Upregulation of CaMKIIβ and Nogo-C mRNA in schizophrenia ...

Upregulation of CaMKIIβ and Nogo-C mRNA in schizophrenia and the prevalence of CAA insert in the 3’UTR of the Nogo gene.

by

Gabriela Novak

A thesis submitted in conformity with the requirements for the degree of Philosophy

Graduate Department of Pharmacology University of Toronto

© Copyright by Gabriela Novak 2008

ii

UPREGULATION OF CAMKIIβ AND NOGO-C MRNA IN SCHIZOPHRENIA AND THE PREVALENCE OF CAA INSERT IN THE 3’UTR OF THE NOGO GENE.

Gabriela Novak

Doctor of philosophy, 2008

Graduate Department of Pharmacology University of Toronto

ABSTRACT

Schizophrenia may result from altered gene expression leading to abnormal neurodevelopment.

In a search for genes with altered expression in schizophrenia, cDNA library subtractive hybridization

experiments using post-mortem human frontal cerebral cortices from schizophrenia individuals and

neurological controls were performed.

I found the mRNA of two neurodevelopmentally important genes, Nogo (RTN4) and

calcium/calmodulin-dependent protein kinase II beta (CaMKIIβ), to be overexpressed in post-mortem

frontal cortex tissues from patients who suffered with schizophrenia. I used the quantitative real-time

polymerase chain reaction method to determined the mRNA levels of these genes in tissues from age-

and sex-matched individuals.

Nogo is a myelin-associated protein which inhibits the outgrowth of neurites and nerve

terminals. The gene produces three splice variants, Nogo-A, B and C. I found Nogo-C mRNA to be

overexpressed by 26% in schizophrenia. I also found a 17% reduction of Nogo-B mRNA in samples

from individuals who had been diagnosed with severe depression. Furthermore, I showed that there is a

direct correlation between the expression of both Nogo-A and -C and the presence of a CAA insert in

the 3’UTR of the Nogo gene.

CaMKII is a kinase localized at the postsynaptic density. The holoenzyme is primarily composed

of the subunits α and β, encoded by two separate genes. It influences the expression of many

neuroreceptors, in particular receptors of the glutamatergic pathway. CaMKII also mediates neural

maturation during puberty, a time of onset of schizophrenia. The expression of CaMKIIα was elevated

29% in frontal cortex tissues of patients who suffered from depression. The expression of CaMKIIβ was

elevated 27% in tissues of schizophrenia patients and 36% in tissues of patients diagnosed with

iii

depression. Upregulation of CaMKIIβ was associated with the presence of the CAA insert in at least one

copy of the Nogo gene in a group containing both healthy subjects and patients with mental illness,

possibly linking the CaMKII and Nogo pathways. The values for the expression of Nogo, CaMKIIα and

CaMKIIβ were normalized to β-glucuronidase expression to minimize the effects of mRNA

degradation. These results confirm that upregulation of Nogo-C and CaMKIIβ is likely associated with

schizophrenia.

iv

ACKNOWLEDGEMENTS

During my Ph.D. studies, I was fortunate to work with a team that has, in their friendship,

assistance and support, far surpassed my expectations. I am deeply grateful to Dr. Philip Seeman for his

guidance, advice, patience and support, which made these past years an incredible learning experience

both in science and in life. It is rare to meet a person with such a profound influence on one's life. I

thank Dr. Teresa Tallerico for her excellent insight in science, for her friendship and for sharing her

invaluable life and parenting experience. The lab would not be the same without Elaine Jack, her

friendship and professional assistance, who also deserves my thanks. I am also grateful to Francoise Ko,

Ph.D., for her friendship and camaraderie. She was a source of contagious optimism, energy and

motivation. The lab would, of course, not be complete without Dr. Guan's contribution and friendly

smiles. I thank my parents and my brother for their support and love. I am grateful to my daughter

Jannine and my husband for their love, their patience, and their understanding, as well as to our

youngest daughters Elizabeth and Kira, who have come into our lives in the past few years, for enriching

our lives with their love.

v

TABLE OF CONTENTS

Page

Title page i

Abstract ii

Acknowledgements iv

Table of contents v

List of figures ix

List of tables x

List of publications xi

Abbreviations xii

INTRODUCTION 1

1. SCHIZOPHRENIA 1

1.1. Pathophysiology 2

1.2. Search for genes dysregulated in schizophrenia. 4

2. CaMKII 5

2.1. Activation of CaMKII 6

2.2. Fine tuning of CaMKII activity 8

2.3. Subunit composition and holoenzyme characteristics 9

2.4. CaMKII splicing and expression 10

2.5. Developmental expression 12

2.6. Synaptic plasticity and memory formation 14

2.7. Sensitization 16

vi

2.8. Involvement of the D2 receptors 18

3. NOGO 18

3.1. The expression of Nogo 22

3.2. Nogo-A in neurodevelopment 23

3.3. The Gi protein – PKC / IP3 pathways 24

3.4. Other pathways involved in Nogo signaling 25

4. DEPRESSION 27

RESULTS 28

Study No. 1: Schizophrenia and Nogo: elevated mRNA in cortex, and high

prevalence of a homozygous CAA insert. 28

1. Abstract for study No. 1 28

2. Introduction for study No. 1 28

3. Materials and Methods for study No. 1 30

3.1. Post-mortem tissues. 30

3.2. Blood samples. 30

3.3. PCR-select cDNA subtractive hybridization. 31

3.4. Quantitative RT-PCR. 32

3.5. Genomic DNA extraction. 33

3.6. Amplification and sequencing of the Nogo DNA template. 33

4. Results of study No. 1 33

vii

Study No. 2: Increased Expression of Calcium/calmodulin-dependent protein

kinase IIβ in Frontal Cortex in Schizophrenia and Depression. 39




3.1. Extraction of total RNA from tissues 41

3.2. First-strand cDNA synthesis 43

3.3. Real-time Quantitative Polymerase Chain Reaction 43

3.4. Determination of mRNA degradation. 44


Study No. 3: Nogo A, B and C Expression in Schizophrenia, Depression

and Bipolar Frontal Cortex, and correlation of Nogo expression with CAA/TATC

polymorphism in 3’UTR. 51




3.1. Extraction of total RNA from tissues 52

3.2. First-strand cDNA synthesis 53

3.3. Real-time Quantitative Polymerase Chain Reaction 53

3.4. Determination of mRNA degradation. 55

3.5. Detection of a CAA / TATC insert 55

3.6. Statistical methods. 55


viii

Supplemental Results

1. Effects of antipsychotics on Nogo expression. 64

2. The mRNA levels of CaMKIIα and CaMKIIβ and their correlation with

the presence of CAA insert in the 3’UTR of the Nogo gene. 65

DISCUSSION 68

Discussion for study No. 1 68



General Discussion 74

1. CaMKII plays an important role in age of onset of schizophrenia 74

2. Dysregulation of the CaMKII pathway can explain key pathophysiological

signs of schizophrenia. 75

3. Environmental factors 77

4. Depression 78

5. Nogo and its role in schizophrenia 79

6. The link between CaMKIIβ expression and the CAA insert in the Nogo gene. 81

REFERENCES 83

APPENDICES 110

ix

LIST OF FIGURES

Figure 1. Risk of developing schizophrenia. 2

Figure 2. Functional domains of CaMKIIα. 7

Figure 3. Tissue specificity of variable domain utilization. 13

Figure 4. The RTN4/Nogo gene. 20

Figure 5. Functional domains of Nogo/RTN4. 22

Figure 6. Nogo cDNA sequence. 35

Figure 7. CaMKIIα in schizophrenia and depression. 46

Figure 8. CaMKIIβ in schizophrenia and depression. 47

Figure 9. Effect of mRNA degradation 50

Figure 10. Standardization eliminates effects of degradation. 57

Figure 11. Nogo A in schizophrenia. 60

Figure 12. Nogo B in depression 61

Figure 13. Nogo C in schizophrenia. 62

Figure 14. Nogo A, B and C levels versus the presence of CAA insert 63

Figure 15. Nogo mRNA levels in antipsychotic treated rats 64

Figure 16. CaMKIIα mRNA levels and their correlation with the presence

of the CAA insert in 3’UTR of the Nogo gene. 66

Figure 17. CaMKIIβ mRNA levels and their correlation with the presence

of the CAA insert in 3’UTR of the Nogo gene. 67

x

LIST OF TABLES

Table 1. List of templates identified through DNA subtraction. 4

Table 2. Alternative names and chromosomal location of the

reticulon family members. 19

Table 3. Quantitative RT-PCR of Nogo gene expression and clinical

summaries of samples 36

Table 4. Frequency of CAA insert in schizophrenia and controls. 37

Table 5. Clinical data and findings on post-mortem frontal cerebral cortex tissues 42

Table 6. Levels of CaMKIIα and CaMKIIβ transcripts 48

Table 7. Levels and percent change 58

Table 8. Clinical summaries for postmortem brain tissues 59

Table 9. Nogo A, B, C, CaMKIIα and CaMKIIβ levels in patients

treated with antipsychotics. 65

xi

LIST OF PUBLICATIONS

1. Novak, G., Seeman, P., Tallerico, T., 2000. Schizophrenia: elevated mRNA for calcium-calmodulin-dependent protein kinase II beta in frontal cortex. Brain Res Mol Brain Res. 82, 95-100

2. Tallerico, T., Novak, G., Liu, I.S., Ulpian, C., Seeman, P., 2001. Schizophrenia: elevated mRNA for dopamine D2(Longer) receptors in frontal cortex. Brain Res Mol Brain Res. 87, 160-165.

3. Novak, G., Kim, D., Seeman, P., Tallerico, T., 2002. Schizophrenia and Nogo: elevated mRNA in cortex, and high prevalence of a homozygous CAA insert. Brain Res Mol Brain Res. 107, 183-189

4. Novak, G., Seeman, P., Tallerico, T., 2006. Increased expression of calcium/calmodulin-dependent protein kinase II beta in frontal cortex in schizophrenia and depression. Synapse. 59, 61-68.

5. Novak, G., Tallerico, T., 2006. Nogo A, B and C expression in schizophrenia, depression and bipolar frontal cortex, and correlation of Nogo expression with CAA/TATC polymorphism in 3'-UTR. Brain Res. 1120, 161-171.

6. Greenstein, R., Novak, G., Seeman, P., 2007. Amphetamine sensitization elevates CaMKIIβ mRNA. Synapse. 61, 827-834.

7. Novak, G. and Seeman, P., 2008. Hyperactive mice show elevated D2High receptors, a model for schizophrenia: calcium/calmodulin-dependent kinase II alpha knockouts (In manuscript)

xii

ABBREVIATIONS

Aβ β-amyloid peptide

AMPA alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate

APP amyloid precursor protein

ATF1 activating transcription factor 1

ATP adenosine5'-triphosphate

BACE1 β-secretase

BDNF brain-derived neurotrophic factor

bp Base pair

CaM calmodulin

CaMKII Ca2+/calmodulin-dependent protein kinase II (CAMK2)

CaMKIIN Ca2+/calmodulin-dependent protein kinase II inhibitor

cAMP cyclic AMP (adenosine monophosphate)

CaMRE CaM kinase responsive element

CBP CREB binding protein

cDNA deoxyribonucleic acid complementary to mRNA

CDK5 cyclin-dependent protein kinase 5

CNS central nervous system

CPEB cytoplasmic polyadenylation element binding protein

CRE cAMP response element, cis-regulatory elements

CREB cAMP response element-binding protein

DA dopamine

DAG diacylglycerol

DAT dopamine transporter

ddNTP dideoxynucleoside 5'-triphosphate

DNA Deoxyribonucleic acid

dNTP Deoxynucleoside-5'-triphosphate

DPFC dorsolateral prefrontal cortex

DP1 Deleted in Polyposis Locus Protein 1 (Yop1p)

D2R dopamine 2 receptor

xiii

ds double stranded

DTT Dithiothreitol

EDTA Ethylenediaminetetraacetic acid

EF-2 kinase elongation factor-2 kinase, also CaMKIII

EGFR epidermal growth factor receptor

EtOH Ethanol

GABA gamma-aminobutyric acid

GABA-R gamma-aminobutyric acid receptor

GDPs giant depolarizing potentials

GluR1 glutamate receptor subunit 1

GPDH Glyceraldehyde-3-phosphate dehydrogenase

LINGO-1 leucine rich repeat and Ig domain containing 1, NgR1 ligand

LRR leucine rich repeat

LTP Long term potentiation

LTD Long term depression

MAG myelin associated glycoprotein

MAPK Mitogen activated protein kinase

MAP2 microtubule associated protein 2

MRI magnetic resonance imaging

mRNA Messenger ribonucleic acid

NF-AT nuclear factor of activated T cells

NF-M Neurofilament - M (medium size)

NGF nerve growth factor

NgR Nogo receptor (RTN4-R)

NMDA N-methyl-D-aspartate

NMDA-R N-methyl-D-aspartate receptor

NR2A-D N-methyl-D-aspartate receptor (NMDA) subunits 2A through D

NR2B N-methyl-D-aspartate receptor (NMDA) subunit 2B

Nt Amino terminus of a protein

OMgp Oligodendrocyte-myelin glycoprotein

PCP Phencyclidine

xiv

PCR Polymerase chain reaction

PEST protein tyrosine phosphatase

PET positron emission tomography

PFC prefrontal cortex

PKA cAMP-dependent protein kinase A

PKC protein kinase C

PLC phospholipase C

PP1 Protein phosphatase-1

PP2A protein phosphatase 2A

PSD postsynaptic density

PSD-95 postsynaptic density protein of 95kD

Ras regulatory GTP hydrolase

RCE retinoblastoma control element

RHD reticulon homology domain

RNA ribonucleic acid

RNase Ribonuclease

RT reverse transcription

SAP mammalian synapse-associated-protein

SPECT Single photon emission computed tomography

SynGAP Synaptic Ras-GTPase-activating protein

TAE tris acetate buffer (4 mM) containing 2 mM EDTA (pH 8.0)

TBE Tris buffer containing 45 mM Tris-borate, 2mM EDTA (pH 8.0)

TE Buffer containing 10mM Tris (pH 8.0), 1 mM EDTA (pH 8.0)

TH tyrosine hydroxylase

TROY TNFRSF19, a transmembrane receptor, member of the tumor necrosis

factor receptor (TNFR) superfamily

uORF upstream of open reading frame

UV ultraviolet

VTA ventral tegmental area

5-HT 5-hydroxytryptamine, serotonin

1

INTRODUCTION

1. SCHIZOPHRENIA

Schizophrenia is a devastating illness, affecting approximately 1% of the population. At the

present time, there is no consensus as to the causes of the disease, although a number of risk factors have

been identified. I have identified two genes that are upregulated in human schizophrenia frontal cortex,

Ca2+/calmodulin-dependent protein kinase II (CaMKII) and a reticulon Nogo/RTN4. My PhD work is an

attempt to explain the contribution of the dysregulation of these genes to the etiology of schizophrenia.

Schizophrenia has a strong genetic component (Figure 1). This follows from the observation that

disease concordance is 50% for monozygotic twins, while the prevalence of the disease in the general

population is only 1%. (Cardno et al., 1999). In other words, approximately 50% of individuals carrying

schizophrenia genes will develop the disease. One may argue that, in twins, the shared in utero

environment plays a determining role in predisposition to schizophrenia but this is refuted by the fact

that dizygotic twins, who share 50% of their genetic material and enjoy the same in utero environment,

only show 10-14% concordance. Furthermore, offspring of both the affected and unaffected

monozygotic twin carry equal risk of developing schizophrenia (17%) (Gottesman and Bertelsen, 1989;

Kringlen and Cramer, 1989). Compared to other complex genetic disorders, schizophrenia has one of the

highest heritabilities. Its heritability (85%) is similar to that of type I diabetes (72%–88%) and greater

than that of breast cancer (30%), coronary heart disease in males (57%), and type II diabetes (26%)

(Kirov et al., 2005).

The analysis of the inheritance pattern of schizophrenia in families suggests the involvement of

several genes, acting in combination, each lending a small contribution to the disease (Cardno and

Gottesman, 2000; Gogos and Gerber, 2006; Risch, 1990). Many genes have been implicated so far,

namely alterations in the levels of parvalbumin, reelin and BDNF (Knable et al., 2004). Other genes

linked to schizophrenia include apolipoprotein L1 (APLOL1) and APOL2 (Mimmack et al., 2002),

DISC1 (Ekelund et al., 2004), RTN4R (Sinibaldi et al., 2004), RGS4 (Mirnics et al., 2001b) and many

others.

Studies also show schizophrenia to be genetically related to other psychoses, such as bipolar

disorder (Shih et al., 2004) and depression (Siris, 2001), but sharing only some of the risk factors

(Cardno and Gottesman, 2000).

2

1.1. Pathophysiology

The first evidence of gross neuropathology in schizophrenia was the demonstration of enlarged

lateral ventricles in approximately one third of those diagnosed with schizophrenia (Johnstone, 1989).

MRI studies subsequently showed enlarged lateral and third ventricle in twins discordant for

schizophrenia and smaller anterior hippocampi in the affected twins (Suddath et al., 1990b; Zipursky et

al., 1992). Further studies have implicated the prefrontal cortex (PFC) as a major locus of dysfunction in

Figure 1. Risk of developing schizophrenia. Risk of developing schizophrenia, depending on a relationship to a family member with schizophrenia. (Gottesman, 1991; Owen, 2005).

schizophrenia (Andreasen et al., 1997; Weinberger et al., 1986). PFC is a brain region critically

involved in the control of cognition, reasoning, perception, and emotion (Goldman-Rakic, 1995),

cognitive tasks impaired by schizophrenia (Goda and Davis, 2003). At the cellular level, a number of

consistent structural abnormalities of the PFC have been reported. These include the maldistribution of

interstitial neurons (Akbarian et al., 1996). Other structural and metabolic abnormalities have also been

reported (Benes, 2000; Moore et al., 1999; Weinberger and Berman, 1996). There are consistent

decreases in nonpyramidal, largely GABAergic (inhibitory), cells (Benes, 2000), alterations in

50%

40%

30%

20%

10%

twins twins

50% 50% 50% 25%

proportion of genes shared

Uncles/aunts Population

% incid

ence

100%

Identical Fraternal Siblings Parents

3

glutamatergic synaptic populations in dorsolateral prefrontal cortex (DPFC) (Lewis, 2000; Lewis and

Gonzalez-Burgos, 2000; Mirnics et al., 2000) and changes in cortical dopaminergic innervation (Akil et

al., 1999).

The strongest evidence for the implication of the dopaminergic system, in particular the

dopamine receptor 2 (D2R), in schizophrenia arises from the observation that all clinically effective

anti-psychotic drugs act as antagonists for D2R and that their abilities to block D2R correlate with their

antipsychotic efficacy (Creese et al., 1976; Seeman et al., 1976; Seeman, 1987; Snyder, 1976). This has

been confirmed in vivo by positron emission tomography (PET) and single photon emission computed

tomography (SPECT), which has shown a strong correlation between D2R occupancy and the clinical

efficacy of antipsychotic drugs (Miyamoto et al., 2005; Remington and Kapur, 1999). This is true for

both the older drugs and for the newer “atypical” antipsychotics (Seeman, 2002). The dopamine theory

of schizophrenia is further supported by the fact that indirect DA agonists, such as amphetamine, elicit

psychotomimetic effects (Breier et al., 1997; Castaneda et al., 1988). Moreover, one of the only clear

pathophysiological signs associated with schizophrenia is amphetamine-induced increase in synaptic DA

in the striatum (compared to controls), (Breier et al., 1997; Breier et al., 1998; Laruelle et al., 1996;

Laruelle et al., 1997), and this is associated with the emergence or with a worsening of psychotic

symptoms clinically (Laruelle et al., 1996; Moore et al., 1999). The observation that amphetamine

sensitization mimics schizophrenia in healthy people and that schizophrenia patients have abnormally

high DA release in response to amphetamine was used in the development of an amphetamine

sensitization animal model of schizophrenia. Chronic administration of amphetamine followed by a

withdrawal period produces a state of sensitization in animals that has characteristics similar to those of

schizophrenia, including enhanced dopamine release and schizophrenia-like cognitive deficits (Adams

and Moghaddam, 1998; Jentsch et al., 1997; Jentsch and Roth, 1999; Moghaddam et al., 1997).

Evidence also supports the involvement of glutamatergic signaling in schizophrenia because

repeated exposure to phencyclidine (PCP), an N-methyl-D-aspartate receptor (NMDA-R) antagonist,

produces a variety of behaviours resembling schizophrenia, including cognitive deficits, loss of short-

term memory and negative symptoms (apathy, avolition, social withdrawal) (Allen and Young, 1978;

Krystal et al., 1994; Snyder, 1980; Tamminga, 1998).

4

1.2. Search for genes dysregulated in schizophrenia

In order to try to identify genes dysregulated in schizophrenia, we performed a subtraction

between three control and three schizophrenia frontal cortex samples (see p. 31 and Appendix). This

technique enabled us to compare two populations of mRNA of genes that are expressed in one

population but not the other. This experiment yielded fourteen candidate sequences (Table 1).

template sequence match

(current name) Size (bp) Quantitation results GenBank accession #

Nogo A 1450 upregulated AJ251383

16s rRNA 774 no difference X93334

Band 11 (TP53INP2) 645 n/a NM_021202

BAC 367D17 (genomic) 539 n/a AC003971

MBP 515 no difference M13577

CAGH3 (SERPINE2) 390 small change NM_006216

mito. ATPase 6 410 n/a X93334

HEV (SPARCL1) 360 n/a NM_004684

calpactin/annexin 338 no difference M81457

mito. Cyto. Ox. II 273 no difference X93334

CaMKIIβ 192 upregulated HSU50358

ZNF 207 229 upregulated AF046001

mito. NADH 4L 250 n/a X93334

NF-M (NEFM) 173 no difference Y00067

Table 1. List of templates identified through DNA subtraction. List of fourteen mRNA templates identified through subtraction between three control and three schizophrenia frontal cortex samples. Our preliminary tests determined three templates to be upregulated, six showed no significant difference and five were not tested. TP53INP2 is a tumor protein p53 inducible nuclear protein 2. SERPINE2 is serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2. SPARCL1 is SPARC-like 1 (mast9, hevin).

5

Of these mRNA species, the cDNA levels for 16s rRNA, MBP (myelin basic protein), calpactin,

mitochondrial cytochrome oxidase II, CAGH3 and NF-M (Neurofilament-M) showed no difference

between the schizophrenia and control group and were excluded from further analysis. Three templates

did show a consistent difference; CaMKIIβ, Nogo (RTN4) and ZNF207. Two genes, CaMKIIβ, a kinase

involved in neurodevelopment and neural functioning, and Nogo, a neural growth inhibitor, were

selected as the most appropriate candidates for further analysis.

2. CAMKII

CaMKII is part of a family of calmodulin-dependent protein kinases (CaM kinases) These

kinases sense calcium signals through binding to calmodulin complexed to four Ca2+ ions. CaMKII is a

multifunctional serine/threonine kinase found in essentially all neuronal compartments, composing up to

1% of total protein in the forebrain and 2% of total protein in the hippocampus (Erondu and Kennedy,

1985). (Reviewed by (Hudmon and Schulman, 2002b)). Transient rises in intracellular Ca2+

concentration contain information in their amplitude, duration and frequency and CaMKII is a molecular

decoder for such oscillation frequencies (Colbran and Brown, 2004; De Koninck and Schulman, 1998;

Sheng and Lee, 2000). Once activated, it forms a molecular memory, which is an integral part of its

ability to interpret these signals (Colbran, 2004; Soderling, 2000). Sustained activation of CaMKII

localized at the postsynaptic density (PSD) results in phosphorylation of numerous synaptic substrates

including ion channels, other signaling molecules and scaffolding proteins (Soderling and Derkach,

2000). Within minutes, this leads to modulation of synaptic transmission (Soderling, 2000), secretion

and cell shape (Braun and Schulman, 1995; Hardingham and Bading, 1999), as well as formation of new

PSDs and remodeling of old PSDs (Soderling, 2000), modulating virtually all neuronal functions

(Colbran, 2004; Colbran and Brown, 2004; Jourdain et al., 2003). Together with other PSD molecules,

CaMKII is a key player in determining the effects of synaptic glutamate release (Sharma et al., 2006).

CaMKII is encoded by four genes, producing four distinct subunits, α, β, γ and δ. Each CaMKII

holoenzyme is composed of 8 - 14 of these subunits (Rosenberg et al., 2006). The CaMKIIα (CaMK2A)

gene is located at 5q33.1 and produces three splice variants, α, αB (Li et al., 2001a) and αKAP (Bayer et

al., 1998; O'Leary et al., 2006b). The CaMKIIα subunit is the most highly expressed CaMKII isoform in

the brain. The CaMKIIβ (CaMK2B) gene is located at 7p14.3-p14.1. It is one of the most important

CaMKII isozymes in the brain and it produces at least eight known splice variants, CaMK2B-1 (β),

CaMK2B-2, CaMK2B-3 (β4), CaMK2B-4 (βe), CaMK2B-5 (βe’), CaMK2B-6 (β6), CaMK2B-7 (β2,

6

βM) and CaMK2B-8 (β7) (Li et al., 2001a; Wang et al., 2000). The full length CaMKIIβ splice variant

(β) is the most prevalent splice variant in the brain (Tombes et al., 2003). The evolutionary conservation

of the CaMKII gene emphasizes its importance. It is present in species that have existed for 600 million

years, such as Caenorhabditis elegans, which has one gene for CaMKII with several splice variants

(Reiner et al., 1999) and Drosophila melanogaster, which also carries only one gene, as compared to

four genes found in mammals (Griffith and Greenspan, 1993). Remarkably, the catalytic and calmodulin

binding domains of Drosophila CaMKII are 85% identical to that of the rat kinase polypeptides

(Yamauchi, 2005). CaMKIIδ is the most ancestral form of the kinase, while CaMKIIα is an

evolutionarily novel form, unique to only birds and mammals (Tombes et al., 2003).

The CaMKII genes are transcribed from a tissue specific promoter, which is under strong

negative control (Kraner et al., 1992; Mori et al., 1992) via elements in the 5’ upstream region, tightly

regulating their neuron-specific expression at the mRNA level (Donai et al., 2001; Mima et al., 2001;

Mima et al., 2002). Since the primary control of CaMKIIα and CaMKIIβ expression is at the level of

transcription, it is important to analyze the mRNA levels of these genes.

2.1. Activation of CaMKII

Cells typically maintain an intracellular Ca2+ level of 10-7M, which is 104 times lower than

the level outside the cells. In response to external stimuli, the intracellular Ca2+ level rapidly increases up

to 10-4M as a result of Ca2+ influx derived from extracellular and intracellular sources. The predominant

intracellular Ca2+ binding protein is calmodulin (CaM), which binds four Ca2+ ions (Yamauchi, 2005)

and is then in turn bound by CaMKII. Each CaMKII isozyme is composed of highly conserved N-

terminal catalytic domain (~280aa) followed by a regulatory domain (~40aa), and a C-terminal

variable/association domain (150-220aa) (Colbran, 2004). The regulatory domains of CaMKIIα and

CaMKIIβ are about 90% identical (Colbran and Brown, 2004), reflecting the similarity in function of

these subunits. (Figure 2). In its inactive state, CaMKII forms tightly packed autoinhibited assemblies

(Rosenberg et al., 2005). The autoinhibitory subdomain forms a number of interactions through its

pseudosubstrate region with the catalytic domain (Brickey et al., 1994; Yang and Schulman, 1999).

These interactions block the ATP, substrate and CaM binding sites (Mukherji and Soderling, 1995). In

the inactive state, Thr286 (Thr287 in CaMKIIβ), binds to a hydrophobic pocket (T site, Val208 and

Trp237) close to the substrate-binding site (S site) (Giese et al., 1998), orienting the pseudosubstrate

region for its interaction with the catalytic site (Merrill et al., 2005). In this state, the catalytic domain

7

becomes blocked by a coiled-coil strut formed by the calmodulin-responsive regulatory segments

(Rosenberg et al., 2005).

Figure 2. Functional domains of CaMKIIα . Numbers denote the amino acid number of CaMKIIα protein sequence. P = phosphorylation site. (Colbran, 2004; Hudmon and Schulman, 2002a; Merrill et al., 2005; Rosenberg et al., 2006)

Binding of Ca2+/CaM to neighbouring subunits disrupts the autoinhibitory interactions and

initiates intersubunit phosphorylation (Giese et al., 1998; Griffith, 2004; Meador et al., 1993; O'Leary et

al., 2006a; Smith et al., 1992; Thiel et al., 1988; Yang and Schulman, 1999). Ca2+/CaM displaces

Thr286, which is immediately upstream of the pseudosubstrate region, and allows neighbouring subunits

to phosphorylate each other on Thr286, converting the holoenzyme into cluster of loosely tethered and

independent kinase domains. This intersubunit autophosphorylation maintains the kinase in autonomous

active state even following removal of Ca2+/CaM when intracellular Ca2+ concentrations drop to basal

levels, forming a molecular memory of synapse activity (Colbran and Brown, 2004; Hudmon and

Schulman, 2002b; Merrill et al., 2005). CaMKII is not only regulated through the interaction of its

domains and activation by Thr286 phosphorylation, but also by other regulatory autophosphorylation

sites (T253, T305, T306 and S314), which provide further fine tuning of its response (Colbran, 2004)

(Migues et al., 2006).

8

2.2. Fine tuning of CaMKII activity

A series of mechanisms renders the kinase sensitive to the duration, magnitude and frequency of

incoming calcium signals (De Koninck and Schulman, 1998). Upon activation, autophosphorylation

induces a local conformational change that allows formation of additional, stabilizing interactions

between Ca2+/CaM and CaMKII, resulting in a 1000 fold increase in CaMKII affinity for Ca2+/CaM and

in Ca2+/CaM “trapping” (Braun and Schulman, 1995; Griffith, 2004; Rich and Schulman, 1998; Risch,

1990; Saitoh et al., 1987; Waxham et al., 1998). Different degrees of autophosphorylation of the 12 (or

14) subunits in the holoenzyme enables CaMKII to translate Ca2+ spike frequency into finely graded

kinase activity (De Koninck and Schulman, 1998).

The activation of CaMKII increases the targeting and binding of CaMKII to its site of action, the

postsynaptic density (PSD) (Shen and Meyer, 1999; Shen et al., 2000; Strack et al., 1997; Yoshimura

and Yamauchi, 1997). Furthermore, in response to depolarization, CaMKII can undergo

autophosphorylation at Thr253, which enhances its binding to PSDs (Migues et al., 2006). Other

interactions also prolong the autonomous activity of CaMKII, such as binding to the NR2B subunit of

the NMDA-R. This not only increases the binding affinity of Ca2+/CaM to CaMKII, but also allows

CaMKII to retain its autonomous activity due to the interaction with NR2B rather than to the bound

Ca2+/CaM. This interaction suppresses inhibitory autophosphorylation at Thr305/306, which would

promote dissociation of CaMKII from the PSD (Bayer et al., 2001). At the PSD CaMKII interacts with

more than 30 protein targets (Fink and Meyer, 2002; Yoshimura et al., 2000; Yoshimura et al., 2002).

Dephosphorylation of Thr286 by protein phosphatase 1 (PP1), as well as autophosphorylation of

the inhibitory sites on Thr305, Thr306 and Ser314 in response to Ca2+/CaM dissociation, is critical for

terminating the PSD-localized state of CaMKII (Fink and Meyer, 2002; Shen and Meyer, 1999). This

prevents rebinding of Ca2+/CaM and produces inhibited kinase that, paradoxically, requires phosphatase

to regain its ability to be stimulated by Ca2+/CaM (Colbran and Soderling, 1990; Griffith, 2004;

Mukherji et al., 1994; Patton et al., 1990). PP1, in turn, is inhibited by inhibitor-1 and phosphorylated by

cAMP-dependent protein kinase A (PKA) (Blitzer et al., 1998; Brown et al., 2000). Soluble CaMKII,

such as CaMKIIα homomers, is dephosphorylated by cytosolic protein phosphatase 2A (PP2A) (Fink

and Meyer, 2002; Lisman and Zhabotinsky, 2001; Strack et al., 1997; Yoshimura et al., 1999). CaMKII

is also inactivated by CaMKII inhibitors α and β (CaMKIINα, β).

9

2.3. Subunit composition and holoenzyme characteristics.

The subunit composition of CaMKII holoenzymes is very significant. It is controlled by the

relative isoform expression levels (Hudmon and Schulman, 2002a, b). Because intersubunit

phosphorylation at Thr286/287 involves two neighbouring subunits, each acting as a substrate and a

kinase, their kinetic properties become important variables in the reaction. The frequency dependence

for activation of homomers of α or β isoforms is markedly different (De Koninck and Schulman, 1998).

Hence the ratio of α:β and the type of splice variants of α and β present in a heteromer modulates its

kinetic properties and requirements for autophosphorylation. At 20 nM calmodulin, for example, twice

as many subunits are autophosphorylated in heteromeric kinase with an α:β ratio of 2:1 than in a

homomer (Brocke et al., 1999). The subunits show significant differences in their CaM binding affinity

(γ> β > δ > α), CaM dependence for autophosphorylation ( β> γ> δ> α), and substrate phosphorylation

(Gaertner et al., 2004). The type of a neighbour in a holoenzyme modulates the properties of individual

subunits themselves (Brocke et al., 1999). In the forebrain, the calmodulin dependence of β subunit

autophosphorylation is shifted toward the lower sensitivity of the α subunit. This is likely the result of

high α subunit content in the holoenzyme since most of the neighbours of the β subunits, which

determine the conditions of their phosphorylation in these heteromers, are the low affinity α subunits

(half-maximal autophosphorylation of α is achieved at 130 nM calmodulin, while that for β occurs at 15

nM calmodulin) (Brocke et al., 1999). Hence CaMKIIβ has better sensitivity for low level signals

(Thiagarajan et al., 2002) and an increase in β will result in holoenzyme with higher affinity for

Ca2+/CaM and responsiveness to weaker Ca2+ signals.

The ratio of α and β is regulated by neuronal activity, tuning CaMKII to changes in Ca2+ signal

levels (Thiagarajan et al., 2002). CaMKIIα preferentially responds to NMDA-R activity and CaMKIIβ

to the activation of the AMPA-R. CaMKIIα levels increase in response to the activation of NMDA-Rs,

whereas CaMKIIβ levels increase in response to AMPA-R blockade, with CaMKIIβ levels being

insensitive to NMDA-R activity (Thiagarajan et al., 2002). Additionally, CaMKIIβ regulates the levels

of CaMKIIα, but not vice versa. Increase in β results in decrease in α, but α levels have no effect on β

(Thiagarajan et al., 2002). In turn, the changing ratio of α:β significantly influences synaptic

transmission, an increase in β lowers synaptic charge and increases signaling frequency (Thiagarajan et

al., 2002).

10

2.4. CaMKII splicing and expression.

The splicing of each CaMKII isozyme strongly affects the kinetic properties of its activation,

deactivation, substrate specificity and CaMKII localization (Wang et al., 2000). CaMKII splice variant

expression is strongly tissue type and developmentally controlled and undergoes a transition in

expression from undifferentiated to differentiated tissues (Tombes et al., 2003). (Figure 3.) These

concerted influences are responsible for the unique ability of CaMKII to interpret frequency and

amplitude of Ca2+ signals, as well as the signaling history of a synapse, and convert these to cell type-

specific response (De Koninck and Schulman, 1998; Dosemeci and Albers, 1996; Hanson et al., 1994).

With at least eight splice variants, CaMKIIβ has a much greater spectrum of response types than

CaMKIIα. The pattern of alternative splicing of CaMKIIβ is under tight control and depends on tissue

type, developmental status, as well as physiological and pathological conditions (Srinivasan et al., 1994;

Wang et al., 2000). It differs even among individual hippocampal neurons (Bayer et al., 2002) with most

neurons expressing specifically only one type of splice variant (Brocke et al., 1999). In general

CaMKIIβ has much the same catalytic capacity as CaMKIIα, but it also has the unique ability to bind F-

actin, where it docks the CaMKIIα/β heterooligomers. It can, therefore, partially rescue CaMKIIα

knockouts. Hence CaMKIIβ, but not CaMKIIα, knockouts are embryonic lethal (Karls et al., 1992).

CaMKIIα can partially escape co-assembly with CaMKIIβ through local translation of its

mRNA within dendritic spines (Burgin et al., 1990; Mayford et al., 1996b). Depolarization leads to

movement of CaMKIIα mRNA granules into the dendrite (Rook et al., 2000) and to an activity-

dependent translation of its mRNA (Ouyang et al., 1999) initiated by phosphorylation of cytoplasmic

polyadenylation element binding protein (CPEB) by CaMKII (Colbran and Brown, 2004; Huang et al.,

2002; Huang et al., 2003; Wu et al., 1998). In dendritic spines CaMKIIα binds to actin filaments and

governs both the formation of dendritic spines during development and their structural plasticity in

mature synapses (Fischer et al., 2000; Matus et al., 1982; Shi and Ethell, 2006). Dendritic spines, which

appear as small protrusions from dendrites, harbor the great majority of excitatory synapses and contain

both AMPA and NMDA receptors (Harris, 1999; Hering and Sheng, 2001; Sheng, 2001). In

hippocampal neurons, such local translation provides means of rapidly altering the protein composition

in the spines in a highly spatially restricted manner (Schuman et al., 2006; Steward and Levy, 1982).

The morphogenic ability of CaMKIIβ to induce dendritic arborization and increase synaptic

density is thought to be mediated by its specific binding to F-actin (Fink et al., 2003; O'Leary et al.,

2006a; Shen et al., 1998). CaMKIIβ assembles into large complexes with F-actin, including bundles of

11

parallel actin filaments and associates with the actin cytoskeleton. CaMKIIβ crosslinks parallel F-actin

filaments into bundles, dissociates upon stimulation and likely plays a role in Ca2+-regulated actin

dynamics (O'Leary et al., 2006a). Overexpression of CaMKIIβ leads to lower actin turnover and

inhibition of growth (Okamoto et al., 2007). CaMKII phosphorylates the microtubule-associated protein

2 (MAP2) and regulates microtubule-microfilament interaction (Hely et al., 2001), inducing microtubule

disassembly, stabilizing the dendritic arbor (Fink and Meyer, 2002; Wu and Cline, 1998; Yamauchi and

Fujisawa, 1983).

