased when compared to 84 age-matched healthy controls (Peterson et al., 2012). Though not thought to be clinically relevant, a change in CXCL4 platelet levels was identified as a predictor of colorectal carcinoma which could potentially enable early diagnosis of disease.

Prostate cancer Prognosis Recent in vitro research has evidenced that particular prostate tumor cells, namely DU-145 and PC-3 cells, exhibit a shift in CXCR3 splice variant presentation (Wu et al., 2012). In combination with the reported elevated tumor CXCL4 expression in vitro, these data suggest CXCL4 might promote in vitro migration and

invasiveness of prostate cancer cells marked by a change in their CXCR3 expression pattern. However, CXCL4 levels have been described previously to be significantly decreased in the sera of all metastatic prostate carcinoma patients compared to healthy individuals, as well as compared to localized prostate carcinoma patients (Lam et al., 2005).

Endometriosis-associated ovarian cancer (EAOC) Oncogenesis Both clear cell and endometrioid types of ovarian cancers occasionally develop on the bases of endometriosis. These endometriosis-associated ovarian cancers (EAOC) are characterized by infiltration of CXCL4-depleted tumor-associated macrophages, whereas in contrast, in pre-existing endometriosis CXCL4 is strongly expressed by CD68+ infiltrating macrophages (Furuya et al., 2012). Macrophage CXCL4 expression is thus associated with EAOC disease state and pre-malignant lesions.

Metastatic carcinoma Disease Analysis of platelet content in a heterogeneous group of patients with newly diagnosed metastatic disease (including colorectal cancer, renal cell cancer, malignant fibrous histiocytoma, leiomyosarcoma and peripheral neuroectodermal cancer) a significant reduction in CXCL4 platelet concentrations was observed (Wiesner et al., 2010). Simultaneously, however, CXCL4 was upregulated in cancer patient plasma.

Chemotherapy-induced thrombocytopenia (CIT) Prognosis CXCL4 may be a useful biomarker predicting the risk of thrombocytopenia developing with chemotherapy (CIT) (Lambert et al., 2012). Patients with low steady-state platelet CXCL4 levels would better tolerate chemotherapy, whereas high concentrations may be an indication for CIT and predict the need for a platelet transfusion.

Hepatitis and liver fibrosis Disease CXCL4 expression is enhanced in the liver of patients with advanced hepatitis C virus-induced fibrosis or nonalcoholic steatohepatitis and Cxcl4 knock-out mice had significantly reduced histological and biochemical liver damage in an in vivo model for fibrotic liver disease (Zaldivar et al., 2010). In vitro, recombinant mouse CXCL4 stimulated proliferation and chemotaxis of hepatic stellate cells.



Malaria Disease Acute Plasmodium falciparum infection, causing malaria characterized by especially high morbidity and mortality, leads to elevated plasma levels of platelet-specific proteins, including CXCL4 (Essien and Ebhota, 1983). On the one hand CXCL4 exerts a protective, antimalarial effect. Upon binding of platelets to infected red blood cells, locally released CXCL4 in particular instigates killing of intraerythrocytic P. falciparum parasites (Love et al., 2012; McMorran et al., 2013). The protective function of blood platelets and CXCL4 is dependent on the Duffy-antigen receptor (Fy/DARC) on the erythrocytes. On the other hand, CXCL4 mediates the pathogenesis of cerebral malaria (CM), a serious complication of P. falciparum infection (Wilson et al., 2011). CXCL4 is believed to promote a pro-inflammatory environment and to contribute to disruption of the blood-brain barrier.

Prognosis Wilson et al. have suggested a prominent role for CXCL4 in the pathogenesis of fatal CM and identified this chemokine as a potential prognostic biomarker for CM mortality (Wilson et al., 2011).

Acquired immunodeficiency syndrome (AIDS) Disease Auerback et al. have identified CXCL4 as a unique broad-spectrum inhibitor of HIV-1 (Auerbach et al., 2012). Through binding of the external viral envelope glycoprotein, gp120, CXCL4 interferes with the earliest events in the viral infectious cycle, namely attachment and entry, and consequently reduces replication of different phenotypic variants of HIV-1 in CD4+ T cells and macrophages. In parallel, another study found activated platelets to release antiviral factors which suppress HIV-1 infection of T cells and confirmed CXCL4 to be a key player in this first line of defense against HIV-1 (Tsegaye et al., 2013).

Prognosis Preliminary results reported by Auerback and colleagues suggest a correlation between higher serum levels of CXCL4 in HIV-1-infected patients and a less advanced clinical stage (Auerbach et al., 2012).

Heparin-induced thrombocytopenia (HIT) Disease Heparin is widely used as anti-coagulant during invasive vascular surgery and to treat thrombo-embolic pathology. HIT is a rare (1-5%), paradoxal

complication of anticoagulant heparin therapy in which patients having developed antibodies against CXCL4/heparin complexes, are at risk for venous as well as arterial thrombosis, despite low platelet counts (Rauova et al., 2010). Heparin is thought to act as an adjuvant integral to immunogenesis, whereas the HIT antibody recognizes antigenic epitopes within CXCL4 and thus the presence of CXCL4 is essential to the clinical manifestations caused by circulating antibodies (Prechel and Walenga, 2013).

Rheumatoid arthritis Prognosis Increased levels of CXCL4 have been reported in the synovial fluid of patients with rheumatoid arthritis (Erdem et al., 2007). However, especially elevated plasma levels of CXCL4 in particular subsets of patients may be associated with clinical manifestation of rheumatoid arthritis, such as the occurrence of cutaneous vasculitis, and also correlate to a non-response to anti-TNFα therapy (Trocme et al., 2009; Yamamoto et al., 2002).

Proliferative diabetic retinopathy (PDR) Disease Early on an association was recognized between diabetes and PDR on the one hand and elevated plasma levels of coagulation factors, such as CXCL4, on the other hand (Ek et al., 1982; Roy et al., 1988). Recent clinical studies have not only confirmed elevated CXCL4 levels in the vitreous fluid of PDR patients but also a correlation between vitreous CXCL4 concentration and PDR clinical disease activity (Nawaz et al., 2013). Vitreous levels of CXCL4 are significantly higher both in PDR with active neovascularisation and in PDR without traction retinal detachment.

Inflammatory bowel disease (IBD) Disease Already in 1987, plasma CXCL4 concentrations were shown to be increased in patients with IBD disease (Simi et al., 1987). CXCL4 was later on identified as a biomarker for IBD using proteomic serum profiling (Meuwis et al., 2007). Though originally controversial, plasma CXCL4 levels were confirmed to be positively correlated to disease activity in Crohn's disease (Vrij et al., 2000).

Prognosis Similar to their predictive role in rheumatoid arthritis, high CXCL4 plasma levels are indicative of non-responsiveness to anti-TNFα antibody



(infliximab) treatment in Crohn's disease (Meuwis et al., 2008).

Atherosclerosis Disease The proatherogenic role of CXCL4 has been established in a variety of mostly preclinical studies (e.g. Sachais et al., 2007). CXCL4, released by activated platelets at injury sites, presumably promotes the progression of atherosclerotic lesions through different mechanisms. These include recruiting and arresting peripheral monocytes at the lesion site and consequently facilitating their differentiation into macrophages and concordant polarization as well as inhibiting degradation of LDL-R while increasing uptake and esterification of ox-LDL in macrophages (Aidoudi and Bikfalvi, 2010; Gleissner, 2012). The histological distribution of CXCL4 was also shown to be associated with the location and grade of vascular lesions (Pitsilos et al., 2003). Staining of macrophages for CXCL4 correlated with symptomatic atherosclerotic disease. Moreover, proinflammatory heteromer formation of CXCL4 with another platelet chemokine CCL5/RANTES has emerged as an additional regulatory mechanism, enhancing monocyte recruitment and thereby contributing to the disease progression (Koenen et al., 2009). Recently, a linkage study described an association between CXCL4 and platelet activation in human patients, thus linking this chemokine to the clinical manifestation of atherosclerosis (Bhatnagar et al., 2012).

References Arthur DC, Bloomfield CD, Lindquist LL, Nesbit ME Jr. Translocation 4; 11 in acute lymphoblastic leukemia: clinical characteristics and prognostic significance. Blood. 1982 Jan;59(1):96-9

Ek I, Thunell S, Blombäck M. Enhanced in vivo platelet activation in diabetes mellitus. Scand J Haematol. 1982 Aug;29(2):185-91

Essien EM, Ebhota MI. Platelet secretory activities in acute malaria (Plasmodium falciparum) infection. Acta Haematol. 1983;70(3):183-8

Griffin CA, Emanuel BS, LaRocco P, Schwartz E, Poncz M. Human platelet factor 4 gene is mapped to 4q12----q21. Cytogenet Cell Genet. 1987;45(2):67-9

Simi M, Leardi S, Tebano MT, Castelli M, Costantini FM, Speranza V. Raised plasma concentrations of platelet factor 4 (PF4) in Crohn's disease. Gut. 1987 Mar;28(3):336-8

Roy MS, Podgor MJ, Rick ME. Plasma fibrinopeptide A, beta-thromboglobulin, and platelet factor 4 in diabetic retinopathy. Invest Ophthalmol Vis Sci. 1988 Jun;29(6):856-60

Vrij AA, Rijken J, Van Wersch JW, Stockbrügger RW. Platelet factor 4 and beta-thromboglobulin in inflammatory

bowel disease and giant cell arteritis. Eur J Clin Invest. 2000 Mar;30(3):188-94

Yamamoto T, Chikugo T, Tanaka Y. Elevated plasma levels of beta-thromboglobulin and platelet factor 4 in patients with rheumatic disorders and cutaneous vasculitis. Clin Rheumatol. 2002 Nov;21(6):501-4

Pitsilos S, Hunt J, Mohler ER, Prabhakar AM, Poncz M, Dawicki J, Khalapyan TZ, Wolfe ML, Fairman R, Mitchell M, Carpenter J, Golden MA, Cines DB, Sachais BS. Platelet factor 4 localization in carotid atherosclerotic plaques: correlation with clinical parameters. Thromb Haemost. 2003 Dec;90(6):1112-20

Lam YW, Mobley JA, Evans JE, Carmody JF, Ho SM. Mass profiling-directed isolation and identification of a stage-specific serologic protein biomarker of advanced prostate cancer. Proteomics. 2005 Jul;5(11):2927-38

Aivado M, Spentzos D, Germing U, Alterovitz G, Meng XY, Grall F, Giagounidis AA, Klement G, Steidl U, Otu HH, Czibere A, Prall WC, Iking-Konert C, Shayne M, Ramoni MF, Gattermann N, Haas R, Mitsiades CS, Fung ET, Libermann TA. Serum proteome profiling detects myelodysplastic syndromes and identifies CXC chemokine ligands 4 and 7 as markers for advanced disease. Proc Natl Acad Sci U S A. 2007 Jan 23;104(4):1307-12

Cheng SH, Ng MH, Lau KM, Liu HS, Chan JC, Hui AB, Lo KW, Jiang H, Hou J, Chu RW, Wong WS, Chan NP, Ng HK. 4q loss is potentially an important genetic event in MM tumorigenesis: identification of a tumor suppressor gene regulated by promoter methylation at 4q13.3, platelet factor 4. Blood. 2007 Mar 1;109(5):2089-99

Erdem H, Pay S, Musabak U, Simsek I, Dinc A, Pekel A, Sengul A. Synovial angiostatic non-ELR CXC chemokines in inflammatory arthritides: does CXCL4 designate chronicity of synovitis? Rheumatol Int. 2007 Aug;27(10):969-73

Meuwis MA, Fillet M, Geurts P, de Seny D, Lutteri L, Chapelle JP, Bours V, Wehenkel L, Belaiche J, Malaise M, Louis E, Merville MP. Biomarker discovery for inflammatory bowel disease, using proteomic serum profiling. Biochem Pharmacol. 2007 May 1;73(9):1422-33

Sachais BS, Turrentine T, Dawicki McKenna JM, Rux AH, Rader D, Kowalska MA. Elimination of platelet factor 4 (PF4) from platelets reduces atherosclerosis in C57Bl/6 and apoE-/- mice. Thromb Haemost. 2007 Nov;98(5):1108-13

Cervi D, Yip TT, Bhattacharya N, Podust VN, Peterson J, Abou-Slaybi A, Naumov GN, Bender E, Almog N, Italiano JE Jr, Folkman J, Klement GL. Platelet-associated PF-4 as a biomarker of early tumor growth. Blood. 2008 Feb 1;111(3):1201-7

Kim JY, Song HJ, Lim HJ, Shin MG, Kim JS, Kim HJ, Kim BY, Lee SW. Platelet factor-4 is an indicator of blood count recovery in acute myeloid leukemia patients in complete remission. Mol Cell Proteomics. 2008 Feb;7(2):431-41

Meuwis MA, Fillet M, Lutteri L, Marée R, Geurts P, de Seny D, Malaise M, Chapelle JP, Wehenkel L, Belaiche J, Merville MP, Louis E. Proteomics for prediction and characterization of response to infliximab in Crohn's disease: a pilot study. Clin Biochem. 2008 Aug;41(12):960-7

Fiedler GM, Leichtle AB, Kase J, Baumann S, Ceglarek U, Felix K, Conrad T, Witzigmann H, Weimann A, Schütte C, Hauss J, Büchler M, Thiery J. Serum peptidome profiling revealed platelet factor 4 as a potential discriminating Peptide associated with pancreatic cancer. Clin Cancer Res. 2009 Jun 1;15(11):3812-9



Koenen RR, von Hundelshausen P, Nesmelova IV, Zernecke A, Liehn EA, Sarabi A, Kramp BK, Piccinini AM, Paludan SR, Kowalska MA, Kungl AJ, Hackeng TM, Mayo KH, Weber C. Disrupting functional interactions between platelet chemokines inhibits atherosclerosis in hyperlipidemic mice. Nat Med. 2009 Jan;15(1):97-103

Shi L, Zhang J, Wu P, Feng K, Li J, Xie Z, Xue P, Cai T, Cui Z, Chen X, Hou J, Zhang J, Yang F. Discovery and identification of potential biomarkers of pediatric acute lymphoblastic leukemia. Proteome Sci. 2009 Mar 16;7:7

Trocmé C, Marotte H, Baillet A, Pallot-Prades B, Garin J, Grange L, Miossec P, Tebib J, Berger F, Nissen MJ, Juvin R, Morel F, Gaudin P. Apolipoprotein A-I and platelet factor 4 are biomarkers for infliximab response in rheumatoid arthritis. Ann Rheum Dis. 2009 Aug;68(8):1328-33

Aidoudi S, Bikfalvi A. Interaction of PF4 (CXCL4) with the vasculature: a role in atherosclerosis and angiogenesis. Thromb Haemost. 2010 Nov;104(5):941-8

Chen C, Bowen DT, Giagounidis AA, Schlegelberger B, Haase S, Wright EG. Identification of disease- and therapy-associated proteome changes in the sera of patients with myelodysplastic syndromes and del(5q). Leukemia. 2010 Nov;24(11):1875-84

Poruk KE, Firpo MA, Huerter LM, Scaife CL, Emerson LL, Boucher KM, Jones KA, Mulvihill SJ. Serum platelet factor 4 is an independent predictor of survival and venous thromboembolism in patients with pancreatic adenocarcinoma. Cancer Epidemiol Biomarkers Prev. 2010 Oct;19(10):2605-10

Rauova L, Hirsch JD, Greene TK, Zhai L, Hayes VM, Kowalska MA, Cines DB, Poncz M. Monocyte-bound PF4 in the pathogenesis of heparin-induced thrombocytopenia. Blood. 2010 Dec 2;116(23):5021-31

Wiesner T, Bugl S, Mayer F, Hartmann JT, Kopp HG. Differential changes in platelet VEGF, Tsp, CXCL12, and CXCL4 in patients with metastatic cancer. Clin Exp Metastasis. 2010 Mar;27(3):141-9

Zaldivar MM, Pauels K, von Hundelshausen P, Berres ML, Schmitz P, Bornemann J, Kowalska MA, Gassler N, Streetz KL, Weiskirchen R, Trautwein C, Weber C, Wasmuth HE. CXC chemokine ligand 4 (Cxcl4) is a platelet-derived mediator of experimental liver fibrosis. Hepatology. 2010 Apr;51(4):1345-53

Kasper B, Petersen F. Molecular pathways of platelet factor 4/CXCL4 signaling. Eur J Cell Biol. 2011 Jun-Jul;90(6-7):521-6

