genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web...
Transcript of genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web...
![Page 1: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/1.jpg)
Supplementary Materials:
Supplementary materials and methods
Drosophila stocks and genetics
Flies were raised on standard cornmeal food at the indicated temperatures. The sources of
the fly lines were: dPINK1B9 (null mutant), Dr. JongKyeong Chung; UAS-yNDI1, parkin1
and parkinΔ21, Dr. Patrik Verstreken; TH-GAL4, Dr. Serge Birman; UAS-mitoGFP, Dr.
William Saxton; UAS-Marf RNAi, Dr. Ming Guo; UAS-ATG1, Dr. Eric Baehrecke; UAS-
Sin1-Flag, Dr. Kazuo Emoto; UAS-Rictor, Tub-AKT WT, Tub-AKT R54A, Tub-AKT
S505A and Tub-AKT T342A, Dr. Stephen Cohen; UAS-PINK1 RNAi, UAS-PINK1 and
UAS-Parkin were generated as described (Yang et al., 2006); UAS-ND75RNAi (2286R-3)
was obtained from National Institute of Genetic Fly Stock Center (Japan); UAS-
CG9672RNAi (v11381) and UAS-Miro RNAi106683 (v106683) from Vienna Drosophila
RNAi Center. UAS-rictor RNAi #1 (B31388) UAS-rictor RNAi #2 (B31527), UAS-AKT-
RNAi (B33615), UAS-Trc-S (B32080), UAS-Trc-L (B32085), UAS-Trc K122A (B32082),
UAS-Trc K122A/T453A (B32086), UAS-Trc S292E (B32081), UAS-Trc T453E (B32089),
UAS-Trc RNAi (B28326) and all other stocks used in the experiments were from
Bloomington Drosophila Stock Center (USA).
Muscle histology
![Page 2: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/2.jpg)
For mitochondria morphology analysis in thoracic muscle, mito-GFP was expressed in
muscle tissue using the Mhc-Gal4 driver, and indirect flight muscles were dissected in
PBS and examined under confocal fluorescence microscope.
Abnormal wing posture and behavioral analyses
Abnormal wing posture was analyzed as described before (Liu and Lu, 2010). Briefly, the
number of flies with abnormal wing posture (either held-up or drooped) was scored after
male flies of the indicated genotypes were aged for 14 days at 29oC. For each experiment,
at least 60 flies per genotype were scored and the percentage of flies with abnormal wing
posture was calculated. For jump/flight ability tests, 10 flies were placed in each vial and
the jump/flight events were counted for two minutes while the vial was gently rolled to
initiate the jump/flight events. Results were averaged to represent the jumping ability of
10 individuals. Each analysis was repeated at least 3 times.
ATP measurement
The ATP level in Drosophila thoracic muscle was measured essentially as previously
described (Liu and Lu, 2010), using a luciferase based bioluminescence assay (ATP
Bioluminescence Assay Kit HS II, Roche Applied Science). For each measurement, 3
thoraxes were used and at least 3 measurements were made for each genotype. The
results were normalized to the ATP level of the control flies.
Stress assays
![Page 3: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/3.jpg)
Five-day-old male flies were starved for 3 hours before being transferred into vials (20
flies per vial) containing filter papers soaked with 5% sucrose solution supplemented
with 1% H2O2 (Sigma Aldrich), 0.4 M NaCl, or 250 μM rotenone (Sigma Aldrich). Flies
were transferred to fresh vials everyday. The survival of the challenged flies was recorded
every day when changing the vials. For the climbing activity assay after rotenone
treatment, the number of individuals that could not climb and stayed at the bottom of the
vials was counted. To detect mitochondrial morphology change and DA neurons loss after
stress treatment, the treated flies were fixed and subjected to the indicated
immunohistochemical analysis.
Immunoprecipitation of PINK1
The HEK293T cell line was used to study the association of PINK1 with mitochondrial
respiratory complexes. Cells were cultured at 37oC and transfected with pcDNA3.1-
PINK1-FLAG. Cells were treated with 10 μM MG132 to stabilize PINK1 and enhance
the formation of complexes between PINK1 and components for the respiratory chain.