Upon activation CaMKIIα holoenzymes quickly translocate to the PSD of excitatory synapses,

whereas CaMKIIα/β holoenzymes are bound to F-actin through CaMKIIβ and dissociate at a much

slower rate before translocation to the PSD (Fink and Meyer, 2002; Shen and Meyer, 1999). The

translocation time of CaMKIIα/β holoenzymes to the postsynaptic density, a key variable in neuronal

function, is determined by the tightly controlled ratio of CaMKIIα to CaMKIIβ isoforms (Shen and

Meyer, 1999; Srinivasan et al., 1994). The translocation time of CaMKIIα/β hetrooligomers differs

significantly depending on their α:β composition, hence alteration in the α:β ratio results in serious

consequences, as seen in heterozygous CaMKIIα knockouts.

The PSD is a complex macromolecular protein network containing many known CaMKII

substrates and downstream signaling partners. PSD95, AMPA-Rs, NMDA-Rs, synGAP and Ras (Hering

et al., 2003; Suzuki et al., 2001), densin-180 (Strack et al., 2000; Walikonis et al., 2001), α-actinin

(Dhavan et al., 2002; Walikonis et al., 2001) and cyclin-dependent protein kinase 5 (CDK5) (Dhavan et

al., 2002). CaMKII plays a large role in clustering of synaptic proteins via protein-protein interactions in

dendritic spines (Robison et al., 2005), acting not only as a kinase, but also as a structural element of the

PSD. In turn, both NR2B and densin-180 interact with other PSD proteins (Ohtakara et al., 2002; Sheng,

2001) This allows the CaMKII complex to form and stabilize the synaptic localization of CaMKII-

multiprotein synaptic signaling complex (Robison et al., 2005). Once at the postsynaptic sites, CaMKII

also controls the clustering and synaptic targeting of the NMDA receptor subunit (Gardoni et al., 2003).

Phosphorylation of SAP97 by CaMKII drives SAP97 to the PSD and by promoting postsynaptic

clustering of SAP97 and GluR1, and preventing SAP97 binding to NR2A (Gardoni et al., 2003; Mauceri

et al., 2004), CaMKII provides a mechanism for the regulation of synaptic targeting of AMPA and

NMDA receptors (Gardoni et al., 2003). In addition, CaMKII-dependent phosphorylation of PSD-95

regulates the interaction of PSD-95 with the NR2A and NR2B subunits of the NMDA receptor (Gardoni

et al., 2006).

12

CaMKII is also targeted to PSD by a non-NMDA mechanism. For example, activation of PKC

interferes with CaMKII-NMDA-R interaction, dispersing the synaptic NMDA-Rs, but driving CaMKII

to synapses (Fong et al., 2002). Targeting CaMKII to active synapses ensures potentiation of their

postsynaptic response (Merrill et al., 2005). CaMKII clustering at activated synapses results in

phosphorylation of CaMKII targets (Barria et al., 1997). It increase in the ion channel activity of the

AMPA-Rs (Derkach et al., 1999) and mediates postsynaptic AMPA-R accumulation (Derkach et al.,

1999; Rongo and Kaplan, 1999), thereby contributing to LTP. Transgenic mice in which targeting of

CaMKII has been disrupted display behavioral defects (Elgersma et al., 2002; Miller et al., 2002). In

hippocampus, LTP involves not only postsynaptic receptor insertion, but also presynaptic protein

kinases, including presynaptic mechanisms of potentiation through CaMKII (Lu and Hawkins, 2006;

Zhai et al., 2001). Postsynaptic activation of CaMKII induces structural remodeling of presynaptic

inputs and the retention of active presynaptic partners (Pratt et al., 2003).

Presynaptic CaMKII binds to and phosphorylates synapsin I (Benfenati et al., 1992) and syntaxin

1A, promoting synaptic vesicle exocytosis and neurotransmitter release (Ohyama et al., 2002) (Nomura

et al., 2003; Ohyama et al., 2002). Phosphorylation of CaMKII plays an important role in the conversion

of preexisting but silent presynaptic terminals to functional ones during glutamate-induced plasticity

(Antonova et al., 2001; Colbran, 2004; Du et al., 2004).

2.5. Developmental expression

CaMKII is a major determinant of neuronal growth and synaptogenesis (Zou and Cline, 1996).

Given that its splice variants have very specific characteristics and that holoenzymes with even a small

variation in the ratio of the α and β subunits will respond differently to Ca2+ signals, expression of

CaMKII must be under strict control. CaMKII controls important neuronal developmental milestones

(Zou and Cline, 1996) (Hanson and Schulman, 1992). In early development, it is a master regulator

whose activity drives and possibly coordinates several events of egg activation, including recruitment of

maternal mRNA (Ducibella et al., 2006). Later on in development it is essential for neuronal growth,

branching, synaptic density and maturation (Borodinsky et al., 2002; Rongo and Kaplan, 1999; Wu and

Cline, 1998).

Full length CaMKIIβ is found throughout the adult brain, but is particularly enriched in the

cerebellum (McGuinness et al., 1985; Miller and Kennedy, 1985; Takeuchi et al., 2002). Other splice

variants, such as β3 and βM, are expressed in the rodent endocrine and muscle tissue, with β’ (β1), βe

13

(β4) and β2 found in the adrenal, pituitary and in pancreatic β cells (Bayer et al., 1998; Bayer et al.,

2002; Breen and Ashcroft, 1997; Gloyn and Ashcroft, 2001; Rochlitz et al., 2000; Urquidi and Ashcroft,

1995). A number of isozymes, in particular β’, βe, and βe’ are embryonic (Brocke et al., 1995;

Urushihara and Yamauchi, 2001). During embryonic development the CaMKIIβe and CaMKIIβe’

replace the function of both CaMKIIβ and CaMKIIα, which have a later onset of expression. The

embryonic forms show reduced Ca2+/CaM affinity (Brickey et al., 1994; Brocke et al., 1999) and are

cytoplasmic (O'Leary et al., 2006a), resembling more closely the characteristics of CaMKIIα. In order to

mediate the necessary morphological changes of early postnatal brain development, CaMKIIβe

predominates because it promotes motility of filopodia and neuritic branching, leading to enhanced

arborization, as shown in developing hippocampal neurons.

I II III IV V VI VII X

α Brain, enriched in FC

αB Striatum, midbrain

αKAP Cardiac, skeletal muscle

β Brain, enriched in cerebellum

β', β1 Brain, endocrine tissue

βe, β4 Embryonic, endocrine tissue

β'e Embryonic

βM X3 Endocrine, muscle membrane

β3 X2 Pancreatic β-cell

β2 Endocrine

Figure 3. Tissue specificity of variable domain utilization. (Tombes et al., 2003). The four genes of CaMKII are highly homologous and draw upon a similar pool of variable domains, but not all domains are present in all CaMKII genes. CaMKIIα and CaMKIIβ utilize different variable domains to generate an array of splice variants with specific tissue expression patterns.

CaMKIIα is expressed later in development because of its ability to stabilize the already developed

dendritic arbor structures (Colbran and Brown, 2004; Fink et al., 2003; Wu and Cline, 1998). The ratio

of α:β in the forebrain changes during maturation, from 1:1 in a 10 day old mice to 3:1 in the adult.

14

(McGuinness et al., 1985; Miller and Kennedy, 1985). Once CaMKIIα is expressed after birth, its levels

increase, correlating with the start of dendritic maturation and increased synapse formation. Its

expression seems to be limited to cells that are no longer dividing (Bayer et al., 1999; Menegon et al.,

2002). CaMKII controls one of the main milestones of neuronal maturation, the switch from LTD to

LTP. This developmental loss of capacity for LTD depends on age-dependent decrease in Ca2+-

independent activity of CaMKII. Furthermore, CaMKII plays an important role in the development of

central glutamatergic synapses, as well as in determining their density (Rongo and Kaplan, 1999; Wu

and Cline, 1998). Transgenic animals, in which the CaMKII kinase is 20 to 30x more active in the

absence of Ca2+ than the wild type enzyme, do not lose the capacity for LTD in adulthood (Dudek and

Bear, 1992; Mayford et al., 1995).

Mice deficient in CaMKIIα show neurodevelopmental defects severely affecting about 50% of

the animals (Gordon et al., 1996), these include disturbances in behaviour and cognition (Chen et al.,

1994; Mayford et al., 1996a; Silva et al., 1992a; Silva et al., 1992b). Recently, phosphorylation of

Thr305 on CaMKII was demonstrated to be increased in Angelman mental retardation syndrome

(Weeber et al., 2003). This phosphorylation results in the inactivation of the kinase and in the reduction

of CaMKII presence at the PSD (Albrecht et al., 1997; Weeber et al., 2003).

2.6. Synaptic plasticity and memory formation

Changes in synaptic strength can occur by presynaptic mechanisms such as neurotransmitter

release or postsynaptically, through LTP and LTD. The initiation of postsynaptic LTP or LTD requires

calcium entry through the NMDA-Rs which activate CaMKII (Choi et al., 2000; Renger et al., 2001;

Zakharenko et al., 2001). CaMKII triggers the synaptic insertion of AMPA-Rs in the case of LTP

(Hayashi et al., 2000), or the removal of AMPA-Rs in the case of LTD (Beattie et al., 2000). For a

review see (Malinow and Malenka, 2002).

NMDA-Rs form tetrameric complexes assembled from two obligatory NR1 and two modulatory

NR2 subunits. The different NR2 subunits (NR2A-NR2D) possess distinct gating and pharmacological

properties. In adult hippocampus and neocortex, NR2A and NR2B are the predominant NR2 subunits

(Cull-Candy et al., 2001). CaMKII is part of the NMDA-R-containing macromolecular complex. It

binds to the NR2A and NR2B subunits of the NMDA-R (Leonard et al., 1999; Strack and Colbran,

1998), albeit with a lower affinity for NR2A than NR2B (Leonard et al., 1999). CaMKII is also known

to bind the NR1 (Leonard et al., 1999; Omkumar et al., 1996). Binding to NR2B in turn increases the

15

binding affinity of CaMKII for Ca2+/CaM, which prolongs the autonomous activity of CaMKII and it

also suppresses inhibitory autophosphorylation, further lengthening its presence at the PSD (Ehlers et

al., 1996). In turn, CaMKII Phosphorylates NR2B (Strack et al., 2000) and NR2A, positively regulating

NMDA-R currents (Liao et al., 2001; Lieberman and Mody, 1994; Rostas et al., 1996; Wang and Salter,

1994), increasing the NMDA-R conductance and modulating synaptic strength (Gardoni et al., 1999;

Leonard et al., 1999; Omkumar et al., 1996; Shen and Meyer, 1999).

During puberty NMDA receptors mature, the NR2B subunits are replaced with NR2A, for which

CaMKII has lower affinity, decreasing the formation of LTP (Barria and Malinow, 2005) This NMDA

receptor maturation process coincides with the development of dopaminergic innervation in the

prefrontal cortex (Goldman-Rakic, 1996) when key corticolimbic afferent systems projecting into the

hippocampal formation are actively maturing (Benes, 2000). It also coincides with the age of onset for

schizophrenia (Keshavan, 1999). Activation of CaMKII is essential for normal NMDA-R mediated

formation of LTP in the hippocampus and its associated functions such as spatial learning, memory

(Fink and Meyer, 2002; Lisman et al., 2002) and plasticity of the central nervous system (Fang et al.,

2002; Garry et al., 2003; Hardingham et al., 2003). Reviewed by (Colbran and Brown, 2004). The

involvement of CaMKII is critical, since synaptic plasticity is blocked by both NMDA antagonists

(Engert and Bonhoeffer, 1999) and by CaMKII inhibitors (Soderling, 2000). Depending on a

developmental stage and type of signal, activation of NMDA receptors and subsequent activation of

CaMKII can cause rapid elongation of filopodia (Maletic-Savatic et al., 1999), formation of novel

dendritic spines (Engert and Bonhoeffer, 1999), or shrinkage of existing ones, resulting in neuron

pruning (Segal et al., 2000).

During neurodevelopment, newly formed synapses are silent unless sufficient depolarization by

NMDA-Rs is provided by coincident activity that could activate postsynaptic CaMKII, resulting in the

appearance of AMPA responses (Ben-Ari et al., 1997; Fukunaga and Miyamoto, 1999; Soderling, 1993;

Wu et al., 1996). This response is mediated by CaMKII phosphorylation of AMPA receptors and

resulting membrane insertion of previously silent AMPA receptors (Ben-Ari et al., 1997; Swope et al.,

1999; Wu et al., 1996). Although NMDA receptors are essential in LTP initiation, expression of LTP is

mediated primarily by AMPA receptors (Soderling, 2000; Soderling and Derkach, 2000). (For review

see (Malinow and Malenka, 2002)). CaMKII phosphorylates GluR1 (Barria et al., 1997; Derkach et al.,

1999; Fukunaga et al., 1996; Roche et al., 1996; Vinade and Dosemeci, 2000; Yakel et al., 1995) and

GluR4 subunits of AMPA receptors (Carvalho et al., 1999; Vinade and Dosemeci, 2000). By

16

phosphorylating the AMPA-Rs, CaMKII mediates plasticity at glutamatergic synapses by increasing

single-channel conductance of existing functional AMPA-Rs, stabilizing their higher conductance state

(Vinade and Dosemeci, 2000) and recruiting new high-conductance-state AMPA-Rs to the PSD

membrane and by modulating the NMDA-R response (Derkach et al., 1999; Leonard et al., 1999;

Omkumar et al., 1996). GluR1 expression can be influenced by a number of pathways. In mature

neurons, NR2A promotes, whereas NR2B inhibits GluR1 surface expression (Kim et al., 2005). GluR1

trafficking can also be increased by protein kinase A (PKA) phosphorylation of GluR1 (Esteban et al.,

2003).

Because CaMKII modulates both the NMDA and GABA systems, it plays an important role in

neonatal neurodevelopment. Developing neurons require certain degree of membrane depolarization

with a consequent rise in intracellular calcium to stimulate neurite outgrowth. The GABAergic network,

which develops prior to the glutamatergic one, appears to provide this depolarization (Ben-Ari et al.,

1994). Paradoxically, GABA, the principal inhibitory neurotransmitter in the adult CNS, plays the role

of main neurotransmitter of excitation in the embryonic and neonatal hippocampus (Leinekugel et al.,

1999; Swope et al., 1999). This membrane depolarization is sufficient to remove the voltage-dependent

Mg2+ block of NMDA receptors (Ben-Ari, 2002; Leinekugel et al., 1999; Lu et al., 1999; Stein et al.,

2004) and increase intracellular calcium concentrations, a stimulus necessary for the initial development

of AMPA responses (Ben-Ari et al., 1997; Fukunaga and Miyamoto, 1999; Soderling, 1993; Wu et al.,

1996).

In mature neurons, CaMKII phosphorylates the GABAA receptors (Macdonald and Olsen, 1994),

increasing their substrate binding (Churn and DeLorenzo, 1998) as well as their currents (Wang et al.,

1995), contributing to the enhancement of inhibitory synaptic transmission (Houston and Smart, 2006;

Wang et al., 1995). CaMKII phosphorylates MeCP2 and hence influences dendritic patterning, spine

morphogenesis and the induction of BDNF transcription (Klose and Bird, 2006; Lewis et al., 1992;

Zhou et al., 2006). Mutations in MeCP2 result in defects in dendritic branching, spine density, synaptic

plasticity, learning and memory, and the maturation of inhibitory circuits and leads to Rett Syndrome

(RTT) (Amir et al., 1999; Katz and Shatz, 1996; Zhou et al., 2006).

2.7. Sensitization

Endogenous amphetamine-like compounds, such as β-phenethylamine, are produced by the brain

(Inwang et al., 1973). These compounds modulate affective behaviours such as excitement and alertness

17

and have been shown to be decreased in depression (Sabelli and Mosnaim, 1974). As compared to

amphetamine, these compounds are metabolized quickly and do not appear to be stored (Berry, 2004)

because of the absence of the α-methyl group which inhibits monoamine oxidase (MAO) (Sulzer et al.,

2005). Like amphetamine, β-phenethylamine releases dopamine (Bergman et al., 2001), but unlike

amphetamine it is metabolized quickly. Psychostimulants such as amphetamine and cocaine can elicit

psychotic symptoms in normal subjects and worsen symptoms in patients with schizophrenia

(Lieberman et al., 1997). It is, therefore, likely that the pathway involved in psychostimulant signaling is

abnormal in schizophrenia and this provides a rare and important clue to the etiology of this elusive

disease. Many of the effects of psychomotor stimulants like amphetamine and cocaine seem to be

mediated by similar pathways (Robinson and Berridge, 1993; Wise and Bozarth, 1987). Repeated

treatment of rats with AMPH or cocaine leads to sensitization and an enhanced release of DA from areas

such as the striatum and nucleus accumbens in response to stimuli (Castaneda et al., 1988; Kantor et al.,

1999; Pierce and Kalivas, 1997; Rawls and McGinty, 2000; Robinson and Becker, 1982; Robinson et

al., 1985).

Amphetamine sensitization is mediated by CaMKII, activation of which is essential for the

enhanced dopamine release in sensitized animals (Jones et al., 1998; Raiteri et al., 1979; Warburton et

al., 1996). The enhanced dopamine release component specific to sensitized animals is independent of

dopamine vesicular storage and dependent on Ca2+ and is transporter-mediated. This is different from

depolarization-mediated dopamine release upon acute administration of amphetamine, which is

cytosolic, vesicular and independent of Ca2+ (Jones et al., 1998; Kantor et al., 1999; Pierce and Kalivas,

1997; Raiteri et al., 1979). Both amphetamine sensitization and later enhanced amphetamine release in

sensitized animals depend on CaMKII. Inhibition of hippocampal CaMKII impairs amphetamine

conditioning in rats (Tan, 2002) and attenuates dopamine release in amphetamine sensitized rats (Kantor

et al., 1999; Pierce and Kalivas, 1997). One of the key components of amphetamine treatment is the

development of amphetamine-induced conditioned place preference in the animals, this also is

dependent on CaMKII activation and is abolished by inhibiting CaMKII (Tan, 2002). Furthermore,

phosphorylation of NMDA-Rs by CaMKII-induced stimulation of D1R and D2R contributes to

enhancement in striatal NMDA sensitivity (Oh et al., 1999).

In humans, amphetamine mimics the positive symptoms of schizophrenia, whereas

phencyclidine (PCP) reproduces the schizophrenia-like psychosis such as positive symptoms, negative

symptoms, and cognitive deficits, closely mimicking schizophrenia symptoms (Javitt and Zukin, 1991;

18

Rainey and Crowder, 1975). In rodents, chronic PCP administration activates the mesolimbic dopamine

pathway and impairs prefrontal cortical function (Jentsch and Roth, 1999). Mice treated with PCP

displayed an impairment of latent learning and a decrease of learning-associated phosphorylation of

CaMKII and NR1 in the prefrontal cortex even after drug withdrawal (Mouri et al., 2007). This supports

the involvement of the CaMKII-NMDA-R pathway in schizophrenia.

2.8. Involvement of the D2 receptors

The D2R is one of the key elements implicated in schizophrenia, as all the antipsychotic drugs are

D2R antagonists and show perfect correlation between their effective antipsychotic efficacy dose and

80% D2R occupancy (Creese et al., 1976; Seeman et al., 1976; Seeman, 1987). D2Rs are enriched in

dendritic spine shafts and heads that are contacted by corticostriatal glutamatergic afferents to form

synapses throughout the striatum (Hersch et al., 1995; Yung and Bolam, 2000).

A direct interaction between D2R and NR2B is critical for modulating NMDA-R-mediated

currents and behavioral responsiveness to cocaine (Liu et al., 2006). Acute cocaine administration

results in interaction of D2Rs with the NR2B and disruption of the NR2B-CaMKII binding, weakening

the CaMKII influence over the phosphorylation site on NR2B and leading to reduced phosphorylation

(Liu et al., 2006). D2Rs are also able to activate the nuclear form of CaMKII and stimulate gene

expression through Ca2+ signaling (Takeuchi et al., 2002). In turn, upregulation of CaMKII was shown,

together with the ERK pathway, to positively upregulate the D2R promoter (Takeuchi et al., 2002).

3. NOGO

The reticulon family constitutes of four members, RTN1, RTN2, RTN3, and RTN4/Nogo (Table

2), all of which are expressed in neurons, with RTN3 and Nogo being expressed most prominently in

white matter (Lauren et al., 2006). Only Nogo possesses the unique ability of inhibiting axonal

regeneration (GrandPre et al., 2000). For review see (Oertle and Schwab, 2003). The representative

feature of RTN proteins is their association with membranes of the endoplasmic reticulum (ER) (van de

Velde et al., 1994) and a conserved carboxy terminal (C terminal) region of approximately 200 amino

acid (aa), called the reticulon homology domain (RHD, Pfam PF02453, http://www.sanger.ac.uk/cgi-

bin/Pfam/getacc?PF02453). The RHD consists of two transmembrane segments, separated by a domain

of approximately 66 aa, involved in protein-protein interactions (Oertle et al., 2003a; Oertle et al.,

2003b; Yan et al., 2006).

19

Nogo was first identified through research in spinal cord regeneration as a neural growth

inhibitor produced by oligodendrocytes and associated with myelin (Chen et al., 2000b; GrandPre et al.,

2000; Prinjha et al., 2000; Spillmann et al., 1998). In 1998 it was also identified by our lab, as an

initially unknown gene, Band 9, elevated in the frontal cortex of schizophrenia patients (Novak et al.,

2002). Together with myelin associated glycoprotein (MAG) (Barton et al., 1987) and oligodendrocyte

myelin glycoprotein (OMgp, arretin) (Kottis et al., 2002), it belongs to a family of myelin associated

neural growth inhibitors, or myelin associated inhibitors (MAIs) (McKerracher and Winton, 2002). The

gene for Nogo has been mapped to chromosome position 2p13-14 (Yang et al., 2000) and the gene for

its receptor, RTN4-R/NgR1, is located on chromosome 22q11 (Fournier et al., 2001). It is of interest

that both the Nogo loci and the NgR1 loci are within important regions linked to schizophrenia, 2p15-

p12 (Coon et al., 1998; Shaw et al., 1998; Straub et al., 2002) and 22q11 (Bassett et al., 1998;

Karayiorgou et al., 1995), respectively. Three mutant NgR1 alleles were detected in schizophrenia

patients, two of which were in neuroleptic resistant patients (Sinibaldi et al., 2004).

Alternative naming, location Reference

RTN1 NSP, s-Rex, 14q21-q22 (Kools et al., 1994; Ninkina et al., 1997)

RTN2 NSPL1, 19q13.3 (Geisler et al., 1998; Roebroek et al., 1998)

RTN3 NSPL2, 11q13 (Moreira et al., 1999)

RTN4

Nogo, ASY, RTN-X, RTN-

xL/xS, NI-220/NI-250, NI-35,

VP20, foocen, KIAA0886,

2p13-14

(Buffo et al., 2000; Chen et al., 2000b; GrandPre et al.,

2000; Morris et al., 1999; Nagase et al., 1998; Prinjha et

al., 2000; Qi et al., 2003; Schwab, 1990; Spillmann et

al., 1998; Tagami et al., 2000).

Table 2. Alternative names and chromosomal location of the reticulon family members.

The Nogo gene consists of 14 exons (Oertle et al., 2003a; Oertle et al., 2003b), which could

theoretically produce many splice variants, but only three main isoforms have been identified, Nogo A,

B and C (Oertle et al., 2003a) (Figures 4 and 5). Generally, diversity is generated by the RTNs through

multiple promoters present in the first large intron, rather than alternative splicing. This strategy

produces isoforms with varied amino terminal (Nt) regions, but with conserved carboxyl terminal (Ct)

region containing the RHD (Oertle et al., 2003a; Oertle et al., 2003b; Roebroek et al., 1996; Yan et al.,

20

2006). The (Nt) variation produces tissue-specific isoforms. (Yan et al., 2006). In Nogo, the Nogo-A/B

and the Nogo-C isoforms use alternate promoters, P1 and P2, respectively (Oertle et al., 2003a).

There are three isoform specific domains present in human Nogo, an N terminal region

containing sequence common to Nogo-A and B (aa 1-185), a region unique to Nogo A (amino-Nogo-A,

aa 186-1004) and an C terminal region common to all three splice variants and which contains the RHD

sequence (aa 1005-1192, also known as Nogo66, Pfam PF02453) (Figure 5) (Oertle et al., 2003c).

(Although the N terminal 11 aa’s unique to Nogo C may be classified as another possible functional

region.)

Figure 4. The RTN4/Nogo gene. The alternative use of nine exons (1A - 9) and two promoters (P1 and P2) (A.) gives rise to three brain-expressed splice variants of Nogo (B.) (Oertle et al., 2003a).

The first Nogo exon, 1A, contains the 5’UTR, and the first N-terminal 172 aa’s common to

Nogo-A and Nogo-B (Oertle et al., 2003a). This Nogo-A/B region is rich in proline, it is similar to SH3

ligands and contains a negatively charged cluster which may function as a low-affinity binding site for

Ca2+ (Oertle et al., 2003a). This section is involved in the inhibition of fibroblast spreading and shows a

general inhibitory activity (Fournier et al., 2001) but does not significantly inhibit neural outgrowth

A.

P1 P21Aa 1A 1D 1E 1F 1G 2 3 1C 4 5 6 7 8 9

Promoters and exons only used in testis

Exons used in brain splice variants

B.

P11A 2 3 4 5 6 7 8 9

Nogo - A

P1

1A 4 5 6 7 8 9

Nogo - B

P2

1C 4 5 6 7 8 9

Nogo - C

21

(Oertle et al., 2003c). The next set of exons, 1Aa, 1Ab, 1D, 1E, 1F, 1G and 2, form minor splice variants

only detected in testis (Oertle et al., 2003a). Exon 1C is expressed via the P2 promoter and contains the

5’ end unique to Nogo-C, encoding its N-terminal 11 amino acid residues. Exon 3 encodes the Nogo-A-

specific region (amino-Nogo-A), which is unusually long (2400 bp), highly conserved, and contains

consensus sequences for PEST (protein tyrosine phosphatase) domains (Oertle et al., 2003a). The

amino-Nogo-A region (aa 186-1004) has been shown to inhibit both spreading of non-neuronal cells and

of axon growth and mediate the collapse of neuronal growth cones (Chen et al., 2000b; Fournier et al.,

2001; Oertle et al., 2003c). A section of the amino-Nogo-A, aa 567-748, was shown not to bind to

NgR1, but is nonpermissive as a substrate for multiple cell types and inhibits neural outgrowth,

suggesting that there might exist a distinct receptor mediating this amino-Nogo-A inhibition (Oertle et

al., 2003c). The amino-Nogo-A region also contains a non-inhibitory binding site for the Nogo receptor

located at aa 995-1018 (Hu et al., 2005). The combination of NgR1 binding through its primary target,

the Nogo-66 domain, as well as the amino-Nogo domain creates a substantially higher-affinity NgR1

ligand (Hu et al., 2005). Exons 4 through 9 encode the part common to all the Nogo isoforms and the

part of the protein that is homologous to the reticulon family members (Oertle et al., 2003a). The protein

ends with a common carboxyl-terminal of 188 amino acids (aa 1005-1192) shared by all three isoforms

of Nogo, which contains the RHD with its two transmembrane domains (Watari and Yutsudo, 2003) and

a central loop of 66 amino acids (Nogo-66), which was used to identify the Nogo receptor (NgR1)

(Fournier et al., 2001). Nogo-66 has been shown to be extracellular and has an axon growth inhibitory

effect and growth cone collapsing function on its own (Fournier et al., 2001; GrandPre et al., 2002;

Oertle et al., 2003c). It strongly interacts with the NgR1 through its leucine rich repeat (LRR) domain

(Lauren et al., 2006).

Exon 4 encodes the first large hydrophobic domain (aa 1017-1052) of the RHD. This region

shares significant homology (38% identity) with the GABA-receptor first transmembrane domain

(Oertle et al., 2003a). Exons 6 and 7 encode the second putative transmembrane domain (aa 1118 –

1154) with a leucine-zipper-like motif. The transmembrane domains determine the topology of Nogo.

Because of their large size, the transmembrane domains seem to have the ability to span the membrane

once or twice and so direct the topology of the loop to the cytosolic or, as in differentiated

oligodendrocytes, to the extracellular space (Dodd et al., 2005; GrandPre et al., 2000; Oertle et al.,

2003c). In differentiated oligodendrocytes, both Nogo-66 and amino-Nogo can be extracellular (Oertle

et al., 2003c). In the ER, both the N- and C-termini of RTNs face the cytoplasm and all the hydrophilic

22

segments are on the same side of the membrane (GrandPre et al., 2000; Oertle and Schwab, 2003;

Voeltz et al., 2006). The transmembrane domains also play a role in subcellular localization of Nogo,

the disruption of the second transmembrane segment has been shown to affect the localization of RTN4

in the ER (Oertle et al., 2003c). Exons 8 and 9 encode the C terminus of Nogo, with exon 9 encoding the

last 13 aa of Nogo protein and the 3’UTR, which contains a typical di-lysine ER membrane retention

signal and a potential nuclear localization signal (Oertle et al., 2003a).

Figure 5. Functional domains of Nogo/RTN4 (Oertle et al., 2003c).

3.1. The expression of Nogo

The P2 promoter of Nogo-C contains E-box which can bind muscle-specific transcription

factors, which is consistent with the expression of Nogo-C in muscle (Oertle et al., 2003a; Oertle and

Schwab, 2003). A negative control element upstream of open reading frames (uORF) likely functions as

negative regulator of Nogo-C translational level (Kozak, 2000). Increased calcium levels lead to

activation of calcineurin and to dephosphorylation and hence activation of NF-AT (Crabtree, 1999).

aa 1Nogo-A

N Camino-Nogo-A Nogo-66, RHD

Nogo-B

TM1 TM2

Nogo-C

inhibition of fibroblast spreading (aa 57-185) but not neural outgrowth general inhibitory activity

inhibits spreading of non-neuronal cells and of axon growth mediates the collapse of neuronal growth cones aa 995-1018 (Nogo-A-24), a non-inhibitory binding site for NgR1

Reticulon Homology Domain (RHD)Central loop of 66 amino acids (Nogo-66), extracellular, axon growth inhibitory

growth cone collapsing, primary binding region for NgR1TM2 - localization of Nogo in the ER

aa 1192185 1004

23

The three Nogo isoforms (Nogo-A, B and C) show different developmental and morphological

expression patterns. Nogo-A is mainly found in oligodendrocytes, (and it is the only Nogo variant

expressed by these cells), as well as Schwann cells (Pot et al., 2002), neurons in the brain and by myelin

sheath of the CNS (Wang et al., 2002c). In adult it is absent in non-neuronal cells such as astrocytes and

microglia (Josephson et al., 2001; Marklund et al., 2006). It is particularly strongly expressed by

oligodendrocytes during fetal development, when it is also broadly expressed by the CNS, cerebral

cortex, hippocampus pyramidal cell bodies, but not by Schwann cells in the PNS (Buss et al., 2005).

Nogo B is far less abundant, but it is expressed quite ubiquitously throughout the brain, with an

expression pattern analogous to a housekeeping gene (Oertle et al., 2003a). Nogo C is expressed in the

brain, but it is also expressed in skeletal muscle (Geisler et al., 1998). Because expression of these splice

variants is also developmentally controlled, they likely play a role in development as well as tissue

specificity and differentiation (Oertle et al., 2003a). For example, Nogo A is most strongly expressed in

fully differentiated, postmitotic neurons, and again decreases in the cells of aged animals (Al Halabiah et

al., 2005; Trifunovski et al., 2006). Within the cell, all isoforms concentrate in the ER, but low levels of

Nogo A are also present on the surface of oligodendrocytes and fibroblasts (GrandPre et al., 2000) and

Nogo B on endothelial cells (Acevedo et al., 2004; Dodd et al., 2005; GrandPre et al., 2000; Voeltz et

al., 2006). A somewhat unique presence is the localization of Nogo A in the Golgi (GrandPre et al.,

2000).

3.2. Nogo-A in neurodevelopment

Paradoxically, Nogo-A is localized to growth cones of growing axons in the developing nervous

system, hence under some circumstances it likely also plays a role in neuronal growth, rather than

inhibition (Tozaki et al., 2002). In the hippocampus, Nogo-A is expressed early in development

(Mingorance-Le Meur et al., 2007). Nogo-A expression by cortical neurons follows their gradient of

positioning and maturation in the cerebral cortex (Mingorance-Le Meur et al., 2007). In particular, Nogo

plays an important role in directing the migration of early cohorts of tangentially migrating GABA-ergic

neurons from the ganglionic eminence. The expression pattern of Nogo-A changes when these neurons

change from migratory to resting. It is targeted to their leading processes and its absence results in

alterations in the migration pattern, increase in axon branching, early polarization and delay in the

migration of interneurons toward the neocortex (Mingorance-Le Meur et al., 2007). Although low levels

of the N-terminus of Nogo-A are present at the neuronal surface, Nogo-A is primarily associated with

24

intracellular compartments (ER) and cytoskeletal proteins such as microtubules in the central region of

growth cones (Mingorance-Le Meur et al., 2007). As compared to Nogo-A, neuronal NgR1 expression

in the neocortex does not start until late prenatal and early postnatal stages (Josephson et al., 2002;

Mingorance et al., 2004; Wang et al., 2002c), indicating that during most embryonic development the

functions of cell surface Nogo-A are not mediated by NgR1 (Mingorance-Le Meur et al., 2007).

NgR-1 serves as a receptor for all three neural growth inhibitor proteins associated with myelin,

Nogo, MAG and OMgp and activates the Rho signaling pathway (Fournier et al., 2001; Fournier et al.,

2003; Liu et al., 2002; McGee and Strittmatter, 2003; Wang et al., 2002b). NgR-1 also binds other

members of the reticulon family, namely RTN2 and RTN3, but not RTN1 (Lauren et al., 2006).

Furthermore, the most predominant proteins that interact with Nogo-A are Nogo-B and Nogo-C (Dodd

et al., 2005) and this interaction is not limited only to splice forms of the same gene, since Nogo B was

shown to interact with another member of the reticulon family, RTN3, through its RHD domain (Qi et

al., 2003). It is likely that clustering of the receptors and targets may increase the efficiency of signaling,

as NogoA-MAG clustering has already shown to potentiate NgR1 signaling (Niederost et al., 2002).

Nogo acts through a number of signaling pathways, but the Nogo-NgR1 pathway is possibly the

most studied. Nogo binds to the NgR1 receptor, which, because of its lack of transmembrane domain to

elicit signal, requires co-receptors (Woolf and Bloechlinger, 2002). Three membrane proteins, which

form a transmembrane receptor complex with NgR1, have been identified as its co-receptors: p75NTR (a

low-affinity neurotrophic factor) (Dechant and Barde, 2002; Hasegawa et al., 2004), a membrane

protein LINGO-1 (leucine-rich repeat and immunoglobulin domain-containing, Nogo receptor

interacting protein) (Mi et al., 2004); and TROY (also known as TAJ, TNF receptor superfamily,

expressed in CNS) (Park et al., 2005; Shao et al., 2005; Wang et al., 2002a; Wong et al., 2002). The

localization of the receptors and their co-receptors adds another layer of spatial control, determining

which signaling pathway will be activated (Ding et al., 2001).

3.3. The Gi protein – PKC / IP3 pathways

The Nogo-NgR1- p75NTR complex also activates two Rho independent, closely connected,

pathways, balance of which determines whether the signal will result in neural growth or inhibition

(Hasegawa et al., 2004). By activating the inhibitory guanine nucleotide binding protein (Gi) (Cai et al.,

1999), Nogo triggers the intracellular elevation of Ca2+ as well as the activation of PKC (Hasegawa et

al., 2004). The Gi protein activates PLC (α, β and β2) (Hasegawa et al., 2004), which in turn mediates

25

PIP2 conversion to IP3 and DAG (Berridge, 1998). Binding of IP3 to the IP3 receptor results in

intracellular elevation of Ca2+, while DAG activates PKC. The PKC pathway mediates growth cone

collapse, while the IP3 pathway mediates growth cone extension (Hasegawa et al., 2004). Thus, it is the

balance between PKC and IP3 which is important for the regulation of axon regeneration or inhibition by

Nogo (Hasegawa et al., 2004). Inhibition of PKC results in neurite extension, while inhibition of IP3

receptor enhances neurite retraction (Hasegawa et al., 2004). Dysregulation of these pathways was

shown to be associated with disease or aberrant neural functioning. High levels of PKC in the prefrontal

cortex induced by stress impair working memory and disrupt prefrontal cortical regulation of behaviour

and thought, resulting in impaired judgment, impulsivity and thought disorder (Birnbaum et al., 2004).

This may be of particular importance when considering the effects of Nogo upregulation in

schizophrenia, as increased Nogo signaling may result in similar dysfunction and contribute to the

disease phenotype. Nogo-NgR1 pathways converge to impart the inhibition of actin cytoskeleton

reorganization and increase the stabilization of formed F-actin, which results in stress fibre formation

and neurite retraction (Maekawa et al., 1999). These pathways have been identified as being involved in

axon pathfinding in development (Lee et al., 1994; McQuillen et al., 2002).