Li Y, Flores R, Yu A, Okcu MF, Murray J, Chintagumpala M, Hicks J, Lau CC, Man TK. Elevated expression of CXC chemokines in pediatric osteosarcoma patients. Cancer. 2011 Jan 1;117(1):207-17

Vandercappellen J, Van Damme J, Struyf S. The role of the CXC chemokines platelet factor-4 (CXCL4/PF-4) and its variant (CXCL4L1/PF-4var) in inflammation, angiogenesis and cancer. Cytokine Growth Factor Rev. 2011 Feb;22(1):1-18

Wilson NO, Jain V, Roberts CE, Lucchi N, Joel PK, Singh MP, Nagpal AC, Dash AP, Udhayakumar V, Singh N, Stiles JK. CXCL4 and CXCL10 predict risk of fatal cerebral malaria. Dis Markers. 2011;30(1):39-49

Auerbach DJ, Lin Y, Miao H, Cimbro R, Difiore MJ, Gianolini ME, Furci L, Biswas P, Fauci AS, Lusso P. Identification of the platelet-derived chemokine CXCL4/PF-

4 as a broad-spectrum HIV-1 inhibitor. Proc Natl Acad Sci U S A. 2012 Jun 12;109(24):9569-74

Bhatnagar P, Lu X, Evans MK, Laveist TA, Zonderman AB, Carter DL, Arking DE, Fletcher CA. Genetic variants in platelet factor 4 modulate inflammatory and platelet activation biomarkers. Circ Cardiovasc Genet. 2012 Aug 1;5(4):412-21

Furuya M, Tanaka R, Miyagi E, Kami D, Nagahama K, Miyagi Y, Nagashima Y, Hirahara F, Inayama Y, Aoki I. Impaired CXCL4 expression in tumor-associated macrophages (TAMs) of ovarian cancers arising in endometriosis. Cancer Biol Ther. 2012 Jun;13(8):671-80

Gleissner CA. Macrophage Phenotype Modulation by CXCL4 in Atherosclerosis. Front Physiol. 2012;3:1

Lambert MP, Reznikov A, Grubbs A, Nguyen Y, Xiao L, Aplenc R, Rauova L, Poncz M. Platelet factor 4 platelet levels are inversely correlated with steady-state platelet counts and with platelet transfusion needs in pediatric leukemia patients. J Thromb Haemost. 2012 Jul;10(7):1442-6

Love MS, Millholland MG, Mishra S, Kulkarni S, Freeman KB, Pan W, Kavash RW, Costanzo MJ, Jo H, Daly TM, Williams DR, Kowalska MA, Bergman LW, Poncz M, DeGrado WF, Sinnis P, Scott RW, Greenbaum DC. Platelet factor 4 activity against P. falciparum and its translation to nonpeptidic mimics as antimalarials. Cell Host Microbe. 2012 Dec 13;12(6):815-23

Peterson JE, Zurakowski D, Italiano JE Jr, Michel LV, Connors S, Oenick M, D'Amato RJ, Klement GL, Folkman J. VEGF, PF4 and PDGF are elevated in platelets of colorectal cancer patients. Angiogenesis. 2012 Jun;15(2):265-73

Wu Q, Dhir R, Wells A. Altered CXCR3 isoform expression regulates prostate cancer cell migration and invasion. Mol Cancer. 2012 Jan 11;11:3

Bai J, He A, Zhang W, Huang C, Yang J, Yang Y, Wang J, Zhang Y. Potential biomarkers for adult acute myeloid leukemia minimal residual disease assessment searched by serum peptidome profiling. Proteome Sci. 2013;11:39

Carlson J, Baxter SA, Dréau D, Nesmelova IV. The heterodimerization of platelet-derived chemokines. Biochim Biophys Acta. 2013 Jan;1834(1):158-68

McMorran BJ, Burgio G, Foote SJ. New insights into the protective power of platelets in malaria infection. Commun Integr Biol. 2013 May 1;6(3):e23653

Nawaz MI, Van Raemdonck K, Mohammad G, Kangave D, Van Damme J, Abu El-Asrar AM, Struyf S. Autocrine CCL2, CXCL4, CXCL9 and CXCL10 signal in retinal endothelial cells and are enhanced in diabetic retinopathy. Exp Eye Res. 2013 Apr;109:67-76

Prechel MM, Walenga JM. Emphasis on the Role of PF4 in the Incidence, Pathophysiology and Treatment of Heparin Induced Thrombocytopenia. Thromb J. 2013 Apr 5;11(1):7

Solomon Tsegaye T, Gnirß K, Rahe-Meyer N, Kiene M, Krämer-Kühl A, Behrens G, Münch J, Pöhlmann S. Platelet activation suppresses HIV-1 infection of T cells. Retrovirology. 2013 May 1;10:48


Van Raemdonck K, Proost P, Van Damme J, Struyf S. PF4 (platelet factor 4). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):598-604.

Leukaemia Section Short Communication



INIST-CNRS

OPEN ACCESS JOURNAL

t(9;13)(p12;q21) PAX5/DACH1 Jean-Loup Huret

Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)


Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0913p12q21ID1560.html DOI: 10.4267/2042/54017


Abstract Short communication on t(9;13)(p12;q21) PAX5/DACH1, with data on clinics, and the genes implicated.

Clinics and pathology Disease B-cell acute lymphoblastic leukemia (B-ALL)

Epidemiology Only one case to date, a 5-year old boy with a CD10+ ALL (Nebral et al., 2009).

Prognosis The patient was noted at an intermediate risk, reached complete remission, and was alive at 23 months+.

Genes involved and proteins PAX5 Location 9p13.2

Protein 391 amino acids; from N-term to C-term, PAX5 contains: a paired domain (aa: 16-142); an octapeptide (aa: 179-186); a partial homeodomain (aa: 228-254); a transactivation domain (aa: 304-359); and an inhibitory domain (aa: 359-391). Lineage-specific transcription factor; recognizes the concensus recognition sequence GNCCANTGAAGCGTGAC, where N is any

nucleotide. Involved in B-cell differentiation. Entry of common lymphoid progenitors into the B cell lineage depends on E2A, EBF1, and PAX5; activates B-cell specific genes and repress genes involved in other lineage commitments. Activates the surface cell receptor CD19 and repress FLT3. Pax5 physically interacts with the RAG1/RAG2 complex, and removes the inhibitory signal of the lysine-9-methylated histone H3, and induces V-to-DJ rearrangements. Genes repressed by PAX5 expression in early B cells are restored in their function in mature B cells and plasma cells, and PAX5 repressed (Fuxa et al., 2004; Johnson et al., 2004; Zhang et al., 2006; Cobaleda et al., 2007; Medvedovic et al., 2011).

DACH1 Location 13q21.33

DNA/RNA 2 splice transcript variants.

Protein 708 and 760 amino acids (aa). From N-term to C-term (for the 760 aa form), contains a Poly-Ala (aa 61-68), three Poly-Gly (aa 74-89; aa 92-103; aa 116-123), a Poly-Ser (aa 142-165), a Dachshund domain motif N (aa 191-277), an interaction region with SIX6 (14q23.1) and HDAC3 (5q31) (aa 191-386), two Poly-Ala (aa 327-335; aa 469-472), a Dachshund Domain motif C (aa 618-698), an interaction region with SIN3A (15q24.2) and SIN3B (19p13.11),(aa 629-708), and a Coiled coil domain (aa 632-720) (Swiss-Prot).

t(9;13)(p12;q21) PAX5/DACH1 Huret JL


PAX5/DACH1 fusion protein. DACH1 is a tumor suppressor. DACH1 downregulates EGFR (7p11.2), CCND1 (11q13), ESR1 (6q25.1) and AR (Xq12), and also TGFB1 (19q13.2), through interaction with SMAD4 (18q21.2) and NCOR1 (17p11.2). DACH1 coprecipitates the histone deacetylase proteins (HDAC1, HDAC2, and NCOR1). DACH1 transcriptionally represses JUN (1p32.1), and FOS (14q24.3), and DACH1 inhibits DNA synthesis and cellular proliferation (Wu et al., 2007). DACH1 is involved in the PAX-EYA-SIX-DACH regulatory pathway (eyeless (PAX6), sine oculis (SIX1, SIX2, SIX3, SIX4, SIX5, SIX6), eyes absent (EYA1, EYA2, EYA3, EYA4), and dachshund (DACH1-2)). CREBBP (16p13.3) is involved in this process. DACH1 is involved in the development of the neocortex and the hippocampus, is expressed by neural stem cells during early neurogenesis, and also in adult neurogenesis following brain ischemia (Honsa et al., 2013). DACH1 inhibits breast cancer cellular proliferation via cyclin D1 (Nan et al., 2009). DACH1 suppresses epithelial-mesenchymal transition via repression of cytoplasmic translational induction of SNAI2 (8q11.21) by inactivating YBX1 (1p34.2). DACH1 blockes YBX1-induced mammary tumor growth (Wu et al., 2014). DACH1 expression appears to be predictive of good prognosis in oestrogen receptor (ER) positive breast cancer (Powe et al., 2014). DACH1 inhibites prostate cancer cellular DNA synthesis and growth (Wu et al., 2009). DACH1, BMP7 (20q13.31), and MECOM (EVI1, 3q26.2) were up-

regulated in advanced-stage ovarian cancers, and inhibited TGF-beta signaling in these cancers associated with TGFb resistance (Purcell et al., 2005). DACH1 is frequently methylated in hepatocellular carcinoma and DACH1 expression is regulated by promoter hypermethylation. Down-regulation of DACH1 is a novel mechanism for gaining resistance to the TGFB1 (19q13.2) antiproliferative signaling (Zhu et al., 2013). DACH1 is also frequently methylated in human colorectal cancer and methylation of DACH1 may serve as detective and prognostic marker in colorectal cancer (Yan et al., 2013). DACH1 regulates FGF2 (4q27)-mediated tumor-initiating activity of glioma cells and inhibits formation of tumor-initiating spheroids of glioma cells (Watanabe et al., 2011).

Result of the chromosomal anomaly Hybrid gene Description Fusion of PAX5 exon 5 to DACH1 exon 5.

Fusion protein Description 585 amino acids. The predicted fusion protein contains the DNA binding paired domain of PAX5 (the 201 N-term aa) and the DACHbox-C of DACH1 (the 384 C-term aa).

t(9;13)(p12;q21) PAX5/DACH1 Huret JL


References Fuxa M, Skok J, Souabni A, Salvagiotto G, Roldan E, Busslinger M. Pax5 induces V-to-DJ rearrangements and locus contraction of the immunoglobulin heavy-chain gene. Genes Dev. 2004 Feb 15;18(4):411-22

Johnson K, Pflugh DL, Yu D, Hesslein DG, Lin KI, Bothwell AL, Thomas-Tikhonenko A, Schatz DG, Calame K. B cell-specific loss of histone 3 lysine 9 methylation in the V(H) locus depends on Pax5. Nat Immunol. 2004 Aug;5(8):853-61

Purcell P, Oliver G, Mardon G, Donner AL, Maas RL. Pax6-dependence of Six3, Eya1 and Dach1 expression during lens and nasal placode induction. Gene Expr Patterns. 2005 Dec;6(1):110-8

Zhang Z, Espinoza CR, Yu Z, Stephan R, He T, Williams GS, Burrows PD, Hagman J, Feeney AJ, Cooper MD. Transcription factor Pax5 (BSAP) transactivates the RAG-mediated V(H)-to-DJ(H) rearrangement of immunoglobulin genes. Nat Immunol. 2006 Jun;7(6):616-24

Cobaleda C, Schebesta A, Delogu A, Busslinger M. Pax5: the guardian of B cell identity and function. Nat Immunol. 2007 May;8(5):463-70

Wu K, Liu M, Li A, Donninger H, Rao M, Jiao X, Lisanti MP, Cvekl A, Birrer M, Pestell RG. Cell fate determination factor DACH1 inhibits c-Jun-induced contact-independent growth. Mol Biol Cell. 2007 Mar;18(3):755-67

Nan F, Lü Q, Zhou J, Cheng L, Popov VM, Wei S, Kong B, Pestell RG, Lisanti MP, Jiang J, Wang C. Altered expression of DACH1 and cyclin D1 in endometrial cancer. Cancer Biol Ther. 2009 Aug;8(16):1534-9

Nebral K, Denk D, Attarbaschi A, König M, Mann G, Haas OA, Strehl S. Incidence and diversity of PAX5 fusion genes in childhood acute lymphoblastic leukemia. Leukemia. 2009 Jan;23(1):134-43

Wu K, Katiyar S, Witkiewicz A, Li A, McCue P, Song LN, Tian L, Jin M, Pestell RG. The cell fate determination factor dachshund inhibits androgen receptor signaling and prostate cancer cellular growth. Cancer Res. 2009 Apr 15;69(8):3347-55

Popov VM, Wu K, Zhou J, Powell MJ, Mardon G, Wang C,

Pestell RG. The Dachshund gene in development and hormone-responsive tumorigenesis. Trends Endocrinol Metab. 2010 Jan;21(1):41-9

Medvedovic J, Ebert A, Tagoh H, Busslinger M. Pax5: a master regulator of B cell development and leukemogenesis. Adv Immunol. 2011;111:179-206

Watanabe A, Ogiwara H, Ehata S, Mukasa A, Ishikawa S, Maeda D, Ueki K, Ino Y, Todo T, Yamada Y, Fukayama M, Saito N, Miyazono K, Aburatani H. Homozygously deleted gene DACH1 regulates tumor-initiating activity of glioma cells. Proc Natl Acad Sci U S A. 2011 Jul 26;108(30):12384-9

Honsa P, Pivonkova H, Anderova M. Focal cerebral ischemia induces the neurogenic potential of mouse Dach1-expressing cells in the dorsal part of the lateral ventricles. Neuroscience. 2013 Jun 14;240:39-53

Yan W, Wu K, Herman JG, Brock MV, Fuks F, Yang L, Zhu H, Li Y, Yang Y, Guo M. Epigenetic regulation of DACH1, a novel Wnt signaling component in colorectal cancer. Epigenetics. 2013 Dec;8(12):1373-83

Zhu H, Wu K, Yan W, Hu L, Yuan J, Dong Y, Li Y, Jing K, Yang Y, Guo M. Epigenetic silencing of DACH1 induces loss of transforming growth factor-β1 antiproliferative response in human hepatocellular carcinoma. Hepatology. 2013 Dec;58(6):2012-22

Powe DG, Dhondalay GK, Lemetre C, Allen T, Habashy HO, Ellis IO, Rees R, Ball GR. DACH1: its role as a classifier of long term good prognosis in luminal breast cancer. PLoS One. 2014;9(1):e84428

Wu K, Chen K, Wang C, Jiao X, Wang L, Zhou J, Wang J, Li Z, Addya S, Sorensen PH, Lisanti MP, Quong A, Ertel A, Pestell RG. Cell fate factor DACH1 represses YB-1-mediated oncogenic transcription and translation. Cancer Res. 2014 Feb 1;74(3):829-39


Huret JL. t(9;13)(p12;q21) PAX5/DACH1. Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):605-607.

Leukaemia Section Short Communication



INIST-CNRS

OPEN ACCESS JOURNAL

t(X;9)(q21;p13) PAX5/DACH2 Jean-Loup Huret

Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)


Online updated version : http://AtlasGeneticsOncology.org/Anomalies/tX09q21p13ID1595.html DOI: 10.4267/2042/54018


Abstract Short communication on t(X;9)(q21;p13) PAX5/DACH2, with data on clinics, and the genes implicated.

Clinics and pathology Disease Acute lymphoblastic leukemia (ALL)

Epidemiology Only one case to date, a 4-year old boy with a pre-B ALL (Coyaud et al., 2010).

Prognosis No data.

Cytogenetics Cytogenetics morphological The t(X;9)(q21;p13) was the sole abnormality.

Genes involved and proteins PAX5 Location 9p13.2

Protein 391 amino acids; from N-term to C-term, PAX5 contains: a paired domain (aa: 16-142); an octapeptide (aa: 179-186); a partial homeodomain (aa: 228-254); a transactivation domain (aa: 304-359); and an inhibitory domain (aa: 359-391). Lineage-specific transcription factor; recognizes the concensus recognition sequence

GNCCANTGAAGCGTGAC, where N is any nucleotide. Involved in B-cell differentiation. Entry of common lymphoid progenitors into the B cell lineage depends on E2A, EBF1, and PAX5; activates B-cell specific genes and repress genes involved in other lineage commitments. Activates the surface cell receptor CD19 and repress FLT3. Pax5 physically interacts with the RAG1/RAG2 complex, and removes the inhibitory signal of the lysine-9-methylated histone H3, and induces V-to-DJ rearrangements. Genes repressed by PAX5 expression in early B cells are restored in their function in mature B cells and plasma cells, and PAX5 repressed (Fuxa et al., 2004; Johnson et al., 2004; Zhang et al., 2006; Cobaleda et al., 2007; Medvedovic et al., 2011).