Cells were lysed in lysis buffer (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 1% Triton X-
100, 1 mM EDTA, 10 mM β-glycerophosphate, 50 mM NaF, and 1 mM PMSF), and
PINK1 was immunoprecipitated by incubating the supernatant with pre-equilibrated anti-
Flag M2 affinity beads (Sigma Aldrich) at 4oC for 12 hours. Purified immunocomplexes
were washed 3 times in lysis buffer, and analyzed by western blot.
Western blot analysis of Drosophila tissues
![Page 4: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/4.jpg)
Western blot analyses of Drosophila tissues were performed essentially as described (Liu
and Lu, 2010). The primary antibodies used in the western blots were anti-pS505-dAKT,
anti-AKT, (Cell Signaling Technology), anti-Actin (Millipore), anti-FLAG, anti-HA
(Sigma Aldrich), anti-GFP (Abcam), anti-NDUSF1 (GeneTex), anti-NDUSF3, anti-
SDHA, anti-ATP5A (MitoScience), and anti-mTOR (Santa Cruz). The anti-TH antibody
was generated as described (Yang et al., 2006). Anti-Trc, anti-pS292-Trc and anti-pT453-
Trc antibodies were generous gifts from Dr. Emoto.
Mitophagy assay in mammalian cells
Mouse embryonic fibroblast (MEF) derived from rictor deficient mice was kindly
provided by Dr. M. Magnuson (Shiota et al., 2006). MEF from PINK1 deficient mice was
generated and maintained as described previously (Matsuda et al., 2010). MEFs were
transfected with a recombinant retroviral vector or Lipofectamine LTX (Invitrogen).
HeLa cells expressing Venus-Parkin (Venus-Parkin/HeLa cells) were generated and
maintained as described previously (Liu et al., 2012). HeLa cells stably expressing GFP-
Parkin and non-tagged Parkin were generated by retroviral infection. Stealth siRNA
duplexes (Invitrogen) were transfected using Lipofectamine RNAiMAX (Invitrogen)
according to manufacturer’s instructions. Stealth siRNAs for control, Rictor, Raptor,
mTOR, NDR1 and NDR2 were purchased from Life Technologies.
To depolarize mitochondria, cells were treated with 10 μM (for
Venus-Parkin/HeLa cells, Parkin/HeLa cells or GFP-Parkin/HeLa cells), 20 µM (for
Rictor MEF), or 30 µM (for PINK1 MEF) CCCP, fixed with 4% paraformaldehyde in
PBS and permeabilized with 50 μg/ml digitonin or 0.2% Triton X-100 in PBS, and
![Page 5: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/5.jpg)
stained with anti-Tom20 in combination with anti-GFP or anti-HA antibodies. Cells were
imaged using laser-scanning confocal microscope systems (LSM510 META, Carl Zeiss
or TCS-SP5, Leica) with 63x/1.4 oil-immersion objectives.
The Phospho-S281 and phospho-T444 NDR antibodies were kindly provided by Dr. B.
Hemmings (Tamaskovic et al., 2003). Other antibodies used in this study are as follows:
anti-FLAG and anti-Tubulin (Sigma-Aldrich), anti-Tom20, anti-Parkin and anti-NDR1/2
(Santa Cruz Biotechnology), anti-COX I and anti-COX IV (Invitrogen), anti-GFP
(Nacalai Tesque), anti-HA (Covance), anti-PINK1 (Novus), anti-Rictor (Bethyl
Laboratories and Cell Signaling Technology), anti-mTOR and anti-Raptor (Cell Signaling
Technology), anti-Hexokinase1 (Cell Signaling Technology), anti-Tim23, anti-
Cytochrome c and anti-Hsp60 (BD), anti-RHOT1/Miro1 and anti-Mitofusin1 (Abnova),
anti-Actin (Millipore). Human PINK1-FLAG (wild-type and kinase-dead forms), HA-
Parkin and GFP-Parkin cloned in a retroviral pMXs-puro vector were described
previously (Matsuda et al., 2010). Myc-tagged human Rictor was obtained from Addgene
and was subcloned in pMXs-puro vector. Human NDR1 with FLAG and 6x His-tag
cloned in pCI-neo vector were provided by Drs. K. Nakagawa and Y. Hata. Human
PINK1-Myc and siRNA-resistant human NDR1 were generated in this study.