3.4. Other pathways involved in Nogo signaling

NgR1 is not always the receptor responsible for mediating Nogo signaling. Although NgR1 is

highly expressed in gray matter where Nogo A is expressed by oligodendrocytes, it is not expressed in

white matter where Nogo is also present (Fournier et al., 2001). Furthermore, in addition to not always

being expressed at the same time or in the same location as NgR1 and Nogo do not always play a neural

growth inhibitory role (Al Halabiah et al., 2005). The reticulons seem to play an important function in

microtubule stability, especially in the ER. Reticulons primarily localize to the tubular ER and interact

with DP1 (Deleted in Polyposis Locus Protein 1)/ Yop1p (S. cerevisiae homologue of DP1), a conserved

integral membrane protein of the peripheral ER. The unique topology of the large transmembrane

domains of Nogo and its interaction with DP1 may help control membrane curvature in the

endomembrane system (Voeltz et al., 2006). Furthermore, the formation of ER tubular network requires

Nogo A (Voeltz et al., 2006) and Nogo-A has been found to co-immunoprecipitate with α-tubulin,

which also suggests that it is involved in microtubule stabilization (Taketomi et al., 2002).

There is evidence of Nogo interacting with multiple signaling and metabolic pathways. Nogo-B

and Nogo-C proteins interact with β-secretase (BACE1, for β-site APP cleaving enzyme / Asp2 /

26

memapsin 2) (He et al., 2004; Murayama et al., 2006; Yan et al., 2006). The β-amyloid peptide (Aβ) is

released from a large amyloid precursor protein (APP) through sequential cleavage by two

endopeptidases: β-secretase and γ-secretase. The accumulation of Aβ is known to cause the formation of

amyloid plaques in Alzheimer’s disease which lead to damage and neuronal death in human brain

(Hardy and Selkoe, 2002). Increased interaction in the ER compartment between RTNs via their C-

terminal RHD and BACE1 sequesters BACE1 from accessing the APP substrate and reduces the

conversion of APP to Aβ (He et al., 2004; Yan et al., 2006).

Nogo-B (ASY, RTN-Xs) has been shown to have diverse functions from apoptosis (Qi et al.,

2003; Tagami et al., 2000) to vascular remodeling and chemotaxis in smooth muscle cells (Acevedo et

al., 2004), which also agrees with its widespread expression pattern (Huber et al., 2002). In addition, it

was isolated as a novel human apoptosis-inducing protein without any known apoptosis-related motifs

(Li et al., 2001b; Watari and Yutsudo, 2003). Nogo-B overexpression was shown to induce ER stress

and precipitate apoptosis. Nogo-B was shown to interact with Bcl–2 and Bcl-XL (Bcl-XL also binds

RTN1-C) and reduce their anti-apoptotic activity (Tagami et al., 2000). Increased interaction of Bcl-2

with Nogo-B increases apoptosis by preventing the translocation of Bcl-2 to the mitochondria from the

ER. Not surprisingly, an increased expression of RTN proteins in certain cells causes changes in their

cellular response to ER stress (Qi et al., 2003). Recently it has been demonstrated that Fluoxetine, a

widely used antidepressant compound, up-regulated expression of Bcl-2 and Bcl-XL (Chiou et al.,

2006). Nogo is located close to a locus that has been associated through linkage with increased risk of

suicide attempts in families with recurrent, early-onset, major depression (Zubenko et al., 2004). Bcl-XL

is another bcl-2 family protein and may be involved in modulation of synaptic stability (Jonas et al.,

2003). Nogo-B also mediates chemotaxis of endothelial cells (Miao et al., 2006) and may play a key role

in triggering the production of pro-inflammatory cytokines and other inflammatory mediators, as well as

in the cellular response to environmental stress. Furthermore, Nogo-B may play important role in the

stabilization of α-tubulin (Rousseau et al., 2005).

Nogo C is transcribed from an alternate promoter (P2) than one used for Nogo-A and Nogo-B

transcription (P1) (Oertle et al., 2003a). In addition to a growth cone collapsing function, mediated

through Nogo-66 binding to the NgR1, Nogo-C may also act similarly to RTN1-C, a protein of the same

family with close similarity to Nogo-C (Oertle et al., 2003b; Yan et al., 2006), which is involved in

neuronal differentiation (Hens et al., 1998). As all main Nogo isoforms, is it expressed in an ER pattern.

It was shown to mediate cell apoptosis by inducing caspase-3 and p53 activation through the JNK-c-Jun-

27

dependent pathway (Chen et al., 2006).

4. DEPRESSION

CaMKII plays an important role in the serotonin signaling pathway. The activation of the

serotonin 1a receptor (5-HT1A) reduces CaMKII autophosphorylation, resulting in decreased GluR1

phosphorylation and smaller AMPA-R mediated currents (Cai et al., 2002; Colbran and Brown, 2004).

The decrease in CaMKII activity also inhibits the induction of LTP by suppressing NMDA receptor

function in postsynaptic neurons. This is achieved by the inhibition of PKA and ensuing activation of

PP1 (Cai et al., 2002), resulting in cognitive deficits and impaired memory retention (Edagawa et al.,

1999). The actions of antidepressants also converge on the CaMKII pathway. Selective serotonin

reuptake inhibitors (SSRIs) (paroxetine and fluvoxamine) upregulate CaMKII activity (Popoli et al.,

1995). They induce presynaptic CaMKII activity and autophosphorylation and increase Ca2+/CaM

dependent phosphorylation of synaptotagmin (with less effect on synapsin) in hippocampus (Popoli et

al., 1997). Furhtermore, synapsin I and synaptotagmin are two major CaMKII presynaptic substrates

(Fukunaga et al., 1996; Popoli et al., 1997). 5-HT1A antagonists also cause a rapid increase in

phosphorylated CaMKII, followed by an enhanced membrane expression of AMPA receptor subunits,

especially GluR1, phosphorylated at the CaMKII site (Schiapparelli et al., 2005).

28

RESULTS

Study No. 1: Schizophrenia and Nogo: elevated mRNA in cortex, and high prevalence of a

homozygous CAA insert.

1. Abstract for study No. 1

Schizophrenia is a major psychiatric disorder which is hypothesized to result from abnormal

neurodevelopment, and may be associated with altered gene expression. To search for genes

overexpressed in schizophrenia, cDNA library subtractive hybridization experiments between post-

mortem human frontal cerebral cortices from schizophrenia individuals and neurological controls were

carried out. One of the genes over-expressed in schizophrenia was identified as Nogo (also known as

reticulon 4, RTN4, NI 250, or RTN-X), a myelin-associated protein which inhibits the outgrowth of

neurites and nerve terminals. The elevated expression of Nogo mRNA in schizophrenia was confirmed

by quantitative reverse transcription-polymerase chain reaction studies using samples from the National

Neurological Research Specimen Bank in Los Angeles and from the Canadian Brain Tissue Bank in

Toronto. We found 16.5 pg Nogo cDNA/µg total RNA in schizophrenia, and 10.2 pg Nogo cDNA/µg

total RNA in controls (n = 7; p = 0.01, t-test for n<30). To identify possible polymorphisms in this gene,

the Nogo nucleotide sequence was determined in a series of schizophrenia and control samples. The

Nogo mRNA was found to contain a CAA insert polymorphism in the 3'-untranslated region. The

prevalence of individuals homozygous for this CAA insert was significantly higher in schizophrenia

compared to controls in genomic DNA samples extracted from post-mortem brain and blood samples:

17/81 or 21% in schizophrenia and 2/61 or 3% in controls (p = 0.0022, Chi-square and Fisher’s Exact

Tests). Because the 3'-untranslated regions of eukaryotic genes are known to regulate gene expression,

the increased frequency of the Nogo CAA insert in schizophrenia may contribute to abnormal regulation

of Nogo gene expression, and may indicate a role for Nogo in disturbed neurodevelopment in

schizophrenia.

2. Introduction for study No. 1

Although schizophrenia is a heritable disorder, the genes responsible for this disease remain to

be identified (Fuller Torrey and Yolken, 2000; Waterwort et al., 2002). It has been hypothesized that

schizophrenia may arise from abnormal neurodevelopment due to aberrant neuron formation and

29

migration, or changes in regenerative/repair capacity in adulthood (Benes, 2000; Bunney and Bunney,

2000). One such critical protein may be Nogo (also known as reticulon 4, RTN4, NI 250 or RTN-X),

which has been shown to be highly expressed by oligodendrocytes in CNS myelinated tissues during rat

fetal development and in the adult rat (Huber et al., 2002; Josephson et al., 2001). Myelin develops in

vivo at about the same time as the CNS loses plasticity, and myelination appears to be synchronized

with the gradual loss of neuronal regenerative ability (Skaper et al., 2001). Nogo has an important role

in regenerative and repair processes in the central nervous system because of its ability to inhibit the

outgrowth of neurites and nerve terminals (Chen et al., 2000b; GrandPre et al., 2000; Prinjha et al.,

2000). The effects of Nogo may be mediated by, or occur in association with, GAP43, CAP23, LIF

kinase, or other neuronal transcription factors, such as c-Jun and JunD, which are associated with

neuronal growth (Zagrebelsky et al., 1998). Nogo has also been shown to inhibit neuronal sprouting of

injured and uninjured Purkinje neurons in the adult rat cerebellum (Buffo et al., 2000). Although Nogo

is also expressed by neurons during development, there is no known functional role for neuronal Nogo

(Huber et al., 2002; Josephson et al., 2001).

The Nogo gene encodes for three alternatively spliced variants, Nogo-A, Nogo-B, and Nogo-C,

which share a common C-terminal domain of 188 amino acids containing two putative transmembrane

domains, and an endoplasmic reticulum retention motif (Skaper et al., 2001). It is not yet clear where the

neurite inhibitory domain resides. Two studies have suggested a Nogo-A-specific region (Chen et al.,

2000b; Prinjha et al., 2000), while a third demonstrated inhibitory activity in a domain common to all

three isoforms (GrandPre et al., 2000). Nogo, therefore, functions as a developmentally regulated

(Huber et al., 2002; Josephson et al., 2001) tonic inhibitor of neuronal growth through negative,

constitutive down-regulation of growth-associated genes (Brittis and Flanagan, 2001; Huber and

Schwab, 2000; Zagrebelsky et al., 1998). Since Nogo has an important role in synaptic plasticity and

neuronal migration, the altered expression of this gene in schizophrenia may contribute to the abnormal

neuronal organization in schizophrenia. At present, there are only a few studies on Nogo expression in

mouse, rat and human fetal tissues (Huber and Schwab, 2000; Josephson et al., 2001), with none

reported on degenerative diseases or schizophrenia.

To search for genes with altered mRNA expression in schizophrenia brain, we carried out cDNA

library subtractive hybridization experiments using RNA extracted from schizophrenia and control post-

mortem frontal cortices (Diatchenko et al., 1996). The brain region selected for study was the prefrontal

cortex, important for memory and cognition. These faculties are often impaired in schizophrenia

30

(Goldman-Rakic and Selemon, 1997), suggesting that there may be changes in gene expression and/or

neuronal organization. These studies identified Nogo as being potentially over-expressed in

schizophrenia. The gene expression of Nogo was, therefore, measured in seven schizophrenia and seven

control frontal cortex samples by quantitative reverse transcription-polymerase chain reaction

(Haberhausen et al., 1998). To identify possible polymorphisms in this gene, the Nogo nucleotide

sequence was determined in a series of schizophrenia and control samples. The Nogo mRNA was found

to contain a CAA insert polymorphism in the 3´-untranslated region, 669 bases beyond the coding

region. The prevalence of individuals homozygous for the CAA insert was significantly higher in

schizophrenia compared to controls.

3. Materials and Methods for study No. 1

3.1. Post-mortem human tissues.

Post-mortem human frontal cortical brain tissues (Brodmann Area 10) were provided by the

Stanley Foundation Neuropathology Consortium (Bethesda, MD) from a collection of 60 brains, 15 each

from individuals diagnosed (DSM-IV criteria) with either schizophrenia, bipolar disorder, non-psychotic

depression or neurologically normal (Torrey et al., 2000). Post-mortem human brain frontal cortices

were also dissected by, and obtained from, the Canadian Brain Tissue Bank (Toronto, ON, Canada) and

the National Neurological Research Specimen Bank (West Los Angeles VA Medical Center, Los

Angeles, CA). The diagnosis of schizophrenia was made by two psychiatrists independently examining

the case records and using DSM-IV criteria (American Psychiatric Association, 1987) (American

Psychiatric Association, 1994).

3.2. Blood samples.

Additional control genomic DNA samples of 34 anonymous Caucasian individuals were

obtained from relatives of rheumatic arthritis patients (laboratory of Dr. K. Siminovitch, Mount Sinai

Hospital, Toronto, ON). Genomic DNA was also obtained from blood samples from individuals

diagnosed with schizophrenia from Dr. J. Lieberman (Hillside Hospital, NY; 15 samples), Dr. C.

Shammi and Dr. C. Hudson (Centre for Addiction and Mental Health, Clarke site, Toronto, ON; 32

samples). Additional genomic DNA samples were obtained from Dr. B. O´Dowd (Toronto, ON; 72

samples) from individuals diagnosed with alcohol addiction (as well as substance abuse in some cases).

31

3.3. PCR-select cDNA subtractive hybridization.

The purpose of using subtractive hybridization in this project was to obtain clones of genes that

were differently expressed in schizophrenia cerebral cortex compared to control tissues. The general

procedure was to convert both mRNA populations in the control and diseased tissues into cDNA. The

schizophrenia (or tester) cDNA was hybridized with the control (or driver) cDNA. The hybrids were

removed, and the remaining unhybridized cDNAs represented genes expressed in schizophrenia but

absent or different from control mRNA.

The method used was the Clontech PCR-Select™ procedure, using the cDNA Subtraction Kit

(Catalog K1804-1; Clontech Laboratories, Palo Alto), and the following outline is adapted from the

procedure provided by Clontech. To obtain preliminary data on this aspect of the project, we used post-

mortem human frontal cortex from two control individuals (who died of non-neurological illnesses) and

from two individuals who died with schizophrenia. Total RNA was extracted from the post-mortem

frontal cortex tissues, using Trizol® Reagent (monophasic solution of phenol and guanidine

isothiocyanate; Life Technologies (Gibco-BRL Products), Burlington, Ontario). The messenger RNA or

Poly A+ RNA was then prepared, using Oligotex™ resin (Qiagen, Mississauga, Ontario). cDNA was

then prepared for each tissue, using 2 mg of poly A+ RNA. The schizophrenia and control cDNAs were

then digested with RsaI (yielding blunt ends). The schizophrenia cDNA was divided into two parts, each

part being ligated with a different cDNA adaptor.

Two hybridizations were now done. The first hybridization was done with an excess of control

cDNA added to each sample of schizophrenia cDNA. The samples were heat denatured and permitted to

anneal. The concentration of high-abundance and low-abundance sequences became equal for the

single-stranded type of molecules (so-called type a molecules in the Clontech procedure). At the same

time, however, the type a molecules were enriched for differentially expressed sequences, while the

cDNAs which were not differentially expressed formed type c molecules (Clontech) with the control

cDNA. In the second hybridization, the two primary hybridization samples were mixed together without

denaturing. Hence, only the remaining equalized and subtracted single-stranded schizophrenia cDNAs

reassociated and formed hybrids (so-called type e in the Clontech procedure). These new hybrids were

double-stranded schizophrenia molecules with different ends, which corresponded to the sequences of

adaptors 1 and 2R. Fresh, denatured control cDNA was added (without denaturing the subtraction mix)

to further enrich fraction e for differentially expressed sequences. After filling in the ends by DNA

polymerase, the type e molecules (which were the differentially expressed schizophrenia sequences) had

32

different annealing sites for the nested primers on their 5´ and 3´ ends. The entire population of

molecules was then subjected to PCR (polymerase chain reaction) in order to amplify the desired

differentially expressed sequences. During PCR, type a and d molecules were missing primer annealing

sites, and were not amplified. Type e molecules, which had two different adaptors, were amplified

exponentially, and these were the equalized, differentially expressed sequences.

We searched for differentially expressed genes in schizophrenia by analysing the type e

molecules directly. This was done by PCR amplification of the type e molecules using many, up to 35,

cycles. This number of cycles amplified the more abundant species of cDNA in the Schizophrenia-

minus-Control cDNAs and in the Control-minus-Schizophrenia cDNAs. These bands, representing the

most abundant species of cDNA, were dissected out, and the cDNAs extracted and cloned (using the

Original TA Cloning® Kit: Box #1 for ligation: Catalog K2001-01; and box #2 for transformation, using

the INVaF´ One Shot™ Kit of E. coli cells: Catalog C2020-03; Invitrogen, San Diego, CA). This

approach yielded many clones, the cDNAs of which were then sequenced and the genes identified

through Genbank.

3.4. Quantitative RT-PCR.

Total RNA was extracted from brain tissue samples using TRIzol® Reagent (Life

Technologies/Invitrogen) according to the manufacturer´s guidelines. Complementary DNA was

prepared from 2 mg of total RNA using the Superscript™ Preamplification System for First Strand

cDNA Synthesis (Life Technologies/Invitrogen). An internally truncated standard for competitive PCR

experiments was prepared with a 75-bp deletion (bases 4460–4534, AF148537) using a reverse primer

with sequences flanking the desired deletion

(5´-TACAGCTTAAACCACAATGGTAGCATTAGATTCAGTCC-3´, complementary to bases 4556–

4535, 4459–4444) and a forward primer (5´-GCATCAGGCACAGATAGATC-3´, bases 3612–3630).

The truncated Nogo PCR product was amplified using Qiagen Taq™ Polymerase, purified using the

Qiaex II Gel Extraction kit (Qiagen, Mississauga, Ontario), and quantitated by A260 UV absorbance.

The competitor template had identical primer annealing sites and similar base composition as the Nogo

cDNA under study, resulting in accurate estimates of transcript levels. The primers used for PCR

amplification were the above forward primer (bases 3612–3630) and a reverse primer

(5´-TACAGCTTAAACCACAATGGTA-3´, complementary to bases 4556–4535), yielding predicted

PCR products of 945 bp from Nogo cDNA and 870 bp from the competitor template. The primers were

33

designed to amplify all three splice variants of Nogo: Nogo-A, Nogo-B, and Nogo-C. To quantitate

Nogo gene expression in frontal cortex cDNA, several dilutions of the competitor template were co-

amplified in PCR reactions with a constant amount of cDNA. The amplified DNA was size-fractionated

by electrophoresis on agarose gels containing ethidium bromide. The amount of stained DNA amplified

(endogenous Nogo and competitor) from each sample was quantified using the Bio-Rad Gel Doc

Imaging System. The amount of endogenous Nogo cDNA in each reaction was determined by

comparison with the level of the coamplified Nogo competitor DNA. That is, the ratios for each dilution

of competitor template input and endogenous Nogo was compared to determine the point of

equivalence.

3.5. Genomic DNA extraction.

Total DNA was extracted from brain tissue samples using TRIzol® Reagent (Life

Technologies/Invitrogen) according to the manufacturer´s guidelines. Genomic DNA was extracted

from blood samples by standard methods. Briefly, 3 ml of blood were mixed with 9 ml of a solution

containing 155 mM NH4Cl, 10 mM KHCO3 and 0.1 mM EDTA. After centrifugation at 3000× g for 10

min at 4 °C, the remaining tissue was digested for 3 h at 55 °C with proteinase K (125 mg/ml) in 3 ml of

nucleus-lysing buffer (75 mM NaCl, 25 mM EDTA, 1% SDS). After centrifugation (3000× g for 10

min), the DNA was precipitated with ethanol, dried, and dissolved in 500 ml of buffer (10 mM Tris, 1

mM EDTA; pH 8) and stored at 4 °C.

3.6. Amplification and sequencing of the Nogo DNA template.

Genomic DNA was PCR-amplified using the Qiagen Taq™ Polymerase Kit (Qiagen). Primers

used for amplification of the Nogo gene, AF148537, were forward primer

(5´-TTACCTGTCTTGACTGCC-3´, bases 3819–3836) and reverse primer

(5´-TACAGCTTAAACCACAATGG-3´, complementary to bases 4556–4537). PCR products were

analyzed using agarose gel electrophoresis before sequence analysis using the Sequenase Version 2.0

PCR Product Sequencing Kit (product # 70170, USB) and the above described reverse primer.

4. Results of study No. 1

The preliminary findings from the subtractive hybridization work revealed the following genes

or gene segments to be over-expressed in schizophrenia: segment within chromosome 13q12–18; G-

34

protein-coupled receptor-7; EST clone 1457813; two unidentified cDNA sequences (400 bp; 800 bp);

and Nogo. A preliminary set of under-expressed genes or gene segments were mitochondrial 16s rRNA;

cytochrome oxidase subunit II; ATPase 6; cDNA with long CAG trinucleotide repeats; antiadhesive

extracellular matrix protein; calcium-dependent membrane-binding protein; protein kinase II;

intermediate neurofilament; five ESTs and five unidentified cDNA sequences (300–1000 bp). Although

some of these genes may be relevant to the many hypotheses of schizophrenia, the Nogo gene appeared

to be the most attractive and interesting for a detailed and precise analysis for the present study.

An internally deleted standard was prepared and used to quantitate the total amount of Nogo

transcript (composed of Nogo-A, Nogo-B, and Nogo-C) in each sample. The clinical summaries and the

values for Nogo gene expression are presented in Table 3. The mean expression in controls was

10.24±1.69 pg Nogo cDNA/ µg total RNA, and in schizophrenia was 16.49±1.83 pg Nogo cDNA/ µg

total RNA, indicating a 60% increase in disease ( P=0.01, t-test for n<30). These data were presented at

the 31st Annual Meeting of the Society for Neuroscience (San Diego, CA, USA, 2001).

Nucleotide sequence analyses of schizophrenia and control DNA samples revealed a

polymorphism in the Nogo cDNA, a single CAA insert in the 3´-untranslated region (bases 4386–4388,

Genbank AF148537), as indicated in Figure 6. The frequency of the CAA insert polymorphism was

examined in neurological controls and in samples from individuals who had schizophrenia. The

prevalence of individuals homozygous for the CAA insert in the schizophrenia samples was 17 out of 81

or 21%, in contrast to 2 out of 61 or 3% in the control samples (Table 4). This difference was found to

be statistically highly significant, using the X2- and Fisher´s exact-tests ( P=0.0022 for both tests). If

only genomic DNA extracted from post-mortem brain samples is considered, the difference increases to

38% in schizophrenia ( n=32) versus 0% in controls ( n=27), and is highly significantly different

(P=0.00058; Fisher´s exact-test for small samples).

35

3661 aaagatgcta tggctaaaat ccaagcaaaa atccctggat tgaagcgcaa agcTGAatga

3721 aaacgcccaa aataattagt aggagttcat ctttaaaggg gatattcatt tgattatacg

3781 gatctttatt tttagccatg cactgttgtg aggaaaaatt acctgtcttg actgccatgt

3841 gttcatcatc ttaagtattg taagctgcta tgtatggatt taaaccgtaa tcatatcttt

3901 ttccTATCtg aggcactggt ggaataaaaa acctgtatat tttactttgt tgcagatagt

3961 cttgccgcat cttggcaagt tgcagagatg gtggagctag aaaaaaaaaa aaaaaagccc

4021 ttttcagttt gtgcactgtg tatggtccgt gtagattgat gcagattttc tgaaatgaaa

4081 tgtttgttta gacgagatca taccggtaaa gcaggaatga caaagcttgc ttttctggta

4141 tgttctaggt gtattgtgac ttttactgtt atattaattg ccaatataag taaatataga

4201 ttatatatgt atagtgtttc acaaagctta gacctttacc ttccagccac cccacagtgc

4261 ttgatatttc agagtcagtc attggttata catgtgtagt tccaaagcac ataagctaga

4321 agaagaaata tttctaggag cactaccatc tgttttcaac atgaaatgcc acacacatag

4381 aactcCAAca acatcaattt cattgcacag actgactgta gttaattttg tcacagaatc

4441 tatggactga atctaatgct tccaaaaatg ttgtttgttt gcaaatatca aacattgtta

4501 tgcaagaaat tattaattac aaaatgaaga tttataccat tgtggtttaa gctgtactga

4561 actaaatctg tggaatgcat tgtgaactgt aaaagcaaag tatcaataaa gcttatagac

4621 ttaaaaaaaa aa

Figure 6. Nogo cDNA sequence. (GenbankAF148537) The CAA insert polymorphism in the 3’-untranslated region is located at bases 4386–4388 and is almost always co-inherited with a deletion of the TATC sequence, as shown here, as compared to the full “TATCTATC” sequence. TGA marks the end of the coding region

36

Brain/Age/sex P.M.

delay (h) Death

Diagnosis,

symptoms

Duration

(psychosis) Antipsychotic Rx

pg Nogo cDNA per

µg total RNA±S.E.

Schizophrenia tissues:

T1176/19/m 52 Suicide Depression 1 year none 19.36 ± 4.33

T1149/22/m 18 Suicide Paranoid 5 years Flupenthixol 9.68 ± 1.77

T1293/29/m 4 Drowning Halluc., depr. 13 years Risperidone 21.84 ± 7.06

L707/28/m 41 Suicide Depression 2 years Off fluphenazine 4years 11.91 ± 3.62

L695/30/m 32 Cardiac Delusions 9 years Thioridazine 20.35 ± 6.44

L1755/74/m 14 Cancer Depression 30 years Trifluperazine 20.35 ± 6.44

L477/82/f 16 Cardiac Delusions 36years Fluphenazine 11.91 ± 2.82

Average: 16.49 ± 1.83*

Control tissues:

L451/25/m 14 Drowning Control None Phencyclidine abuser 16.88 ± 1.98

T1225/31/m 11 Car accident Control None 19.36 ± 4.33

L480/66/m 19 Cardiac infarct Control None 16.38 ± 6.09

L1768/71/m 25 Cardiac; cancer Control None 4.07 ± 1.61

L475/77/f 19 Car accident Control None 7.94 ± 2.79

T1367/80/m 16 Cancer Control None 2.82 ± 0.90

T1214/92/m 3 Tachycardia Control None 4.22 ± 1.43

Average: 10.24 ± 1.69

Table 3. Quantitative RT-PCR of Nogo gene expression and clinical summaries of samples. Abbreviations: L indicates brain tissue from the National Neurological Research Specimen Bank in Los Angeles; T indicates brain tissue from the Canadian Brain Tissue Bank in Toronto. Standard error (SE) for samples based on standard deviation of each sample. SE for average based on standard deviation of the whole (control or schizophrenia) group. * Statistically significantly different from controls (p=0.01, T-test for n<30).

37

Total number

of samples

Homozygous

for CAA insert

Heterozygous

for CAA insert

Schizophrenia:

Stanley Bank 15 6 ** 3

Other Banks 17 6 ** 6

Blood DNA 49 5 24

Total 81 17 (21% of 81) * 33

Controls:

Stanley Bank 15 0 3

Other Banks 12 0 7

Blood DNA 34 2 13

Total 61 2 (3% of 61) 23

Table 4. Frequency of CAA insert in schizophrenia and controls. *Significantly different from controls (P50.0022, χ2- and Fisher’s exact tests). **Combined schizophrenia brain bank tissues significantly different from control brain bank tissues (P50.00058, Fisher’s exact-test).

Almost all the DNA samples were from Caucasians. Of the 12 individuals homozygous for the

CAA insert, two were Asian (one schizophrenia patient of Asian descent was not homozygous for the

insert). The overall CAA allele frequency was 0.41 in schizophrenia and 0.22 in controls. In the well-

matched Stanley brain bank samples, the CAA allele frequency was 0.5 in schizophrenia and 0.1 in

controls. This was in contrast to the blood samples, where the CAA allele frequency was 0.35 in

schizophrenia and 0.25 in controls. These data suggest there are population differences for this Nogo

polymorphism which will require a large set of well-matched samples to elucidate. The CAA insert is in

most cases co-inherited with a TATC deletion at base 3905, 188 bases 3´ of the stop codon (Figure 6).

All individuals homozygous for the CAA insert were also homozygous for the TATC deletion, except

for one schizophrenia sample and one control sample. Three individuals, one each from the bipolar,

major depression, and schizophrenia samples were homozygous for the TATC deletion, but were not

homozygous for the CAA insert.

38

To search for additional polymorphisms, the complete Nogo cDNA sequence was determined for

nine individuals: four schizophrenia, one major depression, and four control samples. No additional

common polymorphisms were identified, and the three polymorphisms listed for Nogo in the NCBI SNP

database (C→T, 1343; C→G, 2850; C→A, 3751), were not present in the nine samples completely

sequenced. Furthermore, two of the three NCBI-listed polymorphisms at positions 1343 and 3751 were

not present in an additional independent set of 10 samples studied. We did identify two additional

polymorphisms, each observed in only one sample, a GTTT deletion (bases 4473 - 4476) and an ATT

insertion at position 4508.

We examined the data for any relation to age of onset. The Stanley Brain Bank samples (n=15)

revealed that none of the five schizophrenia individuals aged 13–19 years were homozygous for the

CAA insert, while six of the 10 schizophrenia individuals with disease onset at age 20–42 years were

homozygous for the CAA insert. We also identified 2/15 (15%) bipolar and 1/15 (7%) major depression

samples to be homozygous for the CAA insert.

In a group of African and Afro-American samples, the prevalence of the CAA insert was three out

of 60, or 5%, in schizophrenia DNA samples, in contrast to two out of 111 or 1.8% in control DNA

samples.

39

Study No. 2: Increased Expression of Calcium/calmodulin-dependent protein kinase IIβ in

Frontal Cortex in Schizophrenia and Depression.


In searching for genes dysregulated in schizophrenia, we measured the expression of the two

splice variants of calcium/calmodulin-dependent protein kinase II (CaMKIIα and CaMKIIβ) in post-

mortem frontal cerebral cortex tissues from patients who had died with schizophrenia, bipolar disorder,

or severe depression. The mRNA levels of expression of these two splice variants were measured by

Real–Time Quantitative PCR using an Mx4000 instrument. The values for the expression of CaMKIIα

and CaMKIIβ were normalized by the expression of β-glucuronidase in the tissues. The expression of

CaMKIIα was significantly elevated in the depression tissues by 29%. The expression of CaMKIIβ was

significantly elevated in the schizophrenia tissues by 27%, and in the depression tissues by 36%.

Because CaMKIIβ influences the expression of many neuroreceptors and influences neural outgrowth

and pruning, its altered expression in the cerebral cortex in schizophrenia or depression may contribute

to these diseases.


Inheritance and twin studies indicate that schizophrenia has a genetic component and that about

50% of individuals carrying these genes develop the disease. Furthermore, the risk of schizophrenia is

similar in the offspring of both affected and unaffected monozygotic twins. The fact that the healthy

twins have the same susceptibility genes for schizophrenia but do not express the phenotype indicates

that other factors must contribute to the etiology of schizophrenia. The inheritance pattern in families

indicates that schizophrenia cannot be due to a single disease gene but is likely a result of

polymorphisms in multiple interacting gene loci (Cardno and Gottesman, 2000) and altered expression

of several genes (Buckland et al., 2004). In order to search for genes with altered expression in

schizophrenia, previous work, using subtractive hybridization between post-mortem frontal cortex

samples from control and schizophrenia patients, had identified two genes with elevated expression in

the schizophrenia tissues, calcium-calmodulin-dependent protein kinase IIβ and Nogo (Novak et al.,

2000; Novak et al., 2002). Using an increased number of post-mortem human samples, and testing for

both CaMKII subunits, CaMKIIα and CaMKIIβ, the present study extends the earlier work on

schizophrenia tissues (Novak et al., 2000).

40

The gene for the α subunit of CaMKII is located at 5q32, a locus which has been linked to

schizophrenia (Lewis et al., 2003; Paunio et al., 2001; Sklar et al., 2004). CaMKIIα is highly expressed

in neurons, where it mediates many aspects of neurone function (Colbran, 2004; Colbran and Brown,

2004). The translocation time of CaMKII to the postsynaptic density, a key variable in neuronal

function, is determined by the ratio of CaMKIIα to CaMKIIβ isoforms (Shen and Meyer, 1999). At the

postsynaptic density, CaMKII acts as a decoder of Ca2+ oscillation frequencies (Colbran, 2004;

Soderling, 2000) and a molecular memory of Ca2+ signals (Shen et al., 2000). Other CaMKII splice

variants are targeted to the nucleus and influence gene transcription (Hardingham and Bading, 1999;

Sun et al., 1994). During early development, CaMKII is essential for synaptic density and maturation

(Borodinsky et al., 2002; Rongo and Kaplan, 1999; Wu and Cline, 1998). Schizophrenia usually has an

onset in early adulthood, although it may be present during puberty. This may correspond to the time

when the CaMKII-Ca2+ decoding parameters change, and an absence of this change may cause neurons

to remain immature (Mayford et al., 1995). CaMKIIα mutations can cause neural defects possibly

related to some aspects of schizophrenia (Gordon et al., 1996), such as disturbed behavior and cognition

(Chen et al., 1994; Giese et al., 1998; Mayford et al., 1996a; Silva et al., 1992a; Silva et al., 1992b).

Therefore, because CaMKII has a role in neurodevelopment, because some aspects of disturbed

behavior that occur with CaMKII mutations may relate to schizophrenia, and because our earlier work

on subtractive hybridization had indicated alterations in CaMKII isoforms, we measured the levels of

the two major CaMKII transcripts in post-mortem frontal cortex tissues. The present study found

CaMKIIβ to be elevated in schizophrenia tissues, and also, surprisingly, in tissues from severely

depressed individuals.


Postmortem tissues were donated by the Stanley Foundation Brain Consortium (Bethesda, MD),

courtesy of Drs. Llewellyn B. Bigelow, Juraj Cervenak, Mary M. Herman, Thomas M. Hyde, Joel E.

Kleinman, José D. Paltn, Robert M. Post, E. Fuller Torrey, Maree J. Webster, and Robert H.Yolken

(Torrey et al., 2000). A total of 60 human frontal cerebral cortex tissues (Brodmann area 10) were

provided by the Stanley Foundation Brain Consortium (Bethesda, MD) from a collection of 60 brains,

fifteen each from individuals diagnosed (DSM IV criteria) with either schizophrenia, bipolar disorder,

non-psychotic depression, or neurological controls (Table 5). The diagnosis of schizophrenia was made

41

by at least two psychiatrists independently examining the case records and using DSM-IV criteria

(American Psychiatric Association, 1994).

3.1. Extraction of total RNA from tissues

TRIzoL® reagent (Invitrogen, Burlington, ON) was used according to the manufacturer’s

guidelines to extract total RNA from the tissues. The tissue was homogenized (Polytron, PT-10 probe,

Brinkmann Instruments, Westbury, NY) in TRIzoL® Reagent (1 ml per 50 mg of tissue) and incubated

at room temperature for 5 min before chloroform (0.2 ml per ml of TRIzoL® Reagent) was added, and

the capped tubes were shaken for 15 s. The samples were incubated at 25°C for 2 min and later

centrifuged at 12,000 x g at 4°C for 15 min. To isolate the total RNA, the aqueous upper phase was

transferred to a new tube. The RNA was precipitated using isopropyl alcohol (0.5 ml per ml of TRIzoL®

Reagent). The samples were incubated at 25°C for 10 min and centrifuged at 12,000 x g at 4°C for 10

min. The RNA pellet was washed with 75% ethanol (1 ml per ml of TRIzoL® Reagent), mixed, and

centrifuged at 12,000 x g at 4°C for 15 min. The RNA pellet was air dried for 5 min, dissolved in RNA

Storage Solution (Ambion), and incubated at 60°C for 10 min. A housekeeping gene, β-glucuronidase,

was used to assess the quality and abundance of RNA for each tissue sample. Although our preliminary

experiments also examined whether β-actin would be a useful housekeeping gene, we found that the

absolute values of β-actin in the tissues were an order of magnitude higher than the expression of

CaMKIIα and CaMKIIβ. Only those tissues were used which showed abundant β-glucuronidase gene

expression and which yielded specific products by means of real-time PCR. Four samples with

anomalously low expression of β-glucuronidase or CaMKIIα and CaMKIIβ cDNA (less than two

standard deviations below average) may have been inadvertently thawed during storage and were,

therefore, excluded.

42

Table 5. Clinical data and findings on post-mortem frontal cerebral cortex tissues.