DACH2 Location Xq21.2

DNA/RNA 7 splice transcript variants.

Protein 599 amino acids and shorter forms; from N-term to C-term, contains a Poly-Gly (amino acids (aa) 56-61), a Dachshund domain motif N (aa 69-155), which interact with HDAC3 (histone deacetylase 3, 5q31), NCOR1 (nuclear receptor corepressor 1, 17p11.2), and SIX6 (SIX homeobox 6, 14q23.1), a Poly-Ala (aa 350-353), a Dachshund Domain motif C, which interact with EYA2 (eyes absent homolog 2 (Drosophila), 20q13.1), and a Coiled coil domain (aa 459-554) (Swiss-Prot). DACH2 is a transcriptional repressor of MYOG (myogenin, 1q32.1).

t(X;9)(q21;p13) PAX5/DACH2 Huret JL


PAX5/DACH2 fusion protein.

PAX3 (paired box gene 3, 2q36.1) and DACH2 positively regulate each other, and support the existence of a PAX3/SIX1/EYA2/LBX1/DACH2 network in regulating the myogenic differentiation program (Mennerich and Braun, 2001; Kardon et al., 2002). Histone deacetylase (HDAC4) activity, imported into the nucleus, suppresses DACH2 gene expression in denervated muscle (Tang and Goldman, 2006; Cohen et al., 2007). DACH2 represses SIX1 (SIX homeobox 1, 14q23.1), and SIX1 overexpression has been described in gliomas. DACH1 (13q22) and DACH2 are required for Müllerian duct development. DACH2 is abundantly expressed in fallopian tubes, and it has been implicated in premature ovarian failure syndrome (Bione et al., 2004; Suzumori et al., 2007). In ovarian cancer, DACH2 is expressed, and a significantly reduced overall survival was found for tumours expressing high levels of DACH2 in the subgroup of serous carcinoma, but not in other subgroups (Nodin et al., 2012).

Result of the chromosomal anomaly Hybrid gene Description Fusion of PAX5 exon 5 to DACH2 exon 3.

Fusion protein Description 587 amino acids. The predicted fusion protein contains the DNA binding paired domain of PAX5 (the 201 N-term aa) and the DACHbox-C of DACH2 (the 386 C-term aa).

References Mennerich D, Braun T. Activation of myogenesis by the homeobox gene Lbx1 requires cell proliferation. EMBO J. 2001 Dec 17;20(24):7174-83

Kardon G, Heanue TA, Tabin CJ. Pax3 and Dach2 positive regulation in the developing somite. Dev Dyn. 2002 Jul;224(3):350-5

Bione S, Rizzolio F, Sala C, Ricotti R, Goegan M, Manzini MC, Battaglia R, Marozzi A, Vegetti W, Dalprà L, Crosignani PG, Ginelli E, Nappi R, Bernabini S, Bruni V, Torricelli F, Zuffardi O, Toniolo D. Mutation analysis of two candidate genes for premature ovarian failure, DACH2 and POF1B. Hum Reprod. 2004 Dec;19(12):2759-66

Fuxa M, Skok J, Souabni A, Salvagiotto G, Roldan E, Busslinger M. Pax5 induces V-to-DJ rearrangements and locus contraction of the immunoglobulin heavy-chain gene. Genes Dev. 2004 Feb 15;18(4):411-22

Johnson K, Pflugh DL, Yu D, Hesslein DG, Lin KI, Bothwell AL, Thomas-Tikhonenko A, Schatz DG, Calame K. B cell-specific loss of histone 3 lysine 9 methylation in the V(H) locus depends on Pax5. Nat Immunol. 2004 Aug;5(8):853-61

Tang H, Goldman D. Activity-dependent gene regulation in skeletal muscle is mediated by a histone deacetylase (HDAC)-Dach2-myogenin signal transduction cascade.

t(X;9)(q21;p13) PAX5/DACH2 Huret JL


Proc Natl Acad Sci U S A. 2006 Nov 7;103(45):16977-82

Zhang Z, Espinoza CR, Yu Z, Stephan R, He T, Williams GS, Burrows PD, Hagman J, Feeney AJ, Cooper MD. Transcription factor Pax5 (BSAP) transactivates the RAG-mediated V(H)-to-DJ(H) rearrangement of immunoglobulin genes. Nat Immunol. 2006 Jun;7(6):616-24

Cobaleda C, Schebesta A, Delogu A, Busslinger M. Pax5: the guardian of B cell identity and function. Nat Immunol. 2007 May;8(5):463-70

Cohen TJ, Waddell DS, Barrientos T, Lu Z, Feng G, Cox GA, Bodine SC, Yao TP. The histone deacetylase HDAC4 connects neural activity to muscle transcriptional reprogramming. J Biol Chem. 2007 Nov 16;282(46):33752-9

Suzumori N, Pangas SA, Rajkovic A. Candidate genes for premature ovarian failure. Curr Med Chem. 2007;14(3):353-7

Coyaud E, Struski S, Prade N, Familiades J, Eichner R,

Quelen C, Bousquet M, Mugneret F, Talmant P, Pages MP, Lefebvre C, Penther D, Lippert E, Nadal N, Taviaux S, Poppe B, Luquet I, Baranger L, Eclache V, Radford I, Barin C, Mozziconacci MJ, Lafage-Pochitaloff M, Antoine-Poirel H, Charrin C, Perot C, Terre C, Brousset P, Dastugue N, Broccardo C. Wide diversity of PAX5 alterations in B-ALL: a Groupe Francophone de Cytogenetique Hematologique study. Blood. 2010 Apr 15;115(15):3089-97

Medvedovic J, Ebert A, Tagoh H, Busslinger M. Pax5: a master regulator of B cell development and leukemogenesis. Adv Immunol. 2011;111:179-206

Nodin B, Fridberg M, Uhlén M, Jirström K. Discovery of dachshund 2 protein as a novel biomarker of poor prognosis in epithelial ovarian cancer. J Ovarian Res. 2012 Jan 27;5(1):6


Huret JL. t(X;9)(q21;p13) PAX5/DACH2. Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):608-610.

Deep Insight Section



INIST-CNRS

OPEN ACCESS JOURNAL

Th17 cells: inflammation and regulation Kazuya Masuda, Tadamitsu Kishimoto

Laboratory of Immune Regulation, Osaka University, World Premier International (WPI) Immunology Frontier Research Center (IFReC), 3-1 Yamadaoka, Suita, Osaka 565-0871, Japan (KM, TK)

Published in Atlas Database: February 2014

Online updated version : http://AtlasGeneticsOncology.org/Deep/Th17CellsID20132.html DOI: 10.4267/2042/54019


Abstract IL-17-producing CD4+ T cells (Th17 cells) are understood to be a distinct lineage of CD4+ T helper (Th) cells, which play an important role in the host defense, tissue inflammation and autoimmunity. The identification of Th17 cells collapsed the concept of the previously held Th1/Th2 paradigm in infection and autoimmunity. Recent studies have provided new information on the role of Th17 cells in different autoimmune diseases and the mechanisms of Th17 cell differentiation. Th17 cells contribute to the exacerbation of autoimmune disease, whereas they possess a protective aspect against microbes such as bacteria and fungi. This suggests that Th17 cells can be broadly categorized as pathogenic or non-pathogenic. Naïve CD4+ T cells can differentiate into Th17 cells in synergy with IL-6 and TGF-β, while TGF-β induces regulatory T cells (iTreg), which appear to be mutually exclusive to Th17 cells. Here we describe the detail molecular mechanism of Th17 cell differentiation, including recently identified molecules, and discuss different roles of Th17 cells in infection, inflammation and autoimmunity in a cytokine milieu.

1- Introduction CD4+ T cells play a pivotal role in host defense, but are also recognized to have pathogenic roles such as in autoimmunity, asthma, cancer and allergic responses (Zhu et al., 2010). On activation by co-stimulatory molecules and particular cytokines, naïve CD4+ T cells can differentiate into the distinct lineage of T helper (Th) cells with different immunological functions, including Th1, Th2, Th17 cells, and regulatory T cells (Treg). Th1 cell polarization was driven by IL-12 and IFN-γ, and Th1 cells, which produced IFN-γ, elicited cell-mediated immunity against intracellular pathogen, whereas Th2 cells, which secreted IL-4, IL-5, and IL-13 (Abbas et al., 1996), were induced by IL-4, and involved in immune responses against extracellular parasites such as helminthes and nematodes (Pearce et al., 2002). Th1 and Th2 cells were shown to be mutually exclusive (Hwang et al., 2005). In Th1 cells, IL-12 activated Stat4 and induced IFN production, which

led to the expression of master transcription factor T-box (Tbx21, T-bet). In Th2 cells, IL-4 enhanced Stat6 signaling, which upregulated the transcriptional factor GATA3. T-bet inhibited Th2 differentiation by attenuating the function of GATA3, whereas GATA3 contributed to the repression of Th1 cell lineage. More recently, IL-17-producing T (Th17) cells, as a third of T cell lineages, have been identified (Harrington et al., 2005; Park et al., 2005). Although it was initially demonstrated that IL-23 drives Th17 cell polarization via Stat3 activation in the absence of IFN-γ, it was generally assumed that the effect of IL-23 was limited in effector and memory CD4+ T cells (Oppmann et al., 2000; Aggarwal et al., 2003; Langrish et al., 2005). Subsequently, the synergy between TGF-β and IL-6 has been shown to efficiently induce the development of Th17 cells through Smad and Stat3 pathway, respectively (Bettelli et al., 2006; Veldhoen et al., 2006). In contrast, TGF-β alone converted naïve CD4+CD25- T cells into CD4+CD25+ regulatory T cells (Chen et al., 2003).

Th17 cells: inflammation and regulation Masuda K, Kishimoto T


The immunopathogenesis of infection, autoimmunity, and allergy has been extensively attributed to the concept of Th1/Th2 paradigm. However, it has been recently reported that CIA and EAE are exacerbated rather than improved under inhibition of Th1 cell-inducing condition such as deficiency of IFN-γR, IL-12 p35 or Stat1 (Iwakura and Ishigame, 2006). Cua et al. has demonstrated that IL-23 rather than IL-12 influences the critical pathogenic effect on autoimmunity such as EAE. Subsequently, by the same group, it has been shown that IL-23 promotes the development and expansion of effector CD4+ T cells, which highly produce IL-17, and IL-17 secreted from activated CD4+ T cells play an important role in various autoimmune diseases (Langrich et al., 2005). The balance between Th17 and Treg cells is an important factor involved in the pathogenesis of autoimmunity. Sakaguchi et al. initially demonstrated that a population of CD4+CD25+ T cells derived from the thymus, known as nTreg, exhibited the inhibitory effect in immunity. TGF-β1 is required for the differentiation of both Treg and Th17 cells, whereas IL-6 suppresses Treg cell population and drives the development of Th17 cells. This suggests a dichotomy between these cells (Bettelli et al., 2007). However, it still remains to be understood how IL-6 in combination with TGF-β drives Th17 cell differentiation, and which cytokine milieu makes Th17 cells "pathogenic" in vivo. In this review, we discuss the mechanism of Th17 cell differentiation, its plasticity and pathogenicity in immune regulation, and its link with inflammatory disease and autoimmunity.

2- Regulation of Th17 polarization The mechanism of Th17 differentiation has been extensively studied with respect to the transcriptional regulation. Betteli et al. found that IL-6 but not IL-23 was a potent inducer for Th17 cell differentiation in combination with TGF-β1. It was initially shown that retinoic acid (RA)-related orphan receptor γ thymus (Rorγt) was an essential transcriptional factor for identifying a distinct lineage of CD4+ T cells (Th17 cells), which constitutively produced IL-17 in the lamina propria of the small intestine (Ivanov et al., 2006). IL-6 signaling IL-6 mainly activates Stat3 via the Jak-Stat pathway (Kishimoto, 2005). The role of Stat3 in Th17 cell differentiation was extensively analyzed by chromatin immunoprecipitation and massive parallel sequencing (ChIP-Seq), in which STAT3 bound to the promoter of cytokine and transcriptional genes including the Rorc, IL-17, IL-17F, Ahr and IL-21 genes. Possibly Stat3 also interacted with the BATF, IRF4, and c-Maf genes (Durant et al., 2010). These transcriptional factors

played an important role in Th17 cell differentiation (Ciofani et al., 2012; Yosef et al., 2013). BATF, which is a basic leucine zipper (b-Zip) transcription factor of the AP-1 protein family, contributed to the generation of Th17 cells (Schraml et al., 2009). It has recently been reported that BATF is a multifunctional transcriptional factor, in which BATF is also required for the generation of T follicular helper (Tfh) cells but not Th1 cells and Treg cells (Betz et al., 2010; Ise et al., 2011). More recently, BATF in cooperation with IRF-4, which is also essential for the development of both Th2 and Th17 cells (Brüstle et al., 2009), has been shown to be involved in the induction of the IL10, IL-17a, and IL-21 genes in T cells (Glasmacher et al., 2012; Li et al., 2012; Tussiwand et al., 2012; Murphy et al., 2013). Although it is still not clear whether the BATF gene is directly regulated by Stat3 activation, recent studies have shown that IL-6 activates the function of BATF/IRF4 complex (Koch et al., 2013). More recently, our group has also identified a key molecule, AT-rich interactive domain 5a (Arid5a), which is induced under Th17 cell-polarizing condition. Arid5a deficiency inhibits the differentiation of Th17 cells (unpublished data). Our previous report has shown that Arid5a positively controls IL-6 mRNA through its 3'-untranslated region (UTR). IL-6 serum level in Arid5a deficient mice was dramatically reduced after LPS injection compared to WT mice, and EAE was also ameliorated, in which the frequency of Th17 cell population was inhibited, whereas that of Th1 cells was enhanced, but not Treg cells (Masuda et al., 2013). IL-21 and IL-23 signaling IL-21 or IL-23 as well as IL-6 enhanced Stat3 activation in Th17 cells via IL-21R or IL-23R (Muranski et al., 2013). IL-21 has been shown to have pleiotropic effects on T cells and B cells (Leonard et al., 2005). IL-21 independent of IL-6 was able to drive naïve T cells into Th17 cells in the presence of TGF-β1 (Chen et al., 2007). Nonetheless, IL-6 activates IL-21 expression in naïve CD4+ T cells via Stat3 activation and IL-21 production is amplified under Th17 cell-inducing condition through an autocrine-loop (Zhou et al., 2007; Nurieva et al., 2007). IL-23 is a heterodimeric cytokine composed of p19 and p40 subunits. IL-23 binds to IL-23R composed of IL-12Rβ1 and IL23R subunits (Parham et al., 2002), and mainly activates Stat3 through the Jak-stat pathway (Cesare et al., 2009). It was initially reported that IL-23 contributed to the proliferation of effector CD4+ T cells (Oppmann et al., 2000). Subsequently, Parham et al. found that naïve CD4+ T cells did not respond to IL-23, and express little or no IL-23R.



Figure 1. Pathogenic Th17 cells were induced by different patterns of cytokines or a chemical, and displayed a unique character in the expression of possible master regulators and chemokine receptors, respectively. Naïve CD4+ T cells differentiate into Th17 cells, which mainly express Rorγt, in the presence of IL-6 and TGF-β1. The Th17 cells primarily produce IL-17, and secret IL-10. IL-23 drives the expansion and proliferation of Th17 cells, and activated Th17 cells secret IL-17, IL-22, and GM-CSF as well as TGF-β3, whereas the production of IL-10 is inhibited in such a pathogenic Th17 cells. A recent study has shown that sodium chloride is a strong enhancer of Th17 cells. The high salt-induced Th17 cells display highly pathogenic, and produce GM-CSF, TNF-α, and IL-2 as well as IL-9. Moreover, it has been reported that there is a direct pathway for the generation of pathogenic Th17 cells in the presence of IL-6 and TGF-β3. In the Th17 cells, the expression of GM-CSF, IL-23R, and Tbx21 is highly upregulated, while IL-10 expression is critically attenuated. These pathogenic Th17 cells commonly express Rorγt, T-bet, and IL-23 R. The Th17 cells under high-salt conditions express serum glucocorticoid kinase 1 (SGK1) downstream of IL-23R signaling, which critically contributes to the induction of pathogenic Th17 cells. Activated Th17 cells also express some chemokine receptors, including CCR4, CCR6 and CCR10. However, it still remains to be elucidated what kinds of key molecules could become master regulators in such a pathogenic Th17 cells.