For making the siRNA-resistant silent mutations, c.432A>T, c.435C>T,
c.438T>C, c.441G>A, c.447T>A, and c.450G>C were introduced into human NDR1
using the following primers; Forward primer: 5’- tgggtagtcaaaatgttctatagt -3’, Reverse
primer: 5’- taagctatcagcctccactaga -3’. Phos-tag western blot was performed as described
(Imai et al., 2010).
![Page 6: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/6.jpg)
In vitro kinase assay of Trc
The protocol was modified from a previous study (Ultanir et al., 2012). For Trc
immunoprecipitation, flies were crossed and raised at 25oC. Male flies expressing Flag-
tagged Trc were collected and homogenized in lysis buffer (1% Nonidet P-40, 10%
glycerol, 1 mM Na3VO4, 20 mM β-glycerol phosphate, 50 mM NaF, 1 mM PMSF, 1X
phosphatase inhibitor cocktail I (Sigma) in 20 mM Tris-HCl pH 8.0 and 150 mM NaCl).
Lysate was incubated on ice for 30 min and centrifuged at 20,000 g for 15 min.
Supernatant was precleared with IgG- Sepharose (GE Healthcare) for 30 min and
incubated with anti-Flag M2 affinity beads (Sigma Aldrich) for 3 hours at 4°C to
immunoprecipitate FLAG-tagged Trc kinase. Beads were washed 2X with lysis buffer,
1X with lysis buffer containing 1 M NaCl for 10 min, followed by one 10 min wash in
lysis buffer and 2X with kinase reaction buffer (20 mM Tris-HCl pH 7.5, 10 mM MgCl2,
1 mM dithiothreitol (DTT), 1 μM cyclic AMP- dependent protein kinase inhibitor peptide
and 1 μM okadaic acid).
AAK1 containing a HA tag was used as the substrate. The expression construct
was a gift from the Jan lab (UCSF). It was transfected in HEK293T cells. The protein
was purified using mouse anti-HA antibody (Sigma Aldrich) and protein-G beads
(Thermo Scientific) as described for Trc Kinase immunoprecipitation, except that no
phosphatase inhibitor was added. AAK1-HA was eluted from the beads in 20 mM Tris-HCl
pH 7.5, 100 mM NaCl, 1 mM DTT, 10 mM MgCl2 and 1 mg/ml HA peptide (GenScript).
For Trc kinase reactions with AAK1 as substrate, 0.5 μg of purified HA-AAK1
together with 0.1 μg of purified FLAG-tagged Trc was included in the reaction, 0.5 mM
ATP-γ-S (Sigma Aldrich) was also included in the reaction. Reaction was incubated at
![Page 7: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/7.jpg)
30oC for 60 min, and followed immediately by alkylation reaction (1 hour at room
temperature) by adding 2 μl of 100 mM p-nitro mesylate (PNBM, Epitomics) per 30μl
kinase reaction. Beads were precipitated by centrifugation. Supernatant was run on a
western blot. Thiophosphorylation was detected using an anti-thiophosphate ester
antibody (1:5000; Epitomics).
![Page 8: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/8.jpg)
Supplementary Figure Legend
Figure S1. Effects of mTORC2 LOF or GOF in wild type or PINK1B9 mutant
backgrounds. Mhc-Gal4 was used to drive transgene expression. Wing posture (A),
jump/flight ability (B), thoracic ATP level (C) for the wild type background, or wing
posture in PINK1B9 mutant background (D) are shown. *, p<0.05 in one-way ANOVA
tests.