CaMKII! CaMKII"

disorder hours years

pg CaMKII! /pg

"-glucuronidase

pg CaMKII" /pg "-

glucuronidase

4 34 m Suicide: jumped 23 15 Risperidone, valproate, venlafaxine 5.1 10.0

6 54 m Subdural hematoma 39 14 Lithium, carbamazepine 1.5 4.7

9 30 m Malnutrition, dehydration 45 16 Valproate, bupropion 4.9 7.7

13 30 m Pneumonia, myocarditis 31 8 Lithium, clozapine 2.6 4.9

18 61 f Suicide: overdose 60 43 Fluoxetine, valproate 4.6 5.2

21 31 m Suicide: jumped 28 10 Haloperidol, trazadone, trihexiphenidyl 1.5 2.6

22 25 f Suicide: hanged 24 6 Thiothixene, carbamazepine, lithium, trazodone 5.3 10.9

30 48 m Suicide: immolation 13 21 Untreated for over 20 yrs 3.8 6.5

31 37 f Suicide: overdose 29 23 Lithium, bupropion, !clonazepam, lorazepam 3.4 6.8

32 50 f Malnutrition, dehydration 18 16 None, untreated for several months 1.7 5.3

42 57 m Cardiac 19 27 Haloperidol, diphenhydramine 1.5 3.1

44 50 m Suicide: jumped 19 23 Valproate, clozapine, flurazepam, benzotropine 3.0 6.6

54 50 f Pulmonary emboli 62 25 Valproate, clomipramine 2.4 5.7

Av ± s.e. = 43 ± 3 Av ± s.e. = 32 ± 4

Depression

5 53 f Alcohol intoxication 40 42 Lithium, trazodone 5.3 10.9

7 51 m Suicide: gunshot 26 1 Nefazadone, hydroxyzine 1.7 4.7

23 65 m Cardiac 19 20 No medication for 5 yrs. 2.8 4.7

33 42 m Suicide: hanged 7 10 Temazepam but off medications for > 2 weeks 6.7 9.5

34 43 m Cardiac 43 13 Trimipramine 4.4 4.7

36 32 f Suicide: overdose 47 1 Imipramine, amitriptyline, !nortriptyline, clonazepam 2.3 4.2

37 42 f Cardiac 25 3 Fluoxetine, lithium 2.9 4.5

38 52 m Cardiac 12 6 No medication for 6 yrs. 5.3 8.9

43 56 m Cardiac 23 4 Sertraline 7.3 9.9

46 39 m Suicide: carbon monoxide 23 22 Never treated 2.3 7.7

49 44 f Suicide: overdose 32 17 Fluoxetine, imipramine, lorazepam 2.3 7.2

52 47 m Cardiac 28 20 Fluoxetine, nefazadone 5.5 10.7

55 30 f Suicide: overdose 33 11 None 5.6 10.4

Av ± s.e. = 46 ± 3 Av ± s.e. = 28 ± 3

Control

2 35 f Cardiac 23 None 5.8 8.9

3 53 m Cardiac 28 None 2.0 4.8

8 29 f Motor vehicle accident 42 Saw counselor for weight control 3.9 5.5

16 52 m Cardiac 8 None 4.7 6.7

20 68 f Pulmonary embolus 13 None 3.8 5.4

25 52 m Cardiac 28 None 3.8 5.3

27 41 m Pulmonary embolus 11 None 3.5 5.2

28 57 f Motor vehicle accident 26 None 2.6 3.6

41 52 m Cardiac 22 None 1.9 3.1

51 58 m Cardiac 27 None 3.6 6.4

53 44 f Cardiac 25 None 4.3 8.2

57 42 m Cardiac 27 None 2.9 7.9

58 44 m Cardiac 10 None 0.8 2.7

60 35 f Pulmonary embolus 40 None 1.7 3.8

Av ± s.e. = 47 ± 3 Av ± s.e. = 24 ± 3

Schizophrenia

1 25 m Suicide: hanged 32 5 Risperidone, paroxetine 5.5 9.9

11 52 m Cardiac 61 32 None; untreated for over 20 yrs. 4.4 5.5

12 30 f Suicide: jumped 60 8 Thiothixene, desipramine 5.2 6.8

15 44 m Cardiac 50 27 Haloperidol, carbamazepine, fluoxetine, clonazepam 1.1 2.4

17 30 m Pneumonia 32 17 Risperidone,thioridazine 5.4 5.6

35 31 m Suicide: jumped 14 13 Clozapine 2.0 3.1

39 60 f Cardiac 40 45 None; had ECT 5.7 10.3

40 56 f Suicide: overdose 12 32 Haloperidol, lithium, diphenhydramine, chloral hydrate 4.7 9.8

48 60 m Accidental drowning 31 33 Thioridazine, amitriptyline 1.6 6.6

50 62 f Motor vechicle accident 26 24 None; untreated for several months 3.2 8.1

56 32 m Acute alcohol intoxication 19 5 Clozapine 3.3 9.7

59 49 f Cardiac 38 24 Haloperidol, clozapine, clonazepam 2.0 6.6

Av ± s.e. = 44 ± 4 Av ± s.e. = 35 ± 5

Illness MedicationBipolar Age, m,f Death

P.M.

interval

43

The samples were not treated with DNAase because it would have resulted in further dilution of

the RNA. Instead, the primers used in the Quantitative Real-Time PCR were designed to span across

intron boundaries to prevent amplification of any genomic DNA. Furthermore, a series of preliminary

PCR reactions were done under various conditions to ensure that no mispriming occurred. Optical

density readings during the Real-Time Quantitative PCR runs indicated whether mispriming or whether

primer dimers occurred. The final total RNA concentration was 5 µg of RNA per 2 to 6 µL of water, as

determined by optical density. This solution was further diluted with RNAase-free water to 5 µg RNA

per 11 µL water for cDNA synthesis. Because mRNA only comprises approximately 10% of total RNA

and is highly susceptible to degradation, the quality of the mRNA was important to determine. This was

done by analyzing the 3’ to 5’ ratio of β-glucuronidase. Although all the samples were standardized to

contain the same amount of total RNA, the mRNA levels could vary depending on the extent of mRNA

degradation. The results show that this effect was minimized by standardizing the expression values

with β-glucuronidase. No non-normalized data were used. All the data presented are normalized to β-

glucuronidase, resulting in the dimensionless unit of expression for the CaMKII variants as (pg/µg total

RNA)/(pg β-glucuronidase /µg total RNA). The 3’/5’ ratio also provided an indication of the degree of

completion of the reverse transcription reaction, especially when using oligo-dT primers in the present

study.

3.2. First-strand cDNA synthesis

The SUPERSCRIPT IIITM First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad,

California) was used for cDNA synthesis using oligo (dT)12-18 and 2 µg total RNA. The samples were

incubated at 50°C for 50 min to allow synthesis of the cDNA, and the reaction was terminated at 85°C

for 5 min, chilled on ice for 5 min, and treated with E. coli RNase H (37 ˚C, 20 min). The resultant 21 µl

cDNA samples were stored at -20°C for later use.

3.3. Real-time Quantitative Polymerase Chain Reaction

The method used to quantitate cDNA was the Quantitative Real-Time PCR method. The levels

of cDNA were determined via fluorescence by the thermal cycler during the PCR cycle, and the

instrument’s software calculated the final data. These data were downloaded into an Excel spreadsheet.

Thus, there is no representative image of the PCR output reactions.

44

Primers were designed using the Primer Express software (Perkin-Elmer Applied Biosystems,

Foster City, California) and Oligo 4.0 (National Biosciences, Plymouth, Minnesota), and synthesized by

Sigma-Genosys (Oakville, Ontario). PCR amplification, real-time quantitation and analysis were done

using the Mx4000TM Multiplex Quantitative PCR System (Stratagene, La Jolla, California). A standard

was prepared for each target gene by conventional PCR, using the same primer pairs later used in real-

time quantitative PCR. The PCR products were excised and extracted from the gel using QIAEX II ®

DNA Extraction Kit (Qiagen, Inc., Santa Clarita, California). The DNA sample (standard) was diluted

ten-fold for optical density measurements at 260 nm. The concentration of the standard was determined

from its optical density (Ausubel, 1995).

The reaction mixture for real-time PCR was prepared using the Brilliant™ SYBR® Green QPCR

Core Reagent Kit (Stratagene, La Jolla, California). The company protocol was followed for a reaction

mix containing 1.5 mM MgCl2. The total reaction volume of 25 ml contained 0.25 µl of forward primer

(10 mM) and 0.25 µl (10mM) of reverse primer. The β-glucuronidase forward primer (5’ to 3’) at the 5’

end of the mRNA was CTCTGACAACCGACGCC and the reverse primer (5’ to 3’) was

TACCACACCCAGCCGAC. The β-glucuronidase forward primer (5’ to 3’) at the 3’ end of the mRNA

was GCCGATTTCATGACTGAACAG and the reverse primer (5’ to 3’) was

TATCTCTCTCGCAAAAGGAACGC. The CAMKIIα forward primer (5’ to 3’) was

GGGGGAAACAAGAAGAGC and the reverse primer (5’ to 3’) was GTGCTCTCTGAGGATTC. The

CAMKIIβ forward primer (5’ to 3’) was GTCCACCGCGGCCTC and the reverse primer (5’ to 3’) was

TTTTGGTGCTATTCGTCTGGG.

The SYBR® Green dye was diluted 1:2000 and the Rox reference dye was diluted 1:500. 3 ml of

1/10 diluted cDNA sample (equivalent to 28.6 ng of total RNA) was used per reaction. The cycling

parameters were 95°C for 10 min to activate the SureStartTM Taq, followed by 40 cycles of 95°C

denaturation for 30 s, 58°C reannealing for 30 s, and extension at 72˚ C for 40 s. In the analysis, to

minimize the effect of background noise and well-to-well variation on the results observed, our data

were normalized against the Rox reference dye and the algorithm of adaptive baseline. Each reaction

was repeated at least four times, using two independent cDNA preparations.

3.4. Determination of mRNA degradation.

The degree of degradation of the mRNA was determined by real-time quantitative PCR as the

ratio of the 5’-end template to the 3’-end template amount of β-glucuronidase. In absence of

45

degradation, the ratio should be equal to 1. Of the total number of four samples which had been

excluded in this study, two samples showed a degradation ratio greater than two standard deviations

from average.


The amount of the CaMKIIα transcript in the control human frontal cortices was 3.2 ± 0.4

(pg/µg total RNA)/(pg β-glucuronidase/µg total RNA), the units of which are essentially dimensionless

(see later). The corresponding value for the fifteen schizophrenia tissues was 3.7 ± 0.5, not significantly

different from the control value (Figure 7). This increase in CaMKIIα was not statistically significant

(TDIST, p = 0.26) (Table 6). We found a statistically significant increase in the CaMKIIα transcript in

samples from people who had suffered with depression (4.2 ± 0.5, an increase of 29%) (TDIST, p =

0.02) (Figure 7). There was no change in samples from patients with bipolar disorder (-2%).

The amount of the CaMKIIβ transcript in the control human frontal cortices was 5.5 ± 0.7. The

value for the twelve schizophrenia tissues was 7.0 ± 0.8, an increase of 27% (Figure 8). This increase

was statistically significant using a t test for small samples (TDIST, p = 0.01). There was also a

significant increase in the CaMKIIβ levels in samples from patients with depression; the value was 7.6 ±

0.8, an increase of 36% (TDIST, P = 0.002) (Figure 8), as compared with that of controls. There was no

statistically significant difference between controls and samples from patients with bipolar disorder.

As noted above, all values are given as pg transcript per µg total RNA, divided by pg β-glucuronidase

per µg total RNA. The values, therefore, represent dimensionless units of pg transcript per pg β-

glucuronidase transcript. This was done because standardization to a housekeeping gene, β-

glucuronidase, markedly reduced the effect of mRNA degradation. Without this standardization, the

levels of CaMKIIα transcript per total RNA decreased with increasing 3’ to 5’ transcript ratio (measured

for β-glucuronidase, Figure 9, top). Expressing CaMKIIα transcript level as a ratio of a housekeeping

gene, β-glucuronidase, which is also subject to degradation, minimized the effect of the degradation

(Figure 9, bottom).

46

Figure 7. CaMKIIα in schizophrenia and depression. The amounts of CaMKIIα transcripts in the postmortem human frontal cortices from control individuals and from those who had died with schizophrenia or major depression.

47

Figure 8. CaMKIIβ in schizophrenia and depression. The amounts of CaMKIIβ transcripts in the postmortem human frontal cortices from control individuals and from those who had died with schizophrenia or major depression. Solid lines indicate mean; dashed lines indicate s.e.

48

CaMKII transcript adjusted by

β-glucuronidase % difference from controls

CaMKIIα CaMKIIβ CaMKIIα CaMKIIβ

Normal 3.2 ± 0.4 5.5 ± 0.5 — —

Bipolar disorder 3.2 ± 0.4 6.1 ± 0.7 -2% 11%

Depression 4.2 ± 0.5 7.6 ± 0.8 29%a 36% b

Schizophrenia 3.7 ± 0.5 7.0 ± 0.8 13% d 27% c

Table 6. Levels of CaMKIIα and CaMKIIβ transcripts in a control and three disease groups and percent change in disease group levels as compared to healthy controls. a. TDIST p=0.02; b. TDIST p=0.002; c. TDIST p=0.01; d. TDIST p=0.26

It was necessary to determine whether the administration of antipsychotic medications during the

lifetime of the individuals altered the amount of CaMKIIβ expression. The expression of CaMKIIβ was

6.35 ± 1.4 (mean ± s.e.; n = 6) for the antipsychotic-treated bipolar patients (see Table 5) and 6.0 ± 0.4

(mean ± s.e.; n = 7) for the non-antipsychotic-treated bipolar patients; there was no statistically

significant difference between these values. Moreover, the expression of CaMKIIβ was 6.57 ± 0.8

(mean ± s.e.; n = 15) for the antipsychotic-treated schizophrenia and bipolar patients (see Table 5) and

6.58 ± 0.55 (mean ± s.e.; n = 10) for the non-antipsychotic-treated schizophrenia and bipolar patients;

there was no statistically significant difference between these values.

It was further necessary to determine whether suicide significantly altered the amount of

CaMKIIβ expression. The expression of CaMKIIβ was 7.1 ± 0.6 (mean ± s.e.; n = 17) for those

individuals who died by suicide (see Table 5) and 6.3 ± 0.6 (mean ± s.e.; n = 20) for all those who did

not so die (omitting the controls); the difference of 12% was not statistically significant. Moreover,

considering only those patients who died with depression, the expression of CaMKIIβ was 7.3 ± 1.0

(mean ± s.e.; n = 6) for those depressed individuals who died by suicide (see Table 5) and 7.8 ± 1.1

(mean ± s.e.; n = 7) for those who did not so die; the difference of 6% was not statistically significant.

Although no Bonferroni correction was applied to these data, there were four diagnostic groups and two

splice variants, making potentially twelve individual t-tests; thus, using a Bonferroni correction would

be overly stringent.

49

Finally, there was no relation between the post-mortem interval or patient ages (Table 5) with the

elevation of either splice variant. For example, the ages of the patients averaged 43 ± 3 y, 46 ± 3 y, 47 ±

3 y and 44 ± 4 y, for the bipolar patients, the depressed individuals, the controls, and those with

schizophrenia, respectively; these values were not statistically significantly different from each other.

Furthermore, the post-mortem intervals were 32 ± 4 h, 28 ± 3 h, 24 ± 3 h, and 35 ± 5 h, respectively.

While the control value of 24 ± 3 h was statistically significantly lower than that for the bipolar and

schizophrenia individuals, this control value was not statistically significantly different from the value of

28 ± 3 h for the depressed individuals who had the most elevated expression of CaMKIIα and CaMKIIβ

(Figures 7 and 8). Although tissue pH is a common measure for post-mortem tissue, insufficient tissue

remained for this measurement. The values for the expression of β-glucuronidase did not correlate with

the post-mortem interval (data not shown).

50

Figure 9. Effect of mRNA degradation was minimized by normalization with a housekeeping gene. Solid lines indicate mean. Top: Without standardization, the levels of CaMKIIα template per total RNA decreased with increasing 3’ to 5’ β-glucuronidase template ratio. An increase in the 3’ to 5’ ratio was a reflection of an increase in mRNA degradation. Bottom: Expressing the CaMKIIα template level as a ratio of a housekeeping gene, β-glucuronidase, minimized the effect of mRNA degradation.

51

Study No. 3: Nogo A, B and C Expression in Schizophrenia, Depression and Bipolar Frontal

Cortex, and correlation of Nogo expression with CAA/TATC polymorphism in 3’UTR.


Schizophrenia may result from altered gene expression leading to abnormal neurodevelopment.

In a search for genes with altered expression in schizophrenia, our previous work on human frontal

cerebral cortex found the mRNA of Nogo, a myelin associated protein which inhibits the outgrowth of

neurites and nerve terminals, to be overexpressed in schizophrenia. Because those earlier results did not

examine tissues for the separate Nogo A, B and C splice variants from age- and sex-matched

individuals, we repeated the study for all three splice variants, using a new set of tissues from matched

individuals, and using the more accurate method of quantitative real-time PCR (polymerase chain

reaction). We found Nogo C to be overexpressed by 26% in the schizophrenia tissues, which is in

accordance with our earlier results. The expression of Nogo B was statistically significantly reduced by

17% in the frontal cortices from individuals who had been diagnosed as having had severe depression.

Furthermore, we show that there is a direct correlation between the expression of Nogo A and C and the

presence of alleles with a CAA insert, irrespective of disease status. While upregulation of Nogo C

expression may play a role in schizophrenia, altered Nogo B may contribute to the clinical condition of

depression. Nogo A showed a statistically non-significant increase in expression in schizophrenia.


Schizophrenia may arise from abnormal neurodevelopment due to aberrant neuron formation or

altered expression of proteins for brain development (Bunney and Bunney, 2000; Goldman-Rakic and

Selemon, 1997). One such critical protein may be Nogo (also known as reticulon 4, RTN4, NI 250 or

RTN-X), which is highly expressed in CNS during neurodevelopment (Josephson et al., 2001). Nogo

inhibits the outgrowth of neurites and nerve terminals (Chen et al., 2000a; Prinjha et al., 2000), and may

have an important role in regulating neuronal migration and plasticity. The Nogo gene encodes three

alternatively spliced variants, Nogo A, Nogo B, and Nogo C, which share a common C-terminal domain

of 188 amino acids containing two putative transmembrane domains (Skaper et al., 2001). All three

forms of Nogo have neuron inhibitory activity (GrandPre et al., 2000). Hence, any significantly altered

expression of this gene may contribute to abnormal neuronal organization in schizophrenia.

Using competitive PCR, our previous work detected an increase in Nogo mRNA in seven post-

52

mortem frontal cerebral cortices from individuals who had schizophrenia (Novak et al., 2000). However,

the individuals in this earlier study were not age- and sex matched and the study did not examine tissues

for the separate Nogo A, B and C splice variants. The present study was done for all three splice variants

on a new larger sample of age- and sex-matched individuals, using the more accurate method of real-

time quantitative PCR. The data from individuals with schizophrenia were compared to healthy controls,

depressed individuals and individuals suffering from bipolar disorder. Nogo expression levels were also

compared with the polymorphic status of the CAA/TATC insert in the 3’UTR of the Nogo gene (Novak

et al., 2002).


Postmortem tissues were donated by the Stanley Foundation Brain Consortium (Bethesda, MD),

courtesy of Drs. Llewellyn B. Bigelow, Juraj Cervenak, Mary M. Herman, Thomas M. Hyde, Joel E.

Kleinman, José D. Paltn, Robert M. Post, E. Fuller Torrey, Maree J. Webster, and Robert H.Yolken

(Torrey et al., 2000). A total of 60 human frontal cerebral cortex tissues (Brodmann area 10) were

provided by the Stanley Foundation Brain Consortium (Bethesda, MD) from a collection of 60 brains,

fifteen each from individuals diagnosed (DSM IV criteria) with either schizophrenia, bipolar disorder,

non-psychotic depression, or neurological controls (Table 8). The diagnosis of schizophrenia was made

by at least two psychiatrists independently examining the case records and using DSM-IV criteria

(American Psychiatric Association, 1994).

3.1. Extraction of total RNA from tissues

TRIzoL® reagent (Invitrogen, Burlington, ON) was used according to the manufacturer’s

guidelines to extract total RNA from the tissues. The tissue was homogenized (Polytron, PT-10 probe,

Brinkmann Instruments, Westbury, NY) in TRIzoL® Reagent (1 ml per 50 mg of tissue) and incubated

at room temperature for 5 min before chloroform (0.2 ml per ml of TRIzoL® Reagent) was added, and

the capped tubes were shaken for 15 s. The samples were incubated at 25°C for 2 min and later

centrifuged at 12,000 x g at 4°C for 15 min. To isolate the total RNA, the aqueous upper phase was

transferred to a new tube. The RNA was precipitated using isopropyl alcohol (0.5 ml per ml of TRIzoL®

Reagent). The samples were incubated at 25°C for 10 min and centrifuged at 12,000 x g at 4°C for 10

min. The RNA pellet was washed with 75% ethanol (1 ml per ml of TRIzoL® Reagent), mixed, and

53

centrifuged at 12,000 x g at 4°C for 15 min. The RNA pellet was air dried for 5 min, dissolved in RNA

Storage Solution (Ambion), and incubated at 60°C for 10 min.

Two housekeeping genes were analyzed, β-actin and β-glucuronidase. Our experiments indicated

that the absolute values of β-actin in the tissues were an order of magnitude higher than the expression

of Nogo, making it less suitable as a housekeeping gene. A gene closer in magnitude of expression to

Nogo, β-glucuronidase, was used to assess the quality and abundance of mRNA for each tissue sample.

Only those tissues were used which showed abundant β-glucuronidase gene expression and which

yielded specific products by means of real-time PCR. The samples were not treated with DNase to avoid

further dilution of the RNA. Instead, the primers used in the Quantitative Real-Time PCR were designed

to span across intron boundaries to prevent amplification of any genomic DNA. A series of preliminary

PCR reactions were done under various conditions, followed by optical density readings during the

Real-Time Quantitative PCR runs to confirm absence of mispriming. The final total RNA concentration

was 5 µg of RNA per 2 to 6 µL of water, as determined by optical density. This solution was diluted

with RNase-free water to 5 µg RNA per 11 µL water for cDNA synthesis.

3.2. First-strand cDNA synthesis

The SUPERSCRIPT IIITM First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad,

California) was used for cDNA synthesis using oligo (dT)12-18 and 2 µg total RNA. The samples were

incubated at 50°C for 50 min to allow synthesis of the cDNA, and the reaction was terminated at 85°C

for 5 min, chilled on ice for 5 min, and treated with E. coli RNase H (37 °C, 20 min). The resultant 21 µl

cDNA samples were stored at -20°C for later use.

3.3. Real-time Quantitative Polymerase Chain Reaction

The method used to quantitate cDNA was the Quantitative Real-Time PCR method. The levels

of cDNA were determined via fluorescence by the thermal cycler during the PCR cycle, and the

instrument’s software calculated the final data. These data were downloaded into an Excel spreadsheet,

representing the final output of the PCR reactions. We found it very important to include test samples of

known concentration to confirm the accuracy of the analysis within the concentration range of the

samples being analyzed. This is rarely done in other studies, which only rely on secondary indicators of

54

validity of their data, such as slope and reaction efficiency, which we deemed insufficient from our

experience. The target value is for the detected concentration of the test samples to be within 5% of the

known concentration.

Primers were designed using the Primer Express software (Perkin-Elmer Applied Biosystems,

Foster City, California) and Oligo 4.0 (National Biosciences, Plymouth, Minnesota), and synthesized by

Sigma-Genosys (Oakville, Ontario). PCR amplification, real-time quantitation and analysis were done

using the MX4000TM Multiplex Quantitative PCR System (Stratagene, La Jolla, California). A standard

was prepared for each target gene by conventional PCR, using the same primer pairs later used in real-

time quantitative PCR. The PCR products were excised and extracted from the gel using QIAEX II ®

DNA Extraction Kit (Qiagen, Inc., Santa Clarita, California). The DNA sample (standard) was diluted

ten-fold for optical density measurements at 260 nm. The concentration of the standard was determined

from its optical density (Ausubel, 1995).

The reaction mixture for real-time PCR was prepared using the Brilliant™ SYBR® Green QPCR

Core Reagent Kit (Stratagene, La Jolla, California). The company protocol was followed for a reaction

mix containing 1.5 mM MgCl2. The total reaction volume of 25 µl contained 0.25 µl of forward primer

(10 µM) and 0.25 µl (10µM) of reverse primer. The forward primers (5’ to 3’) were

CCGATACAGAAAAAGAGGACAG for Nogo A, GGGCTCAGTGGTTGTTGACC for Nogo B and

CGTGACAAGAGATGGACGG for Nogo C. The reverse primer (5’ to 3’) for Nogo A, B and C was

AGGCTGGCACCAAACACC. The β-glucuronidase forward primer (5’ to 3’) at the 5’ end of the

mRNA was CTCTGACAACCGACGCC and the reverse primer (5’ to 3’) was

TACCACACCCAGCCGAC. The β-glucuronidase forward primer (5’ to 3’) at the 3’ end of the mRNA

was GCCGATTTCATGACTGAACAG and the reverse primer (5’ to 3’) was

TATCTCTCTCGCAAAAGGAACGC.

The SYBR® Green dye was diluted 1:2000 and the Rox reference dye was diluted 1:500. 3 µl of

1/10 diluted cDNA sample (equivalent to 28.6 ng of total RNA) was used per reaction. The cycling

parameters were 95°C for 10 min to activate the SureStartTM Taq, followed by 40 cycles of 95°C

denaturation for 30 s, 58°C reannealing for 30 s, and extension at 72° C for 40 s. In the analysis, to

minimize the effect of background noise and well-to-well variation on the results observed, our data

were normalized against the Rox reference dye and the algorithm of adaptive baseline. Each reaction

was repeated at least four times, using two independent cDNA preparations.

55

3.4. Determination of mRNA degradation.

The degree of degradation of the mRNA was determined by real-time quantitative PCR as the

ratio of the 3’-end to the 5’-end of the template of β-glucuronidase. High ratio represents high degree of

mRNA degradation. Samples with degradation ratio greater than three standard deviations from average

were excluded. The 3’/5’ ratio also provided an indication of the degree of completion of the reverse

transcription reaction, especially when using oligo-dT primers in the present study.

3.5. Detection of a CAA / TATC insert

Data and methods were described in Study No. 1 (Novak et al., 2002).

3.6. Statistical methods.

T distribution (TDIST) analysis was done for all sample groups. It returns the Percentage Points

(probability) for the Student t-distribution where a numeric value (x) is a calculated value of t for which

the Percentage Points are to be computed. The t-distribution is used in the hypothesis testing of small

sample data sets. Standard error has been calculated for all results by the formula SE=SD/SQRT(n) and

presented as value ± SE (Ausubel, 1987).

56


All values are expressed as pg template per µg total RNA, all divided by pg β-glucuronidase per

µg total RNA. The values, therefore, possess no units other than the pg template per pg β-glucuronidase.

This was done because standardization to a housekeeping gene, β-glucuronidase, has greatly reduced the

effect of mRNA degradation (Figure 10). Without this adjustment, expressing values as pg per total

RNA would be misleading, because a volume of total RNA contains different amounts of mRNA due to

its high susceptibility to degradation. Standardization to β-glucuronidase has also eliminated

introduction of errors arising from variation in cDNA synthesis efficiency or pipetting during sample

manipulation and dilutions.

We have analyzed the level of mRNA degradation by determining the ratio of β-glucuronidase at

the 3’ end and at 5’ end (Figure 10). High degradation is represented by a high 3’ to 5’ ratio as mRNA is

known to primarily degrade from the 5’ end (Meyer et al., 2004). Samples with degradation levels

higher than three standard deviations from average were excluded, because adjustment by β-

glucuronidase was ineffective (the slope remained high) in these highly degraded samples and the

template levels reflected a decrease due to degradation rather than true template levels. If

standardization by glucuronidase is effective, the slope of the graph of template level (measured at the 3’

end) versus level of degradation (3’/5’) should approach zero, as level of degradation should no longer

have effect on the level of template measured. (Figure 10b.) The following samples were excluded at

different stages of the analysis. Samples 26, 24 contained no RNA. Samples 5, 10, 12, 45 failed to

amplify β-glucuronidase within levels reliably measurable by our instrument, making degradation

analysis impossible. This was an indication of very low mRNA content; furthermore, all these samples

were lower in expression than the group average less 2SD. The following samples, 6, 9, 11, 14, 19, 29,

32, 47, 48, 49, and 59 were both low in β-glucuronidase and highly degraded. These latter samples had

degradation levels higher than group average +3.2 SD and were, therefore, omitted, consistent with

Chauvenet’s criterion (Geigy, 1959). Standardization with β-glucuronidase was ineffective for these

degraded samples and they showed a high correlation of decreasing mRNA levels with the level of

degradation even after standardization.

57

a.

b.

Figure 10. Standardization eliminates effects of degradation. Effect of mRNA degradation was minimized by normalization with a housekeeping gene. (a) Before standardization and removal of degraded samples. (b) After standardization and removal of degraded samples. Expressing the Nogo A template level as a ratio of a housekeeping gene, β-glucuronidase, and discarding highly degraded samples (> average + 3SD), minimized the effect of mRNA degradation. Note that the units before standardization are pg template per µg total RNA. After standardization the units become pg Nogo A per pg β-glucuronidase.

58

The amount of Nogo A transcript in the control human frontal cortices was 7.7 ± 0.4 (pg/µg total

RNA) / (pg of β-glucuronidase/µg total RNA) and in schizophrenia tissues it was 8.6 ± 0.8, this 12%

increase was not statistically significant (TDIST, p<0.3) (Table 7, Figure 11). Nogo A did not

significantly change in bipolar disorder (7.0 ± 0.4, -9%, TDIST, p<0.1) or depression (7.0 ± 0.5, -9%,

TDIST, p<0.2).

The Nogo B transcript showed a significant decrease in depression and, to a lesser degree, in

bipolar disorder. In the control human frontal cortices the level was 2.9 ± 0.1, in depression it was 2.4 ±

0.1, a 17% decrease (TDIST, p<0.002), and in bipolar disorder it was 2.6 ± 0.2, a 10% decrease (TDIST,

p<0.15) (Table 8, Figure 12). It did not significantly change in schizophrenia (2.8 ± 0.2, -3%, TDIST,

p<0.5).

Nogo C expression was significantly higher in schizophrenia than in the control group (Table 7).

The Nogo C level in control group was 27 ± 3 and in schizophrenia it was 34 ± 5, a 26% increase

(TDIST, p<0.03) (Figure 13). It did not change considerably in bipolar disorder (25 ± 4, an 8% decrease;

TDIST, p<0.6) or depression ( 29 ± 4, a 9% increase, TDIST, p<0.6).

Table 7. Levels and percent change of Nogo A, B and C templates in three disease groups as compared to controls. Amount of transcript is expresses as pg template per pg of β-glucuronidase.

Nogo A Nogo B Nogo C Nogo A Nogo B Nogo C

Control 7.7 ± 0.5 2.9 ± 0.1 27 ± 3 — — —

Bipolar dis. 7.0 ± 0.4 2.6 ± 0.2 25 ± 4 -9%, (P<0.1) -10%, (p<0.15) -8%, (p<0.6)

Depression 7.0 ± 0.5 2.4 ± 0.1 29 ± 4 -9%, (P<0.2) -17%, (p<0.002) +9%, (p<0.6)

Schizophrenia 8.6 ± 0.8 2.8 ± 0.2 34 ± 6 +12%, (P<0.3) -3%, (p<0.5) +26%, (p<0.05)

Amount of Transcript % difference from controls

59

Table 8. Clinical summaries for postmortem brain tissues. CAA insert: 0 homozygous for no insert; 1 heterozygous for CAA insert; 2 homozygous for CAA insert. Nogo A, B and C levels are in pg template per pg β-glucuronidase. m, f - male and female, respectively. PM interval - postmortem interval. SE = SD/SQRT(n).

disorder hours years !-glucuronidase !-glucuronidase !-glucuronidase insert

4 34 m Suicide: jumped 23 15 Risperidone, valproate, venlafaxine 9.39 2.97 39.4 1

13 30 m Pneumonia, myocarditis 31 8 Lithium, clozapine 4.73 1.58 16.9 2

18 61 f Suicide: overdose 60 43 Fluoxetine, valproate 6.21 1.85 20.1 1

21 31 m Suicide: jumped 28 10 Halperidol, trazadone, trihexiphenidyl 6.12 3.31 11.9 0

22 25 f Suicide: hanged 24 6 Thiothixene, carbamazepine, lithium, trazodone 8.32 2.50 46.9 0

30 48 m Suicide: immolation 13 21 Untreated for over 20 yrs 7.77 2.97 27.0 2

31 37 f Suicide: overdose 29 23 Lithium, bupropion, !clonazepam, lorazepam 7.31 2.11 25.2 0

42 57 m Cardiac 19 27 Haloperidol, diphenhydramine 6.66 3.36 10.7 0

44 50 m Suicide: jumped 19 23 Valproate, clozapine, flurazepam, benzotropine 6.56 2.79 30.2 0

54 50 f Pulmonary emboli 62 25 Valproate, clomipramine 6.81 2.71 18.8 0

mean ± S.E. 42 ± 4 7.0 ± 0.4 2.6 ± 0.2 24.7 ± 3.7

Depression

7 51 m Suicide: gunshot 26 1 Nefazadone, hydroxyzine 7.46 3.22 19.5 1

23 65 m Cardiac 19 20 No medication for 5 yrs. 6.24 2.56 19.7 2

33 42 m Suicide: hanged 7 10 Temazepam but off medications for > 2 weeks 7.78 2.53 44.7 1

34 43 m Cardiac 43 13 Trimipramine 3.22 1.59 18.1 0

36 32 f Suicide: overdose 47 1 Imipramine, amitriptyline, !nortriptyline, clonazepam 6.37 2.40 11.1 1

37 42 f Cardiac 25 3 Fluoxetine, lithium 7.03 2.73 24.3 1

38 52 m Cardiac 12 6 No medication for 6 yrs. 8.60 2.13 44.3 1

43 56 m Cardiac 23 4 Sertraline 6.90 2.08 31.2 0

46 39 m Suicide: carbon monoxide 23 22 Never treated 6.00 2.41 22.9 1

52 47 m Cardiac 28 20 Fluoxetine, nefazadone 7.93 2.22 40.3 1

55 30 f Suicide: overdose 33 11 None 9.38 2.61 44.3 0

mean ± S.E. 45 ± 3 7.0 ± 0.5 2.4 ± 0.1 29.1 ± 3.7

Control

2 35 f Cardiac 23 None 10.01 2.62 48.2 0

3 53 m Cardiac 28 None 6.60 2.65 23.8 0

8 29 f Motor vehicle accident 42 Saw counselor for weight control 9.12 4.07 29.7 1

16 52 m Cardiac 8 None 8.11 2.81 36.0 1

20 68 f Pulmonary embolus 13 None 7.53 2.83 25.8 0

25 52 m Cardiac 28 None 7.60 2.81 26.3 1

27 41 m Pulmonary embolus 11 None 7.78 2.48 27.4 0

28 57 f Motor vehicle accident 26 None 7.35 3.68 13.0 0

41 52 m Cardiac 22 None 6.61 3.13 14.5 0

51 58 m Cardiac 27 None 7.08 2.67 30.5 0

53 44 f Cardiac 25 None 9.33 3.01 48.5 0

57 42 m Cardiac 27 None 10.35 3.02 32.0 0

58 44 m Cardiac 10 None 5.90 2.83 12.0 0

60 35 f Pulmonary embolus 40 None 4.29 2.16 7.7 0

mean ± S.E. 47 ± 3 7.7 ± 0.4 2.9 ± 0.1 26.8 ± 3.3

Schizophrenia

1 25 m Suicide: hanged 32 5 Risperidone, paroxetine 11.27 2.96 9.5 2

15 44 m Cardiac 50 27 Haloperidol, carbamazepine, fluoxetine, clonazepam benzotropine6.31 3.22 12.6 0

17 30 m Pneumonia 32 17 Risperidone,thioridazine 8.55 2.51 33.3 0

35 31 m Suicide: jumped 14 13 Clozapine 4.36 2.99 37.4 0

39 60 f Cardiac 40 45 None; had ECT 9.76 1.84 39.1 1

40 56 f Suicide: overdose 12 32 Haloperidol, lithium, diphenhydramine, chloral hydrate 9.54 3.04 43.9 1

50 62 f Motor vechicle accident 26 24 None; untreated for several months 10.06 2.90 44.2 2

56 32 m Acute alcohol intoxication 19 5 Clozapine 8.95 3.04 50.8 2

mean ± S.E. 42 ± 5 8.6 ± 0.8 2.8 ± 0.2 33.9 ± 5.3

CAA Illness Medication Nogo A per Nogo B per Nogo C perBipolar Age Death

P.M.

intervalm,f

60

Figure 11. Nogo A in schizophrenia. The amount of Nogo A transcript in the control human frontal cortices and in the schizophrenia tissues. The average was 7.7 ± 0.4 pg Nogo A per pg of β-glucuronidase, and 8.6 ± 0.8 pg Nogo A per pg of β-glucuronidase, respectively. This was an increase of 12%, which was not statistically significant (TDIST, P= 0.3).

61

Figure 12. Nogo B in depression. The average amount of Nogo B transcript in the control human frontal cortices and in samples from patients suffering from depression was 2.9 ± 0.1 and 2.4 ± 0.1 pg Nogo B per pg of β-glucuronidase, respectively. This was a decrease of 17.3% in depression (from 2.91 to 2.41), which was statistically significant (TDIST, P= 0.002).

62

Figure 13. Nogo C in schizophrenia. The average amount of Nogo C transcript in the control human frontal cortices and in the schizophrenia tissues was 27 ± 3 and 34 ± 6 pg Nogo C per pg of β-glucuronidase, respectively. This represents an increase of 26% (TDIST, P= 0.03).

63

Figure 14. Nogo A, B and C levels versus the presence of CAA insert in the 3′-UTR of the Nogo gene, irrespective of disease status. The no insert group represents only individuals homozygous for the allele carrying no insert (n= 23). The insert group represent individuals heterozygous or homozygous for the CAA insert (n= 20). Expression of Nogo A was 13% higher in the insert group (no insert 7.1 ± 0.4; insert 8.0 ± 0.4; TDIST, P= 0.01). Expression of Nogo B was unaffected by the presence or absence of the CAA insert (no insert 2.65 ± 0.12; insert 2.73 ± 0.10; decrease of 3%; TDIST, P= 0.5). Nogo C was 27% higher in individuals carrying at least one CAA insert allele (no insert 25.0 ± 2.7; insert 31.9 ± 2.6; TDIST, P= 0.009).

64

Supplemental Results

1. Effects of antipsychotics.

In a small study we have tested the effect of antipsychotics on the expression of Nogo mRNA.

Even though the results were of low statistical significance because of the small sample size (n=5), the

levels of Nogo mRNA were decreased in the haloperidol treated rats, as expected.

Figure 15. Nogo mRNA levels in antipsychotic treated rats. Nogo mRNA levels in haloperidol treated rats (n=5) as compared to a control group (n=5) of saline treated animals. The error bars represent the standard error for each group. (TDIST, P= 0.14 and P= 0.03 for PFC and striatum, respectively).