Rather, IL-23R was induced in the process of Th17 polarization, and Th17 cell differentiation was promoted by IL-23 (Betteli et al., 2006; Mangan et al., 2006; Veldhoen et al., 2006). Of note, IL-23 is one of the most important cytokines, which convert the Th17 cells differentiated from naïve CD4+ T cells exposed to IL-6 and TGF-β1 into the "pathogenic" Th17 (Figure 1). It has been confirmed that Th17 cells induced by IL-6 and TGF-β in the absence of IL-23 are not sufficient to induce EAE (McGeachy et al., 2007), in which IL-23 diminished the expression of IL-10 produced from such "non-pathogenic" Th17 cells. This result suggests that IL-10 is a key molecule, which distinguishes pathogenic Th17 from non-pathogenic types (Figure 2). Consistent with this, Lee et al. and Kleinewietfeld et al. have demonstrated that IL-10 expression in pathogenic Th17 is suppressed compared to non-pathogenic ones. Furthermore, IL-23 upregulated the Tbx-21 gene (encode T-bet) in pathogenic Th17 (Lee et al., 2012; Yang et al., 2009; Kleinewietfeld et al., 2013). However, it must be further investigated which molecules are critical for the generation and stability of pathogenic Th17 under IL-23 signaling or other pathways (Figure 1).

TGF-β signaling Transforming growth factor β (TGF-β) has complex roles in cell growth and development (O'Kane and Ferguson, 1997). TGF-β as well as IL-10 negatively regulates immune responses including autoimmune disease and inflammation (Letterio and Roberts, 1998; Moore et al., 2001). It is currently understood that there are at least three mammalian TGF-β isoforms (TGF-β1, 2, and 3). TGF-β is an essential factor for the generation of CD4+ CD25+ regulatory T cells (iTreg), which express the forkhead/winged helix transcription factor Foxp3 (Chen et al., 2003; Batteli et al., 2006; Hori et al., 2003). Notably, IL-2 is required for the generation of iTreg (Zheng SG et al., 2007), whereas IL-2 signaling via Stat5 inhibits the differentiation of Th17 cells in vivo and in vitro by ameliorating IL-6 signaling pathway (Liao et al., 2011; Chen et al., 2011; Laurence et al., 2007). The TGF-β superfamily activates not only Smad-dependent but also Smad-independent pathways (Derynck and Zhang, 2003). TGFβ1 and TGFβ3 bind type II receptors on T cells, which leads to the activation of Smad1, 2, 3 and 5, although Smad2 and Smad3 are activated in a different way from the activation of Smad1 and Smad5 (Derynck and Zhang, 2003). As mentioned above, TGFβ1



induced the differentiation of Th17 cells in the presence of IL-6, although the Th17 cells did not show the pathogenicity in autoimmunity possibly due to the elevation of IL-10 production (McGeachy et al., 2007). Of note, c-Maf, which is induced by TGF-β signaling (Rutz et al., 2011), contributes to the generation of "non-pathogenic" Th17 cells, in which the expressions of Rora, Runx1, IL-1R1, Ccl6 and TNF-α are suppressed, whereas the expressions of IL-10, IL-9, Lif and CTLA-4 are enhanced (Ciofani et al., 2012; Xu et al., 2009), although it initially has been reported that c-Maf is required for the differentiation of Th17 cells (Bauquet, 2009, Nat.Immunol.). Such recent data may shed light on the question of how Th17 cells switches from pathogenic into non-pathogenic and vice versa in infection and autoimmunity (Figure 1), because non-pathogenic Th17 cells produce more IL-10 than pathogenic Th17 cells (McGeachy et al., 2007; Lee et al., 2012). In contrast, Lee et al. have recently shown that TGF-β3 directly drives naïve CD4+ T cells into "pathogenic" Th17 cell in the presence of IL-6 (Lee et al., 2012). In this report, TGF-β3-induced Th17 cells highly expressed T-bet and IL-23R, and the expression of IL-10 was suppressed compared with those of TGF-β1-induced Th17 cells (Figure 1). TGF-β activated Smad1 and Smad5 rather than Smad2 and Smad3. These results suggest that Smad1 and Smad5 pathway might be important for the generation of pathogenic Th17 but not non-pathogenic cells. Further investigation of the molecular mechanism of TGF-β3 signaling is able to lead to immunotherapy specifically targeting pathogenic Th17 cells. As mentioned above, IL-2 is a potent suppressor of Th17 cell generation. TGF-β1 inhibited IL-2 mediated Stat5 signaling (Bright et al., 1997), and also attenuated the expression of T-bet and GATA3, which resulted in elimination of Th1 or Th2 differentiation (Carsten et al., 2007). It has been also reported that TGF-β1 produced from CD4+ effector T cells, including Th17 cells, is essential for the differentiation and stabilization of Th17 cells (Gutcher et al., 2011). Thus, it seems that TGF-β1 is essential for initial Th17 polarization in vitro and in vivo. In contrast, it has been reported that TGF-β signaling is not necessary for the generation of pathogenic Th17 cells. Rather, TGF-β1 inhibited the generation of pathogenic Th17 cells (Ghoreschi et al., 2010). Aryl hydrocarbon receptor (Ahr) signaling and other signaling pathways Aryl hydrocarbon receptor (Ahr) is a key factor for the development of Th17 and Th22 cells. Ahr, which normally resides in the cytoplasm, is a ligand-activated transcriptional factor. On recognizing products of tryptophan metabolism as

natural ligands or toxic dioxins such as TCDD, Ahr functions as a transcriptional factor. Our group and two other groups found that Ahr is induced under Th17 cell polarizing condition, and involved in autoimmunity including EAE and CIA (Kimura et al., 2008; Veldhoen et al., 2008; Quintanna et al., 2008; Nakahama et al., 2011). Recently, our group also has shown the role of miR132/212 cluster induced by Ahr in the differentiation of Th17 cells (Nakahama et al., 2013). Although it still remains to be understood how Ahr drives Th17 cell polarization in vivo, we have recently detailed role of Ahr in immune responses, including the possible mechanism of Ahr for Th17 cell differentiation (Nguyen et al., 2013). This was a unique demonstration linking environment and autoimmunity. Recently, as an environmental factor involved in autoimmunity, it has been reported that high salt diet might lead to autoimmunity, in which sodium chloride accelerates EAE through induction of Th17 cells (Kleinewietfeld et al., 2013). Retinoic acid (RA), a vitamin A metabolite, has been shown to mediate reciprocal Th17 and Treg cell differentiation (Mucida et al., 2007). RA with TGF-β contributed to stabilization of Treg cells, and negatively regulates Th17 cell differentiation (Takahashi et al., 2012). In contrast, RA promoted effector T cells via retinoic acid receptor α (Rora) in vivo. Thus, RA controls a dichotomy between Treg and Th17 cells in a concentration-dependent manner. The mammalian target of rapamycin (mTOR) signaling is involved in the maintenance and proliferation of Th17 cells (Chi et al., 2012). mTOR signaling is activated by TCR and/or IL-1β stimulation via Myd88 (Powell et al., 2012; Chang et al., 2013), in which IRF4 expression was regulated (Yao et al., 2013). As mentioned above, the complex of BATF and IRF4 is essential for the generation of Th17 cells. BATF is rapidly induced by TCR stimulation, and then BATF and IRF4 plays a synergistic role in setting the initial transcriptional program, including chromatin remodeling and cooperation in accessibility of the transcriptional factors to target genes such as the IL-17 gene (Ciofani et al., 2012). IL-27 (a member of the IL-12 family of cytokines) signaling contributes to inhibition of Th17 differentiation (Pot et al., 2011). IL-27 binds to a receptor complex composed of WSX1 (IL-27R) and gp130, and in turn activates both Stat1 and Stat3. IL-27 also induces IL-10 expression in CD4+ T cells, whereas IL-27 inhibits IL-17, IL-22, and GM-CSF expression through suppression of Rorγt activation. Thus, IL-27 is a potent negative regulator of Th17 cell polarization. Taken together, a large number of transcriptional factors control Th17 cell differentiation, in which a balance between the activation of Stat3 and other



Stat families (Stat1, 4, 5, and 6) may be an important factor for driving Th17 cell differentiation. Moreover, it is for future studies to decipher the molecular circuits and regulatory networks in the differentiation of CD4+ T cells and the plasticity between different T cell lineages, especially Th17 and Treg cells. A recent new strategy for identifying regulatory networks controlling Th17 cell differentiation and the plasticity have shown the existence of novel factors including the Mina, Fas, Pou2af1, Tsc22d3, and Fosl2 genes and dynamism among key transcriptional regulators (Ciofani et al., 2012; Yosef et al., 2013).

3- Role of Th17 cells in inflammation It has been established that Th17 cells are critically involved in the pathogenesis of autoimmunity, gut inflammation, tissue inflammation and cancer, whereas Th17 cells contributes to protection against a variety of bacteria and fungi. Emerging data on Th17-mediated diseases suggest that different types of IL-17-producing T cells exist in vivo, which might be divided into pathogenic or non-pathogenic Th17 cells. Th17 cells produce IL-17 (IL-17A), IL-17F, IL-17A/F heterodimers, IL-21, IL-22, and GM-CSF as well as other chemokines such as CXC cytokines (Korn et al., 2009). In an early study, IL-17A and IL-22 secreted from activated T cells were recognized as pro-inflammatory cytokines (Dumoutier et al., 2000a; Yao et al., 1995, Ouyang

et al., 2008). Infante-Duarte et al. suggested that effector CD4+ T cells primed by B. burgdorferi highly produced IL-17 in inflammatory lesions, and such cell-types were distinct from Th1 and Th2 cell types (Infante-Duarte et al., 2000). Following this initial demonstration, Ye at al. reported that IL-17 secreted from CD4+ T cells protected against Klebsiella pneumonia for host defense. Role of IL-22 in Th17 cells IL-22 as well as IL-17 plays a critical role in host defense and protecting against tissue damage. IL-22 signaling is transmitted through a heterodimeric receptor complex composed of IL-10R2 and IL-22R1 (Kotenko et al., 2001; Xie et al., 2000). IL-22R is mainly expressed in epithelial tissues, including keratinocytes, hepatocytes, and intestinal and respiratory epithelial cells, but not in immune cells (Aggawal et al., 2001; Ouyang et al., 2008; Rutz et al., 2013). The biological functions of IL-22 are known to be protective against infection and inflammation because IL-22 contributes to tissue maintenance, repair, and wound healing through the expression of anti-microbial, antiapototic proteins and proteins involved in cell proliferation via IL-22R in intestinal epithelial cells and goblet cells (Rutz et al., 2013). IL-22 plays a protective role against bacterial infections. Neutralizing IL-22 secreted by the Th17 lineage led to the failure to clear pathogen from infected lung by K. pneumonia, and in turn the early death of infected animals (Aujla et al., 2007). In this report, IL-17A produced from Th17 cells synergized with IL-22 to protect against bacteria.

Figure 2. The plasticity between Th17 cells and Treg, and various types of Th17 cells expanded by IL-23. TGF-β1 is required for the initial Th17 differentiation in the presence of IL-6. The Th17 cells produce IL-17 and IL-10. TGF-β1 also induces iTreg. In general, the plasticity of Th17 and Treg cells is tightly regulated in normal condition. However, once an antigen induces inflammation, macrophages and dendritic cells produce IL-23. IL-23 can convert non-pathogenic Th17 cells into pathogenic ones. In contrast, IL-23 can inhibit the generation of Treg cells. IL-23-induced Th17 cells convert different cytokine- producing Th17 cells. IL-6 synergized with IL-1 and IL-23 emerges IL-22 and IFN-γ- producing Th17 cells. IL-6 alone is enough to induce IL-22-producing T cells. IL-23 alone also promoted IFN-γ-producing T cells.



The coexpression of both IL-17 and IL-22 in Th17 cells are important for expression of antimicrobial peptides, as mentioned above. The expression pattern of IL-17 and IL-22 in CD4+ T cells, however, varies according to a cytokine milieu. IL-6 and/or IL-23 induced IL-22 expression in vitro in the absence of TGF-β (Qu et al., 2013). In contrast, TGF-β inhibited the expression of IL-22 (Zheng Y et al., 2007), whereas TGF-β is essential for the differentiation of Th17 in the presence of IL-6 (Figure 2). Moreover, IL-6 deficiency did not affect the frequency of IL-22 cell population in vivo (Zenewicz et al., 2008). These results suggest that IL-22 is produced by not only Th17 cells but also other immune cells. Therefore, not all Th17 cells might play a protective role for host defense through IL-22 production. Likewise, although IL-22 played a protective role in infection by various kinds of bacteria, including C. rodentium, M. tuberculosis, and Salmonera typhimurium, the sources of IL-22 was assumed to be not from Th17 cells (Zheng et al., 2008; Schulz et al., 2008; Dhiman et al., 2009). Moreover, NK cells as well as CD4+ T cells are involved in protection against IBD by IL-22, whereas IL-17A contributed to exacerbation of IBD (Zenewicz et al., 2008). In contrast, IL-22 produced from effector Th17 cells contributed to promotion of CD-like experimental colitis (Yen et al., 2006; Strober et al., 2007). In line with these reports, Ahern et al. has demonstrated that IL-23 promotes intestinal inflammation through directly enhancing the development of effector Th17 cells, which secret IL-17, IFN-γ and possibly IL-22 (Figure 2). Moreover, IL-22-expressing Th17 cells transferred into IL-22 deficient host mice provided protection against hepatitis, whereas IL-17 had no apparent role in liver inflammation (Zenewicz et al., 2007). However, Xu et al. and Nagata et al. have shown that IL-17 is required for the development of hepatitis. Although these reports appear to be contradictory, CD4+ T cells, which dominantly produce IL-22 rather than IL-17, might be protective against hepatitis, whereas IL-23-induced Th17 cells might have the pathogenicity in liver inflammation. In agreement with this, Zheng Y et al. has reported that the production of IL-17 and IL-22 from Th17 cells is differentially controlled, and Th17 cells enhanced by IL-23, which produce IL-22, are essential for dermal inflammation and acanthosis. IL-23/Th17 axis The IL-23/Th17 axis is clearly involved in various autoimmune diseases, including rheumatoid arthritis, multiple sclerosis, psoriasis, and IBD (Iwakura and Ishigame, 2006). IL-23 plays an important role in the maintenance and expansion of Th17 cells, and makes Th17 cells "pathogenic" (Figure1). As mentioned above, although different

types of effector Th17 cells reside in inflammatory lesions (Figure 2), a growing number of reports have shown that IL-17 and IL-23 critically contribute to the pathogenesis of RA, in which IL-17A and IL-17F play an important role in joint inflammation and bone erosion. Arthritis associated with psoriasis (psoriatic arthritis) is also dependent on Th17 cells activated by IL-23 (Maeda et al., 2012). The elevation of IL-23 and IL-17 were detected in synovial fluid, synovial tissues and sera of RA patients but not of osteoarthritis (Alfadhli, 2013). IL-23 is also pivotal for the onset of EAE (Cua et al., 2003). IL-23 or IL-23R deficient mice were resistant to EAE (Awasthi et al., 2009). IL-17A and IL-17F double knockout mice showed critical reduction of the development of EAE, whereas the effect of IL-17F on EAE development is less than that of IL-17A in mice (Ishigame et al., 2007). More recently, Kang et al. has reported that IL-17 is involved in perturbation of the maturation of oligodendrocyte lineage cells, which might lead to inflammation and neurodegeneration in MS. Pathogenic Th17 cells produce GM-CSF (Figure 1), which is an important cytokine for induction of IL-23 in dendritic cells (McGeachy et al., 2011). It has been reported that neutralizing GM-CSF at the effector stage results in suppression of the further development of EAE (El-Behi et al., 2011). Thus, GM-CSF is also required for the maintenance and expansion of Th17 cells possibly through the enhancement of IL-23. Th17 cells in host defense Th17 cells were increased at the mucosal sites after infection (Happel et al., 2005; Mangan et al., 2006). So far, it has been demonstrated that Th17 cells are involved in protection against a variety of bacteria such as Candida albicans, Staphylococcus aureus, Citrobacter rodentium, Salmonella and Bordetella pertusis (Peck and Mellins, 2010). However, the role of IL-17 and Th17 cells in protection against Asperillus fumigatus and other fungi are diverse and controversial (Muranski et al., 2013). One of the reasons is that the inflammatory milieu for the generation of Th17 cells is different in infection by different types of fungi, in which macrophages and dendritic cells recognize different kinds of fungal pattern recognition receptors (PRRs) such as Dectin-1, Dectin-2, Mincle and MR, and produce inflammatory cytokines for Th17 polarization, including IL-6, IL-1β, TNF-α and IL-23 as well as GM-CSF (Wüthrich et al., 2012). Zielinski et al. has reported that by eliciting different cytokines respectively, C. albicans and S. aureus prime different types of IL-17-producing T cells "Th17" cells that produce IFN-γ or IL-10 respectively, which might be significant for answering the question of what makes pathogenic or non-pathogenic Th17 cells.