Figure S2. Interaction between PINK1 and mitochondrial complex-I (CI). (A, B) Mhc-
Gal4 driven RNAi of CI subunits ND75 or CG9762 phenocopied Mhc>PINK1 RNAi
effects. Note that the effects of CI RNAi were evident only after more complete
knockdown using two copies (2x) of the RNAi transgenes. (C) RNAi of CI subunits
induced mitochondrial aggregation in DNs. (D) In vitro phosphorylation of human GST-
AKT-KD by Drosophila TORC2, which were affinity-purified using anti-Flag from
control or ND75-RNAi animals expressing a Sin1-Flag transgene. Similar amounts of
Sin1 and dTOR were present in the extracts or immunoprecipitated TORC2. After the
kinase reaction, AKT phosphorylation was detected with anti-pS473-AKT. Total GST-
AKT-KD protein was detected by Coomassie Blue staining (CBS). Bar graph shows data
quantification. (E-G) RNAi of CI enhanced, whereas yNDI1 co-expression suppressed
PINK1 RNAi-induced abnormal wing posture (E), drop of ATP level (F), or
mitochondrial aggregation (G). * or #, p<0.05; ** or ## , p<0.01; and *** or ###, p<0.005 in
one-way ANOVA tests, when data from DAY1 (*), or DAY14 (#) were compared. (H)
Western blot analysis showing that PINK1 associates with mitochondrial complex-I
![Page 9: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/9.jpg)
subunits. HEK cells transfected with PINK1-FLAG and treated or mock treated with
MG132 were subjected to immunoprecipitation with anti-FLAG. The presence of
respiratory chain CI, CII, or CV subunits was detected by western blot analysis.
Figure S3. Sensitivity of TORC2 LOF mutants to mitochondrial CI inhibition. (A-D)
Survival of wild type, rictor mutant, and sin1 mutant flies under H2O2 (A), NaCl (B), heat
shock (C), and rotenone (D) induced stresses. (E) Impaired climbing activity of rictor and
sin1 mutant flies after rotenone treatment. Non-treated rictor and sin1 mutant flies exhibit
normal climbing activity (data not shown). (F) Loss of PPL1 cluster DNs in rictor mutant
flies after rotenone treatment. The number of DNs in the PPL1 clusters of the left and
right brain lobes of DMSO mock-treated or rotenone-treated animals was counted. (G)
Synergy between rictor mutation and ND75 RNAi in inducing abnormal wing posture. *,
p<0.05; **, p<0.01 in one-way ANOVA tests.
Figure S4. Lack of genetic interaction between PINK1 and AKT. (A, B) The abnormal
wing posture (A) and reduced jump/flight activity (B) phenotypes caused by Mhc-
Gal4>PINK1 RNAi were not affected by genetic manipulations of AKT activity. (C) The
mitochondrial aggregation phenotype in indirect flight muscle of Mhc-Gal4>PINK1
RNAi animals was not modified after AKT OE or AKT RNAi.
![Page 10: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/10.jpg)
Figure S5. Effects of Trc LOF or GOF in wild type or PINK1B9 mutant backgrounds.
Mhc-Gal4 was used to drive transgene expression. Wing posture (A), jump/flight ability
(B), thoracic ATP level (C) for the wild type background, or wing posture in PINK1B9
mutant background (D) are shown. *, p<0.05 in one-way ANOVA tests.
Figure S6. Genetic evidence that Trc acts downstream of TORC2. (A) Co-expression of
Trc-S292E or Trc-L attenuated the enhancement of Mhc>PINK1 RNAi-induced
abnormal wing posture by rictor deletion. (B) While Rictor OE was able to suppress
Mhc>PINK1 RNAi-induced abnormal wing posture phenotype in an otherwise wild type
background, it failed to do so in a dominant negative Trc K122A/T453A co-expression
background. (C) Co-expression of Trc-S292E attenuated the exacerbation of
Mhc>PINK1 RNAi-induced mitochondrial aggregation by rictor deletion. (D) Rictor OE
failed to rescue Mhc>PINK1 RNAi-induced mitochondrial aggregation in a dominant
negative Trc K122A/T453A co-expression background. ** or ## , p<0.01 in one-way
ANOVA tests.