65

Nogo A Nogo B Nogo C CaMKIIα CaMKIIβ

antipsychotics 7.4±0.5 2.7±0.1 28.7±3.6 6.8±0.8 3.8±0.5

non-antipsych. 7.4±0.5 2.5±0.1 29.1±3.5 7.1±0.6 3.8±0.5

Table 9. Nogo A, B, C, CaMKIIα and CaMKIIβ levels in patients treated with antipsychotics. Nogo A, B, C, CaMKIIα and CaMKIIβ levels in patients treated with antipsychotics (Clozapine, Fluoxetine, Haloperidol, Risperidone, etc.; n=16) versus patients treated with non-antipsychotic medications (Imipramine, Clonazepam, Clomipramine, etc., or untreated; n=15).

None of the genes showed significant change in expression in patients treated with antipsychotics as

compared to patients treated with non-antipsychotic medication or untreated patients. Therefore it is

plausible that the effects of antipsychotics are exerted downstream of the CaMKII pathway. This would

explain why not all effects of CaMKII upregulation would be alleviated by these drugs and why these

drug treatments are associated with a number of side effects.

2. The mRNA levels of CaMKIIα and CaMKIIβ and their correlation with the presence of CAA

insert in the 3’UTR of the Nogo gene.

Even though the CAA insert in the 3’UTR of Nogo gene is on a different chromosome than

CaMKIIα or CaMKIIβ and hence should have no direct effect on the expression of CaMKII, I have

found a direct correlation between the presence of a CAA insert in the 3’UTR of the Nogo gene and the

mRNA levels of both CaMKIIα and CaMKIIβ isozymes. The Nogo gene is found on chromosome 2,

while the CaMKIIα and β genes are found on chromosomes 5 and 7, respectively. In individuals

carrying one or two copies of the Nogo gene with a CAA insert (n=23), compared to individuals

homozygous for a Nogo gene without an insert (n=29), CaMKIIα levels were increased by 25.5%

(TDIST, P= 0.004) and CaMKIIβ levels were increased by 23%, with high statistical significance

(TDIST, P= 0.002).

66

Figure 16. CaMKIIα mRNA levels and their correlation with the presence of the CAA insert in 3’UTR of the Nogo gene. The mRNA levels were standardized to β-glucuronidase. CaMKIIα levels in individuals with no insert were 3.2±0.3 pg CaMKIIα/pg β-glucuronidase and in individuals carrying at least one CAA insert the levels were 4.0±0.3 pg CaMKIIα/pg β-glucuronidase. The error bars represent standard error. This represents a 25.5% increase (TDIST, P= 0.004).

67

Figure 17. CaMKIIβ mRNA levels and their correlation with the presence of the CAA insert in 3’UTR of the Nogo gene. The mRNA levels were standardized to β-glucuronidase. CaMKIIβ levels in individuals with no insert were 5.9±0.5 pg CaMKIIα/pg β-glucuronidase and in individuals carrying at least one CAA insert the levels were 7.3±0.5 pg CaMKIIα/pg β-glucuronidase. The error bars represent standard error. This represents a 23% increase (TDIST, P= 0.002).

68

DISCUSSION

Discussion for study No. 1

Because early-onset schizophrenia is generally a more severe form of schizophrenia than late-

onset schizophrenia, we examined the data for any relation to age of onset. The data suggest that

individuals with early-onset schizophrenia (before 20 years of age) were much less likely to carry the

CAA insert. However, because of the limited number of samples in this group, supplied by the National

Neurological Research Specimen Bank in Los Angeles and by the Canadian Brain Tissue Bank in

Toronto, these findings are only suggestive, and a much more extensive series of samples need to be

examined. We also analyzed the prevalence of the CAA insert in bipolar and depressed individuals

(Cantor-Graae et al., 2001). It has been hypothesized that schizophrenia and affective disorders may

share some genetic susceptibility (Berrettini, 2000; Maier et al., 1993). We found a slightly increased

prevalence of the CAA insert in these affective disorders. However, the sample size was too small to

comment on the possible role of the CAA insert. In a group of African and Afro-American samples,

there was a 2.8-fold increased prevalence of the homozygous CAA insert polymorphism in

schizophrenia. However, the overall prevalence of the CAA insert in the population was only 3%. These

frequency data were too low for statistical analysis, but do indicate a much lower prevalence of the CAA

insert in African and Afro-American population.

The 5´- and 3´-untranslated regions (UTR) of eukaryotic mRNAs have been shown to regulate

several aspects of gene expression. In particular, the 3´-UTR is involved in the regulation of mRNA

stability (Mitchell and Tollervey, 2001), translation initiation (Gray and Wickens, 1998), and mRNA

subcellular localization (Jansen, 2001). In neurons, several mRNAs have been demonstrated to be

targeted to dendrites via 3´-UTR motifs (Kiebler and DesGroseillers, 2000; Mohr, 1999). Mutations in

the 3´-UTR are associated with a number of diseases, including neuroblastoma, myotonic dystrophy and

α-thalassemia (Conne et al., 2000). The functional role of the CAA insert in the Nogo 3´-UTR is

unknown, and it does not match any known 3´-UTR functional motifs (Pesole et al., 2002). However,

polymorphisms in the Nogo 3´-UTR could contribute to altered expression of the Nogo gene in

schizophrenia.

In order to see whether there is any relation between the prevalence of the CAA insert and the

extent of Nogo expression in the post-mortem human frontal cortex, a separate series of tissues will need

to be examined. This is because we only had sufficient post-mortem tissue from six of the seven

69

schizophrenia tissues in order to obtain both the expression and the DNA sequence. Although all but one

of these schizophrenia tissues revealed a CAA insert (compared to three out of eight post-mortem

control samples), only one schizophrenia sample was homozygous for the CAA insert. Moreover, using

a specific antibody to the Nogo protein, the abundance of the Nogo protein itself will need to be

examined as well in the post-mortem tissue. (At the time, additional or sufficient post-mortem

schizophrenia tissues were not available from the brain banks.)

The gene for Nogo is located on chromosome 2p13–14 (Nagase et al., 1998; Yang et al., 2000),

and genome scans have found schizophrenia to be associated or linked to this region, 2p15–p12 (Coon et

al., 1998; Shaw et al., 1998). The present findings, therefore, offer new support to this chromosomal

region as a site of schizophrenia susceptibility. Increased Nogo mRNA expression in schizophrenia, as

described above, may lead to elevated levels of Nogo protein expression, and may, therefore, result in

increased Nogo receptor stimulation. The Nogo receptor is located on chromosome 22q11 (Fournier et

al., 2001), a region strongly associated with schizophrenia (Bassett et al., 1998; Karayiorgou et al.,

1995). Nogo and its receptor may, therefore, be of considerable relevance to the biological basis of

schizophrenia.

Obviously, the data needs to be confirmed in a much larger series of samples. However, if the

high prevalence of the Nogo CAA insert in schizophrenia holds in a more extensive study, then

individuals homozygous for the Nogo CAA insert would have a significantly elevated risk for

developing schizophrenia. Furthermore, increased Nogo gene expression in schizophrenia also suggests

Nogo may have a role in the disturbed neurodevelopment and plasticity in schizophrenia, since Nogo is

hypothesized to regulate neuronal migration during development (Skaper et al., 2001) and plasticity in

the adult (Buffo et al., 2000).


The main finding was that the CaMKIIβ transcript was significantly elevated in the post-mortem

frontal cerebral cortex tissues of individuals who died with schizophrenia or depression (tissue supplied

by the Stanley Foundation Brain Consortium). This finding may be relevant to the development of

schizophrenia or depression. For example, it is known that neural maturation is related to the ratio of α

and β isoforms of CaMKII (Shen and Meyer, 1999). Thus, there are three aspects of neurodevelopment

in which dysregulation of CaMKIIβ may contribute to the development of schizophrenia.

70

First, CaMKII controls many molecular aspects of postnatal dendritic growth and maturation,

including the phosphorylation of GABA-A receptor subunits (Churn and DeLorenzo, 1998; Macdonald

and Olsen, 1994; Wang et al., 1995), and indirectly may assist in the activation of NMDA and AMPA

receptors in early development. (Ben-Ari et al., 1994; Swope et al., 1999). Phosphorylation of the NR2B

subunit of the NMDA receptor by CaMKII is critical for axon guidance and for establishment and

maturation of dendritic spines during neurodevelopment (Rakic et al., 1986). Elevating CaMKII activity

levels in young neurons to levels of mature neurons slows their dendritic growth (Shen et al., 1998). The

increased CaMKIIβ levels observed in schizophrenia patients, if found during early development, may

play a role in abnormal neurodevelopment and subsequent predisposition to schizophrenia.

Second, during puberty, CaMKII plays a key role in CNS maturation, controlling ingrowth of

dopaminergic fibers and pruning of neurons (Soderling, 2000). The timing of schizophrenia onset

coincides with a change in CaMKII subunit composition and its Ca2+ decoding parameters at puberty.

This shift determines the pre- and post-pubertal response characteristics of neurons. Absence of this

maturation, induced by upregulation of CaMKII in mutant animals, leads to neuropathology and

behavioural defects in adulthood (Dudek and Bear, 1992; Keshavan et al., 1994; Mayford et al., 1995).

Third, in an important animal model of schizophrenia, methamphetamine sensitization (Suemaru et al.,

2000), there is an excess of the β isoform of CaMKII, relative to the α isoform (Greenstein et al., 2007;

Lou et al., 1999). This is consistent with our present data showing a much greater increase in CaMKIIβ

than CaMKIIα in schizophrenia.

In addition, CaMKII modulates catecholamine metabolism via phosphorylation of tyrosine

hydroxylase; thus, a disturbance in CaMKII may be compatible with a possible abnormality in dopamine

signaling in schizophrenia (Burt et al., 1976; Seeman et al., 1975; Seeman et al., 1976). Given the

important role CaMKII plays in neuronal development, maturation and signaling, deviations from its

normal level of expression may have clinically significant implications. However, if CaMKIIβ is truly

important for the pathophysiology of schizophrenia, the increase of 27% in the schizophrenia tissues is

surprisingly less than that of the 36% increase found in the tissues from the depressed individuals.

Naturally, the relative or absolute magnitude of these differences will vary considerably depending on

the clinical mix in the patient populations. Although the expression of CaMKIIβ was also elevated in the

post-mortem tissues from severely depressed individuals (Figure 8), the clinical relevance of this finding

is not clear. One of the current hypotheses in the field of antidepressant research is that the

antidepressants may alter the number of synaptic spines. While this may be possible, the present data did

71

not reveal any effect of the clinical antidepressants on the expression of CaMKIIβ; the expression of

CaMKIIβ was 7.5 ± 1.1 (mean ± s.e.) in seven depressed patients who had been on antidepressants,

essentially similar to the value of 7.7 ± 0.8 (mean ± s.e.) in six depressed patients who had not been on

antidepressants. Therefore, if antidepressants alter synaptic spine sprouting, there is no reason to

consider CaMKIIβ as a contributing factor.


Because mRNA only comprises approximately 10% of total RNA and is highly susceptible to

degradation, the quality of the mRNA was important to determine. This was done by analyzing the 3’ to

5’ ratio of β-glucuronidase. Although all the samples were standardized to contain the same amount of

total RNA, the mRNA levels could vary greatly depending on the extent of mRNA degradation Figure

10a). The results show that this effect was minimized by standardizing the expression values with β-

glucuronidase (Figure 10b). No non-normalized data were used. All the data presented are normalized to

β-glucuronidase, resulting in the dimensionless unit of expression for the Nogo variants as (pg Nogo

variant /µg total RNA) per (pg β-glucuronidase/µg total RNA).

As noted above, earlier work (Novak et al., 2002) found Nogo mRNA (which consisted of Nogo

A + B + C) to be overexpressed in seven unmatched schizophrenia frontal cortices in tissues from the

National Neurological Research Specimen Bank in Los Angeles and from the Canadian Brain Tissue

Bank in Toronto. The present data, using a different group of age- and sex-matched tissues from the

Stanley Foundation Brain Consortium (Bethesda, MD) and a more accurate method, indicate that Nogo

C is overexpressed in schizophrenia (26% increase) (Figure 13). A novel observation is that Nogo B is

significantly underexpressed in depression (-17%) (Figure 12). Nogo A did not show a significant

change in any of the disease groups examined (Figure 11). The reason for the relative overexpression of

Nogo in the earlier schizophrenia cortices (Novak et al., 2002) stemmed from the fact that Nogo C

constitutes by far the largest fraction of the Nogo mRNA (75%) and is overexpressed in schizophrenia.

Therefore, our current results are in accordance with our previous results.

The gene for Nogo is at chromosome position 2p13-14 (Yang et al., 2000), and genome scans

have found schizophrenia to be associated with this region, 2p15-p12 (Coon et al., 1998; Shaw et al.,

1998; Straub et al., 2002). Thus, altered Nogo mRNA expression in schizophrenia may lead to altered

levels of Nogo protein expression and altered stimulation of the Nogo receptor. The gene for the Nogo

receptor is located on chromosome 22q11 (Fournier et al., 2001), a region also associated with

72

schizophrenia (Bassett et al., 1998; Karayiorgou et al., 1995). Thus, Nogo and its receptor may be

relevant to the biological basis of schizophrenia (Nogo C) and other disorders, such as depression (Nogo

B). In a previous publication we have identified a CAA and a TATC insertion in the 3’UTR of the Nogo

gene (Novak et al., 2002). There is a direct correlation between the expression of Nogo A and C and the

number of alleles with CAA insert and individual carries, irrespective of the disease status (Figure 14).

The inverse is true for TATC insert, as it is generally not inherited with the CAA insert on the same

allele. Generally, an allele has either the CAA insertion or the TATC insertion, but not both. People

carrying a CAA insert on at least one of their Nogo alleles have a 13% higher Nogo A expression and a

27% higher Nogo C expression than people homozygous for alleles without an insert. (If the samples are

sorted based on the presence of TATC insert, the TATC insert samples show statistically nonsignificant

decrease in Nogo C expression).

The 5’- and 3’- untranslated regions (UTR) of eukaryotic mRNAs have been shown to regulate

several aspects of gene expression. The 3’-UTR is involved in the regulation of mRNA stability

(Mitchell and Tollervey, 2001), translation initiation (Gray and Wickens, 1998) and targeting (Kiebler

and DesGroseillers, 2000). Mutations in 3’-UTR are associated with a number of diseases, including

neuroblastoma, myotonic dystrophy and α-thalassemia (Conne et al., 2000). I remains to be shown

whether the 3’UTR CAA insert in Nogo directly results in upregulation of Nogo A and C or if it is

coinherited with another regulatory region, although after sequencing the Nogo mRNA from a number

of individuals, we did not detect any other sequence variants (Novak et al., 2002).

The roles Nogo A, B or C may play in the etiology of schizophrenia or depression are hard to

predict, because we still do not know how these splice variants differ in function. We do know that all

three Nogo splice variants show different developmental and morphological expression patterns (Oertle

et al., 2003a) and, therefore, likely play different roles determined by both developmental stage and

tissue specificity. The difference between the splice variants lies in their N terminal, which determines

their protein interactions (Hu et al., 2005). There are at least three different functional domains present

in Nogo. The N-terminal region common to Nogo A and B is involved in the inhibition of fibroblast

spreading, a central region present only in Nogo A that restricts neurite outgrowth, cell spreading and

induces growth cone collapse, and a C-terminal region common to all splice variants which has a growth

cone collapsing function (Oertle et al., 2003c). Change in the levels of individual splice variants would

then be expected to produce different outcomes.

73

Nogo is a strong inhibitor of neurite outgrowth (Buffo et al., 2000; Chen et al., 2000b; GrandPre

et al., 2000; Prinjha et al., 2000). It is highly expressed by oligodendrocytes in CNS myelinated tissues

during fetal development (Huber et al., 2002; Josephson et al., 2001) and it is hypothesized to suppress

gene expression of neuronal transcription factors, e.g., c-Jun and JunD, which are associated with

neuronal growth (Zagrebelsky et al., 1998). Nogo is not surprisingly also involved in other

neurodegenerative diseases. Autoantibodies to Nogo-A have been detected in MS patients (Reindl et al.,

2003), with Nogo as an important modulator of the immune response to autoimmune-mediated

demyelination (Karnezis et al., 2004). Analogous to our results in schizophrenia, the relative levels of

Nogo splice variants were shown to be differentially affected in other disease states as well. In ALS

levels of Nogo-A protein are elevated and correlate with disease severity and degree of muscle atrophy,

while Nogo-C levels are deceased (Dupuis et al., 2002; Jokic et al., 2005). The splice variant we

identified as significantly elevated in schizophrenia tissues, Nogo-C, in addition to a growth cone

collapsing function, may also act similarly to RTN1-C, a protein of the same family with close similarity

to Nogo-C (Oertle et al., 2003b; Yan et al., 2006), which is involved in neuronal differentiation (Hens et

al., 1998).

Increased levels of Nogo C in schizophrenia may influence neuronal differentiation, neuronal

migration during embryogenesis and synaptic pruning during adolescence. Synaptic pruning is thought

to be associated with schizophrenia and occurs at the time of the disease onset (Feinberg, 1990;

Hickmott and Constantine-Paton, 1997; Keshavan et al., 1994). Observations of maldistribution of

interstitial neurons in prefrontal white matter (Akbarian et al., 1996), as well as enlarged lateral and

third ventricle and smaller anterior hippocampi (Suddath et al., 1990b) do point to a possible

developmental failure, such as abnormal neuronal migration (Suddath et al., 1990).

Nogo-B, which we found significantly decreased in depression, has been shown to have diverse

functions from apoptosis (Qi et al., 2003; Tagami et al., 2000) to vascular remodeling (Acevedo et al.,

2004). Nogo B (RTN-Xs) was shown to interact with Bcl–2 and Bcl-Xl and reduce their anti-apoptotic

activity (Tagami et al., 2000). Bcl-2 was shown to be part of the route by which chronic stressors could

impact depressive state (Hayley et al., 2005). Bcl-Xl is another bcl-2 family protein, which may be

involved in modulation of synaptic stability (Jonas et al., 2003). Recently it has been demonstrated that

Fluoxetine, a widely used antidepressant compound, up-regulated expression of Bcl-2, Bcl-xL (Chiou et

al., 2006). Nogo B is located close to a locus that has been associated through linkage with increased

risk of suicide attempts in families with recurrent, early-onset, major depression (Zubenko et al., 2004).

74

General Discussion

To date, no single gene or pathway has been able to account for all the hallmark signs of

schizophrenia. With the discovery of the involvement of CaMKII, we may be closer to explaining the

full range of pathophysiological findings in schizophrenia. We know that the disease has a strong

genetic component and likely involves more than one gene. We also know that the phenotype is

expressed only in 50% of individuals carrying such genes (Cardno et al., 1999; Risch, 1990) with adult

onset (Kendler et al., 1987).

From a molecular point of view, the identification of CaMKII as a gene key to schizophrenia

explains the involvement of the NMDA, AMPA, GABA and DA signaling pathways (Carlsson et al.,

2001; Harrison et al., 2003; Lewis, 2000; Meador-Woodruff and Healy, 2000; Seeman, 1987).

Furthermore, it explains the observed pathophysiology, which includes abnormal neuronal migration

(Akbarian et al., 1996; Benes, 2000; Kovalenko et al., 2003), anomalous synaptic plasticity and

connectivity (Frankle et al., 2003) and exaggerated, transporter dependent, release of dopamine (DA)

(Breier et al., 1997; Laruelle et al., 1996).

As a corollary, if CaMKII is a key element in the etiology of schizophrenia, perturbation of the

CaMKII pathway should then be able to mimic symptoms of schizophrenia. The following discussion

will focus on the individual pathways affected by upregulation of CaMKII and correlate the effects with

observed pathology in schizophrenia.

1. CaMKII plays an important role in age of onset of schizophrenia

CaMKII mediates synaptic pruning during adolescence, which occurs at the time of onset of

schizophrenia and is thought to be associated with the disease (Feinberg, 1990; Hickmott and

Constantine-Paton, 1997; Keshavan et al., 1994; Teicher et al., 1995). During normal development,

hippocampus shows a developmental loss of capacity for LTD during adolescence. CaMKII controls this

switch from LTD to LTP (Mayford et al., 1995; Mayford et al., 1996a; Muller et al., 1989). This

coincides with the development of dopaminergic innervation in the prefrontal cortex and is abolished in

CaMKII mutant mice (Goldman-Rakic, 1996; Mayford et al., 1995). In transgenic mice with

hyperactivated CaMKII, an animal model of CaMKII upregulation, the capacity for LTD is not lost in

adulthood. High expression of constitutively active CaMKIIα not only shifts the threshold from LTP

toward LTD, but also triggers a number of compensatory mechanisms, such as upregulation of the

inhibitory neuropeptide Y, possibly reducing the LTP induction threshold, and an increase in potassium

75

currents through increase of Kv4.2 channel expression, which decreases excitability. Overall, these

changes lead to the enhancement of some neural connections and elimination of others (reviewed by

(Elgersma et al., 2004)) and would corroborate the neuropathological findings in schizophrenia and

support the abnormal pruning hypothesis of schizophrenia (Feinberg, 1990; Keshavan et al., 1994;

Mayford et al., 1995; Segal et al., 2000; Soderling, 2000). Furthermore, CaMKII mice carrying a

hyperactive form of the enzyme show increased sensitivity to NMDA-R antagonists at concentrations

that do not affect wild type mice. This also parallels the symptoms of schizophrenia (Ohno et al., 2002).

Given the role CaMKII plays during the transition from immature to adult neuronal function, it is

not surprising that CaMKIIα mutant mice show adult onset phenomena (Elgersma et al., 2004). Yet,

interestingly, CaMKIIα null mutants also show neurodevelopmental defects severely affecting about

50% of the animals (Gordon et al., 1996), as seen in schizophrenia. These defects include disturbance in

behaviour such as decreased fear phenomena and high aggression, as well as defects in cognition and

neocortical plasticity (Chen et al., 1994; Elgersma et al., 2004; Mayford et al., 1995; Mayford et al.,

1996a; Silva et al., 1992a; Silva et al., 1992b). This is similar to responses seen in hippocampus-

lesioned animals, another animal model of schizophrenia (Elgersma et al., 2004; Silva et al., 1992a).

Normal learning has been shown in several non-hippocampus dependent learning tasks, an indicator that

this is a good animal model of the disease (Elgersma et al., 2004).

2. Dysregulation of the CaMKII pathway can explain key pathophysiological signs of

schizophrenia.

Developmentally, at the molecular level, CaMKIIβ, which at first is expressed in the absence of

CaMKIIα, determines the establishment of the AMPA, NMDA and GABA signaling pathways (Ben-Ari

et al., 1997). The α and β isoforms drive neuronal differentiation in opposite directions. While

CaMKIIα enhances synaptic strength, CaMKIIβ promotes branching and development of new synapses

(Fink et al., 2003). Overexpression of CaMKIIβ increases dendritic arborization, motility, filopodia

extension, and synapse number. Developing hippocampal neurons, where CaMKIIβ is highly expressed,

show high arborization of dendrites (Fink et al., 2003). Furthermore, the α:β expression ratio of CaMKII

plays a particularly important role in the development and density determination of glutamatergic

synapses (Burgin et al., 1990; Rongo and Kaplan, 1999; Wu and Cline, 1998). This would be in

accordance with the developmental theory of schizophrenia and with findings of abnormal neuronal

migration and plasticity. It would also account for the involvement of the glutamatergic and GABAergic

76

molecular pathways, as well as the dopaminergic pathway since glutamatergic neurons then interact with

dopaminergic neurons via inhibitory GABAergic interneurons (Lieberman et al., 1997).

Schizophrenia is also said to be a disease of the synapse (Frankle et al., 2003; Mirnics et al.,

2001a). The proper levels of CaMKIIα and β are key in normal functioning of the synapse, as well as its

structure and localization (Fink and Meyer, 2002). Deviation from correct α:β ratio results in functional

consequences on synaptic transmission, with overexpression of β rendering these synapses oversensitive

to low Ca2+ signals and easier to trigger (Ahmed et al., 2006; Thiagarajan et al., 2002; Ullian et al.,

2001). CaMKII overexpression also leads to abnormal increases in ion channel activity in activated

synapses (Derkach et al., 1999). In addition, CaMKII activity controls the retention of active presynaptic

partners, which may lead to aberrant retention of synaptic contacts (Pratt et al., 2003). This again is in

accordance with the current theory of schizophrenia neuropathology.

Upregulation of CaMKII also explains the increased sensitivity of schizophrenia patients to

psychostimulants such as amphetamine (Benes, 2000). This is also true in amphetamine sensitized

animals, which is another model of the disease. This unique type of DA release is transporter-mediated,

rather than vesicular (Jones et al., 1998; Kantor et al., 1999; Pierce and Kalivas, 1997; Raiteri et al.,

1979) and is mediated by CaMKII, whose activation is essential for the enhanced DA release (Jones et

al., 1998; Raiteri et al., 1979; Warburton et al., 1996). This dopamine release is mediated by the

phosphorylation of the dopamine transporter (DAT) by CaMKII which results in a reversal of transport

through DAT and dopamine efflux. It is this non-vesicular DA release which is induced by amphetamine

sensitization and present in schizophrenia (Fog et al., 2006; Sulzer et al., 2005). Furthermore, the

function of DAT is controlled by its direct contact with D2Rs. Disruption of this contact results in

hyperlocomotion, analogous to DAT mutant mice (Lee et al., 2007) or CaMKIIα deficient mice (Chen

et al., 1994; Silva et al., 1992a).

As expected, upregulation of CaMKII results in NMDA-R antagonist sensitivity analogous to the

one seen in schizophrenia (Ohno et al., 2002). Correspondingly, inhibition of hippocampal CaMKII

impairs amphetamine conditioning (Tan, 2002) and attenuates amphetamine induced DA release

sensitized rats (Kantor et al., 1999; Pierce and Kalivas, 1997). Studies of opioid tolerance suggest that it

is upregulation of the CaMKIIβ isozyme which is key in this response, as withdrawal of morphine

results in CaMKIIβ overshoot, but does not affect α (Fan et al., 1999; Lou et al., 1999).

The dopaminergic theory is central to the etiology of schizophrenia and therefore it is important

that upregulation of CaMKII can explain the involvement of the DA pathway. There are many

77

interactions between the CaMKII and D2R pathways. The D2R disrupts the interaction between NR2B

and CaMKII, leading to reduced phosphorylation of the NMDA-Rs (Liu et al., 2006). In turn,

upregulation of CaMKII positively upregulates the D2R promoter (Takeuchi et al., 2002). CaMKII also

influences catecholamine synthesis through phosphorylation of tyrosine hydroxylase and tryptophan

hydroxylase (Ohyama et al., 2002; Yamauchi, 2005).

3. Environmental factors

CaMKII plays an important role in abnormal synaptic function, especially in adaptation to the

factors which precipitate schizophrenia. Stress, hypoxia and glutamate receptor agonists have long been

known to be able to elicit psychosis (Tsuang, 2000).

Hippocampus is a major target of stress induced changes (Kim and Diamond, 2002; McEwen

and Sapolsky, 1995). After exposure to stress, hippocampal neurons show changes in cellular

morphology and dendritic remodeling, including atrophy and decreased length of the dendritic branches

and loss of synapses (Du et al., 2004; McEwen, 2003; Sapolsky, 2000). These stress induced alterations

arise from increased glutamatergic neurotransmission through increased levels of glutamate in the

hippocampus and stimulation of the NMDA-Rs and can be prevented by NMDA antagonists (Du et al.,

2004; McEwen, 2003; Sapolsky, 2000) or by AMPA antagonists (Suenaga et al., 2004). Since CaMKII

regulates these pathways, it may have major contribution to the stress induced pathophysiology (Molnar

et al., 2003; Xing et al., 2002). Acute stress upregulates CaMKII and in turn also the AMPA and

NMDA receptors in the hippocampus, while chronic stress results in inhibition of CaMKII and decrease

in BDNF (Aleisa et al., 2006; Suenaga et al., 2004). It is plausible that it is the inability to properly

downregulate CaMKII during chronic stress that may predispose individuals to the disease. In fact, in

chronically stressed rats, nicotine has been shown to counter some of the effects of chronic stress by

increasing the basal levels of BDNF protein. This activated CaMKII through the TrkB/ PLCg pathway

(Minichiello et al., 2002).

During hypoxia, oxygen and glucose supplies are disrupted, resulting in dysregulation of ionic

gradients and depolarization of the plasma membrane. The resulting glutamate release leads to

overstimulation of AMPA and NMDA receptors and large increase in Ca2+ influx, which overactivates

CaMKII (Lee et al., 1999; Merrill et al., 2005). Such insult to an already predisposed system may also

contribute to the development of schizophrenia. By inhibiting CaMKII activity, ischemia-induced

78

accumulation of CaMKII at the PSD is greatly reduced and such drugs may be therapeutically useful

(Meng and Zhang, 2002; Merrill et al., 2005).

In summary, CaMKIIβ upregulation in schizophrenia leads to CaMKII holoenzymes containing

higher β:α ratio will be more responsive to smaller, lower frequency Ca2+ spikes (Brocke et al., 1999).

This will lead to abnormal signal decoding, resulting in altered neuronal response to a given Ca2+ signal.

While CaMKIIα enhances synaptic strength, overexpression of β results in filopodia extension,

increased branching and in development of new synapses (Fink et al., 2003). Expression of CaMKIIβ

also has effect on CaMKIIα expression, downregulating the expression of α, while α has no effect on β

(Thiagarajan et al., 2002). This results in altered maturation, with neurons of an immature phenotype

(Shen and Meyer, 1999) and in abnormal dendritic growth (Shen et al., 1998). The interaction with other

pathways is also be altered. Increase in β lowers synaptic charge and increases signaling frequency, as

well as responsiveness to NMDA-R activity and enhanced inhibition by AMPA-R activity (Thiagarajan

et al., 2002). The overall resulting immature phenotype of neurons with synapses easily triggered by

lower than normal Ca2+ concentrations, abnormal glutamatergic signaling and increased outflow of DA

through the DAT are all in accordance with the findings in schizophrenia.

4. Depression

CaMKII plays a critical role in serotonergic regulation of PFC neuronal activity, which may

partially explain the neuropsychiatric behavioral phenotypes of increased aggression seen in CaMKII

knockout mice (Cai et al., 2002). Long term administration of antidepressants, such as the tricyclic

antidepressant desipramine and norepinephrine reuptake inhibitor reboxetine, was shown to significantly

increase the kinase activity in presynaptic vesicles of frontal and prefrontal cortex (Celano et al., 2003;

Tiraboschi et al., 2004). The SSRI paroxetine increased membrane levels of activated CaMKII which

phosphorylated the AMPA-R and enhanced AMPA-R conductance and receptor delivery (Martinez-

Turrillas et al., 2007). Similar effect was produced by the 5-HT and noradrenaline (NA) reuptake

inhibitor venlafaxine or by a repeated electroconvulsive shock (ECS). Both treatments induced a large

increase in the activity of bound kinase and a decrease in the activity of soluble kinase (Du et al., 2004;

Popoli et al., 2002). This may reflect an increase in β, as β docks the CaMKII α/β holoenzymes. This is

in accordance with our findings, since CaMKIIα, the soluble variant of CaMKII, was found elevated in

depression and would be decreased by the treatment. Because of the similar effects of so many different

79

types of treatments for depression on CaMKII, it is possible that CaMKII may be an important target in

the treatment of depression (Du et al., 2004; Popoli et al., 2002).

CaMKII also plays an important role in catecholamine and serotonin synthesis. Tyrosine

hydroxylase and tryptophan hydroxylase are phosphorylated by CaMKII and then activated by activator

protein (14-3-3 protein). Furthermore, binding of CaMKII to syntaxin is an important step in the

regulation of the exocytosis pathway (Ohyama et al., 2002). Reviewed by (Yamauchi, 2005).

5. Nogo and its role in schizophrenia

Nogo plays an important role in neuronal migration and maturation of the GABAergic neurons.

Aberrant Nogo expression results in improper axon branching, polarization and alterations in migration

patterns (Mingorance-Le Meur et al., 2007). All three Nogo-NgR1 triggered pathways increase the

stabilization of formed F-actin (Maekawa et al., 1999), which is bound by CaMKIIβ and serves as a

reservoir for the inactivated form of the kinase. Hence upregulation of Nogo would impact the balance

between the pools of active and inactive kinase.

Hypoxia upregulates Nogo A/B (Schmidt-Kastner et al., 2006; Wang et al., 2006; Zhou et al.,

2003) and it has been observed that prenatally experienced hypoxia may play a role in predisposition to

schizophrenia (Kietzmann et al., 2001). Hypoxia activates genes involved in vascular development,

which are important players in neurodevelopment, because neurogenesis is greatly depends on

angiogenesis (Carmeliet, 2003; Palmer et al., 2000). This would be in agreement with the role Nogo-B

plays in vascular remodeling (Acevedo et al., 2004).

The Nogo and CaMKII pathways are also coupled via PKC. Like the D2Rs, the NgR couples to

the inhibitory guanine nucleotide binding protein (Gi) (Cai et al., 1999) and triggers intracellular

elevation of Ca2+ as well as the activation of PKC (Hasegawa et al., 2004). Activation of PKC interferes

with CaMKII-NMDA-R interaction, dispersing the synaptic NMDA-Rs, but driving CaMKII to

synapses (Fong et al., 2002). High PKC levels induced by stress were shown to trigger thought disorder

(Johnson et al., 1989).

The exact roles Nogo A, B or C may play in the etiology of schizophrenia or depression are hard

to predict, because we still do not know the many different functions of these splice variants. An

example of this is its involvement in numerous pathological states. We do know that all three Nogo

splice variants show different developmental and morphological expression patterns (Oertle et al.,

2003a) and, therefore, likely play different roles determined by both developmental stage and tissue

80

specificity. Change in the levels of individual splice variants would then be expected to produce

different phenotypic outcomes. Nogo is highly expressed by oligodendrocytes in CNS myelinated

tissues during fetal development (Huber et al., 2002; Josephson et al., 2001) and it is hypothesized to

suppress gene expression of neuronal transcription factors, which are associated with neuronal growth

(Zagrebelsky et al., 1998).

The splice variant we identified as significantly elevated in schizophrenia tissues, Nogo-C, may

also act similarly to RTN1-C, a protein of the same family with close similarity to Nogo-C (Oertle et al.,

2003b), which is involved in neuronal differentiation (Hens et al., 1998). Increased levels of Nogo C in

schizophrenia may influence neuronal migration during embryogenesis. Observations of maldistribution

of interstitial neurons in prefrontal white matter (Akbarian et al., 1996) do point to a possible

developmental failure, such as abnormal neuronal migration (Suddath et al., 1990a).

Schizophrenia and depression may have some etiology in common, especially considering rates of

comorbid depression disorders in patients with schizophrenia (Association, 2000), with nearly 60% of

patients with schizophrenia experiencing a depressive syndrome at some time during the course of their

illness (Lewandowski et al., 2006; Martin et al., 1985). Nogo- B, which we found significantly

decreased in depression, has been shown to have diverse functions from apoptosis (Qi et al., 2003;

Tagami et al., 2000) to vascular remodeling (Acevedo et al., 2004). Nogo B (RTN-Xs) was shown to

interact with Bcl–2 and Bcl-Xl (Tagami et al., 2000). Bcl-2 was shown to be part of the route by which

chronic stressors could impact depressive state (Hayley et al., 2005). Bcl-Xl is another bcl-2 family

protein, which may be involved in modulation of synaptic stability (Jonas et al., 2003). Recently it has

been demonstrated that Fluoxetine, a widely used antidepressant compound, up-regulated expression of

Bcl-2 and Bcl-xL (Chiou et al., 2006). In addition, Nogo is located close to a locus that has been

associated through linkage with increased risk of suicide attempts in families with recurrent, early-onset,

major depression (Zubenko et al., 2004).

Nogo is involved in a number of neurodegenerative diseases. Autoantibodies to Nogo-A have

been detected in multiple sclerosis (MS) patients (Reindl et al., 2003), because it is an important

modulator of the immune response to autoimmune-mediated demyelination (Karnezis et al., 2004).

Nogo-A is elevated in amyotrophic lateral sclerosis (ALS), and correlate with disease severity, while

Nogo-C levels are decreased (Dupuis et al., 2002; Jokic et al., 2005). Nogo was shown to be markedly

up-regulated in temporal lobe epilepsy (TLE), associated with extensive neurodegeneration of

hippocampal neurons and hippocampal reorganization (Bandtlow et al., 2004). Nogo-A was also found

81

to be increased in pyramidal cells in the hippocampus in Alzheimer’s disease (AD) (Gil et al., 2006).

Brain NgR interacts with amyloid precursor protein (APP) through its amyloid-β (Aβ) peptide domain

and reduces Aβ, a protein accumulating in AD plaques, by blockade of α/β secretase or by increased

clearance of (Aβ) protein (Park et al., 2006).

6. The link between CaMKIIβ expression and the CAA insert in the Nogo gene.

The mode of inheritance of schizophrenia suggests the involvement of a number of genes with

mild mutations or possible mutations in regulatory elements of these genes. This implies that

polymorphisms in regulatory elements (“cis-acting variations”) could play a significant role (Bray et al.,

2003). The background in which these genes are expressed may also be important. Neves-Pereira et al.

(2005) studied a polymorphism in the BDNF gene as a risk factor for schizophrenia and showed that the

risk for a disease may depend upon the haplotypic background on which a gene variant is carried

(Neves-Pereira et al., 2005).