Th17 cells in cancer The role of Th17 cells in cancer displays complexity in various types of tumor immunity. Although it seems that the pathogenic role of IL-23-induced Th17 cells has been consistently documented in autoimmunity, Th17 cells in cancer display both anti-tumorigenic and pro-tumorigenic functions (Zou and Restifo, 2010). Administration of IL-23 and IL-23-producing dendritic cells, has been reported to inhibit tumor growth (Kaiga et al., 2007; Hu et al., 2006), whereas IL-23 has been shown to promote tumor incidence and growth (Langowski et al., 2006). The role of IL-17 in tumor immunity is also controversial, although the source of IL-17 is not only Th17 cells, but also other types of T cells, including CD8+ T cells (known as Tc17 cells) and Rorγt+ Foxp3+ T cells (Li and Boussiotis, 2013). IL-17 enhanced tumor growth through the promotion of tumor vasculization, especially in some immune-deficient mice (Zou and Restio, 2010). In contrast, in immunocompetent mice, IL-17 played a protective role against tumor growth (Benchetrit et al., 2002; Kryczek et al., 2009; Hirahata et al., 2001). Although Th17 cells are present in tumor microenvironment, the number of Th17 cells represents a minor population of effector T cells (Kryczek et al., 2007), suggesting that the frequency of Th17 cell population is tightly regulated in tumor immunity. The number of Treg and Th17 cells inversely correlates in the same tumor (Zou and Restifo, 2010). It has also been reported that, in the microenvironment of ulcerative coloitis (UC) and associated colon cancer, not only Th17 cells but also IL-17+Foxp3+ T cells are detected (Kryczek et al., 2011). Thus, the character of IL-17-producing CD4+ T cells might be classified more precisely in the context of tumor immunity. Balance between Th17 cells and Treg in autoimmunity It seems that there is no doubt that Treg cells play a critical suppressive role in immune responses in vitro and in vivo (Shevach et al., 2009; Vignali et al., 2008). Treg cells are a potent inducer of IL-10 and TGF-β1, resulting in suppression of effector T cell functions. However, the balance between Th17 and Treg cells in vivo is dependent on the context of inflammatory disease. The existence of Treg cells does not always suppress the function of Th17 cells. Treg promoted Th17 cell development through IL-2 regulation rather than control of TGFβ1 (Pandiyan et al., 2011; Chen et al., 2011). IL-2 is a critical cytokine in deciding a dichotomy between Th17 and Treg cells. Treg cells induced by IL-2 combined with TGF-β or all-trans retinoic acid, were resistant to Th17 cells (Muchida et al., 2007; Zheng et al., 2008; Zhou et al., 2010). Conversely, IL-6 is a strong inducer of Th17 cells

differentiation. Zheng has indicated that IL-6 can convert nTregs into Th17 cells, and other CD4+ T cells (Zheng, 2013). It is notable that IL-6 plays a critical role in conversion of Foxp3+ CD4+ T cells into pathogenic Th17 cells in autoimmune arthritis (Komatsu et al., 2014). Th17 cell expansion is also regulated by TGFβ1 secreted from Th17 cells itself but not Treg cells (Gutcher et al., 2011). Rather, it seems that high concentration of TGF-β reduces Th17 cell populations (Zhou et al., 2008). The concentration of TGF-β1 is one of the important factors, which drives or inhibits the differentiation of Th17 cells (Zhou et al., 2008). High levels of TGF-β1 inhibited Th17 cell differentiation and enhanced the development of iTreg through high expression of Foxp3. In such a cytokine milieu, Foxp3 induced by TGF-β interacted with Rorγt, and in turn antagonized the function of Rorγt in CD4+ T cells, in which the expression of IL-23R, IL-22 and IL-17 was repressed (Zhou and Littmann, 2009). In contrast, at low concentrations, TGF-β1 was helpful for the generation of Th17 cells in synergy with IL-6 or IL-21 (Zhou et al., 2008), although it is still not clear how IL-6 or IL-21 overcomes the inhibitory effect of Foxp3 on Rorγt function. Runx-1 controls the differentiation of Th17 cells thorough binding both Foxp3 and Rorγt (Zhang et al., 2008). The interaction of Runx-1 with Rorγt promoted the transcription of the IL-17 gene, whereas Foxp3 inhibited Rorγt- and Runx-1-induced IL-17 expression by binding to Runx-1 (Zhang et al., 2008), suggesting that the role of Runx-1 is also dependent on the concentration of TGF-β1.

4- Therapy (treatment of Th17-dependent autoimmunity) A great number of recent studies have revealed that the biology of Th17 cells in mice is broadly common with phenomena in humans (Tesmer et al., 2008; Jong et al., 2010). Th17 cells in humans play an important role in the pathogenesis of rheumatoid arthritis, psoriasis, asthma, inflammatory bowel disease (IBD) and transplantation rejection. Accordingly, blocking pro-inflammatory cytokines, including IL-6, IL-1β, IL-23, and IL-17 as well as GM-CSF, will lead to the abatement of tissue inflammation, gut inflammation and autoimmunity. Several anti-IL-17A monoclonal antibodies, including secukinumab and ixekizumab, and anti-IL-17A receptor monoclonal antibody, brodalumab have been treated to patients in the process of phase II clinical trials (Kellner et al., 2013). Secukinumab is most likely to be clinically efficacious in RA. An anti-IL-1β monoclonal antibody, gevokizumab is currently being investigated in a Phase â…¡ clinical program. An anti-IL-12/IL-23 monoclonal antibody, usutekinumab has been demonstrated the high efficacy in the treatment of patients with



psoriasis (Krueger et al., 2007). An anti-GM-CSF monoclonal antibody, mavrilimumab for treatment of rheumatoid arthritis has shown promising results under phase II clinical trial (Burmester et al., 2013). In the future, emerging data will establish the efficacy of these monoclonal antibodies against several autoimmune diseases such as rheumatoid arthritis. IL-6 is involved in the initial differentiation of Th17 cells (Betteli et al., 2006). In mice, blockade of IL-6 pathway has been shown to result in a decrease of the frequency of Th17 cell population (Nowell et al., 2009; Serada et al., 2009). A humanized anti-IL-6 receptor antibody (Tocilizumab, TCZ) displayed a remarkable protective effect in patients with rheumatoid arthritis as well as Castleman's disease and juvenile idiopathic arthritis (Genovese et al., 2008; Tanaka et al., 2012). Although the biological effect of TCZ on human autoimmune disease is complex (Tanaka et al., 2013), Samon et al. have demonstrated TCZ affects the IL-6/Th17 axis in patients with rheumatoid arthritis, in which the ratio of Th17 cells to Treg cells was significantly reduced. Therefore, administration of IL-6 blockade (TCZ) might be highly efficacious against not only such diseases as mentioned above, but also Th17 cell-dependent diseases, including IBD and psoriasis, and cancer. On the contrary, although elevation of IL-6 level in inflammatory lesions leads to the exacerbation of autoimmunity, it remains to be understood why IL-6 is overproduced in autoimmune disease such as rheumatoid arthritis. A recent report has shown that posttranscriptional regulation of IL-6 production is essential for immune homeostasis. Zc3h12a (known as Regnase-1, MCPIP) constitutively degrades level of IL-6 mRNA trough binding to its 3'UTR, whereas Zc3h12a deficiency led to spontaneous autoimmunity (Matsushita et al., 2009). Moreover, our recent study has shown that Arid5a controls IL-6 level in vivo through stabilization of IL-6 mRNA. Arid5a deficient mice are resistant to EAE, in which the frequency of Th17 cell population is dramatically reduced (Masuda et al, 2013, PNAS). Notably, Arid5a counteracted the destabilization effect of Zc3h12a (Masuda et al., 2013). Consequently, imbalance between Arid5a and Zc3h12a in vivo might be involved in autoimmunity. Given that administration of TCZ is efficacious against several autoimmune diseases, the monoclonal antibody targeting Arid5a might be also clinically useful. Concluding remarks Since IL-17-producing CD4+ T cells have been shown to be involved in various types of inflammatory diseases, our understanding of the pathogenesis of such diseases as rheumatoid arthritis, multiple sclerosis, and psoriasis, has been

dramatically improved since the original concept of a Th1/Th2 paradigm. However, emerging data on Th17 cells have revealed that IL-17-producing CD4+ T cells are not simple cell population. Th17 cells are classified into pathogenic or non-pathogenic ones. IL-23 is a critical factor, which enhances the pathogenecity of Th17 cells. Recent data suggests that TGF-β3 and sodium chloride as well as IL-23 are involved in the generation of pathogenic Th17 cells. In contrast, TGFβ1 secreted from Treg cells inhibits the conversion into pathogenic Th17 cells by attenuating IL-23 production from activated macrophages and dendritic cells, whereas TGF-β1 is essential for the initial induction of Th17 cells. Moreover, the concentration of TGFβ1 is essential for the plasticity of Th17 and Treg cells. Taken together, Th17 cells play a pathogenic or protective role in infection and inflammatory disease in an antigen-dependent manner. Consequently, to identify which molecules and signaling pathways are critical for the generation of pathogenic Th17 cells, will lead to the development of more efficacious therapeutic drugs for Th17 cell-dependent inflammatory disease.

References Sakaguchi S, Sakaguchi N, Asano M, Itoh M, Toda M. Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol. 1995 Aug 1;155(3):1151-64

Yao Z, Fanslow WC, Seldin MF, Rousseau AM, Painter SL, Comeau MR, Cohen JI, Spriggs MK. Herpesvirus Saimiri encodes a new cytokine, IL-17, which binds to a novel cytokine receptor. Immunity. 1995 Dec;3(6):811-21

Abbas AK, Murphy KM, Sher A. Functional diversity of helper T lymphocytes. Nature. 1996 Oct 31;383(6603):787-93

Bright JJ, Kerr LD, Sriram S. TGF-beta inhibits IL-2-induced tyrosine phosphorylation and activation of Jak-1 and Stat 5 in T lymphocytes. J Immunol. 1997 Jul 1;159(1):175-83

O'Kane S, Ferguson MW. Transforming growth factor beta s and wound healing. Int J Biochem Cell Biol. 1997 Jan;29(1):63-78

Letterio JJ, Roberts AB. Regulation of immune responses by TGF-beta. Annu Rev Immunol. 1998;16:137-61

Dumoutier L, Louahed J, Renauld JC. Cloning and characterization of IL-10-related T cell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL-10 and inducible by IL-9. J Immunol. 2000 Feb 15;164(4):1814-9

Infante-Duarte C, Horton HF, Byrne MC, Kamradt T. Microbial lipopeptides induce the production of IL-17 in Th cells. J Immunol. 2000 Dec 1;165(11):6107-15

Oppmann B, Lesley R, Blom B, Timans JC, Xu Y, Hunte B, Vega F, Yu N, Wang J, Singh K, Zonin F, Vaisberg E, Churakova T, Liu M, Gorman D, Wagner J, Zurawski S, Liu Y, Abrams JS, Moore KW, Rennick D, de Waal-Malefyt R,



Hannum C, Bazan JF, Kastelein RA. Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity. 2000 Nov;13(5):715-25

Xie MH, Aggarwal S, Ho WH, Foster J, Zhang Z, Stinson J, Wood WI, Goddard AD, Gurney AL. Interleukin (IL)-22, a novel human cytokine that signals through the interferon receptor-related proteins CRF2-4 and IL-22R. J Biol Chem. 2000 Oct 6;275(40):31335-9

Aggarwal S, Xie MH, Maruoka M, Foster J, Gurney AL. Acinar cells of the pancreas are a target of interleukin-22. J Interferon Cytokine Res. 2001 Dec;21(12):1047-53

Kotenko SV, Izotova LS, Mirochnitchenko OV, Esterova E, Dickensheets H, Donnelly RP, Pestka S. Identification of the functional interleukin-22 (IL-22) receptor complex: the IL-10R2 chain (IL-10Rbeta ) is a common chain of both the IL-10 and IL-22 (IL-10-related T cell-derived inducible factor, IL-TIF) receptor complexes. J Biol Chem. 2001 Jan 26;276(4):2725-32

Moore KW, de Waal Malefyt R, Coffman RL, O'Garra A. Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol. 2001;19:683-765

Ye P, Rodriguez FH, Kanaly S, Stocking KL, Schurr J, Schwarzenberger P, Oliver P, Huang W, Zhang P, Zhang J, Shellito JE, Bagby GJ, Nelson S, Charrier K, Peschon JJ, Kolls JK. Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense. J Exp Med. 2001 Aug 20;194(4):519-27

Benchetrit F, Ciree A, Vives V, Warnier G, Gey A, Sautès-Fridman C, Fossiez F, Haicheur N, Fridman WH, Tartour E. Interleukin-17 inhibits tumor cell growth by means of a T-cell-dependent mechanism. Blood. 2002 Mar 15;99(6):2114-21

Parham C, Chirica M, Timans J, Vaisberg E, Travis M, Cheung J, Pflanz S, Zhang R, Singh KP, Vega F, To W, Wagner J, O'Farrell AM, McClanahan T, Zurawski S, Hannum C, Gorman D, Rennick DM, Kastelein RA, de Waal Malefyt R, Moore KW. A receptor for the heterodimeric cytokine IL-23 is composed of IL-12Rbeta1 and a novel cytokine receptor subunit, IL-23R. J Immunol. 2002 Jun 1;168(11):5699-708

Pearce EJ, MacDonald AS. The immunobiology of schistosomiasis. Nat Rev Immunol. 2002 Jul;2(7):499-511

Aggarwal S, Ghilardi N, Xie MH, de Sauvage FJ, Gurney AL. Interleukin-23 promotes a distinct CD4 T cell activation state characterized by the production of interleukin-17. J Biol Chem. 2003 Jan 17;278(3):1910-4

Chen W, Jin W, Hardegen N, Lei KJ, Li L, Marinos N, McGrady G, Wahl SM. Conversion of peripheral CD4+CD25- naive T cells to CD4+CD25+ regulatory T cells by TGF-beta induction of transcription factor Foxp3. J Exp Med. 2003 Dec 15;198(12):1875-86

Cua DJ, Sherlock J, Chen Y, Murphy CA, Joyce B, Seymour B, Lucian L, To W, Kwan S, Churakova T, Zurawski S, Wiekowski M, Lira SA, Gorman D, Kastelein RA, Sedgwick JD. Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain. Nature. 2003 Feb 13;421(6924):744-8

Derynck R, Zhang YE. Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature. 2003 Oct 9;425(6958):577-84

Hori S, Nomura T, Sakaguchi S. Control of regulatory T cell development by the transcription factor Foxp3. Science. 2003 Feb 14;299(5609):1057-61

Happel KI, Dubin PJ, Zheng M, Ghilardi N, Lockhart C, Quinton LJ, Odden AR, Shellito JE, Bagby GJ, Nelson S, Kolls JK. Divergent roles of IL-23 and IL-12 in host defense against Klebsiella pneumoniae. J Exp Med. 2005 Sep 19;202(6):761-9

Harrington LE, Hatton RD, Mangan PR, Turner H, Murphy TL, Murphy KM, Weaver CT. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol. 2005 Nov;6(11):1123-32

Hwang ES, Szabo SJ, Schwartzberg PL, Glimcher LH. T helper cell fate specified by kinase-mediated interaction of T-bet with GATA-3. Science. 2005 Jan 21;307(5708):430-3

Kishimoto T. Interleukin-6: from basic science to medicine--40 years in immunology. Annu Rev Immunol. 2005;23:1-21

Langrish CL, Chen Y, Blumenschein WM, Mattson J, Basham B, Sedgwick JD, McClanahan T, Kastelein RA, Cua DJ. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med. 2005 Jan 17;201(2):233-40

Leonard WJ, Spolski R. Interleukin-21: a modulator of lymphoid proliferation, apoptosis and differentiation. Nat Rev Immunol. 2005 Sep;5(9):688-98

Park H, Li Z, Yang XO, Chang SH, Nurieva R, Wang YH, Wang Y, Hood L, Zhu Z, Tian Q, Dong C. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol. 2005 Nov;6(11):1133-41

Bettelli E, Carrier Y, Gao W, Korn T, Strom TB, Oukka M, Weiner HL, Kuchroo VK. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature. 2006 May 11;441(7090):235-8

Hu J, Yuan X, Belladonna ML, Ong JM, Wachsmann-Hogiu S, Farkas DL, Black KL, Yu JS. Induction of potent antitumor immunity by intratumoral injection of interleukin 23-transduced dendritic cells. Cancer Res. 2006 Sep 1;66(17):8887-96

Ivanov II, McKenzie BS, Zhou L, Tadokoro CE, Lepelley A, Lafaille JJ, Cua DJ, Littman DR.. The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell. 2006 Sep 22;126(6):1121-33.