Figure S7. Effects of Trc LOF in DNs. (A) TH-Gal4-driven Trc RNAi caused loss of
DNs in the PPL1 cluster. (B) TH-Gal4-driven Trc RNAi caused mitochondrial
aggregation in TH-positive DNs. (C) Quantification of mitochondrial size showing an
increase in the number of DNs with mitochondrial size greater than 2 μm in diameter in
TH-Gal4>Trc RNAi animals. *, p<0.05; **, p<0.01 in Student’s t-tests.
![Page 11: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/11.jpg)
Figure S8. Evidence that activated p-Trc and mTORC2 are present on mitochondria. (A)
Western blot analysis showing that phosphorylated Trc was primarily found in the
mitochondrial fraction, whereas total Trc protein was evenly distributed between the
mitochondrial and cytoplasmic fractions. NDUFS3 and actin serve as mitochondrial and
cytoplasmic markers, respectively. (B) Western blot analysis showing that TORC2
components were found in the mitochondrial fraction. NDUFS3 was used as
mitochondrial marker, and Actin as a cytoplasmic marker.
Figure S9. Inhibition of NDR1 function in mammalian cells impairs the recruitment of
Parkin to damaged mitochondria and the clearance of damaged mitochondria by
mitophagy. (A) siRNA treatment against NDR1, but not NDR2, compromised Parkin
translocation to mitochondria damaged by CCCP treatment. Venus-Parkin/HeLa cells
were treated with the indicated siRNA for 69 hrs, and were further treated with 10 µM
CCCP for 60 or 90 mins. Anti-Tom20 staining revealed that recruitment of Parkin to
mitochondria was reduced after NDR1 RNAi, and that the perinuclear aggregation of
mitochondria was impaired. Scale bars = 10 µm. (B) Impairments of Parkin recruitment
and mitophagy induced by NDR1 siRNA were rescued by RNAi-resistant NDR1
overexpression, but not by PINK1 overexpression. Cells expressing transfected plasmids
are indicated with asterisks. Scale bars = 10 µm. Note that in CCCP-treated cells NDR1
protein colocalizes with the mitochondria marker Tom 20. (C) Analysis of Parkin auto-
degradation and mitophagy through western blot analysis of mitochondrial marker
expression. Control or NDR1 siRNA-treated Venus-Parkin/HeLa cells were incubated
![Page 12: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/12.jpg)
with 10 µM CCCP for the indicated periods. Mitochondrial markers for the outer
membrane (Tom20, VDAC1), the intermembrane space (Cytochrome c; Cyto c), the
inner membrane (Tim23) and the matrix (Hsp60) were examined by western blot to
monitor the elimination of damaged mitochondria. Note that Parkin-mediated degradation
of the mitochondrial outer membrane proteins occurs earlier than the removal of inner
membrane and matrix proteins by autophagosomes in the mitophagy process (Chan et al.,
2011; Okatsu et al., 2012). Therefore, the outer membrane protein (Tom20 and VDAC1)
and intermembrane protein (Cyt C) markers exhibit differential kinetics in their clearance
than inner membrane (Tim23) and matrix (Hsp60) markers. Also note that NDR1 but not
NDR2 is mainly expressed in Venus-Parkin/HeLa cells as knockdown of NDR1 caused
the disappearance of anti-NDR1/2-immunoreactive bands. (D) Western blot analysis
demonstrating the persistence of the RNAi-resistant NDR1 after NDR1 RNAi.