Both the gene for Nogo and for its receptor, NgR, lie in chromosomal hotspots linked to

schizophrenia. Nogo is located at 2p13-14 (Yang et al., 2000), which was identified as a possible

susceptibility locus (2p15-p12) (Coon et al., 1998; Shaw et al., 1998; Straub et al., 2002) and NgR is

located on 22q11 (Fournier et al., 2001), a schizophrenia susceptibility locus 4 (SCZD4) 22q11.2

(Bassett et al., 1998; Karayiorgou et al., 1994; Karayiorgou et al., 1995; Online Mendelian Inheritance

in Man, 2007; Pulver et al., 1994). The NgR has recently been identified by Hsu et al. (2007) as possibly

modulating the genetic risk or clinical expression of schizophrenia (Hsu et al., 2007). The gene for the α

subunit of CaMKII is located at 5q32, a locus which has been linked to schizophrenia (SCZD1, 5q23.2-

q34) (Bassett et al., 1988; Lewis et al., 2003; Online Mendelian Inheritance in Man, 2007; Paunio et al.,

2001; Sklar et al., 2004). CaMKIIβ gene is located at 7p14.3-p14.1, a locus that has not yet been

identified as being linked to schizophrenia. It is possible that either a change in the CaMKIIβ gene,

leading to CaMKIIβ dysregulation, is of minor effect and depends strongly on the genetic background in

which it is expressed, or this dysregulation is of secondary effect, primary cause perhaps being an insert

in a regulatory element of a gene such as Nogo. This insert may cause the dysregulation of the Nogo

pathway, which interacts with the CaMKII pathway. CaMKII subunit expression is in turn controlled by

a feedback mechanisms within the CaMKII pathway, perturbation of which would alter the subunit

expression. Another possibility is that Nogo alters the expression of the CaMKII genes directly, through

activation of transcription factors, as Nogo is known to interact with GAP43, CAP23, LIF kinase, c-Jun

82

JunD, and other neuronal transcription factors (Zagrebelsky et al., 1998). In either case we should see a

direct correlation between the presence of CAA insert and high CaMKII expression levels, which is in

fact what I have observed (Figures 16 and 17). Nogo upregulation may lead to an aberrant neuronal

migration, maturation and function, affecting many signaling pathways, such as Kv channels, Gi protein

signaling, the Rho kinase pathway and PKC. This may in turn affect CaMKIIβ signaling, particularly

through BDNF or via Ca2+ currents induced through Gi pathway and through PKC. Since CaMKII plays

highly important role during maturation, especially at puberty, it is quite likely that the preexisting

abnormality manifests itself during this key period of neuronal pruning and functional neural shift, both

of which seem to be controlled by CaMKII.

It is of great interest that new evidence is emerging and confirming the role of CaMKII in

schizophrenia and other psychiatric illnesses, including drug addiction (Li et al., 2008).

We may not be able to correct an insert in the Nogo gene, but the use of CaMKII inhibitors may

perhaps prevent development of the disease in susceptible individuals who show an upregulation of

CaMKII. Further studies are necessary to determine whether CaMKII upregulation is present before

adolescence and whether CaMKII inhibitors would be effective in preventing the development of this

disease.

83

REFERENCES Acevedo, L., Yu, J., Erdjument-Bromage, H., Miao, R.Q., Kim, J.E., Fulton, D., Tempst, P., Strittmatter,

S.M., and Sessa, W.C. (2004) A new role for Nogo as a regulator of vascular remodeling. Nat Med. 10(4): 382-388.

Adams, B., and Moghaddam, B. (1998) Corticolimbic dopamine neurotransmission is temporally dissociated from the cognitive and locomotor effects of phencyclidine. J Neurosci. 18(14): 5545-5554.

Ahmed, R., Zha, X.M., Green, S.H., and Dailey, M.E. (2006) Synaptic activity and F-actin coordinately regulate CaMKIIalpha localization to dendritic postsynaptic sites in developing hippocampal slices. Mol Cell Neurosci. 31(1): 37-51.

Akbarian, S., Kim, J.J., Potkin, S.G., Hetrick, W.P., Bunney, W.E., Jr., and Jones, E.G. (1996) Maldistribution of interstitial neurons in prefrontal white matter of the brains of schizophrenic patients. Arch Gen Psychiatry. 53(5): 425-436.

Akil, M., Pierri, J.N., Whitehead, R.E., Edgar, C.L., Mohila, C., Sampson, A.R., and Lewis, D.A. (1999) Lamina-specific alterations in the dopamine innervation of the prefrontal cortex in schizophrenic subjects. Am J Psychiatry. 156(10): 1580-1589.

Al Halabiah, H., Delezoide, A.L., Cardona, A., Moalic, J.M., and Simonneau, M. (2005) Expression pattern of NOGO and NgR genes during human development. Gene Expr Patterns. 5(4): 561-568.

Albrecht, U., Sutcliffe, J.S., Cattanach, B.M., Beechey, C.V., Armstrong, D., Eichele, G., and Beaudet, A.L. (1997) Imprinted expression of the murine Angelman syndrome gene, Ube3a, in hippocampal and Purkinje neurons. Nat Genet. 17(1): 75-78.

Aleisa, A.M., Alzoubi, K.H., Gerges, N.Z., and Alkadhi, K.A. (2006) Chronic psychosocial stress-induced impairment of hippocampal LTP: possible role of BDNF. Neurobiol Dis. 22(3): 453-462.

Allen, R.M., and Young, S.J. (1978) Phencyclidine-induced psychosis. Am J Psychiatry. 135(9): 1081-1084.

American Psychiatric Association, A. (1994) Diagnostic and statistical manual of mental disorders (DSM-IV). American Psychiatric Association.

Amir, R.E., Van den Veyver, I.B., Wan, M., Tran, C.Q., Francke, U., and Zoghbi, H.Y. (1999) Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet. 23(2): 185-188.

Andreasen, N.C., O'Leary, D.S., Flaum, M., Nopoulos, P., Watkins, G.L., Boles Ponto, L.L., and Hichwa, R.D. (1997) Hypofrontality in schizophrenia: distributed dysfunctional circuits in neuroleptic-naive patients. Lancet. 349(9067): 1730-1734.

Antonova, I., Arancio, O., Trillat, A.C., Wang, H.G., Zablow, L., Udo, H., Kandel, E.R., and Hawkins, R.D. (2001) Rapid increase in clusters of presynaptic proteins at onset of long-lasting potentiation. Science. 294(5546): 1547-1550.

Association, A.P. (2000) Diagnostic and Statistical Manual (4th ed., rev.). Washington, DC: American Psychiatric Press.

Bandtlow, C.E., Dlaska, M., Pirker, S., Czech, T., Baumgartner, C., and Sperk, G. (2004) Increased expression of Nogo-A in hippocampal neurons of patients with temporal lobe epilepsy. Eur J Neurosci. 20(1): 195-206.

84

Barria, A., Muller, D., Derkach, V., Griffith, L.C., and Soderling, T.R. (1997) Regulatory phosphorylation of AMPA-type glutamate receptors by CaM-KII during long-term potentiation. Science. 276(5321): 2042-2045.

Barria, A., and Malinow, R. (2005) NMDA receptor subunit composition controls synaptic plasticity by regulating binding to CaMKII. Neuron. 48(2): 289-301.

Barton, D.E., Arquint, M., Roder, J., Dunn, R., and Francke, U. (1987) The myelin-associated glycoprotein gene: mapping to human chromosome 19 and mouse chromosome 7 and expression in quivering mice. Genomics. 1(2): 107-112.

Bassett, A.S., McGillivray, B.C., Jones, B.D., and Pantzar, J.T. (1988) Partial trisomy chromosome 5 cosegregating with schizophrenia. Lancet. 1(8589): 799-801.

Bassett, A.S., Hodgkinson, K., Chow, E.W., Correia, S., Scutt, L.E., and Weksberg, R. (1998) 22q11 deletion syndrome in adults with schizophrenia. Am J Med Genet. 81(4): 328-337.

Bayer, K.U., Harbers, K., and Schulman, H. (1998) alphaKAP is an anchoring protein for a novel CaM kinase II isoform in skeletal muscle. Embo J. 17(19): 5598-5605.

Bayer, K.U., Lohler, J., Schulman, H., and Harbers, K. (1999) Developmental expression of the CaM kinase II isoforms: ubiquitous gamma- and delta-CaM kinase II are the early isoforms and most abundant in the developing nervous system. Brain Res Mol Brain Res. 70(1): 147-154.

Bayer, K.U., De Koninck, P., Leonard, A.S., Hell, J.W., and Schulman, H. (2001) Interaction with the NMDA receptor locks CaMKII in an active conformation. Nature. 411(6839): 801-805.

Bayer, K.U., De Koninck, P., and Schulman, H. (2002) Alternative splicing modulates the frequency-dependent response of CaMKII to Ca(2+) oscillations. Embo J. 21(14): 3590-3597.

Beattie, E.C., Carroll, R.C., Yu, X., Morishita, W., Yasuda, H., von Zastrow, M., and Malenka, R.C. (2000) Regulation of AMPA receptor endocytosis by a signaling mechanism shared with LTD. Nat Neurosci. 3(12): 1291-1300.

Ben-Ari, Y., Tseeb, V., Raggozzino, D., Khazipov, R., and Gaiarsa, J.L. (1994) gamma-Aminobutyric acid (GABA): a fast excitatory transmitter which may regulate the development of hippocampal neurones in early postnatal life. Prog Brain Res. 102(261-273.

Ben-Ari, Y., Khazipov, R., Leinekugel, X., Caillard, O., and Gaiarsa, J.L. (1997) GABAA, NMDA and AMPA receptors: a developmentally regulated 'menage a trois'. Trends Neurosci. 20(11): 523-529.

Ben-Ari, Y. (2002) Excitatory actions of gaba during development: the nature of the nurture. Nat Rev Neurosci. 3(9): 728-739.

Benes, F.M. (2000) Emerging principles of altered neural circuitry in schizophrenia. Brain Res Brain Res Rev. 31(2-3): 251-269.

Benfenati, F., Valtorta, F., Rubenstein, J.L., Gorelick, F.S., Greengard, P., and Czernik, A.J. (1992) Synaptic vesicle-associated Ca2+/calmodulin-dependent protein kinase II is a binding protein for synapsin I. Nature. 359(6394): 417-420.

Bergman, J., Yasar, S., and Winger, G. (2001) Psychomotor stimulant effects of beta-phenylethylamine in monkeys treated with MAO-B inhibitors. Psychopharmacology (Berl). 159(1): 21-30.

Berrettini, W.H. (2000) Are schizophrenic and bipolar disorders related? A review of family and molecular studies. Biol Psychiatry. 48(6): 531-538.

Berridge, M.J. (1998) Neuronal calcium signaling. Neuron. 21(1): 13-26. Berry, M.D. (2004) Mammalian central nervous system trace amines. Pharmacologic amphetamines,

physiologic neuromodulators. J Neurochem. 90(2): 257-271.

85

Birnbaum, S.G., Yuan, P.X., Wang, M., Vijayraghavan, S., Bloom, A.K., Davis, D.J., Gobeske, K.T., Sweatt, J.D., Manji, H.K., and Arnsten, A.F. (2004) Protein kinase C overactivity impairs prefrontal cortical regulation of working memory. Science. 306(5697): 882-884.

Blitzer, R.D., Connor, J.H., Brown, G.P., Wong, T., Shenolikar, S., Iyengar, R., and Landau, E.M. (1998) Gating of CaMKII by cAMP-regulated protein phosphatase activity during LTP. Science. 280(5371): 1940-1942.

Borodinsky, L.N., Coso, O.A., and Fiszman, M.L. (2002) Contribution of Ca2+ calmodulin-dependent protein kinase II and mitogen-activated protein kinase kinase to neural activity-induced neurite outgrowth and survival of cerebellar granule cells. J Neurochem. 80(6): 1062-1070.

Braun, A.P., and Schulman, H. (1995) The multifunctional calcium/calmodulin-dependent protein kinase: from form to function. Annu Rev Physiol. 57(417-445.

Bray, N.J., Buckland, P.R., Owen, M.J., and O'Donovan, M.C. (2003) Cis-acting variation in the expression of a high proportion of genes in human brain. Hum Genet. 113(2): 149-153.

Breen, M.A., and Ashcroft, S.J. (1997) Human islets of Langerhans express multiple isoforms of calcium/calmodulin-dependent protein kinase II. Biochem Biophys Res Commun. 236(2): 473-478.

Breier, A., Su, T.P., Saunders, R., Carson, R.E., Kolachana, B.S., de Bartolomeis, A., Weinberger, D.R., Weisenfeld, N., Malhotra, A.K., Eckelman, W.C., and Pickar, D. (1997) Schizophrenia is associated with elevated amphetamine-induced synaptic dopamine concentrations: evidence from a novel positron emission tomography method. Proc Natl Acad Sci U S A. 94(6): 2569-2574.

Breier, A., Adler, C.M., Weisenfeld, N., Su, T.P., Elman, I., Picken, L., Malhotra, A.K., and Pickar, D. (1998) Effects of NMDA antagonism on striatal dopamine release in healthy subjects: application of a novel PET approach. Synapse. 29(2): 142-147.

Brickey, D.A., Bann, J.G., Fong, Y.L., Perrino, L., Brennan, R.G., and Soderling, T.R. (1994) Mutational analysis of the autoinhibitory domain of calmodulin kinase II. J Biol Chem. 269(46): 29047-29054.

Brittis, P.A., and Flanagan, J.G. (2001) Nogo domains and a Nogo receptor: implications for axon regeneration. Neuron. 30(1): 11-14.

Brocke, L., Srinivasan, M., and Schulman, H. (1995) Developmental and regional expression of multifunctional Ca2+/calmodulin-dependent protein kinase isoforms in rat brain. J Neurosci. 15(10): 6797-6808.

Brocke, L., Chiang, L.W., Wagner, P.D., and Schulman, H. (1999) Functional implications of the subunit composition of neuronal CaM kinase II. J Biol Chem. 274(32): 22713-22722.

Brown, G.P., Blitzer, R.D., Connor, J.H., Wong, T., Shenolikar, S., Iyengar, R., and Landau, E.M. (2000) Long-term potentiation induced by theta frequency stimulation is regulated by a protein phosphatase-1-operated gate. J Neurosci. 20(21): 7880-7887.

Buckland, P.R., Hoogendoorn, B., Guy, C.A., Coleman, S.L., Smith, S.K., Buxbaum, J.D., Haroutunian, V., and O'Donovan, M.C. (2004) A high proportion of polymorphisms in the promoters of brain expressed genes influences transcriptional activity. Biochim Biophys Acta. 1690(3): 238-249.

Buffo, A., Zagrebelsky, M., Huber, A.B., Skerra, A., Schwab, M.E., Strata, P., and Rossi, F. (2000) Application of neutralizing antibodies against NI-35/250 myelin-associated neurite growth inhibitory proteins to the adult rat cerebellum induces sprouting of uninjured purkinje cell axons. J Neurosci. 20(6): 2275-2286.

Bunney, W.E., and Bunney, B.G. (2000) Evidence for a compromised dorsolateral prefrontal cortical parallel circuit in schizophrenia. Brain Res Brain Res Rev. 31(2-3): 138-146.

86

Burgin, K.E., Waxham, M.N., Rickling, S., Westgate, S.A., Mobley, W.C., and Kelly, P.T. (1990) In situ hybridization histochemistry of Ca2+/calmodulin-dependent protein kinase in developing rat brain. J Neurosci. 10(6): 1788-1798.

Burt, D.R., Creese, I., and Snyder, S.H. (1976) Properties of [3H]haloperidol and [3H]dopamine binding associated with dopamine receptors in calf brain membranes. Mol Pharmacol. 12(5): 800-812.

Buss, A., Sellhaus, B., Wolmsley, A., Noth, J., Schwab, M.E., and Brook, G.A. (2005) Expression pattern of NOGO-A protein in the human nervous system. Acta Neuropathol (Berl). 110(2): 113-119.

Cai, D., Shen, Y., De Bellard, M., Tang, S., and Filbin, M.T. (1999) Prior exposure to neurotrophins blocks inhibition of axonal regeneration by MAG and myelin via a cAMP-dependent mechanism. Neuron. 22(1): 89-101.

Cai, X., Gu, Z., Zhong, P., Ren, Y., and Yan, Z. (2002) Serotonin 5-HT1A receptors regulate AMPA receptor channels through inhibiting Ca2+/calmodulin-dependent kinase II in prefrontal cortical pyramidal neurons. J Biol Chem. 277(39): 36553-36562.

Cantor-Graae, E., Nordstrom, L.G., and McNeil, T.F. (2001) Substance abuse in schizophrenia: a review of the literature and a study of correlates in Sweden. Schizophr Res. 48(1): 69-82.

Cardno, A.G., Marshall, E.J., Coid, B., Macdonald, A.M., Ribchester, T.R., Davies, N.J., Venturi, P., Jones, L.A., Lewis, S.W., Sham, P.C., Gottesman, II, Farmer, A.E., McGuffin, P., Reveley, A.M., and Murray, R.M. (1999) Heritability estimates for psychotic disorders: the Maudsley twin psychosis series. Arch Gen Psychiatry. 56(2): 162-168.

Cardno, A.G., and Gottesman, II (2000) Twin studies of schizophrenia: from bow-and-arrow concordances to star wars Mx and functional genomics. Am J Med Genet. 97(1): 12-17.

Carlsson, A., Waters, N., Holm-Waters, S., Tedroff, J., Nilsson, M., and Carlsson, M.L. (2001) Interactions between monoamines, glutamate, and GABA in schizophrenia: new evidence. Annu Rev Pharmacol Toxicol. 41(237-260.

Carmeliet, P. (2003) Blood vessels and nerves: common signals, pathways and diseases. Nat Rev Genet. 4(9): 710-720.

Carvalho, A.L., Kameyama, K., and Huganir, R.L. (1999) Characterization of phosphorylation sites on the glutamate receptor 4 subunit of the AMPA receptors. J Neurosci. 19(12): 4748-4754.

Castaneda, E., Becker, J.B., and Robinson, T.E. (1988) The long-term effects of repeated amphetamine treatment in vivo on amphetamine, KCl and electrical stimulation evoked striatal dopamine release in vitro. Life Sci. 42(24): 2447-2456.

Celano, E., Tiraboschi, E., Consogno, E., D'Urso, G., Mbakop, M.P., Gennarelli, M., de Bartolomeis, A., Racagni, G., and Popoli, M. (2003) Selective regulation of presynaptic calcium/calmodulin-dependent protein kinase II by psychotropic drugs. Biol Psychiatry. 53(5): 442-449.

Chen, C., Rainnie, D.G., Greene, R.W., and Tonegawa, S. (1994) Abnormal fear response and aggressive behavior in mutant mice deficient for alpha-calcium-calmodulin kinase II [see comments]. Science. 266(5183): 291-294.

Chen, H., Bernstein, B.W., and Bamburg, J.R. (2000a) Regulating actin-filament dynamics in vivo. Trends Biochem Sci. 25(1): 19-23.

Chen, M.S., Huber, A.B., Haar, M.E.v.d., Frank, M., Schnell, L., Spillmann, A.A., Christ, F., and Schwab, M.E. (2000b) Nogo-A is a myelin-associated neurite outgrowth inhibitor and an antigen for monoclonal antibody IN-1. (Letter) Nature. 403(january 27): 434-439.

Chen, Y., Tang, X., Cao, X., Chen, H., and Zhang, X. (2006) Human Nogo-C overexpression induces HEK293 cell apoptosis via a mechanism that involves JNK-c-Jun pathway. Biochem Biophys Res Commun. 348(3): 923-928.

87

Chiou, S.H., Chen, S.J., Peng, C.H., Chang, Y.L., Ku, H.H., Hsu, W.M., Ho, L.L., and Lee, C.H. (2006) Fluoxetine up-regulates expression of cellular FLICE-inhibitory protein and inhibits LPS-induced apoptosis in hippocampus-derived neural stem cell. Biochem Biophys Res Commun. 343(2): 391-400.

Choi, S., Klingauf, J., and Tsien, R.W. (2000) Postfusional regulation of cleft glutamate concentration during LTP at 'silent synapses'. Nat Neurosci. 3(4): 330-336.

Churn, S.B., and DeLorenzo, R.J. (1998) Modulation of GABAergic receptor binding by activation of calcium and calmodulin-dependent kinase II membrane phosphorylation. Brain Res. 809(1): 68-76.

Colbran, R.J., and Soderling, T.R. (1990) Calcium/calmodulin-independent autophosphorylation sites of calcium/calmodulin-dependent protein kinase II. Studies on the effect of phosphorylation of threonine 305/306 and serine 314 on calmodulin binding using synthetic peptides. J Biol Chem. 265(19): 11213-11219.

Colbran, R.J. (2004) Targeting of calcium/calmodulin-dependent protein kinase II. Biochem J. 378(Pt 1): 1-16.

Colbran, R.J., and Brown, A.M. (2004) Calcium/calmodulin-dependent protein kinase II and synaptic plasticity. Curr Opin Neurobiol. 14(3): 318-327.

Conne, B., Stutz, A., and Vassalli, J.D. (2000) The 3' untranslated region of messenger RNA: A molecular 'hotspot' for pathology? Nat Med. 6(6): 637-641.

Coon, H., Myles-Worsley, M., Tiobech, J., Hoff, M., Rosenthal, J., Bennett, P., Reimherr, F., Wender, P., Dale, P., Polloi, A., and Byerley, W. (1998) Evidence for a chromosome 2p13-14 schizophrenia susceptibility locus in families from Palau, Micronesia. Mol Psychiatry. 3(6): 521-527.

Crabtree, G.R. (1999) Generic signals and specific outcomes: signaling through Ca2+, calcineurin, and NF-AT. Cell. 96(5): 611-614.

Creese, I., Burt, D.R., and Snyder, S.H. (1976) Dopamine receptor binding predicts clinical and pharmacological potencies of antischizophrenic drugs. Science. 192(4238): 481-483.

Cull-Candy, S., Brickley, S., and Farrant, M. (2001) NMDA receptor subunits: diversity, development and disease. Curr Opin Neurobiol. 11(3): 327-335.

De Koninck, P., and Schulman, H. (1998) Sensitivity of CaM kinase II to the frequency of Ca2+ oscillations. Science. 279(5348): 227-230.

Dechant, G., and Barde, Y.A. (2002) The neurotrophin receptor p75(NTR): novel functions and implications for diseases of the nervous system. Nat Neurosci. 5(11): 1131-1136.

Derkach, V., Barria, A., and Soderling, T.R. (1999) Ca2+/calmodulin-kinase II enhances channel conductance of alpha-amino-3- hydroxy-5-methyl-4-isoxazolepropionate type glutamate receptors. Proc Natl Acad Sci U S A. 96(6): 3269-3274.

Dhavan, R., Greer, P.L., Morabito, M.A., Orlando, L.R., and Tsai, L.H. (2002) The cyclin-dependent kinase 5 activators p35 and p39 interact with the alpha-subunit of Ca2+/calmodulin-dependent protein kinase II and alpha-actinin-1 in a calcium-dependent manner. J Neurosci. 22(18): 7879-7891.

Diatchenko, L., Lau, Y.F., Campbell, A.P., Chenchik, A., Moqadam, F., Huang, B., Lukyanov, S., Lukyanov, K., Gurskaya, N., Sverdlov, E.D., and Siebert, P.D. (1996) Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci U S A. 93(12): 6025-6030.

88

Ding, J., Hu, B., Tang, L.S., and Yip, H.K. (2001) Study of the role of the low-affinity neurotrophin receptor p75 in naturally occurring cell death during development of the rat retina. Dev Neurosci. 23(6): 390-398.

Dodd, D.A., Niederoest, B., Bloechlinger, S., Dupuis, L., Loeffler, J.P., and Schwab, M.E. (2005) Nogo-A, -B, and -C are found on the cell surface and interact together in many different cell types. J Biol Chem. 280(13): 12494-12502.

Donai, H., Morinaga, H., and Yamauchi, T. (2001) Genomic organization and neuronal cell type specific promoter activity of beta isoform of Ca(2+)/calmodulin dependent protein kinase II of rat brain. Brain Res Mol Brain Res. 94(1-2): 35-47.

Dosemeci, A., and Albers, R.W. (1996) A mechanism for synaptic frequency detection through autophosphorylation of CaM kinase II. Biophys J. 70(6): 2493-2501.

Du, J., Szabo, S.T., Gray, N.A., and Manji, H.K. (2004) Focus on CaMKII: a molecular switch in the pathophysiology and treatment of mood and anxiety disorders. Int J Neuropsychopharmacol. 7(3): 243-248.

Ducibella, T., Schultz, R.M., and Ozil, J.P. (2006) Role of calcium signals in early development. Semin Cell Dev Biol. 17(2): 324-332.

Dudek, S.M., and Bear, M.F. (1992) Homosynaptic long-term depression in area CA1 of hippocampus and effects of N-methyl-D-aspartate receptor blockade. Proc Natl Acad Sci U S A. 89(10): 4363-4367.

Dupuis, L., Gonzalez de Aguilar, J.L., di Scala, F., Rene, F., de Tapia, M., Pradat, P.F., Lacomblez, L., Seihlan, D., Prinjha, R., Walsh, F.S., Meininger, V., and Loeffler, J.P. (2002) Nogo provides a molecular marker for diagnosis of amyotrophic lateral sclerosis. Neurobiol Dis. 10(3): 358-365.

Edagawa, Y., Saito, H., and Abe, K. (1999) Stimulation of the 5-HT1A receptor selectively suppresses NMDA receptor-mediated synaptic excitation in the rat visual cortex. Brain Res. 827(1-2): 225-228.

Ehlers, M.D., Zhang, S., Bernhadt, J.P., and Huganir, R.L. (1996) Inactivation of NMDA receptors by direct interaction of calmodulin with the NR1 subunit. Cell. 84(5): 745-755.

Ekelund, J., Hennah, W., Hiekkalinna, T., Parker, A., Meyer, J., Lonnqvist, J., and Peltonen, L. (2004) Replication of 1q42 linkage in Finnish schizophrenia pedigrees. Molecular Psychiatry. 9(1037 - 1041.

Elgersma, Y., Fedorov, N.B., Ikonen, S., Choi, E.S., Elgersma, M., Carvalho, O.M., Giese, K.P., and Silva, A.J. (2002) Inhibitory autophosphorylation of CaMKII controls PSD association, plasticity, and learning. Neuron. 36(3): 493-505.

Elgersma, Y., Sweatt, J.D., and Giese, K.P. (2004) Mouse genetic approaches to investigating calcium/calmodulin-dependent protein kinase II function in plasticity and cognition. J Neurosci. 24(39): 8410-8415.

Engert, F., and Bonhoeffer, T. (1999) Dendritic spine changes associated with hippocampal long-term synaptic plasticity [see comments]. Nature. 399(6731): 66-70.

Erondu, N.E., and Kennedy, M.B. (1985) Regional distribution of type II Ca2+/calmodulin-dependent protein kinase in rat brain. J Neurosci. 5(12): 3270-3277.

Esteban, J.A., Shi, S.H., Wilson, C., Nuriya, M., Huganir, R.L., and Malinow, R. (2003) PKA phosphorylation of AMPA receptor subunits controls synaptic trafficking underlying plasticity. Nat Neurosci. 6(2): 136-143.

Fan, G.H., Wang, L.Z., Qiu, H.C., Ma, L., and Pei, G. (1999) Inhibition of calcium/calmodulin-dependent protein kinase II in rat hippocampus attenuates morphine tolerance and dependence. Mol Pharmacol. 56(1): 39-45.

89

Fang, L., Wu, J., Lin, Q., and Willis, W.D. (2002) Calcium-calmodulin-dependent protein kinase II contributes to spinal cord central sensitization. J Neurosci. 22(10): 4196-4204.

Feinberg, I. (1990) Cortical pruning and the development of schizophrenia [letter; comment]. Schizophr Bull. 16(4): 567-570.

Fink, C.C., and Meyer, T. (2002) Molecular mechanisms of CaMKII activation in neuronal plasticity. Curr Opin Neurobiol. 12(3): 293-299.

Fink, C.C., Bayer, K.U., Myers, J.W., Ferrell, J.E., Jr., Schulman, H., and Meyer, T. (2003) Selective regulation of neurite extension and synapse formation by the beta but not the alpha isoform of CaMKII. Neuron. 39(2): 283-297.

Fischer, M., Kaech, S., Wagner, U., Brinkhaus, H., and Matus, A. (2000) Glutamate receptors regulate actin-based plasticity in dendritic spines. Nat Neurosci. 3(9): 887-894.

Fog, J.U., Khoshbouei, H., Holy, M., Owens, W.A., Vaegter, C.B., Sen, N., Nikandrova, Y., Bowton, E., McMahon, D.G., Colbran, R.J., Daws, L.C., Sitte, H.H., Javitch, J.A., Galli, A., and Gether, U. (2006) Calmodulin kinase II interacts with the dopamine transporter C terminus to regulate amphetamine-induced reverse transport. Neuron. 51(4): 417-429.

Fong, D.K., Rao, A., Crump, F.T., and Craig, A.M. (2002) Rapid synaptic remodeling by protein kinase C: reciprocal translocation of NMDA receptors and calcium/calmodulin-dependent kinase II. J Neurosci. 22(6): 2153-2164.

Fournier, A.E., GrandPre, T., and Strittmatter, S.M. (2001) Identification of a receptor mediating Nogo-66 inhibition of axonal regeneration. Nature. 409(6818): 341-346.

Fournier, A.E., Takizawa, B.T., and Strittmatter, S.M. (2003) Rho kinase inhibition enhances axonal regeneration in the injured CNS. J Neurosci. 23(4): 1416-1423.

Frankle, W.G., Lerma, J., and Laruelle, M. (2003) The synaptic hypothesis of schizophrenia. Neuron. 39(2): 205-216.

Fukunaga, K., Muller, D., and Miyamoto, E. (1996) CaM kinase II in long-term potentiation. Neurochem Int. 28(4): 343-358.

Fukunaga, K., and Miyamoto, E. (1999) Current studies on a working model of CaM kinase II in hippocampal long- term potentiation and memory. Jpn J Pharmacol. 79(1): 7-15.

Fuller Torrey, E., and Yolken, R.H. (2000) Familial and genetic mechanisms in schizophrenia. Brain Res Brain Res Rev. 31(2-3): 113-117.

Gaertner, T.R., Kolodziej, S.J., Wang, D., Kobayashi, R., Koomen, J.M., Stoops, J.K., and Waxham, M.N. (2004) Comparative analyses of the three-dimensional structures and enzymatic properties of alpha, beta, gamma and delta isoforms of Ca2+-calmodulin-dependent protein kinase II. J Biol Chem. 279(13): 12484-12494.

Gardoni, F., Schrama, L.H., van Dalen, J.J., Gispen, W.H., Cattabeni, F., and Di Luca, M. (1999) AlphaCaMKII binding to the C-terminal tail of NMDA receptor subunit NR2A and its modulation by autophosphorylation. FEBS Lett. 456(3): 394-398.

Gardoni, F., Mauceri, D., Fiorentini, C., Bellone, C., Missale, C., Cattabeni, F., and Di Luca, M. (2003) CaMKII-dependent phosphorylation regulates SAP97/NR2A interaction. J Biol Chem. 278(45): 44745-44752.

Gardoni, F., Polli, F., Cattabeni, F., and Di Luca, M. (2006) Calcium-calmodulin-dependent protein kinase II phosphorylation modulates PSD-95 binding to NMDA receptors. Eur J Neurosci. 24(10): 2694-2704.

Garry, E.M., Moss, A., Delaney, A., O'Neill, F., Blakemore, J., Bowen, J., Husi, H., Mitchell, R., Grant, S.G., and Fleetwood-Walker, S.M. (2003) Neuropathic sensitization of behavioral reflexes and

90

spinal NMDA receptor/CaM kinase II interactions are disrupted in PSD-95 mutant mice. Curr Biol. 13(4): 321-328.

Geigy, D. (1959) Scientific Tables. Geisler, J.G., Stubbs, L.J., Wasserman, W.W., and Mucenski, M.L. (1998) Molecular cloning of a novel

mouse gene with predominant muscle and neural expression. Mamm Genome. 9(4): 274-282. Giese, K.P., Fedorov, N.B., Filipkowski, R.K., and Silva, A.J. (1998) Autophosphorylation at Thr286 of

the alpha calcium-calmodulin kinase II in LTP and learning. Science. 279(5352): 870-873. Gil, V., Nicolas, O., Mingorance, A., Urena, J.M., Tang, B.L., Hirata, T., Saez-Valero, J., Ferrer, I.,

Soriano, E., and del Rio, J.A. (2006) Nogo-A expression in the human hippocampus in normal aging and in Alzheimer disease. J Neuropathol Exp Neurol. 65(5): 433-444.

Gloyn, A.L., and Ashcroft, S.J. (2001) The beta-cell Ca2+/calmodulin-dependent protein kinase II (CaM kinase II) beta3 isoform containing a proline-rich tandem repeat in the association domain can be found in the human genome. Diabetologia. 44(6): 787.

Goda, Y., and Davis, G.W. (2003) Mechanisms of synapse assembly and disassembly. Neuron. 40(2): 243-264.

Gogos, J.A., and Gerber, D.J. (2006) Schizophrenia susceptibility genes: emergence of positional candidates and future directions. Trends Pharmacol Sci. 27(4): 226-233.

Goldman-Rakic, P.S. (1995) Cellular basis of working memory. Neuron. 14(3): 477-485. Goldman-Rakic, P.S. (1996) Regional and cellular fractionation of working memory. Proc Natl Acad

Sci U S A. 93(24): 13473-13480. Goldman-Rakic, P.S., and Selemon, L.D. (1997) Functional and anatomical aspects of prefrontal

pathology in schizophrenia. Schizophr Bull. 23(3): 437-458. Gordon, J.A., Cioffi, D., Silva, A.J., and Stryker, M.P. (1996) Deficient plasticity in the primary visual

cortex of alpha- calcium/calmodulin-dependent protein kinase II mutant mice. Neuron. 17(3): 491-499.

Gottesman, II, and Bertelsen, A. (1989) Confirming unexpressed genotypes for schizophrenia. Risks in the offspring of Fischer's Danish identical and fraternal discordant twins. Arch Gen Psychiatry. 46(10): 867-872.

Gottesman, I. (1991) Schizophrenia Genesis: The Origins of Madness. New York: Freedman. GrandPre, T., Nakamura, F., Vartanian, T., and Strittmatter, S.M. (2000) Identification of the Nogo

inhibitor of axon regeneration as a Reticulon protein. Nature. 403(6768): 439-444. GrandPre, T., Li, S., and Strittmatter, S.M. (2002) Nogo-66 receptor antagonist peptide promotes axonal

regeneration. Nature. 417(6888): 547-551. Gray, N.K., and Wickens, M. (1998) Control of translation initiation in animals. Annu Rev Cell Dev

Biol. 14(399-458. Greenstein, R., Novak, G., and Seeman, P. (2007) Amphetamine sensitization elevates CaMKIIb

mRNA. Synapse. 61(10): 827-834. Griffith, L.C., and Greenspan, R.J. (1993) The diversity of calcium/calmodulin-dependent protein kinase

II isoforms in Drosophila is generated by alternative splicing of a single gene. J Neurochem. 61(4): 1534-1537.

Griffith, L.C. (2004) Regulation of calcium/calmodulin-dependent protein kinase II activation by intramolecular and intermolecular interactions. J Neurosci. 24(39): 8394-8398.

Haberhausen, G., Pinsl, J., Kuhn, C.C., and Markert-Hahn, C. (1998) Comparative study of different standardization concepts in quantitative competitive reverse transcription-PCR assays. J Clin Microbiol. 36(3): 628-633.

91

Hanson, P.I., and Schulman, H. (1992) Neuronal Ca2+/calmodulin-dependent protein kinases. Annu Rev Biochem. 61(559-601.

Hanson, P.I., Meyer, T., Stryer, L., and Schulman, H. (1994) Dual role of calmodulin in autophosphorylation of multifunctional CaM kinase may underlie decoding of calcium signals. Neuron. 12(5): 943-956.

Hardingham, G.E., and Bading, H. (1999) Calcium as a versatile second messenger in the control of gene expression. Microsc Res Tech. 46(6): 348-355.

Hardingham, N., Glazewski, S., Pakhotin, P., Mizuno, K., Chapman, P.F., Giese, K.P., and Fox, K. (2003) Neocortical long-term potentiation and experience-dependent synaptic plasticity require alpha-calcium/calmodulin-dependent protein kinase II autophosphorylation. J Neurosci. 23(11): 4428-4436.

Hardy, J., and Selkoe, D.J. (2002) The amyloid hypothesis of Alzheimer's disease: progress and problems on the road to therapeutics. Science. 297(5580): 353-356.

Harris, K.M. (1999) Structure, development, and plasticity of dendritic spines. Curr Opin Neurobiol. 9(3): 343-348.

Harrison, P.J., Law, A.J., and Eastwood, S.L. (2003) Glutamate receptors and transporters in the hippocampus in schizophrenia. Ann N Y Acad Sci. 1003(94-101.

Hasegawa, Y., Fujitani, M., Hata, K., Tohyama, M., Yamagishi, S., and Yamashita, T. (2004) Promotion of axon regeneration by myelin-associated glycoprotein and Nogo through divergent signals downstream of Gi/G. J Neurosci. 24(30): 6826-6832.

Hayashi, Y., Shi, S.H., Esteban, J.A., Piccini, A., Poncer, J.C., and Malinow, R. (2000) Driving AMPA receptors into synapses by LTP and CaMKII: requirement for GluR1 and PDZ domain interaction. Science. 287(5461): 2262-2267.

Hayley, S., Poulter, M.O., Merali, Z., and Anisman, H. (2005) The pathogenesis of clinical depression: stressor- and cytokine-induced alterations of neuroplasticity. Neuroscience. 135(3): 659-678.

He, W., Lu, Y., Qahwash, I., Hu, X.Y., Chang, A., and Yan, R. (2004) Reticulon family members modulate BACE1 activity and amyloid-beta peptide generation. Nat Med. 10(9): 959-965.

Hely, T.A., Graham, B., and Ooyen, A.V. (2001) A computational model of dendrite elongation and branching based on MAP2 phosphorylation. J Theor Biol. 210(3): 375-384.

Hens, J., Nuydens, R., Geerts, H., Senden, N.H., Van de Ven, W.J., Roebroek, A.J., van de Velde, H.J., Ramaekers, F.C., and Broers, J.L. (1998) Neuronal differentiation is accompanied by NSP-C expression. Cell Tissue Res. 292(2): 229-237.