Iwakura Y, Ishigame H.. The IL-23/IL-17 axis in inflammation. J Clin Invest. 2006 May;116(5):1218-22.

Langowski JL, Zhang X, Wu L, Mattson JD, Chen T, Smith K, Basham B, McClanahan T, Kastelein RA, Oft M.. IL-23 promotes tumour incidence and growth. Nature. 2006 Jul 27;442(7101):461-5. Epub 2006 May 10.

Mangan PR, Harrington LE, O'Quinn DB, Helms WS, Bullard DC, Elson CO, Hatton RD, Wahl SM, Schoeb TR, Weaver CT.. Transforming growth factor-beta induces development of the T(H)17 lineage. Nature. 2006 May 11;441(7090):231-4. Epub 2006 Apr 30.

Veldhoen M, Hocking RJ, Atkins CJ, Locksley RM, Stockinger B.. TGFbeta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity. 2006 Feb;24(2):179-89.

Yen D, Cheung J, Scheerens H, Poulet F, McClanahan T, McKenzie B, Kleinschek MA, Owyang A, Mattson J, Blumenschein W, Murphy E, Sathe M, Cua DJ, Kastelein RA, Rennick D.. IL-23 is essential for T cell-mediated colitis and promotes inflammation via IL-17 and IL-6. J Clin Invest. 2006 May;116(5):1310-6.



Bettelli E, Oukka M, Kuchroo VK.. T(H)-17 cells in the circle of immunity and autoimmunity. Nat Immunol. 2007 Apr;8(4):345-50. (REVIEW)

Brustle A, Heink S, Huber M, Rosenplanter C, Stadelmann C, Yu P, Arpaia E, Mak TW, Kamradt T, Lohoff M.. The development of inflammatory T(H)-17 cells requires interferon-regulatory factor 4. Nat Immunol. 2007 Sep;8(9):958-66. Epub 2007 Aug 5.

Chen Z, Laurence A, O'Shea JJ.. Signal transduction pathways and transcriptional regulation in the control of Th17 differentiation. Semin Immunol. 2007 Dec;19(6):400-8. doi: 10.1016/j.smim.2007.10.015. Epub 2007 Dec 31. (REVIEW)

Kaiga T, Sato M, Kaneda H, Iwakura Y, Takayama T, Tahara H.. Systemic administration of IL-23 induces potent antitumor immunity primarily mediated through Th1-type response in association with the endogenously expressed IL-12. J Immunol. 2007 Jun 15;178(12):7571-80.

Krueger GG, Langley RG, Leonardi C, Yeilding N, Guzzo C, Wang Y, Dooley LT, Lebwohl M; CNTO 1275 Psoriasis Study Group.. A human interleukin-12/23 monoclonal antibody for the treatment of psoriasis. N Engl J Med. 2007 Feb 8;356(6):580-92.

Kryczek I, Wei S, Zou L, Altuwaijri S, Szeliga W, Kolls J, Chang A, Zou W.. Cutting edge: Th17 and regulatory T cell dynamics and the regulation by IL-2 in the tumor microenvironment. J Immunol. 2007 Jun 1;178(11):6730-3.

Laurence A, Tato CM, Davidson TS, Kanno Y, Chen Z, Yao Z, Blank RB, Meylan F, Siegel R, Hennighausen L, Shevach EM, O'shea JJ.. Interleukin-2 signaling via STAT5 constrains T helper 17 cell generation. Immunity. 2007 Mar;26(3):371-81.

McGeachy MJ, Bak-Jensen KS, Chen Y, Tato CM, Blumenschein W, McClanahan T, Cua DJ.. TGF-beta and IL-6 drive the production of IL-17 and IL-10 by T cells and restrain T(H)-17 cell-mediated pathology. Nat Immunol. 2007 Dec;8(12):1390-7. Epub 2007 Nov 11.

Mucida D, Park Y, Kim G, Turovskaya O, Scott I, Kronenberg M, Cheroutre H.. Reciprocal TH17 and regulatory T cell differentiation mediated by retinoic acid. Science. 2007 Jul 13;317(5835):256-60. Epub 2007 Jun 14.

Nurieva R, Yang XO, Martinez G, Zhang Y, Panopoulos AD, Ma L, Schluns K, Tian Q, Watowich SS, Jetten AM, Dong C.. Essential autocrine regulation by IL-21 in the generation of inflammatory T cells. Nature. 2007 Jul 26;448(7152):480-3. Epub 2007 Jun 20.

Strober W, Fuss I, Mannon P.. The fundamental basis of inflammatory bowel disease. J Clin Invest. 2007 Mar;117(3):514-21. (REVIEW)

Zenewicz LA, Yancopoulos GD, Valenzuela DM, Murphy AJ, Karow M, Flavell RA.. Interleukin-22 but not interleukin-17 provides protection to hepatocytes during acute liver inflammation. Immunity. 2007 Oct;27(4):647-59. Epub 2007 Oct 4.

Zheng SG, Wang J, Wang P, Gray JD, Horwitz DA.. IL-2 is essential for TGF-beta to convert naive CD4+CD25- cells to CD25+Foxp3+ regulatory T cells and for expansion of these cells. J Immunol. 2007 Feb 15;178(4):2018-27.

Zheng Y, Danilenko DM, Valdez P, Kasman I, Eastham-Anderson J, Wu J, Ouyang W.. Interleukin-22, a T(H)17 cytokine, mediates IL-23-induced dermal inflammation and acanthosis. Nature. 2007 Feb 8;445(7128):648-51. Epub 2006 Dec 24.

Zhou L, Ivanov II, Spolski R, Min R, Shenderov K, Egawa T, Levy DE, Leonard WJ, Littman DR.. IL-6 programs T(H)-17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways. Nat Immunol. 2007 Sep;8(9):967-74. Epub 2007 Jun 20.

Aujla SJ, Chan YR, Zheng M, Fei M, Askew DJ, Pociask DA, Reinhart TA, McAllister F, Edeal J, Gaus K, Husain S, Kreindler JL, Dubin PJ, Pilewski JM, Myerburg MM, Mason CA, Iwakura Y, Kolls JK.. IL-22 mediates mucosal host defense against Gram-negative bacterial pneumonia. Nat Med. 2008 Mar;14(3):275-81. doi: 10.1038/nm1710. Epub 2008 Feb 10.

Genovese MC, McKay JD, Nasonov EL, Mysler EF, da Silva NA, Alecock E, Woodworth T, Gomez-Reino JJ.. Interleukin-6 receptor inhibition with tocilizumab reduces disease activity in rheumatoid arthritis with inadequate response to disease-modifying antirheumatic drugs: the tocilizumab in combination with traditional disease-modifying antirheumatic drug therapy study. Arthritis Rheum. 2008 Oct;58(10):2968-80. doi: 10.1002/art.23940.

Kimura A, Naka T, Nohara K, Fujii-Kuriyama Y, Kishimoto T.. Aryl hydrocarbon receptor regulates Stat1 activation and participates in the development of Th17 cells. Proc Natl Acad Sci U S A. 2008 Jul 15;105(28):9721-6. doi: 10.1073/pnas.0804231105. Epub 2008 Jul 7.

Nagata T, McKinley L, Peschon JJ, Alcorn JF, Aujla SJ, Kolls JK.. Requirement of IL-17RA in Con A induced hepatitis and negative regulation of IL-17 production in mouse T cells. J Immunol. 2008 Dec 1;181(11):7473-9.

Ouyang W, Kolls JK, Zheng Y.. The biological functions of T helper 17 cell effector cytokines in inflammation. Immunity. 2008 Apr;28(4):454-67. doi: 10.1016/j.immuni.2008.03.004. (REVIEW)

Quintana FJ1, Basso AS, Iglesias AH, Korn T, Farez MF, Bettelli E, Caccamo M, Oukka M, Weiner HL.. Control of T(reg) and T(H)17 cell differentiation by the aryl hydrocarbon receptor. Nature. 2008 May 1;453(7191):65-71. doi: 10.1038/nature06880. Epub 2008 Mar 23.

Schulz SM, Kohler G, Schutze N, Knauer J, Straubinger RK, Chackerian AA, Witte E, Wolk K, Sabat R, Iwakura Y, Holscher C, Muller U, Kastelein RA, Alber G.. Protective immunity to systemic infection with attenuated Salmonella enterica serovar enteritidis in the absence of IL-12 is associated with IL-23-dependent IL-22, but not IL-17. J Immunol. 2008 Dec 1;181(11):7891-901.

Serada S, Fujimoto M, Mihara M, Koike N, Ohsugi Y, Nomura S, Yoshida H, Nishikawa T, Terabe F, Ohkawara T, Takahashi T, Ripley B, Kimura A, Kishimoto T, Naka T.. IL-6 blockade inhibits the induction of myelin antigen-specific Th17 cells and Th1 cells in experimental autoimmune encephalomyelitis. Proc Natl Acad Sci U S A. 2008 Jul 1;105(26):9041-6. doi: 10.1073/pnas.0802218105. Epub 2008 Jun 24.

Tesmer LA, Lundy SK, Sarkar S, Fox DA.. Th17 cells in human disease. Immunol Rev. 2008 Jun;223:87-113. doi: 10.1111/j.1600-065X.2008.00628.x. (REVIEW)

Veldhoen M, Hirota K, Westendorf AM, Buer J, Dumoutier L, Renauld JC, Stockinger B.. The aryl hydrocarbon receptor links TH17-cell-mediated autoimmunity to environmental toxins. Nature. 2008 May 1;453(7191):106-9. doi: 10.1038/nature06881. Epub 2008 Mar 23.

Vignali DA, Collison LW, Workman CJ.. How regulatory T cells work. Nat Rev Immunol. 2008 Jul;8(7):523-32. doi: 10.1038/nri2343. (REVIEW)

Zenewicz LA, Yancopoulos GD, Valenzuela DM, Murphy



AJ, Stevens S, Flavell RA.. Innate and adaptive interleukin-22 protects mice from inflammatory bowel disease. Immunity. 2008 Dec 19;29(6):947-57. doi: 10.1016/j.immuni.2008.11.003.

Zheng Y, Valdez PA, Danilenko DM, Hu Y, Sa SM, Gong Q, Abbas AR, Modrusan Z, Ghilardi N, de Sauvage FJ, Ouyang W.. Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat Med. 2008 Mar;14(3):282-9. doi: 10.1038/nm1720. Epub 2008 Feb 10.

Zhang F, Meng G, Strober W.. Interactions among the transcription factors Runx1, RORgammat and Foxp3 regulate the differentiation of interleukin 17-producing T cells. Nat Immunol. 2008 Nov;9(11):1297-306. doi: 10.1038/ni.1663. Epub 2008 Oct 12.

Zheng SG, Wang J, Horwitz DA.. Cutting edge: Foxp3+CD4+CD25+ regulatory T cells induced by IL-2 and TGF-beta are resistant to Th17 conversion by IL-6. J Immunol. 2008 Jun 1;180(11):7112-6.

Zhou L, Lopes JE, Chong MM, Ivanov II, Min R, Victora GD, Shen Y, Du J, Rubtsov YP, Rudensky AY, Ziegler SF, Littman DR.. TGF-beta-induced Foxp3 inhibits T(H)17 cell differentiation by antagonizing RORgammat function. Nature. 2008 May 8;453(7192):236-40. doi: 10.1038/nature06878. Epub 2008 Mar 26.

Awasthi A, Riol-Blanco L, Jager A, Korn T, Pot C, Galileos G, Bettelli E, Kuchroo VK, Oukka M.. Cutting edge: IL-23 receptor gfp reporter mice reveal distinct populations of IL-17-producing cells. J Immunol. 2009 May 15;182(10):5904-8. doi: 10.4049/jimmunol.0900732.

Dhiman R, Indramohan M, Barnes PF, Nayak RC, Paidipally P, Rao LV, Vankayalapati R.. IL-22 produced by human NK cells inhibits growth of Mycobacterium tuberculosis by enhancing phagolysosomal fusion. J Immunol. 2009 Nov 15;183(10):6639-45. doi: 10.4049/jimmunol.0902587. Epub 2009 Oct 28.

Di Cesare A, Di Meglio P, Nestle FO.. The IL-23/Th17 axis in the immunopathogenesis of psoriasis. J Invest Dermatol. 2009 Jun;129(6):1339-50. doi: 10.1038/jid.2009.59. Epub 2009 Mar 26. (REVIEW)

Kryczek I, Banerjee M, Cheng P, Vatan L, Szeliga W, Wei S, Huang E, Finlayson E, Simeone D, Welling TH, Chang A, Coukos G, Liu R, Zou W.. Phenotype, distribution, generation, and functional and clinical relevance of Th17 cells in the human tumor environments. Blood. 2009 Aug 6;114(6):1141-9. doi: 10.1182/blood-2009-03-208249. Epub 2009 May 21.

Nowell MA, Williams AS, Carty SA, Scheller J, Hayes AJ, Jones GW, Richards PJ, Slinn S, Ernst M, Jenkins BJ, Topley N, Rose-John S, Jones SA.. Therapeutic targeting of IL-6 trans signaling counteracts STAT3 control of experimental inflammatory arthritis. J Immunol. 2009 Jan 1;182(1):613-22.

Schraml BU, Hildner K, Ise W, Lee WL, Smith WA, Solomon B, Sahota G, Sim J, Mukasa R, Cemerski S, Hatton RD, Stormo GD, Weaver CT, Russell JH, Murphy TL, Murphy KM.. The AP-1 transcription factor Batf controls T(H)17 differentiation. Nature. 2009 Jul 16;460(7253):405-9. doi: 10.1038/nature08114. Epub 2009 Jul 5.

Shevach EM.. Mechanisms of foxp3+ T regulatory cell-mediated suppression. Immunity. 2009 May;30(5):636-45. doi: 10.1016/j.immuni.2009.04.010. (REVIEW)

Xu J, Yang Y, Qiu G, Lal G, Wu Z, Levy DE, Ochando JC, Bromberg JS, Ding Y.. c-Maf regulates IL-10 expression

during Th17 polarization. J Immunol. 2009 May 15;182(10):6226-36. doi: 10.4049/jimmunol.0900123.

Yang Y, Weiner J, Liu Y, Smith AJ, Huss DJ, Winger R, Peng H, Cravens PD, Racke MK, Lovett-Racke AE.. T-bet is essential for encephalitogenicity of both Th1 and Th17 cells. J Exp Med. 2009 Jul 6;206(7):1549-64. doi: 10.1084/jem.20082584. Epub 2009 Jun 22.

Zhou L, Littman DR.. Transcriptional regulatory networks in Th17 cell differentiation. Curr Opin Immunol. 2009 Apr;21(2):146-52. doi: 10.1016/j.coi.2009.03.001. Epub 2009 Mar 26. (REVIEW)

Korn T, Bettelli E, Oukka M, Kuchroo VK.. IL-17 and Th17 Cells. Annu Rev Immunol. 2009;27:485-517. doi: 10.1146/annurev.immunol.021908.132710. (REVIEW)

Peck A, Mellins ED.. Precarious balance: Th17 cells in host defense. Infect Immun. 2010 Jan;78(1):32-8. doi: 10.1128/IAI.00929-09. Epub 2009 Nov 9. (REVIEW)

de Jong E, Suddason T, Lord GM.. Translational mini-review series on Th17 cells: development of mouse and human T helper 17 cells. Clin Exp Immunol. 2010 Feb;159(2):148-58. doi: 10.1111/j.1365-2249.2009.04041.x. Epub 2009 Nov 11. (REVIEW)

Zou W, Restifo NP.. T(H)17 cells in tumour immunity and immunotherapy. Nat Rev Immunol. 2010 Apr;10(4):248-56. doi: 10.1038/nri2742. (REVIEW)

Betz BC, Jordan-Williams KL, Wang C, Kang SG, Liao J, Logan MR, Kim CH, Taparowsky EJ.. Batf coordinates multiple aspects of B and T cell function required for normal antibody responses. J Exp Med. 2010 May 10;207(5):933-42. doi: 10.1084/jem.20091548. Epub 2010 Apr 26.