Figure S10. Effects of PINK1 on NDR1 phosphorylation in mammalian cells. (A)
Western blot analysis showing that pT444-NDR1 level was reduced in PINK1(-/-) MEF
cells reconstituted with a kinase-dead (KD) form of PINK1 compared to PINK1(-/-) MEF
cells reconstituted with wild-type (WT) PINK1, after treatment with CCCP for the
indicated times. Lysate form MEF transiently transfected with FLAG-His-NDR1 were
subjected to Ni-NTA pull-down, then precipitates were analyzed with the indicated
antibodies. To preserve p-NDR1 signals, cells were treated with the phosphatase inhibitor
okadaic acid (OA). (B) Quantification of p-T444 NDR1 signals in the samples shown in
(A). (C) Similarly to (A), endogenous pT444-NDR1 level was analyzed without OA
![Page 13: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/13.jpg)
treatment. (D) Quantification of p-T444 NDR1 signals in the samples shown in (C). *,
p<0.05 in Student’s t-tests.
Figure S11. Inhibition of Rictor function in mammalian cells impairs the recruitment of
Parkin to damaged mitochondria and the clearance of damaged mitochondria by
mitophagy. (A) Knockdown of Rictor but not Raptor compromised Parkin translocation
to mitochondria upon CCCP treatment. Venus-Parkin/HeLa cells were treated with the
indicated siRNA for 69 hrs, and were further treated with 10 µM CCCP for 3 hrs. Anti-
Tom20 staining revealed that recruitment of Parkin to mitochondria was reduced after
Rictor RNAi, and that the perinuclear aggregation of mitochondria was impaired. Scale
bars = 10 µm. (B) Loss of Rictor delayed the mitochondrial translocation of Parkin and
subsequent mitophagy. Rictor (+/+) and Rictor (-/-) MEFs expressing HA-Parkin were
treated with 20 µM CCCP for the indicated periods. Anti-Tom20 stain (red) and DAPI
counterstain (blue) help visualize mitochondrial morphology and mitophagy progression.
Note the increased Parkin expression in Rictor (-/-) MEF, which was reproducible in
three independent experiments (see also western blot data in C). Scale bar = 10 µm. (C)
Analysis of mitophagy through western blot analysis of mitochondrial marker expression.
Rictor (+/+) or Rictor (-/-) MEFs stably expressing HA-Parkin were treated with 20 µM
CCCP for the indicated periods. Mitochondrial markers for the outer membrane (Tom20,
Hexokinase1 and Mitofusin1) and the inner membrane (COXI and COXIV) were
examined by western blot to monitor the elimination of damaged mitochondria. Actin
serves as a loading control. Expression levels of transfected Parkin and endogenous
Hexokinase1 were increased in Rictor (-/-) MEF in three independent experiments. (D)
![Page 14: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/14.jpg)
Western blot analysis examining knockdown efficiencies of Rictor, Raptor and mTOR
siRNAs. HEK293T cells were treated with three different siRNAs (1-3, 10 nM each) or a
mixture of them (M, 10 nM). Note that treatment with mTOR siRNA affected the
stability of Rictor and Raptor; therefore we did not use mTOR siRNA in this study. (E)
Impairments of Parkin recruitment and mitophagy in Rictor (-/-) MEFs were rescued by
the overexpression of Rictor. Rictor (-/-) MEF were retrovirally transfected with pMXs-
puro-human Rictor or an empty vector (mock) along with pMXs-puro-HA-Parkin. Cells
were analyzed as in (B).