Hering, H., and Sheng, M. (2001) Dendritic spines: structure, dynamics and regulation. Nat Rev Neurosci. 2(12): 880-888.

Hering, H., Lin, C.C., and Sheng, M. (2003) Lipid rafts in the maintenance of synapses, dendritic spines, and surface AMPA receptor stability. J Neurosci. 23(8): 3262-3271.

Hersch, S.M., Ciliax, B.J., Gutekunst, C.A., Rees, H.D., Heilman, C.J., Yung, K.K., Bolam, J.P., Ince, E., Yi, H., and Levey, A.I. (1995) Electron microscopic analysis of D1 and D2 dopamine receptor proteins in the dorsal striatum and their synaptic relationships with motor corticostriatal afferents. J Neurosci. 15(7 Pt 2): 5222-5237.

Hickmott, P.W., and Constantine-Paton, M. (1997) Experimental down-regulation of the NMDA channel associated with synapse pruning. J Neurophysiol. 78(2): 1096-1107.

Houston, C.M., and Smart, T.G. (2006) CaMK-II modulation of GABA(A) receptors expressed in HEK293, NG108-15 and rat cerebellar granule neurons. Eur J Neurosci. 24(9): 2504-2514.

Hsu, R., Woodroffe, A., Lai, W., Cook, M.N., Mukai, J., Dunning, J.P., Swanson, D.J., Roos, J.L., Abecasis, G.R., Karayiorgou, M., and Gogos, J.A. (2007) Nogo Receptor 1 (RTN4R) as a

92

Candidate Gene for Schizophrenia: Analysis Using Human and Mouse Genetic Approaches. PLoS ONE. 2(11): e1234.

Hu, F., Liu, B.P., Budel, S., Liao, J., Chin, J., Fournier, A., and Strittmatter, S.M. (2005) Nogo-A interacts with the Nogo-66 receptor through multiple sites to create an isoform-selective subnanomolar agonist. J Neurosci. 25(22): 5298-5304.

Huang, Y.S., Jung, M.Y., Sarkissian, M., and Richter, J.D. (2002) N-methyl-D-aspartate receptor signaling results in Aurora kinase-catalyzed CPEB phosphorylation and alpha CaMKII mRNA polyadenylation at synapses. Embo J. 21(9): 2139-2148.

Huang, Y.S., Carson, J.H., Barbarese, E., and Richter, J.D. (2003) Facilitation of dendritic mRNA transport by CPEB. Genes Dev. 17(5): 638-653.

Huber, A.B., and Schwab, M.E. (2000) Nogo-A, a potent inhibitor of neurite outgrowth and regeneration. Biol Chem. 381(5-6): 407-419.

Huber, A.B., Weinmann, O., Brosamle, C., Oertle, T., and Schwab, M.E. (2002) Patterns of Nogo mRNA and protein expression in the developing and adult rat and after CNS lesions. J Neurosci. 22(9): 3553-3567.

Hudmon, A., and Schulman, H. (2002a) Neuronal CA2+/calmodulin-dependent protein kinase II: the role of structure and autoregulation in cellular function. Annu Rev Biochem. 71(473-510.

Hudmon, A., and Schulman, H. (2002b) Structure-function of the multifunctional Ca2+/calmodulin-dependent protein kinase II. Biochem J. 364(Pt 3): 593-611.

Inwang, E.E., Mosnaim, A.D., and Sabelli, H.C. (1973) Isolation and characterization of phenylethylamine and phenylethanolamine from human brain. J Neurochem. 20(5): 1469-1473.

Jansen, R.P. (2001) mRNA localization: message on the move. Nat Rev Mol Cell Biol. 2(4): 247-256. Javitt, D.C., and Zukin, S.R. (1991) Recent advances in the phencyclidine model of schizophrenia. Am J

Psychiatry. 148(10): 1301-1308. Jentsch, J.D., Tran, A., Le, D., Youngren, K.D., and Roth, R.H. (1997) Subchronic phencyclidine

administration reduces mesoprefrontal dopamine utilization and impairs prefrontal cortical-dependent cognition in the rat. Neuropsychopharmacology. 17(2): 92-99.

Jentsch, J.D., and Roth, R.H. (1999) The neuropsychopharmacology of phencyclidine: from NMDA receptor hypofunction to the dopamine hypothesis of schizophrenia. Neuropsychopharmacology. 20(3): 201-225.

Johnson, P.W., Abramow-Newerly, W., Seilheimer, B., Sadoul, R., Tropak, M.B., Arquint, M., Dunn, R.J., Schachner, M., and Roder, J.C. (1989) Recombinant myelin-associated glycoprotein confers neural adhesion and neurite outgrowth function. Neuron. 3(3): 377-385.

Johnstone, E.C. (1989) The spectrum of structural brain changes in schizophrenia: age of onset as a predictor of cognitive and clinical impairments and their cerebral correlates. Psychological medicine. 19(1): 91-103.

Jokic, N., Gonzalez de Aguilar, J.L., Pradat, P.F., Dupuis, L., Echaniz-Laguna, A., Muller, A., Dubourg, O., Seilhean, D., Hauw, J.J., Loeffler, J.P., and Meininger, V. (2005) Nogo expression in muscle correlates with amyotrophic lateral sclerosis severity. Ann Neurol. 57(4): 553-556.

Jonas, E.A., Hoit, D., Hickman, J.A., Brandt, T.A., Polster, B.M., Fannjiang, Y., McCarthy, E., Montanez, M.K., Hardwick, J.M., and Kaczmarek, L.K. (2003) Modulation of synaptic transmission by the BCL-2 family protein BCL-xL. J Neurosci. 23(23): 8423-8431.

Jones, S.R., Gainetdinov, R.R., Wightman, R.M., and Caron, M.G. (1998) Mechanisms of amphetamine action revealed in mice lacking the dopamine transporter. J Neurosci. 18(6): 1979-1986.

93

Josephson, A., Widenfalk, J., Widmer, H.W., Olson, L., and Spenger, C. (2001) NOGO mRNA expression in adult and fetal human and rat nervous tissue and in weight drop injury. Exp Neurol. 169(2): 319-328.

Josephson, A., Trifunovski, A., Widmer, H.R., Widenfalk, J., Olson, L., and Spenger, C. (2002) Nogo-receptor gene activity: cellular localization and developmental regulation of mRNA in mice and humans. J Comp Neurol. 453(3): 292-304.

Jourdain, P., Fukunaga, K., and Muller, D. (2003) Calcium/calmodulin-dependent protein kinase II contributes to activity-dependent filopodia growth and spine formation. J Neurosci. 23(33): 10645-10649.

Kantor, L., Hewlett, G.H., and Gnegy, M.E. (1999) Enhanced amphetamine- and K+-mediated dopamine release in rat striatum after repeated amphetamine: differential requirements for Ca2+- and calmodulin-dependent phosphorylation and synaptic vesicles. J Neurosci. 19(10): 3801-3808.

Karayiorgou, M., Kasch, L., Lasseter, V.K., Hwang, J., Elango, R., Bernardini, D.J., Kimberland, M., Babb, R., Francomano, C.A., Wolyniec, P.S., and et al. (1994) Report from the Maryland Epidemiology Schizophrenia Linkage Study: no evidence for linkage between schizophrenia and a number of candidate and other genomic regions using a complex dominant model. Am J Med Genet. 54(4): 345-353.

Karayiorgou, M., Morris, M.A., Morrow, B., Shprintzen, R.J., Goldberg, R., Borrow, J., Gos, A., Nestadt, G., Wolyniec, P.S., Lasseter, V.K., and et al. (1995) Schizophrenia susceptibility associated with interstitial deletions of chromosome 22q11. Proc Natl Acad Sci U S A. 92(17): 7612-7616.

Karls, U., Muller, U., Gilbert, D.J., Copeland, N.G., Jenkins, N.A., and Harbers, K. (1992) Structure, expression, and chromosome location of the gene for the beta subunit of brain-specific Ca2+/calmodulin-dependent protein kinase II identified by transgene integration in an embryonic lethal mouse mutant. Mol Cell Biol. 12(8): 3644-3652.

Karnezis, T., Mandemakers, W., McQualter, J.L., Zheng, B., Ho, P.P., Jordan, K.A., Murray, B.M., Barres, B., Tessier-Lavigne, M., and Bernard, C.C. (2004) The neurite outgrowth inhibitor Nogo A is involved in autoimmune-mediated demyelination. Nat Neurosci. 7(7): 736-744.

Katz, L.C., and Shatz, C.J. (1996) Synaptic activity and the construction of cortical circuits. Science. 274(5290): 1133-1138.

Kendler, K.S., Tsuang, M.T., and Hays, P. (1987) Age at onset in schizophrenia. A familial perspective. Arch Gen Psychiatry. 44(10): 881-890.

Keshavan, M.S., Anderson, S., and Pettegrew, J.W. (1994) Is schizophrenia due to excessive synaptic pruning in the prefrontal cortex? The Feinberg hypothesis revisited. J Psychiatr Res. 28(3): 239-265.

Keshavan, M.S. (1999) Development, disease and degeneration in schizophrenia: a unitary pathophysiological model. J Psychiatr Res. 33(6): 513-521.

Kiebler, M.A., and DesGroseillers, L. (2000) Molecular insights into mRNA transport and local translation in the mammalian nervous system. Neuron. 25(1): 19-28.

Kietzmann, T., Knabe, W., and Schmidt-Kastner, R. (2001) Hypoxia and hypoxia-inducible factor modulated gene expression in brain: involvement in neuroprotection and cell death. Eur Arch Psychiatry Clin Neurosci. 251(4): 170-178.

Kim, J.J., and Diamond, D.M. (2002) The stressed hippocampus, synaptic plasticity and lost memories. Nat Rev Neurosci. 3(6): 453-462.

94

Kim, M.J., Dunah, A.W., Wang, Y.T., and Sheng, M. (2005) Differential roles of NR2A- and NR2B-containing NMDA receptors in Ras-ERK signaling and AMPA receptor trafficking. Neuron. 46(5): 745-760.

Kirov, G., O'Donovan, M.C., and Owen, M.J. (2005) Finding schizophrenia genes. J Clin Invest. 115(6): 1440-1448.

Klose, R.J., and Bird, A.P. (2006) Genomic DNA methylation: the mark and its mediators. Trends Biochem Sci. 31(2): 89-97.

Knable, M.B., Barci, B.M., Webster, M.J., Meador-Woodruff, J.H., and Torrey, E.F. (2004) Molecular abnormalities of the hippocampus in severe psychiatric illness: postmortem findings from the Stanley Neuropathology Consortium. Molecular Psychiatry. 9(609 - 620.

Kools, P.F., Roebroek, A.J., Van de Velde, H.J., Marynen, P., Bullerdiek, J., and Van de Ven, W.J. (1994) Regional mapping of the human NSP gene to chromosome region 14q21-->q22 by fluorescence in situ hybridization analysis. Cytogenet Cell Genet. 66(1): 48-50.

Kottis, V., Thibault, P., Mikol, D., Xiao, Z.C., Zhang, R., Dergham, P., and Braun, P.E. (2002) Oligodendrocyte-myelin glycoprotein (OMgp) is an inhibitor of neurite outgrowth. J Neurochem. 82(6): 1566-1569.

Kovalenko, S., Bergmann, A., Schneider-Axmann, T., Ovary, I., Majtenyi, K., Havas, L., Honer, W.G., Bogerts, B., and Falkai, P. (2003) Regio entorhinalis in schizophrenia: more evidence for migrational disturbances and suggestions for a new biological hypothesis. Pharmacopsychiatry. 36 Suppl 3(S158-161.

Kozak, M. (2000) Do the 5'untranslated domains of human cDNAs challenge the rules for initiation of translation (or is it vice versa)? Genomics. 70(3): 396-406.

Kraner, S.D., Chong, J.A., Tsay, H.J., and Mandel, G. (1992) Silencing the type II sodium channel gene: a model for neural-specific gene regulation. Neuron. 9(1): 37-44.

Kringlen, E., and Cramer, G. (1989) Offspring of monozygotic twins discordant for schizophrenia. Arch Gen Psychiatry. 46(10): 873-877.

Krystal, J.H., Karper, L.P., Seibyl, J.P., Freeman, G.K., Delaney, R., Bremner, J.D., Heninger, G.R., Bowers, M.B., Jr., and Charney, D.S. (1994) Subanesthetic effects of the noncompetitive NMDA antagonist, ketamine, in humans. Psychotomimetic, perceptual, cognitive, and neuroendocrine responses. Arch Gen Psychiatry. 51(3): 199-214.

Laruelle, M., Abi-Dargham, A., van Dyck, C.H., Gil, R., D'Souza, C.D., Erdos, J., McCance, E., Rosenblatt, W., Fingado, C., Zoghbi, S.S., Baldwin, R.M., Seibyl, J.P., Krystal, J.H., Charney, D.S., and Innis, R.B. (1996) Single photon emission computerized tomography imaging of amphetamine-induced dopamine release in drug-free schizophrenic subjects. Proc Natl Acad Sci U S A. 93(17): 9235-9240.

Laruelle, M., D'Souza, C.D., Baldwin, R.M., Abi-Dargham, A., Kanes, S.J., Fingado, C.L., Seibyl, J.P., Zoghbi, S.S., Bowers, M.B., Jatlow, P., Charney, D.S., and Innis, R.B. (1997) Imaging D2 receptor occupancy by endogenous dopamine in humans. Neuropsychopharmacology. 17(3): 162-174.

Lauren, J., Hu, F., Chin, J., Liao, J., Airaksinen, M.S., and Strittmatter, S.M. (2006) Characterization of myelin ligand complexes with the neuronal NOGO-66 receptor family. J Biol Chem.

Lee, F.J., Pei, L., Moszczynska, A., Vukusic, B., Fletcher, P.J., and Liu, F. (2007) Dopamine transporter cell surface localization facilitated by a direct interaction with the dopamine D2 receptor. Embo J. 26(8): 2127-2136.

Lee, J.M., Zipfel, G.J., and Choi, D.W. (1999) The changing landscape of ischaemic brain injury mechanisms. Nature. 399(6738 Suppl): A7-14.

95

Lee, K.F., Bachman, K., Landis, S., and Jaenisch, R. (1994) Dependence on p75 for innervation of some sympathetic targets. Science. 263(5152): 1447-1449.

Leinekugel, X., Khalilov, I., McLean, H., Caillard, O., Gaiarsa, J.L., Ben-Ari, Y., and Khazipov, R. (1999) GABA is the principal fast-acting excitatory transmitter in the neonatal brain. Adv Neurol. 79(189-201.

Leonard, A.S., Lim, I.A., Hemsworth, D.E., Horne, M.C., and Hell, J.W. (1999) Calcium/calmodulin-dependent protein kinase II is associated with the N- methyl-D-aspartate receptor. Proc Natl Acad Sci U S A. 96(6): 3239-3244.

Lewandowski, K.E., Barrantes-Vidal, N., Nelson-Gray, R.O., Clancy, C., Kepley, H.O., and Kwapil, T.R. (2006) Anxiety and depression symptoms in psychometrically identified schizotypy. Schizophr Res. 83(2-3): 225-235.

Lewis, C.M., Levinson, D.F., Wise, L.H., DeLisi, L.E., Straub, R.E., Hovatta, I., Williams, N.M., Schwab, S.G., Pulver, A.E., Faraone, S.V., Brzustowicz, L.M., Kaufmann, C.A., Garver, D.L., Gurling, H.M., Lindholm, E., Coon, H., Moises, H.W., Byerley, W., Shaw, S.H., Mesen, A., Sherrington, R., O'Neill, F.A., Walsh, D., Kendler, K.S., Ekelund, J., Paunio, T., Lonnqvist, J., Peltonen, L., O'Donovan, M.C., Owen, M.J., Wildenauer, D.B., Maier, W., Nestadt, G., Blouin, J.L., Antonarakis, S.E., Mowry, B.J., Silverman, J.M., Crowe, R.R., Cloninger, C.R., Tsuang, M.T., Malaspina, D., Harkavy-Friedman, J.M., Svrakic, D.M., Bassett, A.S., Holcomb, J., Kalsi, G., McQuillin, A., Brynjolfson, J., Sigmundsson, T., Petursson, H., Jazin, E., Zoega, T., and Helgason, T. (2003) Genome scan meta-analysis of schizophrenia and bipolar disorder, part II: Schizophrenia. Am J Hum Genet. 73(1): 34-48.

Lewis, D.A. (2000) GABAergic local circuit neurons and prefrontal cortical dysfunction in schizophrenia. Brain Res Brain Res Rev. 31(2-3): 270-276.

Lewis, D.A., and Gonzalez-Burgos, G. (2000) Intrinsic excitatory connections in the prefrontal cortex and the pathophysiology of schizophrenia. Brain Res Bull. 52(5): 309-317.

Lewis, J.D., Meehan, R.R., Henzel, W.J., Maurer-Fogy, I., Jeppesen, P., Klein, F., and Bird, A. (1992) Purification, sequence, and cellular localization of a novel chromosomal protein that binds to methylated DNA. Cell. 69(6): 905-914.

Li, C.Y., Mao, X., and Wei, L. (2008) Genes and (Common) Pathways Underlying Drug Addiction. PLoS ONE. 4(1): e2.

Li, G., Laabich, A., Liu, L.O., Xue, J., and Cooper, N.G. (2001a) Molecular cloning and sequence analyses of calcium/calmodulin-dependent protein kinase II from fetal and adult human brain. Sequence analyses of human brain calciuum/calmodulin-dependent protein kinase II. Mol Biol Rep. 28(1): 35-41.

Li, Q., Qi, B., Oka, K., Shimakage, M., Yoshioka, N., Inoue, H., Hakura, A., Kodama, K., Stanbridge, E.J., and Yutsudo, M. (2001b) Link of a new type of apoptosis-inducing gene ASY/Nogo-B to human cancer. Oncogene. 20(30): 3929-3936.

Liao, G.Y., Wagner, D.A., Hsu, M.H., and Leonard, J.P. (2001) Evidence for direct protein kinase-C mediated modulation of N-methyl-D-aspartate receptor current. Mol Pharmacol. 59(5): 960-964.

Lieberman, D.N., and Mody, I. (1994) Regulation of NMDA channel function by endogenous Ca(2+)-dependent phosphatase. Nature. 369(6477): 235-239.

Lieberman, J.A., Sheitman, B.B., and Kinon, B.J. (1997) Neurochemical sensitization in the pathophysiology of schizophrenia: deficits and dysfunction in neuronal regulation and plasticity. Neuropsychopharmacology. 17(4): 205-229.

Lisman, J., Schulman, H., and Cline, H. (2002) The molecular basis of CaMKII function in synaptic and behavioural memory. Nat Rev Neurosci. 3(3): 175-190.

96

Lisman, J.E., and Zhabotinsky, A.M. (2001) A model of synaptic memory: a CaMKII/PP1 switch that potentiates transmission by organizing an AMPA receptor anchoring assembly. Neuron. 31(2): 191-201.

Liu, B.P., Fournier, A., GrandPre, T., and Strittmatter, S.M. (2002) Myelin-associated glycoprotein as a functional ligand for the Nogo-66 receptor. Science. 297(5584): 1190-1193.

Liu, X.Y., Chu, X.P., Mao, L.M., Wang, M., Lan, H.X., Li, M.H., Zhang, G.C., Parelkar, N.K., Fibuch, E.E., Haines, M., Neve, K.A., Liu, F., Xiong, Z.G., and Wang, J.Q. (2006) Modulation of D2R-NR2B Interactions in Response to Cocaine. Neuron. 52(5): 897-909.

Lou, L., Zhou, T., Wang, P., and Pei, G. (1999) Modulation of Ca2+/calmodulin-dependent protein kinase II activity by acute and chronic morphine administration in rat hippocampus: differential regulation of alpha and beta isoforms. Mol Pharmacol. 55(3): 557-563.

Lu, F.M., and Hawkins, R.D. (2006) Presynaptic and postsynaptic Ca(2+) and CamKII contribute to long-term potentiation at synapses between individual CA3 neurons. Proc Natl Acad Sci U S A. 103(11): 4264-4269.

Lu, J., Karadsheh, M., and Delpire, E. (1999) Developmental regulation of the neuronal-specific isoform of K-Cl cotransporter KCC2 in postnatal rat brains. J Neurobiol. 39(4): 558-568.

Macdonald, R.L., and Olsen, R.W. (1994) GABAA receptor channels. Annu Rev Neurosci. 17(569-602. Maekawa, M., Ishizaki, T., Boku, S., Watanabe, N., Fujita, A., Iwamatsu, A., Obinata, T., Ohashi, K.,

Mizuno, K., and Narumiya, S. (1999) Signaling from Rho to the actin cytoskeleton through protein kinases ROCK and LIM-kinase. Science. 285(5429): 895-898.

Maier, W., Lichtermann, D., Minges, J., Hallmayer, J., Heun, R., Benkert, O., and Levinson, D.F. (1993) Continuity and discontinuity of affective disorders and schizophrenia. Results of a controlled family study. Arch Gen Psychiatry. 50(11): 871-883.

Maletic-Savatic, M., Malinow, R., and Svoboda, K. (1999) Rapid dendritic morphogenesis in CA1 hippocampal dendrites induced by synaptic activity [see comments]. Science. 283(5409): 1923-1927.

Malinow, R., and Malenka, R.C. (2002) AMPA receptor trafficking and synaptic plasticity. Annu Rev Neurosci. 25(103-126.

Marklund, N., Fulp, C.T., Shimizu, S., Puri, R., McMillan, A., Strittmatter, S.M., and McIntosh, T.K. (2006) Selective temporal and regional alterations of Nogo-A and small proline-rich repeat protein 1A (SPRR1A) but not Nogo-66 receptor (NgR) occur following traumatic brain injury in the rat. Exp Neurol. 197(1): 70-83.

Martin, R.L., Cloninger, C.R., Guze, S.B., and Clayton, P.J. (1985) Frequency and differential diagnosis of depressive syndromes in schizophrenia. J Clin Psychiatry. 46(11 Pt 2): 9-13.

Martinez-Turrillas, R., Del Rio, J., and Frechilla, D. (2007) Neuronal proteins involved in synaptic targeting of AMPA receptors in rat hippocampus by antidepressant drugs. Biochem Biophys Res Commun. 353(3): 750-755.

Matus, A., Ackermann, M., Pehling, G., Byers, H.R., and Fujiwara, K. (1982) High actin concentrations in brain dendritic spines and postsynaptic densities. Proc Natl Acad Sci U S A. 79(23): 7590-7594.

Mauceri, D., Cattabeni, F., Di Luca, M., and Gardoni, F. (2004) Calcium/calmodulin-dependent protein kinase II phosphorylation drives synapse-associated protein 97 into spines. J Biol Chem. 279(22): 23813-23821.

Mayford, M., Wang, J., Kandel, E.R., and O'Dell, T.J. (1995) CaMKII regulates the frequency-response function of hippocampal synapses for the production of both LTD and LTP. Cell. 81(6): 891-904.

97

Mayford, M., Bach, M.E., and Kandel, E. (1996a) CaMKII function in the nervous system explored from a genetic perspective. Cold Spring Harb Symp Quant Biol. 61(219-224.

Mayford, M., Baranes, D., Podsypanina, K., and Kandel, E.R. (1996b) The 3'-untranslated region of CaMKII alpha is a cis-acting signal for the localization and translation of mRNA in dendrites. Proc Natl Acad Sci U S A. 93(23): 13250-13255.

McEwen, B.S., and Sapolsky, R.M. (1995) Stress and cognitive function. Curr Opin Neurobiol. 5(2): 205-216.

McEwen, B.S. (2003) Mood disorders and allostatic load. Biol Psychiatry. 54(3): 200-207. McGee, A.W., and Strittmatter, S.M. (2003) The Nogo-66 receptor: focusing myelin inhibition of axon

regeneration. Trends Neurosci. 26(4): 193-198. McGuinness, T.L., Lai, Y., and Greengard, P. (1985) Ca2+/calmodulin-dependent protein kinase II.

Isozymic forms from rat forebrain and cerebellum. J Biol Chem. 260(3): 1696-1704. McKerracher, L., and Winton, M.J. (2002) Nogo on the go. Neuron. 36(3): 345-348. McQuillen, P.S., DeFreitas, M.F., Zada, G., and Shatz, C.J. (2002) A novel role for p75NTR in subplate

growth cone complexity and visual thalamocortical innervation. J Neurosci. 22(9): 3580-3593. Meador, W.E., Means, A.R., and Quiocho, F.A. (1993) Modulation of calmodulin plasticity in molecular

recognition on the basis of x-ray structures. Science. 262(5140): 1718-1721. Meador-Woodruff, J.H., and Healy, D.J. (2000) Glutamate receptor expression in schizophrenic brain.

Brain Res Brain Res Rev. 31(2-3): 288-294. Menegon, A., Verderio, C., Leoni, C., Benfenati, F., Czernik, A.J., Greengard, P., Matteoli, M., and

Valtorta, F. (2002) Spatial and temporal regulation of Ca2+/calmodulin-dependent protein kinase II activity in developing neurons. J Neurosci. 22(16): 7016-7026.

Meng, F., and Zhang, G.C. (2002) Autophosphorylated calcium/calmodulin-dependent protein kinase II alpha induced by cerebral ischemia immediately targets and phosphorylates N-methyl-D-aspartate receptor subunit 2B (NR2B) in hippocampus of rats. Neurosci Lett. 333(1): 59-63.

Merrill, M.A., Chen, Y., Strack, S., and Hell, J.W. (2005) Activity-driven postsynaptic translocation of CaMKII. Trends Pharmacol Sci. 26(12): 645-653.

Mi, S., Lee, X., Shao, Z., Thill, G., Ji, B., Relton, J., Levesque, M., Allaire, N., Perrin, S., Sands, B., Crowell, T., Cate, R.L., McCoy, J.M., and Pepinsky, R.B. (2004) LINGO-1 is a component of the Nogo-66 receptor/p75 signaling complex. Nat Neurosci. 7(3): 221-228.

Miao, R.Q., Gao, Y., Harrison, K.D., Prendergast, J., Acevedo, L.M., Yu, J., Hu, F., Strittmatter, S.M., and Sessa, W.C. (2006) Identification of a receptor necessary for Nogo-B stimulated chemotaxis and morphogenesis of endothelial cells. Proc Natl Acad Sci U S A. 103(29): 10997-11002.

Migues, P.V., Lehmann, I.T., Fluechter, L., Cammarota, M., Gurd, J.W., Sim, A.T., Dickson, P.W., and Rostas, J.A. (2006) Phosphorylation of CaMKII at Thr253 occurs in vivo and enhances binding to isolated postsynaptic densities. J Neurochem. 98(1): 289-299.

Miller, S., Yasuda, M., Coats, J.K., Jones, Y., Martone, M.E., and Mayford, M. (2002) Disruption of dendritic translation of CaMKIIalpha impairs stabilization of synaptic plasticity and memory consolidation. Neuron. 36(3): 507-519.

Miller, S.G., and Kennedy, M.B. (1985) Distinct forebrain and cerebellar isozymes of type II Ca2+/calmodulin-dependent protein kinase associate differently with the postsynaptic density fraction. J Biol Chem. 260(15): 9039-9046.

Mima, K., Deguchi, S., and Yamauchi, T. (2001) Characterization of 5' flanking region of alpha isoform of rat Ca2+/calmodulin-dependent protein kinase II gene and neuronal cell type specific promoter activity. Neurosci Lett. 307(2): 117-121.

98

Mima, K., Donai, H., and Yamauchi, T. (2002) Investigation of Neuronal Cell Type-Specific Gene Expression of Ca2+/Calmodulin-dependent Protein Kinase II. Biol Proced Online. 3(79-90.

Mimmack, M.L., Ryan, M., Baba, H., Navarro-Ruiz, J., Iritani, S., Faull, R.L.M., McKenna, P.J., Jones, P.B., Arai, H., Starkey, M., Emson, P.C., and Bahn, S. (2002) Gene expression analysis in schizophrenia: reproducible up-regulation of several members of the apolipoprotein L family located in a high-susceptibility locus for schizophrenia on chromosome 22. Proc Natl Acad Sci U S A. 99(4680 - 4685.

Mingorance, A., Fontana, X., Sole, M., Burgaya, F., Urena, J.M., Teng, F.Y., Tang, B.L., Hunt, D., Anderson, P.N., Bethea, J.R., Schwab, M.E., Soriano, E., and del Rio, J.A. (2004) Regulation of Nogo and Nogo receptor during the development of the entorhino-hippocampal pathway and after adult hippocampal lesions. Mol Cell Neurosci. 26(1): 34-49.

Mingorance-Le Meur, A., Zheng, B., Soriano, E., and Del Rio, J.A. (2007) Involvement of the Myelin-Associated Inhibitor Nogo-A in Early Cortical Development and Neuronal Maturation. Cereb Cortex.

Minichiello, L., Calella, A.M., Medina, D.L., Bonhoeffer, T., Klein, R., and Korte, M. (2002) Mechanism of TrkB-mediated hippocampal long-term potentiation. Neuron. 36(1): 121-137.

Mirnics, K., Middleton, F.A., Marquez, A., Lewis, D.A., and Levitt, P. (2000) Molecular characterization of schizophrenia viewed by microarray analysis of gene expression in prefrontal cortex. Neuron. 28(1): 53-67.

Mirnics, K., Middleton, F.A., Lewis, D.A., and Levitt, P. (2001a) Analysis of complex brain disorders with gene expression microarrays: schizophrenia as a disease of the synapse. Trends Neurosci. 24(8): 479-486.

Mirnics, K., Middleton, F.A., Stanwood, G.D., Lewis, D.A., and Levitt, P. (2001b) Disease-specific changes in regulator of G-protein signaling 4 (RGS$) expression in schizophrenia. Molecular Psychiatry. 6(293 - 301.

Mitchell, P., and Tollervey, D. (2001) mRNA turnover. Curr Opin Cell Biol. 13(3): 320-325. Miyamoto, S., Duncan, G.E., Marx, C.E., and Lieberman, J.A. (2005) Treatments for schizophrenia: a

critical review of pharmacology and mechanisms of action of antipsychotic drugs. Mol Psychiatry. 10(1): 79-104.

Moghaddam, B., Adams, B., Verma, A., and Daly, D. (1997) Activation of glutamatergic neurotransmission by ketamine: a novel step in the pathway from NMDA receptor blockade to dopaminergic and cognitive disruptions associated with the prefrontal cortex. J Neurosci. 17(8): 2921-2927.

Mohr, E. (1999) Subcellular RNA compartmentalization. Prog Neurobiol. 57(5): 507-525. Molnar, M., Potkin, S.G., Bunney, W.E., and Jones, E.G. (2003) MRNA expression patterns and

distribution of white matter neurons in dorsolateral prefrontal cortex of depressed patients differ from those in schizophrenia patients. Biol Psychiatry. 53(1): 39-47.

Moore, H., West, A.R., and Grace, A.A. (1999) The regulation of forebrain dopamine transmission: relevance to the pathophysiology and psychopathology of schizophrenia. Biol Psychiatry. 46(1): 40-55.

Moreira, E.F., Jaworski, C.J., and Rodriguez, I.R. (1999) Cloning of a novel member of the reticulon gene family (RTN3): gene structure and chromosomal localization to 11q13. Genomics. 58(1): 73-81.

Mori, N., Schoenherr, C., Vandenbergh, D.J., and Anderson, D.J. (1992) A common silencer element in the SCG10 and type II Na+ channel genes binds a factor present in nonneuronal cells but not in neuronal cells. Neuron. 9(1): 45-54.

99

Morris, N.J., Ross, S.A., Neveu, J.M., Lane, W.S., and Lienhard, G.E. (1999) Cloning and characterization of a 22 kDa protein from rat adipocytes: a new member of the reticulon family. Biochim Biophys Acta. 1450(1): 68-76.

Mouri, A., Noda, Y., Noda, A., Nakamura, T., Tokura, T., Yura, Y., Nitta, A., Furukawa, H., and Nabeshima, T. (2007) Involvement of a dysfunctional dopamine-D1/NMDA-NR1 and CaMKII pathway in the impairment of latent learning in a model of schizophrenia induced by phencyclidine. Mol Pharmacol.

Mukherji, S., Brickey, D.A., and Soderling, T.R. (1994) Mutational analysis of secondary structure in the autoinhibitory and autophosphorylation domains of calmodulin kinase II. J Biol Chem. 269(32): 20733-20738.

Mukherji, S., and Soderling, T.R. (1995) Mutational analysis of Ca(2+)-independent autophosphorylation of calcium/calmodulin-dependent protein kinase II. J Biol Chem. 270(23): 14062-14067.

Muller, D., Oliver, M., and Lynch, G. (1989) Developmental changes in synaptic properties in hippocampus of neonatal rats. Brain Res Dev Brain Res. 49(1): 105-114.

Murayama, K.S., Kametani, F., Saito, S., Kume, H., Akiyama, H., and Araki, W. (2006) Reticulons RTN3 and RTN4-B/C interact with BACE1 and inhibit its ability to produce amyloid beta-protein. Eur J Neurosci. 24(5): 1237-1244.

Nagase, T., Ishikawa, K., Suyama, M., Kikuno, R., Hirosawa, M., Miyajima, N., Tanaka, A., Kotani, H., Nomura, N., and Ohara, O. (1998) Prediction of the coding sequences of unidentified human genes. XII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res. 5(6): 355-364.

Neves-Pereira, M., Cheung, J.K., Pasdar, A., Zhang, F., Breen, G., Yates, P., Sinclair, M., Crombie, C., Walker, N., and St Clair, D.M. (2005) BDNF gene is a risk factor for schizophrenia in a Scottish population. Mol Psychiatry. 10(2): 208-212.

Niederost, B., Oertle, T., Fritsche, J., McKinney, R.A., and Bandtlow, C.E. (2002) Nogo-A and myelin-associated glycoprotein mediate neurite growth inhibition by antagonistic regulation of RhoA and Rac1. J Neurosci. 22(23): 10368-10376.

Ninkina, N.N., Baka, I.D., and Buchman, V.L. (1997) Rat and chicken s-rex/NSP mRNA: nucleotide sequence of main transcripts and expression of splice variants in rat tissues. Gene. 184(2): 205-210.

Nomura, K., Ohyama, A., Komiya, Y., and Igarashi, M. (2003) Minimal residues in linker domain of syntaxin 1A required for binding affinity to Ca2+/calmodulin-dependent protein kinase II. J Neurosci Res. 72(2): 198-202.

Novak, G., Seeman, P., and Tallerico, T. (2000) Schizophrenia: elevated mRNA for calcium-calmodulin-dependent protein kinase IIbeta in frontal cortex. Brain Res Mol Brain Res. 82(1-2): 95-100.

Novak, G., Kim, D., Seeman, P., and Tallerico, T. (2002) Schizophrenia and Nogo: elevated mRNA in cortex, and high prevalence of a homozygous CAA insert. Brain Res Mol Brain Res. 107(2): 183-189.

O'Leary, H., Lasda, E., and Bayer, K.U. (2006a) CaMKII{beta} Association with the Actin-Cytoskeleton Is Regulated by Alternative Splicing. Mol Biol Cell.

O'Leary, H., Sui, X., Lin, P.J., Volpe, P., and Bayer, K.U. (2006b) Nuclear targeting of the CaMKII anchoring protein alphaKAP is regulated by alternative splicing and protein kinases. Brain Res. 1086(1): 17-26.

100

Oertle, T., Huber, C., van der Putten, H., and Schwab, M.E. (2003a) Genomic structure and functional characterisation of the promoters of human and mouse nogo/rtn4. J Mol Biol. 325(2): 299-323.

Oertle, T., Klinger, M., Stuermer, C.A., and Schwab, M.E. (2003b) A reticular rhapsody: phylogenic evolution and nomenclature of the RTN/Nogo gene family. Faseb J. 17(10): 1238-1247.

Oertle, T., and Schwab, M.E. (2003) Nogo and its paRTNers. Trends Cell Biol. 13(4): 187-194. Oertle, T., van der Haar, M.E., Bandtlow, C.E., Robeva, A., Burfeind, P., Buss, A., Huber, A.B.,

Simonen, M., Schnell, L., Brosamle, C., Kaupmann, K., Vallon, R., and Schwab, M.E. (2003c) Nogo-A inhibits neurite outgrowth and cell spreading with three discrete regions. J Neurosci. 23(13): 5393-5406.

Oh, J.D., Vaughan, C.L., and Chase, T.N. (1999) Effect of dopamine denervation and dopamine agonist administration on serine phosphorylation of striatal NMDA receptor subunits. Brain Res. 821(2): 433-442.

Ohno, M., Frankland, P.W., and Silva, A.J. (2002) A pharmacogenetic inducible approach to the study of NMDA/alphaCaMKII signaling in synaptic plasticity. Curr Biol. 12(8): 654-656.

Ohtakara, K., Nishizawa, M., Izawa, I., Hata, Y., Matsushima, S., Taki, W., Inada, H., Takai, Y., and Inagaki, M. (2002) Densin-180, a synaptic protein, links to PSD-95 through its direct interaction with MAGUIN-1. Genes Cells. 7(11): 1149-1160.

Ohyama, A., Hosaka, K., Komiya, Y., Akagawa, K., Yamauchi, E., Taniguchi, H., Sasagawa, N., Kumakura, K., Mochida, S., Yamauchi, T., and Igarashi, M. (2002) Regulation of exocytosis through Ca2+/ATP-dependent binding of autophosphorylated Ca2+/calmodulin-activated protein kinase II to syntaxin 1A. J Neurosci. 22(9): 3342-3351.

Okamoto, K., Narayanan, R., Lee, S.H., Murata, K., and Hayashi, Y. (2007) The role of CaMKII as an F-actin-bundling protein crucial for maintenance of dendritic spine structure. Proc Natl Acad Sci U S A. 104(15): 6418-6423.