Durant L, Watford WT, Ramos HL, Laurence A, Vahedi G, Wei L, Takahashi H, Sun HW, Kanno Y, Powrie F, O'Shea JJ.. Diverse targets of the transcription factor STAT3 contribute to T cell pathogenicity and homeostasis. Immunity. 2010 May 28;32(5):605-15. doi: 10.1016/j.immuni.2010.05.003. Epub 2010 May 20.

Ahern PP, Schiering C, Buonocore S, McGeachy MJ, Cua DJ, Maloy KJ, Powrie F.. Interleukin-23 drives intestinal inflammation through direct activity on T cells. Immunity. 2010 Aug 27;33(2):279-88. doi: 10.1016/j.immuni.2010.08.010.

Zhou X, Kong N, Wang J, Fan H, Zou H, Horwitz D, Brand D, Liu Z, Zheng SG.. Cutting edge: all-trans retinoic acid sustains the stability and function of natural regulatory T cells in an inflammatory milieu. J Immunol. 2010 Sep 1;185(5):2675-9. doi: 10.4049/jimmunol.1000598. Epub 2010 Aug 2.

Ghoreschi K, Laurence A, Yang XP, Tato CM, McGeachy MJ, Konkel JE, Ramos HL, Wei L, Davidson TS, Bouladoux N, Grainger JR, Chen Q, Kanno Y, Watford WT, Sun HW, Eberl G, Shevach EM, Belkaid Y, Cua DJ, Chen W, O'Shea JJ.. Generation of pathogenic T(H)17 cells in the absence of TGF-beta signalling. Nature. 2010 Oct 21;467(7318):967-71. doi: 10.1038/nature09447.

Zhu J, Yamane H, Paul WE.. Differentiation of effector CD4 T cell populations (*). Annu Rev Immunol. 2010;28:445-89. doi: 10.1146/annurev-immunol-030409-101212.

Gutcher I, Donkor MK, Ma Q, Rudensky AY, Flavell RA, Li MO.. Autocrine transforming growth factor-beta1 promotes in vivo Th17 cell differentiation. Immunity. 2011 Mar 25;34(3):396-408. doi: 10.1016/j.immuni.2011.03.005.



Chen Y, Haines CJ, Gutcher I, Hochweller K, Blumenschein WM, McClanahan T, Hammerling G, Li MO, Cua DJ, McGeachy MJ.. Foxp3(+) regulatory T cells promote T helper 17 cell development in vivo through regulation of interleukin-2. Immunity. 2011 Mar 25;34(3):409-21. doi: 10.1016/j.immuni.2011.02.011.

Pandiyan P, Conti HR, Zheng L, Peterson AC, Mathern DR, Hernandez-Santos N, Edgerton M, Gaffen SL, Lenardo MJ.. CD4(+)CD25(+)Foxp3(+) regulatory T cells promote Th17 cells in vitro and enhance host resistance in mouse Candida albicans Th17 cell infection model. Immunity. 2011 Mar 25;34(3):422-34. doi: 10.1016/j.immuni.2011.03.002.

McGeachy MJ.. GM-CSF: the secret weapon in the T(H)17 arsenal. Nat Immunol. 2011 Jun;12(6):521-2. doi: 10.1038/ni.2044.

El-Behi M, Ciric B, Dai H, Yan Y, Cullimore M, Safavi F, Zhang GX, Dittel BN, Rostami A.. The encephalitogenicity of T(H)17 cells is dependent on IL-1- and IL-23-induced production of the cytokine GM-CSF. Nat Immunol. 2011 Jun;12(6):568-75. doi: 10.1038/ni.2031. Epub 2011 Apr 24.

Liao W, Lin JX, Wang L, Li P, Leonard WJ.. Modulation of cytokine receptors by IL-2 broadly regulates differentiation into helper T cell lineages. Nat Immunol. 2011 Jun;12(6):551-9. doi: 10.1038/ni.2030. Epub 2011 Apr 24.

Nakahama T, Kimura A, Nguyen NT, Chinen I, Hanieh H, Nohara K, Fujii-Kuriyama Y, Kishimoto T.. Aryl hydrocarbon receptor deficiency in T cells suppresses the development of collagen-induced arthritis. Proc Natl Acad Sci U S A. 2011 Aug 23;108(34):14222-7. doi: 10.1073/pnas.1111786108. Epub 2011 Aug 8.

Xu M, Morishima N, Mizoguchi I, Chiba Y, Fujita K, Kuroda M, Iwakura Y, Cua DJ, Yasutomo K, Mizuguchi J, Yoshimoto T.. Regulation of the development of acute hepatitis by IL-23 through IL-22 and IL-17 production. Eur J Immunol. 2011 Oct;41(10):2828-39. doi: 10.1002/eji.201141291. Epub 2011 Aug 31.

Rutz S1, Noubade R, Eidenschenk C, Ota N, Zeng W, Zheng Y, Hackney J, Ding J, Singh H, Ouyang W.. Transcription factor c-Maf mediates the TGF-beta-dependent suppression of IL-22 production in T(H)17 cells. Nat Immunol. 2011 Oct 16;12(12):1238-45. doi: 10.1038/ni.2134.

Pot C, Apetoh L, Awasthi A, Kuchroo VK.. Induction of regulatory Tr1 cells and inhibition of T(H)17 cells by IL-27. Semin Immunol. 2011 Dec;23(6):438-45. doi: 10.1016/j.smim.2011.08.003. Epub 2011 Sep 3. (REVIEW)

Chi H.. Regulation and function of mTOR signalling in T cell fate decisions. Nat Rev Immunol. 2012 Apr 20;12(5):325-38. doi: 10.1038/nri3198. (REVIEW)

Zielinski CE, Mele F, Aschenbrenner D, Jarrossay D, Ronchi F, Gattorno M, Monticelli S, Lanzavecchia A, Sallusto F.. Pathogen-induced human TH17 cells produce IFN-gamma or IL-10 and are regulated by IL-1beta. Nature. 2012 Apr 26;484(7395):514-8. doi: 10.1038/nature10957.

Takahashi H, Kanno T, Nakayamada S, Hirahara K, Sciume G, Muljo SA, Kuchen S, Casellas R, Wei L, Kanno Y, O'Shea JJ.. TGF-beta and retinoic acid induce the microRNA miR-10a, which targets Bcl-6 and constrains the plasticity of helper T cells. Nat Immunol. 2012 Apr 29;13(6):587-95. doi: 10.1038/ni.2286.

Samson M, Audia S, Janikashvili N, Ciudad M, Trad M, Fraszczak J, Ornetti P, Maillefert JF, Miossec P, Bonnotte B.. Brief report: inhibition of interleukin-6 function corrects

Th17/Treg cell imbalance in patients with rheumatoid arthritis. Arthritis Rheum. 2012 Aug;64(8):2499-503. doi: 10.1002/art.34477.

Ciofani M, Madar A, Galan C, Sellars M, Mace K, Pauli F, Agarwal A, Huang W, Parkurst CN, Muratet M, Newberry KM, Meadows S, Greenfield A, Yang Y, Jain P, Kirigin FK, Birchmeier C, Wagner EF, Murphy KM, Myers RM, Bonneau R, Littman DR.. A validated regulatory network for Th17 cell specification. Cell. 2012 Oct 12;151(2):289-303. doi: 10.1016/j.cell.2012.09.016. Epub 2012 Sep 25.

Tussiwand R, Lee WL, Murphy TL, Mashayekhi M, Wumesh KC, Albring JC, Satpathy AT, Rotondo JA, Edelson BT, Kretzer NM, Wu X, Weiss LA, Glasmacher E, Li P, Liao W, Behnke M, Lam SS, Aurthur CT, Leonard WJ, Singh H, Stallings CL, Sibley LD, Schreiber RD, Murphy KM.. Compensatory dendritic cell development mediated by BATF-IRF interactions. Nature. 2012 Oct 25;490(7421):502-7. doi: 10.1038/nature11531. Epub 2012 Sep 19.

Li P, Spolski R, Liao W, Wang L, Murphy TL, Murphy KM, Leonard WJ.. BATF-JUN is critical for IRF4-mediated transcription in T cells. Nature. 2012 Oct 25;490(7421):543-6. doi: 10.1038/nature11530. Epub 2012 Sep 19.

Lee Y, Awasthi A, Yosef N, Quintana FJ, Xiao S, Peters A, Wu C, Kleinewietfeld M, Kunder S, Hafler DA, Sobel RA, Regev A, Kuchroo VK.. Induction and molecular signature of pathogenic TH17 cells. Nat Immunol. 2012 Oct;13(10):991-9. doi: 10.1038/ni.2416. Epub 2012 Sep 9.

Glasmacher E, Agrawal S, Chang AB, Murphy TL, Zeng W, Vander Lugt B, Khan AA, Ciofani M, Spooner CJ, Rutz S, Hackney J, Nurieva R, Escalante CR, Ouyang W, Littman DR, Murphy KM, Singh H.. A genomic regulatory element that directs assembly and function of immune-specific AP-1-IRF complexes. Science. 2012 Nov 16;338(6109):975-80. doi: 10.1126/science.1228309. Epub 2012 Sep 13.

Powell JD, Pollizzi KN, Heikamp EB, Horton MR.. Regulation of immune responses by mTOR. Annu Rev Immunol. 2012;30:39-68. doi: 10.1146/annurev-immunol-020711-075024. Epub 2011 Nov 29. (REVIEW)

Wuthrich M, Deepe GS Jr, Klein B.. Adaptive immunity to fungi. Annu Rev Immunol. 2012;30:115-48. doi: 10.1146/annurev-immunol-020711-074958. Epub 2012 Jan 3. (REVIEW)

Tanaka T, Narazaki M, Kishimoto T.. Therapeutic targeting of the interleukin-6 receptor. Annu Rev Pharmacol Toxicol. 2012;52:199-219. doi: 10.1146/annurev-pharmtox-010611-134715. Epub 2011 Sep 9. (REVIEW)

Tanaka T, Narazaki M, Masuda K, Kishimoto T.. Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases. Inflammation and Regeneration. 2013 Jan;33(1).

AlFadhli S.. The interleukin-23/interleukin-17 axis and the role of Treg/Th17 cells in rheumatoid arthritis and joint destruction. OA Arthritis 2013 Feb 02;1(1):5.

Chang J, Burkett PR, Borges CM, Kuchroo VK, Turka LA, Chang CH.. MyD88 is essential to sustain mTOR activation necessary to promote T helper 17 cell proliferation by linking IL-1 and IL-23 signaling. Proc Natl Acad Sci U S A. 2013 Feb 5;110(6):2270-5. doi: 10.1073/pnas.1206048110. Epub 2013 Jan 22.

Zheng SG.. Regulatory T cells vs Th17: differentiation of Th17 versus Treg, are the mutually exclusive? Am J Clin Exp Immunol. 2013 Feb 27;2(1):94-106. Print 2013.



Rutz S, Eidenschenk C, Ouyang W.. IL-22, not simply a Th17 cytokine. Immunol Rev. 2013 Mar;252(1):116-32. doi: 10.1111/imr.12027. (REVIEW)

Muranski P, Restifo NP.. Essentials of Th17 cell commitment and plasticity. Blood. 2013 Mar 28;121(13):2402-14. doi: 10.1182/blood-2012-09-378653. Epub 2013 Jan 16. (REVIEW)

Yosef N, Shalek AK, Gaublomme JT, Jin H, Lee Y, Awasthi A, Wu C, Karwacz K, Xiao S, Jorgolli M, Gennert D, Satija R, Shakya A, Lu DY, Trombetta JJ, Pillai MR, Ratcliffe PJ, Coleman ML, Bix M, Tantin D, Park H, Kuchroo VK, Regev A.. Dynamic regulatory network controlling TH17 cell differentiation. Nature. 2013 Apr 25;496(7446):461-8. doi: 10.1038/nature11981. Epub 2013 Mar 6.

Kleinewietfeld M, Manzel A, Titze J, Kvakan H, Yosef N, Linker RA, Muller DN, Hafler DA.. Sodium chloride drives autoimmune disease by the induction of pathogenic TH17 cells. Nature. 2013 Apr 25;496(7446):518-22. doi: 10.1038/nature11868. Epub 2013 Mar 6.

Masuda K, Ripley B, Nishimura R, Mino T, Takeuchi O, Shioi G, Kiyonari H, Kishimoto T.. Arid5a controls IL-6 mRNA stability, which contributes to elevation of IL-6 level in vivo. Proc Natl Acad Sci U S A. 2013 Jun 4;110(23):9409-14. doi: 10.1073/pnas.1307419110. Epub 2013 May 15.

Kellner H.. Targeting interleukin-17 in patients with active rheumatoid arthritis: rationale and clinical potential. Ther Adv Musculoskelet Dis. 2013 Jun;5(3):141-52. doi: 10.1177/1759720X13485328.

Murphy TL, Tussiwand R, Murphy KM.. Specificity through cooperation: BATF-IRF interactions control immune-regulatory networks. Nat Rev Immunol. 2013 Jul;13(7):499-509. doi: 10.1038/nri3470. Epub 2013 Jun 21. (REVIEW)

Nguyen NT, Hanieh H, Nakahama T, Kishimoto T.. The roles of aryl hydrocarbon receptor in immune responses. Int Immunol. 2013 Jun;25(6):335-43. doi: 10.1093/intimm/dxt011. Epub 2013 Apr 11. (REVIEW)

Nakahama T, Hanieh H, Nguyen NT, Chinen I, Ripley B, Millrine D, Lee S, Nyati KK, Dubey PK, Chowdhury K, Kawahara Y, Kishimoto T.. Aryl hydrocarbon receptor-mediated induction of the microRNA-132/212 cluster promotes interleukin-17-producing T-helper cell differentiation. Proc Natl Acad Sci U S A. 2013 Jul 16;110(29):11964-9. doi: 10.1073/pnas.1311087110. Epub

2013 Jul 1.

Li L, Boussiotis VA.. The role of IL-17-producing Foxp3+ CD4+ T cells in inflammatory bowel disease and colon cancer. Clin Immunol. 2013 Aug;148(2):246-53. doi: 10.1016/j.clim.2013.05.003. Epub 2013 May 15. (REVIEW)

Burmester GR, Weinblatt ME, McInnes IB, Porter D, Barbarash O, Vatutin M, Szombati I, Esfandiari E, Sleeman MA, Kane CD, Cavet G, Wang B, Godwood A, Magrini F; EARTH Study Group.. Efficacy and safety of mavrilimumab in subjects with rheumatoid arthritis. Ann Rheum Dis. 2013 Sep 1;72(9):1445-52. doi: 10.1136/annrheumdis-2012-202450. Epub 2012 Dec 12.

Kang Z, Wang C, Zepp J, Wu L, Sun K, Zhao J, Chandrasekharan U, DiCorleto PE, Trapp BD, Ransohoff RM, Li X.. Act1 mediates IL-17-induced EAE pathogenesis selectively in NG2+ glial cells. Nat Neurosci. 2013 Oct;16(10):1401-8. doi: 10.1038/nn.3505. Epub 2013 Sep 1.

Yao S, Buzo BF, Pham D, Jiang L, Taparowsky EJ, Kaplan MH, Sun J.. Interferon regulatory factor 4 sustains CD8(+) T cell expansion and effector differentiation. Immunity. 2013 Nov 14;39(5):833-45. doi: 10.1016/j.immuni.2013.10.007. Epub 2013 Nov 7.