Figure S12. Biochemical evidence that NDR1 acts upstream of Parkin and the key MQC
executors in mammalian cells. (A) Effects of NDR1 RNAi on CCCP-induced Parkin
phosphorylation. HeLa cells stably expressing non-tagged Parkin were transfected with
siRNA against NDR1 or control siRNA. Cells were further treated with 10 µM CCCP or
DMSO solvent alone for 60 min. Phosphorylated and non-phosphorylated forms of
Parkin and NDR1 separated on a Phos-tag gel (Wako) were indicated. Phosphorylated
proteins disappeared after lambda phosphatase treatment (PP). Levels of NDR1, Miro1,
and Mfn1 were detected by western blot analysis. Actin serves as loading control. Note
that in control siRNA treated cells, CCCP treatment led to increased Parkin
phosphorylation, and degradation of Miro1 and Mfn1. These effects were significantly
attenuated by NDR1 RNAi. (B) Effects of NDR1 RNAi on the autoubiquitination activity
of Parkin. HeLa cells stably expressing GFP-tagged Parkin (GFP-Parkin/HeLa) were
transfected with siRNA against PINK1 or NDR1, or control siRNA. Seventy-one hours
after transfection, cells were treated with 10μM CCCP or DMSO for 60 min. After that,
![Page 15: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/15.jpg)
cells were lysed with RIPA buffer and analyzed by western blot with anti-Parkin. β-actin
serves as loading control. Auto-ubiquitination of GFP-Parkin results in higher molecular
weight species. (C) A diagram depicting possible mechanisms of mitochondrial quality
control by the PINK1 pathway. Our data suggest that PINK1 acts through mitochondrial
CI to regulate the activity of TORC2, which then signals through Trc/NDR kinase to
direct mitochondrial quality control (MQC) through a number of distinct but not mutually
exclusive mechanisms: (a) Trc/NDR could act through the actin cytoskeleton to affect
MQC; (b) Trc could act through Parkin to regulate MQC; (c) Trc could cooperate with
Parkin to directly target certain MQC execution proteins through a phosphorylation-
dependent ubiquitination and ubiquitin proteasome system (UPS)-mediated degradation
mechanism.
Supplementary References:
Chan, N.C., Salazar, A.M., Pham, A.H., Sweredoski, M.J., Kolawa, N.J., Graham, R.L.,
Hess, S.,
and Chan, D.C. (2011). Broad activation of the ubiquitin-proteasome system by
Parkin is
critical for mitophagy. Hum Mol Genet 20: 1726-1737.
Imai, Y., Kanao, T., Sawada, T., Kobayashi, Y., Moriwaki, Y., Ishida, Y., Takeda, K.,
Ichijo, H.,
![Page 16: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/16.jpg)
Lu, B., and Takahashi, R. (2010). The Loss of PGAM5 Suppresses the
Mitochondrial Degeneration Caused by Inactivation of PINK1 in Drosophila.
PLoS Genet 6: e1001237.
Matsuda, N., Sato, S., Shiba, K., Okatsu, K., Saisho, K., Gautier, C.A., Sou, Y.S., Saiki,
S.,
Kawajiri, S., Sato, F., et al. (2010). PINK1 stabilized by mitochondrial
depolarization
recruits Parkin to damaged mitochondria and activates latent Parkin for
mitophagy. J
Cell Biol 189: 211-221.
Okatsu, K., Iemura, S., Koyano, F., Go, E., Kimura, M., Natsume, T., Tanaka, K., and
Matsuda,
N. (2012). Mitochondrial hexokinase HKI is a novel substrate of the Parkin
ubiquitin
ligase. Biochem Biophys Res Commun 428: 197-202.
Shiota, C., Woo, J.T., Lindner, J., Shelton, K.D., and Magnuson, M.A. (2006).
Multiallelic
disruption of the rictor gene in mice reveals that mTOR complex 2 is essential for
fetal
growth and viability. Dev Cell 11: 583-589.
Tamaskovic, R., Bichsel, S.J., Rogniaux, H., Stegert, M.R., and Hemmings, B.A. (2003).
Mechanism of Ca2+-mediated regulation of NDR protein kinase through
![Page 17: genesdev.cshlp.orggenesdev.cshlp.org/.../2013/01/24/27.2.157.DC1/SuppText.docx · Web viewSupplementary Materials: Supplementary materials and methods Drosophila stocks and genetics](https://reader035.fdocuments.us/reader035/viewer/2022081820/5af044547f8b9a572b8f227a/html5/thumbnails/17.jpg)
autophosphorylation and phosphorylation by an upstream kinase. J Biol Chem
278: 6710-
6718.