Omkumar, R.V., Kiely, M.J., Rosenstein, A.J., Min, K.T., and Kennedy, M.B. (1996) Identification of a phosphorylation site for calcium/calmodulindependent protein kinase II in the NR2B subunit of the N-methyl-D-aspartate receptor. J Biol Chem. 271(49): 31670-31678.

Online Mendelian Inheritance in Man, O.T. (2007) #600850, SCZD4. Journal. Ouyang, Y., Rosenstein, A., Kreiman, G., Schuman, E.M., and Kennedy, M.B. (1999) Tetanic

stimulation leads to increased accumulation of Ca(2+)/calmodulin-dependent protein kinase II via dendritic protein synthesis in hippocampal neurons. J Neurosci. 19(18): 7823-7833.

Owen, M.J. (2005) Genomic approaches to schizophrenia. Clin Ther. 27 Suppl A(S2-7. Palmer, T.D., Willhoite, A.R., and Gage, F.H. (2000) Vascular niche for adult hippocampal

neurogenesis. J Comp Neurol. 425(4): 479-494. Park, J.B., Yiu, G., Kaneko, S., Wang, J., Chang, J., He, X.L., Garcia, K.C., and He, Z. (2005) A TNF

receptor family member, TROY, is a coreceptor with Nogo receptor in mediating the inhibitory activity of myelin inhibitors. Neuron. 45(3): 345-351.

Park, J.H., Widi, G.A., Gimbel, D.A., Harel, N.Y., Lee, D.H., and Strittmatter, S.M. (2006) Subcutaneous Nogo receptor removes brain amyloid-beta and improves spatial memory in Alzheimer's transgenic mice. J Neurosci. 26(51): 13279-13286.

Patton, B.L., Miller, S.G., and Kennedy, M.B. (1990) Activation of type II calcium/calmodulin-dependent protein kinase by Ca2+/calmodulin is inhibited by autophosphorylation of threonine within the calmodulin-binding domain. J Biol Chem. 265(19): 11204-11212.

Paunio, T., Ekelund, J., Varilo, T., Parker, A., Hovatta, I., Turunen, J.A., Rinard, K., Foti, A., Terwilliger, J.D., Juvonen, H., Suvisaari, J., Arajarvi, R., Suokas, J., Partonen, T., Lonnqvist, J., Meyer, J., and Peltonen, L. (2001) Genome-wide scan in a nationwide study sample of

101

schizophrenia families in Finland reveals susceptibility loci on chromosomes 2q and 5q. Hum Mol Genet. 10(26): 3037-3048.

Pesole, G., Liuni, S., Grillo, G., Licciulli, F., Mignone, F., Gissi, C., and Saccone, C. (2002) UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs. Update 2002. Nucleic Acids Res. 30(1): 335-340.

Pierce, R.C., and Kalivas, P.W. (1997) Repeated cocaine modifies the mechanism by which amphetamine releases dopamine. J Neurosci. 17(9): 3254-3261.

Popoli, M., Vocaturo, C., Perez, J., Smeraldi, E., and Racagni, G. (1995) Presynaptic Ca2+/calmodulin-dependent protein kinase II: autophosphorylation and activity increase in the hippocampus after long-term blockade of serotonin reuptake. Mol Pharmacol. 48(4): 623-629.

Popoli, M., Venegoni, A., Vocaturo, C., Buffa, L., Perez, J., Smeraldi, E., and Racagni, G. (1997) Long-term blockade of serotonin reuptake affects synaptotagmin phosphorylation in the hippocampus. Mol Pharmacol. 51(1): 19-26.

Popoli, M., Gennarelli, M., and Racagni, G. (2002) Modulation of synaptic plasticity by stress and antidepressants. Bipolar Disord. 4(3): 166-182.

Pot, C., Simonen, M., Weinmann, O., Schnell, L., Christ, F., Stoeckle, S., Berger, P., Rulicke, T., Suter, U., and Schwab, M.E. (2002) Nogo-A expressed in Schwann cells impairs axonal regeneration after peripheral nerve injury. J Cell Biol. 159(1): 29-35.

Pratt, K.G., Watt, A.J., Griffith, L.C., Nelson, S.B., and Turrigiano, G.G. (2003) Activity-dependent remodeling of presynaptic inputs by postsynaptic expression of activated CaMKII. Neuron. 39(2): 269-281.

Prinjha, R., Moore, S.E., Vinson, M., Blake, S., Morrow, R., Christie, G., Michalovich, D., Simmons, D.L., and Walsh, F.S. (2000) Inhibitor of neurite outgrowth in humans. Nature. 403(6768): 383-384.

Pulver, A.E., Karayiorgou, M., Wolyniec, P.S., Lasseter, V.K., Kasch, L., Nestadt, G., Antonarakis, S., Housman, D., Kazazian, H.H., Meyers, D., and et al. (1994) Sequential strategy to identify a susceptibility gene for schizophrenia: report of potential linkage on chromosome 22q12-q13.1: Part 1. Am J Med Genet. 54(1): 36-43.

Qi, B., Qi, Y., Watari, A., Yoshioka, N., Inoue, H., Minemoto, Y., Yamashita, K., Sasagawa, T., and Yutsudo, M. (2003) Pro-apoptotic ASY/Nogo-B protein associates with ASYIP. J Cell Physiol. 196(2): 312-318.

Rainey, J.M., Jr., and Crowder, M.K. (1975) Prolonged psychosis attributed to phencyclidine: report of three cases. Am J Psychiatry. 132(10): 1076-1078.

Raiteri, M., Cerrito, F., Cervoni, A.M., and Levi, G. (1979) Dopamine can be released by two mechanisms differentially affected by the dopamine transport inhibitor nomifensine. J Pharmacol Exp Ther. 208(2): 195-202.

Rakic, P., Bourgeois, J.P., Eckenhoff, M.F., Zecevic, N., and Goldman-Rakic, P.S. (1986) Concurrent overproduction of synapses in diverse regions of the primate cerebral cortex. Science. 232(4747): 232-235.

Rawls, S.M., and McGinty, J.F. (2000) Delta opioid receptors regulate calcium-dependent, amphetamine-evoked glutamate levels in the rat striatum: an in vivo microdialysis study. Brain Res. 861(2): 296-304.

Reindl, M., Khantane, S., Ehling, R., Schanda, K., Lutterotti, A., Brinkhoff, C., Oertle, T., Schwab, M.E., Deisenhammer, F., Berger, T., and Bandtlow, C.E. (2003) Serum and cerebrospinal fluid antibodies to Nogo-A in patients with multiple sclerosis and acute neurological disorders. J Neuroimmunol. 145(1-2): 139-147.

102

Reiner, D.J., Newton, E.M., Tian, H., and Thomas, J.H. (1999) Diverse behavioural defects caused by mutations in Caenorhabditis elegans unc-43 CaM kinase II. Nature. 402(6758): 199-203.

Remington, G., and Kapur, S. (1999) D2 and 5-HT2 receptor effects of antipsychotics: bridging basic and clinical findings using PET. J Clin Psychiatry. 60 Suppl 10(15-19.

Renger, J.J., Egles, C., and Liu, G. (2001) A developmental switch in neurotransmitter flux enhances synaptic efficacy by affecting AMPA receptor activation. Neuron. 29(2): 469-484.

Rich, R.C., and Schulman, H. (1998) Substrate-directed function of calmodulin in autophosphorylation of Ca2+/calmodulin-dependent protein kinase II. J Biol Chem. 273(43): 28424-28429.

Risch, N. (1990) Linkage strategies for genetically complex traits. I. Multilocus models. Am J Hum Genet. 46(2): 222-228.

Robinson, T.E., and Becker, J.B. (1982) Behavioral sensitization is accompanied by an enhancement in amphetamine-stimulated dopamine release from striatal tissue in vitro. Eur J Pharmacol. 85(2): 253-254.

Robinson, T.E., Becker, J.B., Moore, C.J., Castaneda, E., and Mittleman, G. (1985) Enduring enhancement in frontal cortex dopamine utilization in an animal model of amphetamine psychosis. Brain Res. 343(2): 374-377.

Robinson, T.E., and Berridge, K.C. (1993) The neural basis of drug craving: an incentive-sensitization theory of addiction. Brain Res Brain Res Rev. 18(3): 247-291.

Robison, A.J., Bass, M.A., Jiao, Y., MacMillan, L.B., Carmody, L.C., Bartlett, R.K., and Colbran, R.J. (2005) Multivalent interactions of calcium/calmodulin-dependent protein kinase II with the postsynaptic density proteins NR2B, densin-180, and alpha-actinin-2. J Biol Chem. 280(42): 35329-35336.

Roche, K.W., O'Brien, R.J., Mammen, A.L., Bernhardt, J., and Huganir, R.L. (1996) Characterization of multiple phosphorylation sites on the AMPA receptor GluR1 subunit. Neuron. 16(6): 1179-1188.

Rochlitz, H., Voigt, A., Lankat-Buttgereit, B., Goke, B., Heimberg, H., Nauck, M.A., Schiemann, U., Schatz, H., and Pfeiffer, A.F. (2000) Cloning and quantitative determination of the human Ca2+/calmodulin-dependent protein kinase II (CaMK II) isoforms in human beta cells. Diabetologia. 43(4): 465-473.

Roebroek, A.J., Ayoubi, T.A., Van de Velde, H.J., Schoenmakers, E.F., Pauli, I.G., and Van de Ven, W.J. (1996) Genomic organization of the human NSP gene, prototype of a novel gene family encoding reticulons. Genomics. 32(2): 191-199.

Roebroek, A.J., Contreras, B., Pauli, I.G., and Van de Ven, W.J. (1998) cDNA cloning, genomic organization, and expression of the human RTN2 gene, a member of a gene family encoding reticulons. Genomics. 51(1): 98-106.

Rongo, C., and Kaplan, J.M. (1999) CaMKII regulates the density of central glutamatergic synapses in vivo. Nature. 402(6758): 195-199.

Rook, M.S., Lu, M., and Kosik, K.S. (2000) CaMKIIalpha 3' untranslated region-directed mRNA translocation in living neurons: visualization by GFP linkage. J Neurosci. 20(17): 6385-6393.

Rosenberg, O.S., Deindl, S., Sung, R.J., Nairn, A.C., and Kuriyan, J. (2005) Structure of the autoinhibited kinase domain of CaMKII and SAXS analysis of the holoenzyme. Cell. 123(5): 849-860.

Rosenberg, O.S., Deindl, S., Comolli, L.R., Hoelz, A., Downing, K.H., Nairn, A.C., and Kuriyan, J. (2006) Oligomerization states of the association domain and the holoenyzme of Ca2+/CaM kinase II. Febs J. 273(4): 682-694.

103

Rostas, J.A., Brent, V.A., Voss, K., Errington, M.L., Bliss, T.V., and Gurd, J.W. (1996) Enhanced tyrosine phosphorylation of the 2B subunit of the N-methyl-D-aspartate receptor in long-term potentiation. Proc Natl Acad Sci U S A. 93(19): 10452-10456.

Rousseau, S., Peggie, M., Campbell, D.G., Nebreda, A.R., and Cohen, P. (2005) Nogo-B is a new physiological substrate for MAPKAP-K2. Biochem J. 391(Pt 2): 433-440.

Sabelli, H.C., and Mosnaim, A.D. (1974) Phenylethylamine hypothesis of affective behavior. Am J Psychiatry. 131(6): 695-699.

Saitoh, Y., Yamamoto, H., Fukunaga, K., Matsukado, Y., and Miyamoto, E. (1987) Inactivation and reactivation of the multifunctional calmodulin-dependent protein kinase from brain by autophosphorylation and dephosphorylation: involvement of protein phosphatases from brain. J Neurochem. 49(4): 1286-1292.

Sapolsky, R.M. (2000) Glucocorticoids and hippocampal atrophy in neuropsychiatric disorders. Arch Gen Psychiatry. 57(10): 925-935.

Schiapparelli, L., Del Rio, J., and Frechilla, D. (2005) Serotonin 5-HT receptor blockade enhances Ca(2+)/calmodulin-dependent protein kinase II function and membrane expression of AMPA receptor subunits in the rat hippocampus: implications for memory formation. J Neurochem. 94(4): 884-895.

Schmidt-Kastner, R., van Os, J., H, W.M.S., and Schmitz, C. (2006) Gene regulation by hypoxia and the neurodevelopmental origin of schizophrenia. Schizophr Res. 84(2-3): 253-271.

Schuman, E.M., Dynes, J.L., and Steward, O. (2006) Synaptic regulation of translation of dendritic mRNAs. J Neurosci. 26(27): 7143-7146.

Schwab, M.E. (1990) Myelin-associated inhibitors of neurite growth. Exp Neurol. 109(1): 2-5. Seeman, P., Chau-Wong, M., Tedesco, J., and Wong, K. (1975) Brain receptors for antipsychotic drugs

and dopamine: direct binding assays. Proc Natl Acad Sci U S A. 72(11): 4376-4380. Seeman, P., Lee, T., Chau-Wong, M., and Wong, K. (1976) Antipsychotic drug doses and

neuroleptic/dopamine receptors. Nature. 261(5562): 717-719. Seeman, P. (1987) Dopamine receptors and the dopamine hypothesis of schizophrenia. Synapse. 1(2):

133-152. Seeman, P. (2002) Atypical antipsychotics: mechanism of action. Can J Psychiatry. 47(1): 27-38. Segal, I., Korkotian, I., and Murphy, D.D. (2000) Dendritic spine formation and pruning: common

cellular mechanisms? [see comments]. Trends Neurosci. 23(2): 53-57. Shao, Z., Browning, J.L., Lee, X., Scott, M.L., Shulga-Morskaya, S., Allaire, N., Thill, G., Levesque,

M., Sah, D., McCoy, J.M., Murray, B., Jung, V., Pepinsky, R.B., and Mi, S. (2005) TAJ/TROY, an orphan TNF receptor family member, binds Nogo-66 receptor 1 and regulates axonal regeneration. Neuron. 45(3): 353-359.

Sharma, K., Fong, D.K., and Craig, A.M. (2006) Postsynaptic protein mobility in dendritic spines: long-term regulation by synaptic NMDA receptor activation. Mol Cell Neurosci. 31(4): 702-712.

Shaw, S.H., Kelly, M., Smith, A.B., Shields, G., Hopkins, P.J., Loftus, J., Laval, S.H., Vita, A., De Hert, M., Cardon, L.R., Crow, T.J., Sherrington, R., and DeLisi, L.E. (1998) A genome-wide search for schizophrenia susceptibility genes. Am J Med Genet. 81(5): 364-376.

Shen, K., Teruel, M.N., Subramanian, K., and Meyer, T. (1998) CaMKIIbeta functions as an F-actin targeting module that localizes CaMKIIalpha/beta heterooligomers to dendritic spines. Neuron. 21(3): 593-606.

Shen, K., and Meyer, T. (1999) Dynamic control of CaMKII translocation and localization in hippocampal neurons by NMDA receptor stimulation. Science. 284(5411): 162-166.

104

Shen, K., Teruel, M.N., Connor, J.H., Shenolikar, S., and Meyer, T. (2000) Molecular memory by reversible translocation of calcium/calmodulin-dependent protein kinase II. Nat Neurosci. 3(9): 881-886.

Sheng, M., and Lee, S.H. (2000) Growth of the NMDA receptor industrial complex. Nat Neurosci. 3(7): 633-635.

Sheng, M. (2001) Molecular organization of the postsynaptic specialization. Proc Natl Acad Sci U S A. 98(13): 7058-7061.

Shi, Y., and Ethell, I.M. (2006) Integrins control dendritic spine plasticity in hippocampal neurons through NMDA receptor and Ca2+/calmodulin-dependent protein kinase II-mediated actin reorganization. J Neurosci. 26(6): 1813-1822.

Shih, R.A., Belmonte, P.L., and Zandi, P.P. (2004) A review of the evidence from family, twin and adoption studies for a genetic contribution to adult psychiatric disorders. Int Rev Psychiatry. 16(4): 260-283.

Silva, A.J., Paylor, R., Wehner, J.M., and Tonegawa, S. (1992a) Impaired spatial learning in alpha-calcium-calmodulin kinase II mutant mice [see comments]. Science. 257(5067): 206-211.

Silva, A.J., Stevens, C.F., Tonegawa, S., and Wang, Y. (1992b) Deficient hippocampal long-term potentiation in alpha-calcium- calmodulin kinase II mutant mice [see comments]. Science. 257(5067): 201-206.

Sinibaldi, L., De Luca, A., Bellacchio, E., Conti, E., Pasini, A., Paloscia, C., Spalletta, G., Caltagirone, C., Pizzuti, A., and Dallapiccola, B. (2004) Mutations of the Nogo-66 receptor (RTN4R) gene in schizophrenia. Hum Mutat. 24(6): 534-535.

Siris, S.G. (2001) Suicide and schizophrenia. Journal of psychopharmacology. 15(2): 127-135. Skaper, S.D., Moore, S.E., and Walsh, F.S. (2001) Cell signalling cascades regulating neuronal growth-

promoting and inhibitory cues. Prog Neurobiol. 65(6): 593-608. Sklar, P., Pato, M.T., Kirby, A., Petryshen, T.L., Medeiros, H., Carvalho, C., Macedo, A., Dourado, A.,

Coelho, I., Valente, J., Soares, M.J., Ferreira, C.P., Lei, M., Verner, A., Hudson, T.J., Morley, C.P., Kennedy, J.L., Azevedo, M.H., Lander, E., Daly, M.J., and Pato, C.N. (2004) Genome-wide scan in Portuguese Island families identifies 5q31-5q35 as a susceptibility locus for schizophrenia and psychosis. Mol Psychiatry. 9(2): 213-218.

Smith, M.K., Colbran, R.J., Brickey, D.A., and Soderling, T.R. (1992) Functional determinants in the autoinhibitory domain of calcium/calmodulin-dependent protein kinase II. Role of His282 and multiple basic residues. J Biol Chem. 267(3): 1761-1768.

Snyder, S.H. (1976) The dopamine hypothesis of schizophrenia: focus on the dopamine receptor. Am J Psychiatry. 133(2): 197-202.

Snyder, S.H. (1980) Phencyclidine. Nature. 285(5764): 355-356. Soderling, T.R. (1993) Calcium/calmodulin-dependent protein kinase II: role in learning and memory.

Mol Cell Biochem. 127-128(93-101. Soderling, T.R. (2000) CaM-kinases: modulators of synaptic plasticity. Curr Opin Neurobiol. 10(3):

375-380. Soderling, T.R., and Derkach, V.A. (2000) Postsynaptic protein phosphorylation and LTP. Trends

Neurosci. 23(2): 75-80. Spillmann, A.A., Bandtlow, C.E., Lottspeich, F., Keller, F., and Schwab, M.E. (1998) Identification and

characterization of a bovine neurite growth inhibitor (bNI-220). J Biol Chem. 273(30): 19283-19293.

105

Srinivasan, M., Edman, C.F., and Schulman, H. (1994) Alternative splicing introduces a nuclear localization signal that targets multifunctional CaM kinase to the nucleus. J Cell Biol. 126(4): 839-852.

Stein, V., Hermans-Borgmeyer, I., Jentsch, T.J., and Hubner, C.A. (2004) Expression of the KCl cotransporter KCC2 parallels neuronal maturation and the emergence of low intracellular chloride. J Comp Neurol. 468(1): 57-64.

Steward, O., and Levy, W.B. (1982) Preferential localization of polyribosomes under the base of dendritic spines in granule cells of the dentate gyrus. J Neurosci. 2(3): 284-291.

Strack, S., Barban, M.A., Wadzinski, B.E., and Colbran, R.J. (1997) Differential inactivation of postsynaptic density-associated and soluble Ca2+/calmodulin-dependent protein kinase II by protein phosphatases 1 and 2A. J Neurochem. 68(5): 2119-2128.

Strack, S., and Colbran, R.J. (1998) Autophosphorylation-dependent targeting of calcium/ calmodulin- dependent protein kinase II by the NR2B subunit of the N-methyl- D- aspartate receptor. J Biol Chem. 273(33): 20689-20692.

Strack, S., McNeill, R.B., and Colbran, R.J. (2000) Mechanism and regulation of calcium/calmodulin-dependent protein kinase II targeting to the NR2B subunit of the N-methyl-D-aspartate receptor. J Biol Chem. 275(31): 23798-23806.

Straub, R.E., MacLean, C.J., Ma, Y., Webb, B.T., Myakishev, M.V., Harris-Kerr, C., Wormley, B., Sadek, H., Kadambi, B., O'Neill, F.A., Walsh, D., and Kendler, K.S. (2002) Genome-wide scans of three independent sets of 90 Irish multiplex schizophrenia families and follow-up of selected regions in all families provides evidence for multiple susceptibility genes. Mol Psychiatry. 7(6): 542-559.

Suddath, R.L., Christison, G.W., Torrey, E.F., Casanova, M.F., and Weinberger, D.R. (1990a) Anatomical abnormalities in the brains of monozygotic twins discordant for schizophrenia. N Engl J Med. 322(12): 789-794.

Suddath, R.L., Christison, G.W., Torrey, E.F., Casanova, M.F., and Weinberger, D.R. (1990b) Anatomical abnormalities in the brains of monozygotic twins discordant for schizophrenia [published erratum appears in N Engl J Med 1990 May 31;322(22):1616] [see comments]. N Engl J Med. 322(12): 789-794.

Suemaru, J., Akiyama, K., Tanabe, Y., and Kuroda, S. (2000) Methamphetamine decreases calcium-calmodulin dependent protein kinase II activity in discrete rat brain regions. Synapse. 36(3): 155-166.

Suenaga, T., Morinobu, S., Kawano, K., Sawada, T., and Yamawaki, S. (2004) Influence of immobilization stress on the levels of CaMKII and phospho-CaMKII in the rat hippocampus. Int J Neuropsychopharmacol. 7(3): 299-309.

Sulzer, D., Sonders, M.S., Poulsen, N.W., and Galli, A. (2005) Mechanisms of neurotransmitter release by amphetamines: a review. Prog Neurobiol. 75(6): 406-433.

Sun, P., Enslen, H., Myung, P.S., and Maurer, R.A. (1994) Differential activation of CREB by Ca2+/calmodulin-dependent protein kinases type II and type IV involves phosphorylation of a site that negatively regulates activity. Genes Dev. 8(21): 2527-2539.

Suzuki, T., Ito, J., Takagi, H., Saitoh, F., Nawa, H., and Shimizu, H. (2001) Biochemical evidence for localization of AMPA-type glutamate receptor subunits in the dendritic raft. Brain Res Mol Brain Res. 89(1-2): 20-28.

Swope, S.L., Moss, S.I., Raymond, L.A., and Huganir, R.L. (1999) Regulation of ligand-gated ion channels by protein phosphorylation. Adv Second Messenger Phosphoprotein Res. 33(49-78.

106

Tagami, S., Eguchi, Y., Kinoshita, M., Takeda, M., and Tsujimoto, Y. (2000) A novel protein, RTN-XS, interacts with both Bcl-XL and Bcl-2 on endoplasmic reticulum and reduces their anti-apoptotic activity. Oncogene. 19(50): 5736-5746.

Taketomi, M., Kinoshita, N., Kimura, K., Kitada, M., Noda, T., Asou, H., Nakamura, T., and Ide, C. (2002) Nogo-A expression in mature oligodendrocytes of rat spinal cord in association with specific molecules. Neurosci Lett. 332(1): 37-40.

Takeuchi, Y., Fukunaga, K., and Miyamoto, E. (2002) Activation of nuclear Ca(2+)/calmodulin-dependent protein kinase II and brain-derived neurotrophic factor gene expression by stimulation of dopamine D2 receptor in transfected NG108-15 cells. J Neurochem. 82(2): 316-328.

Tamminga, C.A. (1998) Schizophrenia and glutamatergic transmission. Crit Rev Neurobiol. 12(1-2): 21-36.

Tan, S.E. (2002) Impairing the amphetamine conditioning in rats through the inhibition of hippocampal calcium/calmodulin-dependent protein kinase II activity. Neuropharmacology. 42(4): 540-547.

Teicher, M.H., Andersen, S.L., and Hostetter, J.C., Jr. (1995) Evidence for dopamine receptor pruning between adolescence and adulthood in striatum but not nucleus accumbens. Brain Res Dev Brain Res. 89(2): 167-172.

Thiagarajan, T.C., Piedras-Renteria, E.S., and Tsien, R.W. (2002) alpha- and betaCaMKII. Inverse regulation by neuronal activity and opposing effects on synaptic strength. Neuron. 36(6): 1103-1114.

Thiel, G., Czernik, A.J., Gorelick, F., Nairn, A.C., and Greengard, P. (1988) Ca2+/calmodulin-dependent protein kinase II: identification of threonine-286 as the autophosphorylation site in the alpha subunit associated with the generation of Ca2+-independent activity. Proc Natl Acad Sci U S A. 85(17): 6337-6341.

Tiraboschi, E., Giambelli, R., D'Urso, G., Galietta, A., Barbon, A., de Bartolomeis, A., Gennarelli, M., Barlati, S., Racagni, G., and Popoli, M. (2004) Antidepressants activate CaMKII in neuron cell body by Thr286 phosphorylation. Neuroreport. 15(15): 2393-2396.

Tombes, R.M., Faison, M.O., and Turbeville, J.M. (2003) Organization and evolution of multifunctional Ca(2+)/CaM-dependent protein kinase genes. Gene. 322(17-31.

Torrey, E.F., Webster, M., Knable, M., Johnston, N., and Yolken, R.H. (2000) The Stanley Foundation Brain Collection and Neuropathology Consortium. Schizophr Res. 44(2): 151-155.

Tozaki, H., Kawasaki, T., Takagi, Y., and Hirata, T. (2002) Expression of Nogo protein by growing axons in the developing nervous system. Brain Res Mol Brain Res. 104(2): 111-119.

Trifunovski, A., Josephson, A., Bickford, P.C., Olson, L., and Brene, S. (2006) Selective decline of Nogo mRNA in the aging brain. Neuroreport. 17(9): 913-916.

Tsuang, M. (2000) Schizophrenia: genes and environment. Biol Psychiatry. 47(3): 210-220. Ullian, E.M., Sapperstein, S.K., Christopherson, K.S., and Barres, B.A. (2001) Control of synapse

number by glia. Science. 291(5504): 657-661. Urquidi, V., and Ashcroft, S.J. (1995) A novel pancreatic beta-cell isoform of calcium/calmodulin-

dependent protein kinase II (beta 3 isoform) contains a proline-rich tandem repeat in the association domain. FEBS Lett. 358(1): 23-26.

Urushihara, M., and Yamauchi, T. (2001) Role of beta isoform-specific insertions of Ca2+/calmodulin-dependent protein kinase II. Eur J Biochem. 268(17): 4802-4808.

van de Velde, H.J., Roebroek, A.J., Senden, N.H., Ramaekers, F.C., and Van de Ven, W.J. (1994) NSP-encoded reticulons, neuroendocrine proteins of a novel gene family associated with membranes of the endoplasmic reticulum. J Cell Sci. 107(Pt 9): 2403-2416.

107

Vinade, L., and Dosemeci, A. (2000) Regulation of the phosphorylation state of the AMPA receptor GluR1 subunit in the postsynaptic density [In Process Citation]. Cell Mol Neurobiol. 20(4): 451-463.

Voeltz, G.K., Prinz, W.A., Shibata, Y., Rist, J.M., and Rapoport, T.A. (2006) A class of membrane proteins shaping the tubular endoplasmic reticulum. Cell. 124(3): 573-586.

Walikonis, R.S., Oguni, A., Khorosheva, E.M., Jeng, C.J., Asuncion, F.J., and Kennedy, M.B. (2001) Densin-180 forms a ternary complex with the (alpha)-subunit of Ca2+/calmodulin-dependent protein kinase II and (alpha)-actinin. J Neurosci. 21(2): 423-433.

Wang, H., Yao, Y., Jiang, X., Chen, D., Xiong, Y., and Mu, D. (2006) Expression of Nogo-A and NgR in the developing rat brain after hypoxia-ischemia. Brain Res. 1114(1): 212-220.

Wang, K.C., Kim, J.A., Sivasankaran, R., Segal, R., and He, Z. (2002a) P75 interacts with the Nogo receptor as a co-receptor for Nogo, MAG and OMgp. Nature. 420(6911): 74-78.

Wang, K.C., Koprivica, V., Kim, J.A., Sivasankaran, R., Guo, Y., Neve, R.L., and He, Z. (2002b) Oligodendrocyte-myelin glycoprotein is a Nogo receptor ligand that inhibits neurite outgrowth. Nature. 417(6892): 941-944.

Wang, P., Wu, Y., Zhou, T.H., Sun, Y., and Pei, G. (2000) Identification of alternative splicing variants of the beta subunit of human Ca(2+)/calmodulin-dependent protein kinase II with different activities. FEBS Lett. 475(2): 107-110.

Wang, R.A., Cheng, G., Kolaj, M., and Randic, M. (1995) Alpha-subunit of calcium/calmodulin-dependent protein kinase II enhances gamma-aminobutyric acid and inhibitory synaptic responses of rat neurons in vitro. J Neurophysiol. 73(5): 2099-2106.

Wang, X., Chun, S.J., Treloar, H., Vartanian, T., Greer, C.A., and Strittmatter, S.M. (2002c) Localization of Nogo-A and Nogo-66 receptor proteins at sites of axon-myelin and synaptic contact. J Neurosci. 22(13): 5505-5515.

Wang, Y.T., and Salter, M.W. (1994) Regulation of NMDA receptors by tyrosine kinases and phosphatases. Nature. 369(6477): 233-235.

Warburton, E.C., Mitchell, S.N., and Joseph, M.H. (1996) Calcium dependence of sensitised dopamine release in rat nucleus accumbens following amphetamine challenge: implications for the disruption of latent inhibition. Behav Pharmacol. 7(2): 119-129.

Watari, A., and Yutsudo, M. (2003) Multi-functional gene ASY/Nogo/RTN-X/RTN4: apoptosis, tumor suppression, and inhibition of neuronal regeneration. Apoptosis. 8(1): 5-9.

Waterwort, D.M., Bassett, A.S., and Brzustowicz, L.M. (2002) Recent advances in the genetics of schizophrenia. Cell Mol Life Sci. 59(2): 331-348.

Waxham, M.N., Tsai, A.L., and Putkey, J.A. (1998) A mechanism for calmodulin (CaM) trapping by CaM-kinase II defined by a family of CaM-binding peptides. J Biol Chem. 273(28): 17579-17584.

Weeber, E.J., Jiang, Y.H., Elgersma, Y., Varga, A.W., Carrasquillo, Y., Brown, S.E., Christian, J.M., Mirnikjoo, B., Silva, A., Beaudet, A.L., and Sweatt, J.D. (2003) Derangements of hippocampal calcium/calmodulin-dependent protein kinase II in a mouse model for Angelman mental retardation syndrome. J Neurosci. 23(7): 2634-2644.

Weinberger, D.R., Berman, K.F., and Zec, R.F. (1986) Physiologic dysfunction of dorsolateral prefrontal cortex in schizophrenia. I. Regional cerebral blood flow evidence. Arch Gen Psychiatry. 43(2): 114-124.

Weinberger, D.R., and Berman, K.F. (1996) Prefrontal function in schizophrenia: confounds and controversies. Philos Trans R Soc Lond B Biol Sci. 351(1346): 1495-1503.

108

Wise, R.A., and Bozarth, M.A. (1987) A psychomotor stimulant theory of addiction. Psychol Rev. 94(4): 469-492.

Wong, S.T., Henley, J.R., Kanning, K.C., Huang, K.H., Bothwell, M., and Poo, M.M. (2002) A p75(NTR) and Nogo receptor complex mediates repulsive signaling by myelin-associated glycoprotein. Nat Neurosci. 5(12): 1302-1308.

Woolf, C.J., and Bloechlinger, S. (2002) Neuroscience. It takes more than two to Nogo. Science. 297(5584): 1132-1134.

Wu, G., Malinow, R., and Cline, H.T. (1996) Maturation of a central glutamatergic synapse. Science. 274(5289): 972-976.

Wu, G.Y., and Cline, H.T. (1998) Stabilization of dendritic arbor structure in vivo by CaMKII. Science. 279(5348): 222-226.

Wu, L., Wells, D., Tay, J., Mendis, D., Abbott, M.A., Barnitt, A., Quinlan, E., Heynen, A., Fallon, J.R., and Richter, J.D. (1998) CPEB-mediated cytoplasmic polyadenylation and the regulation of experience-dependent translation of alpha-CaMKII mRNA at synapses. Neuron. 21(5): 1129-1139.

Xing, G., Russell, S., Hough, C., O'Grady, J., Zhang, L., Yang, S., Zhang, L.X., and Post, R. (2002) Decreased prefrontal CaMKII alpha mRNA in bipolar illness. Neuroreport. 13(4): 501-505.

Yakel, J.L., Vissavajjhala, P., Derkach, V.A., Brickey, D.A., and Soderling, T.R. (1995) Identification of a Ca2+/calmodulin-dependent protein kinase II regulatory phosphorylation site in non-N-methyl-D-aspartate glutamate receptors. Proc Natl Acad Sci U S A. 92(5): 1376-1380.

Yamauchi, T., and Fujisawa, H. (1983) Disassembly of microtubules by the action of calmodulin-dependent protein kinase (Kinase II) which occurs only in the brain tissues. Biochem Biophys Res Commun. 110(1): 287-291.

Yamauchi, T. (2005) Neuronal Ca2+/calmodulin-dependent protein kinase II--discovery, progress in a quarter of a century, and perspective: implication for learning and memory. Biol Pharm Bull. 28(8): 1342-1354.

Yan, R., Shi, Q., Hu, X., and Zhou, X. (2006) Reticulon proteins: emerging players in neurodegenerative diseases. Cell Mol Life Sci. 63(7-8): 877-889.

Yang, E., and Schulman, H. (1999) Structural examination of autoregulation of multifunctional calcium/calmodulin-dependent protein kinase II. J Biol Chem. 274(37): 26199-26208.

Yang, J., Yu, L., Bi, A.D., and Zhao, S.Y. (2000) Assignment of the human reticulon 4 gene (RTN4) to chromosome 2p14-->2p13 by radiation hybrid mapping. Cytogenet Cell Genet. 88(1-2): 101-102.

Yoshimura, Y., and Yamauchi, T. (1997) Phosphorylation-dependent reversible association of Ca2+/calmodulin-dependent protein kinase II with the postsynaptic densities. J Biol Chem. 272(42): 26354-26359.

Yoshimura, Y., Sogawa, Y., and Yamauchi, T. (1999) Protein phosphatase 1 is involved in the dissociation of Ca2+/calmodulin-dependent protein kinase II from postsynaptic densities. FEBS Lett. 446(2-3): 239-242.

Yoshimura, Y., Aoi, C., and Yamauchi, T. (2000) Investigation of protein substrates of Ca(2+)/calmodulin-dependent protein kinase II translocated to the postsynaptic density. Brain Res Mol Brain Res. 81(1-2): 118-128.

Yoshimura, Y., Shinkawa, T., Taoka, M., Kobayashi, K., Isobe, T., and Yamauchi, T. (2002) Identification of protein substrates of Ca(2+)/calmodulin-dependent protein kinase II in the postsynaptic density by protein sequencing and mass spectrometry. Biochem Biophys Res Commun. 290(3): 948-954.

109

Yung, K.K., and Bolam, J.P. (2000) Localization of dopamine D1 and D2 receptors in the rat neostriatum: synaptic interaction with glutamate- and GABA-containing axonal terminals. Synapse. 38(4): 413-420.

Zagrebelsky, M., Buffo, A., Skerra, A., Schwab, M.E., Strata, P., and Rossi, F. (1998) Retrograde regulation of growth-associated gene expression in adult rat Purkinje cells by myelin-associated neurite growth inhibitory proteins. J Neurosci. 18(19): 7912-7929.

Zakharenko, S.S., Zablow, L., and Siegelbaum, S.A. (2001) Visualization of changes in presynaptic function during long-term synaptic plasticity. Nat Neurosci. 4(7): 711-717.

Zhai, R.G., Vardinon-Friedman, H., Cases-Langhoff, C., Becker, B., Gundelfinger, E.D., Ziv, N.E., and Garner, C.C. (2001) Assembling the presynaptic active zone: a characterization of an active one precursor vesicle. Neuron. 29(1): 131-143.

Zhou, C., Li, Y., Nanda, A., and Zhang, J.H. (2003) HBO suppresses Nogo-A, Ng-R, or RhoA expression in the cerebral cortex after global ischemia. Biochem Biophys Res Commun. 309(2): 368-376.

Zhou, Z., Hong, E.J., Cohen, S., Zhao, W.N., Ho, H.Y., Schmidt, L., Chen, W.G., Lin, Y., Savner, E., Griffith, E.C., Hu, L., Steen, J.A., Weitz, C.J., and Greenberg, M.E. (2006) Brain-specific phosphorylation of MeCP2 regulates activity-dependent Bdnf transcription, dendritic growth, and spine maturation. Neuron. 52(2): 255-269.

Zipursky, R.B., Lim, K.O., Sullivan, E.V., Brown, B.W., and Pfefferbaum, A. (1992) Widespread cerebral gray matter volume deficits in schizophrenia. Arch Gen Psychiatry. 49(3): 195-205.

Zou, D.J., and Cline, H.T. (1996) Expression of constitutively active CaMKII in target tissue modifies presynaptic axon arbor growth. Neuron. 16(3): 529-539.

Zubenko, G.S., Maher, B.S., Hughes, H.B., 3rd, Zubenko, W.N., Scott Stiffler, J., and Marazita, M.L. (2004) Genome-wide linkage survey for genetic loci that affect the risk of suicide attempts in families with recurrent, early-onset, major depression. Am J Med Genet B Neuropsychiatr Genet. 129(1): 47-54.

110

APPENDICES

Upregulation of CaMKIIβ and Nogo-C mRNA in schizophrenia ...

Documents

Transcript of Upregulation of CaMKIIβ and Nogo-C mRNA in schizophrenia ...