Qu N, Xu M, Mizoguchi I, Furusawa J, Kaneko K, Watanabe K, Mizuguchi J, Itoh M, Kawakami Y, Yoshimoto T.. Pivotal roles of T-helper 17-related cytokines, IL-17, IL-22, and IL-23, in inflammatory diseases. Clin Dev Immunol. 2013;2013:968549. doi: 10.1155/2013/968549. Epub 2013 Jul 14. (REVIEW)

Koch S, Mousset S, Graser A, Reppert S, Ubel C, Reinhardt C, Zimmermann T, Rieker R, Lehr HA, Finotto S.. IL-6 activated integrated BATF/IRF4 functions in lymphocytes are T-bet-independent and reversed by subcutaneous immunotherapy. Sci Rep. 2013;3:1754. doi: 10.1038/srep01754.

Komatsu N, Okamoto K, Sawa S, Nakashima T, Oh-hora M, Kodama T, Tanaka S, Bluestone JA, Takayanagi H. Pathogenic conversion of Foxp3+ T cells into TH17 cells in autoimmune arthritis. Nat Med. 2014 Jan;20(1):62-8. doi: 10.1038/nm.3432. Epub 2013 Dec 22.


Masuda K, Kishimoto T. Th17 cells: inflammation and regulation. Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):611-623.

Case Report Section Paper co-edited with the European LeukemiaNet



INIST-CNRS

OPEN ACCESS JOURNAL

T-cell acute lymphoblastic leukemia with t(7;14)(p15;q11.2)/HOXA-TCRA/D and biallelic deletion of CDKN2A. Case report and literature review Jonathon Mahlow, Salah Ebrahim, Anwar N Mohamed

Cytogenetics Laboratory, Pathology Department, Wayne State University School of Medicine and Detroit Medical Center, Detroit MI, USA (JM, SE, ANM)


Online updated version : http://AtlasGeneticsOncology.org/Reports/t0714p15q11MahlowID100075.html DOI: 10.4267/2042/54020


Abstract Case report and literature review on T-cell acute lymphoblastic leukemia with t(7;14)(p15;q11.2)/HOXA-TCRA/D and biallelic deletion of CDKN2A.

Clinics Age and sex 9 years old male patient.

Previous history No preleukemia, no previous malignancy, no inborn condition of note, no main items.

Organomegaly No hepatomegaly, splenomegaly, enlarged lymph nodes, no central nervous system involvement.

Note Positive for splenomegaly, bilateral enlarged kidneys, large mediastinal mass, extensive lymphadenopathy of intrathoracic, retroperitoneal, cervical, and axillary regions. Cerebral spinal fluid negative for malignant cells.

Blood WBC: 31.6 X 109/l HB: 8.6g/dl Platelets: 15 X 109/l Blasts: 65% Bone marrow: Dry tap.

Note: Peripheral blood showed anemia, thrombocytopenia and leukocytosis.

Cyto-Pathology Classification Cytology Peripheral blood smear showed large L2 lymphoblasts with nucleoli, normochromic, normocytic RBCs and markedly decreased platelets.

Immunophenotype Flow cytometric analysis of peripheral blood demonstrated an abnormal CD45dim circulating lymphoblasts (75%) expressing CD2, CD5, CD7, CD8, CD10, cytoplasmic CD3, TdT and partially expressing weak CD30. Overall, these findings were consistent with T-cell malignancy.

Rearranged Ig Tcr No rearrangements of TCRB and TCRA/D genes by FISH.

Electron microscopy Not performed.

Diagnosis T-cell acute lymphoblastic leukemia (T-ALL).

Survival Date of diagnosis: 09-2013

T-cell acute lymphoblastic leukemia with t(7;14)(p15;q11.2)/HOXA-TCRA/D and biallelic Mahlow J, et al. deletion of CDKN2A. Case report and literature review


Treatment: Patient was treated with COG-AALL00434 protocol including vincristine, daunorubicin hydrochloride, prednisone, pegaspargase, and intrathecal cytarabine and methotrexate. Complete remission: yes Treatment related death: no Relapse: no

Status: Alive. Last follow up: 01-2014

Survival: 4 months

Note: In remission; on maintenance chemotherapy as of Jan 28, 2014.

Karyotype Sample: Peripheral blood

Culture time: 24 and 48hrs unstimulated cultures

Banding: GTG

Results 46, XY,del(6)(q14q21),t(7;14)(p15;q11.2),del(9)(p13)[12]/92,idemx2,[7]/46,XY[1] (Figure 1)

Other molecular cytogenetics technics Fluorescence in situ hybridization (FISH) FISH using Vysis LSI BCR/ABL, CDKN2A/CEP-9 and TCRA/D, as well as Cytocell TCRB DNA probes was performed on peripheral blood harvested pellet. FISH analysis revealed four copies for TCRB/7q34, TRA/D/14q11.2, BCR/22q11.2, and ABL/9q34 in approximately 50% of cells, representing the pseudotetraploid cell line observed by karyotype. No BCR/ABL gene fusion was detected in any cell line. The hybridization with the CDKN2A/CEP9 probe set produced nullisomy (biallelic loss) of the

CDKN2A in 79% of cells but four copies of the control CEP-9 in 44% of cells and two copies in the remaining 35% while the normal cells had 2 copies of each (Figure 2). To verify the results of chromosome analysis with respect to t(7;14), confirmatory FISH was performed using Signature Genomic DNA probes BAC probes RP11-1132K14/7p15 (orange) covering the HOXA cluster genes and CTD-2555K7/14q11.2 (green) laying immediately telomeric to the TCRA/D/14q11.2 coding region. The hybridization revealed a fusion pattern; one fusion signal in the pseudodiploid and two fusion signals in the pseudotetraploid cells (Figure 3). Array Comparative Genomic Hybridization (aCGH) Genomic DNA was isolated from peripheral blood using a Puregene kit (Gentra Systems, Minneapolis, MN). The aCGH was performed using a genome wide oligonucleotide + single nucleotide polymorphism based microarray containing 180K-features (SurePrint G3 GGXChip + SNP v1.0 4x180k Agilent Technologies, St Clara, CA). The microarray slide was scanned by Agilent G2565 CA microarray scanner system with data imported to aCGH Analytics Software (Genoglyphix™; Signature Genomic Laboratories). The array design and genomic coordinates are based on NCBI build 37 (hg19). The aCGH revealed a 33.3Mb terminal monoallelic deletion of chromosome 9p13.3->pter, with 1.39 Mb biallelic deletions in the 9p21.3 region which spans the CDKN2A gene locus (Figure 4). It also detected a large 20.7 Mb interstitial deletion at del(6)(q14.1q16.2) and 1.34 Mb duplication within the 4q32.1 region.

Figure 1: G-banded karyotype of the pseudodiploid cell line demonstrating del(6q) (hollow arrow), t(7;14)(p15;q11.2) (thin arrows), and del(9p) (solid arrow).



Figure 2: FISH was performed using CDKN2A (orange) and the control CEP 9 (green) DNA probe set. The hybridization revealed biallelic loss of CDKN2A in an abnormal metaphase (long arrow) while the normal diploid interphase cell had two copies of each (short arrow).

Figure 3: FISH of a t(7;14) carrying metaphase cell demonstrating fusion of HOXA-TCRA/D gene regions (thin arrow).

Figure 4: aCGH plot for chromosome 9 showing compound deletions. The light blue region indicates a terminal monoallelic deletion of 33.3 Mb of 9p while dark blue region points to biallelic deletion within the 9p21.3.


Comments The patient here presented with progressive cough and neck mass. He was found to have an elevated WBC count with concomitant anemia and thrombocytopenia. Assessment of peripheral blood revealed the diagnosis of T-cell acute lymphoblastic leukemia (T-ALL). Chromosome analysis showed two clones, pseudodiploid and pseudotetraploid, both exhibiting t(7;14)(p15;q11.2), del(6)(q14q21), and del(9)(p13) (Figure 1). However, the pseudotetraploid clone had two copies of these abnormalities indicating it was derived from duplication of the pseudodiploid clone. FISH confirmed juxtaposing of HOXA/7p15 and TCRD/14q11.2 genes in the t(7;14) carrying leukemic cells (Figure 3). Homeobox (HOX) genes encode transcription factors which act as key regulators in embryonic development and normal hematopoiesis. Recently, the HOXA gene cluster at chromosome 7p15 has been described as a new recurrent breakpoint that occurs in up to 3% of T-ALL. The inv(7)(p15q34) and t(7;7)(p15;q34) place HOXA under the control of T-cell specific enhancer of TCRB, leading to upregulation of HOXA genes particularly HOXA10 and HOXA11. Another rare translocation is t(7;14)(p15;q11.2), previously described in a 29-year-old patient with T-ALL. The translocation resulted in colocalization of HOXA-TCRD genes, and generalized overexpression of the HOXA genes. However the leukemic clone of this case had also t(10;11)(p14;q21), and expressed CALM-AF10 fusion transcript. Therefore, it was concluded that the existence of both HOXA-TCRD and CALM-AF10 in the same leukemic cells may contribute to the global expression of HOXA genes. The t(7;14) in a 31-year old female with T-ALL was also cited but not well documented in a technical report by Garipidou et al 1991. The present case is believed to be the only other well described case with t(7;14)(p15;q11.2)/HOXA-TCRD translocation. However, our case was lacking t(10;11) which may make the two cases different in clinical presentation and response to therapy. Biallelic deletion of CDKN2A/9p21 as documented by aCGH and FISH was also found in our case (Figures 2, 4). Deletion of CDKN2A, tumor suppressor gene, is the most frequent genomic aberration occurs in over 70% of T-ALL which emphasizes the importance of CDKN2A inactivation in the development of this leukemia. A study pooling 907 individual cases of ALL has demonstrated that CDKN2A deletion, mono- or biallelic, is an independent risk factor for the development of ALL irrespective of cell lineage (B or T-cell). However, the prognostic significance of CDKN2A deletion in cases of pediatric T-cell ALL is currently unknown due to its frequent

association with other recurrent cytogenetic abnormalities. The deletion CDKN2A/9p21 has been previously shown to accompany the common yet nonspecific finding of del(6q), which was also present in this case. In summary, the t(7;14)(p15;q11.2) translocation is extremely rare resulting in an aberrant juxtaposing of HOXA-TCRD genes. Therefore, TCRD/14q11.2 may consider as a new variant partner for activation of HOXA/7p15 in T-ALL. Although the expression of HOXA genes was not tested in the present case, we assume it was upregulated as documented previously in HOXA-TCRD case and HOXA-TCRB cases.

References Hayashi Y, Raimondi SC, Look AT et al.. Abnormalities of the long arm of chromosome 6 in childhood acute lymphoblastic leukemia. Blood. 1990 Oct 15;76(8):1626-30

Garipidou V, Secker-Walker LM. The use of fluorodeoxyuridine synchronization for cytogenetic investigation of acute lymphoblastic leukemia. Cancer Genet Cytogenet. 1991 Mar;52(1):107-11

Magli MC, Largman C, Lawrence HJ. Effects of HOX homeobox genes in blood cell differentiation. J Cell Physiol. 1997 Nov;173(2):168-77

Merup M, Moreno TC, Heyman M et al.. 6q deletions in acute lymphoblastic leukemia and non-Hodgkin's lymphomas. Blood. 1998 May 1;91(9):3397-400

Soulier J, Clappier E et al.. HOXA genes are included in genetic and biologic networks defining human acute T-cell leukemia (T-ALL). Blood. 2005 Jul 1;106(1):274-86

Bergeron J, Clappier E et al.. HOXA cluster deregulation in T-ALL associated with both a TCRD-HOXA and a CALM-AF10 chromosomal translocation. Leukemia. 2006 Jun;20(6):1184-7

Chiaretti S, Foà R. T-cell acute lymphoblastic leukemia. Haematologica. 2009 Feb;94(2):160-2

Sulong S, Moorman AV, Irving JA et al.. A comprehensive analysis of the CDKN2A gene in childhood acute lymphoblastic leukemia reveals genomic deletion, copy number neutral loss of heterozygosity, and association with specific cytogenetic subgroups. Blood. 2009 Jan 1;113(1):100-7

Bach C, Buhl S, Mueller D et al.. Leukemogenic transformation by HOXA cluster genes. Blood. 2010 Apr 8;115(14):2910-8

Sherborne AL, Hosking FJ, Prasad RB et al.. Variation in CDKN2A at 9p21.3 influences childhood acute lymphoblastic leukemia risk. Nat Genet. 2010 Jun;42(6):492-4

Van Vlierberghe P, Ferrando A. The molecular basis of T cell acute lymphoblastic leukemia. J Clin Invest. 2012 Oct 1;122(10):3398-406


Mahlow J, Ebrahim S, Mohamed AN. T-cell acute lymphoblastic leukemia with t(7;14)(p15;q11.2)/HOXA-TCRA/D and biallelic deletion of CDKN2A. Case report and literature review. Atlas Genet Cytogenet Oncol Haematol. 2014; 18(8):624-627.


INIST-CNRS

OPEN ACCESS JOURNAL

Instructions to Authors Manuscripts submitted to the Atlas must be submitted solely to the Atlas. Iconography is most welcome: there is no space restriction. The Atlas publishes "cards", "deep insights", "case reports", and "educational items". Cards are structured review articles. Detailed instructions for these structured reviews can be found at: http://AtlasGeneticsOncology.org/Forms/Gene_Form.html for reviews on genes, http://AtlasGeneticsOncology.org/Forms/Leukaemia_Form.html for reviews on leukaemias, http://AtlasGeneticsOncology.org/Forms/SolidTumour_Form.html for reviews on solid tumours, http://AtlasGeneticsOncology.org/Forms/CancerProne_Form.html for reviews on cancer-prone diseases. According to the length of the paper, cards are divided, into "reviews" (texts exceeding 2000 words), "mini reviews" (between), and "short communications" (texts below 400 words). The latter category may not be accepted for indexing by bibliographic databases. Deep Insights are written as traditional papers, made of paragraphs with headings, at the author's convenience. No length restriction. Case Reports in haematological malignancies are dedicated to recurrent -but rare- chromosomes abnormalities in leukaemias/lymphomas. Cases of interest shall be: 1- recurrent (i.e. the chromosome anomaly has already been described in at least 1 case), 2- rare (previously described in less than 20 cases), 3- with well documented clinics and laboratory findings, and 4- with iconography of chromosomes. It is mandatory to use the specific "Submission form for Case reports": see http://AtlasGeneticsOncology.org/Reports/Case_Report_Submission.html. Educational Items must be didactic, give full information and be accompanied with iconography. Translations into French, German, Italian, and Spanish are welcome.

Subscription: The Atlas is FREE!

Corporate patronage, sponsorship and advertising Enquiries should be addressed to [email protected].

Rules, Copyright Notice and Disclaimer Conflicts of Interest: Authors must state explicitly whether potential conflicts do or do not exist. Reviewers must disclose to editors any conflicts of interest that could bias their opinions of the manuscript. The editor and the editorial board members must disclose any potential conflict. Privacy and Confidentiality – Iconography: Patients have a right to privacy. Identifying details should be omitted. If complete anonymity is difficult to achieve, informed consent should be obtained. Property: As "cards" are to evolve with further improvements and updates from various contributors, the property of the cards belongs to the editor, and modifications will be made without authorization from the previous contributor (who may, nonetheless, be asked for refereeing); contributors are listed in an edit history manner. Authors keep the rights to use further the content of their papers published in the Atlas, provided that the source is cited. Copyright: The information in the Atlas of Genetics and Cytogenetics in Oncology and Haematology is issued for general distribution. All rights are reserved. The information presented is protected under international conventions and under national laws on copyright and neighbouring rights. Commercial use is totally forbidden. Information extracted from the Atlas may be reviewed, reproduced or translated for research or private study but not for sale or for use in conjunction with commercial purposes. Any use of information from the Atlas should be accompanied by an acknowledgment of the Atlas as the source, citing the uniform resource locator (URL) of the article and/or the article reference, according to the Vancouver convention. Reference to any specific commercial products, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favouring. The views and opinions of contributors and authors expressed herein do not necessarily state or reflect those of the Atlas editorial staff or of the web site holder, and shall not be used for advertising or product endorsement purposes. The Atlas does not make any warranty, express or implied, including the warranties of merchantability and fitness for a particular purpose, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, and shall not be liable whatsoever for any damages incurred as a result of its use. In particular, information presented in the Atlas is only for research purpose, and shall not be used for diagnosis or treatment purposes. No responsibility is assumed for any injury and/or damage to persons or property for any use or operation of any methods products, instructions or ideas contained in the material herein. See also: "Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Writing and Editing for Biomedical Publication - Updated October 2004": http://www.icmje.org.

http://AtlasGeneticsOncology.org

© ATLAS - ISSN 1768-3262

vol 18 8 2014

Documents

Transcript of vol 18 8 2014