Genetics Unit Teacher

Notes

Details for how best to implement this curriculum in your classroom

Created by: It’s Not Rocket Science

1- Implementation• Read First (this document) with 10 pages of

teacher notes for how to implement this curriculum

• Links to YouTube Video Lectures for each PowerPoint

• Lab Set-up – 23 pages with details for the activities and project included in this bundle.

• Unit Plans for CP (non-honors) + editable version

• Unit plans for Honors + editable version• NGSS Alignment overview• How to Write A Great Study Guide Resource• Cracking the Code Video Questions

Included by Folder:2-Packets

• 32-page Packet of notes outlines, practice handouts, and other student handouts for lab activities for Biology CP

• 35-page Packet of notes outlines, practice handouts, and other student handouts for lab activities for Biology Honors

• 4-page guide to accessing and using the paperless digital packets (for CP and Honors) through Google Drive™

3-Notes• Concept 1 CP Notes: DNA Structure and

Replication– 11 slide ppt• Concept 2 CP Notes: Protein Synthesis– 13

slide ppt• Concept 3 CP Notes: Meiosis – 21 slide ppt• Concept 1 Honors Notes: DNA Structure and

Replication – 22 slide ppt• Concept 2 Honors Notes: Protein Synthesis–

14 slide ppt• Concept 3 Honors Notes: Meiosis – 21 slide

ppt**All ppts are fully animated in presenter mode**

4-Activities• 20 Game Cards for Protein

Syn-thingo• 6 QR Code Review Stations +

editable version• Editable version of student

handouts for Create a Children’s Book project

• Editable clues for Protein Synthesis Scavenger Hunt activity

5-Quizzes and Tests• Unit 4 Test CP: Concepts 1-2 + Cumulative – Versions A and B (Multiple choice

rearranged) + Answer Sheet– 4 page MC and OR Test, 2 page Answer Sheet– Editable Version of Test A

• Meiosis Quiz CP (Concept 3) – Versions A and B (Multiple choice rearranged)– 2 page MC and OR Quiz – Editable Version of Quiz A

• Unit 4 Test Honors – Versions A and B (Multiple choice rearranged) + Answer Sheet– 5 page MC and OR test, 3 page Answer Sheet– Editable Version of Test A

• Answer keys for CP and Honors, A and B versions© It’s Not Rocket Science

Teacher Notes:Overview: This product is designed to be everything you need to teach A genetics unit in your biology class. Content covered for both CP (college prep, or non-honors) and Honors curriculum includes: DNA and RNA structure, DNA replication, protein synthesis, and meiosis. This product includes notes, a packet of student handouts for activities and Labs, a meiosis quiz (for CP), an end of term project, and unit tests. Everything is provided for two levels – CP and Honors. Not only that, but the student packets come in a paperless digital version that can be used in Google Drive™ and/or Microsoft OneDrive™.

Packet instead of Interactive Notebook:I started creating packets for my students six years ago, and I love them so much more than interactive notebooks. While interactive notebooks are great resources, I have found that packet strategy to be a more appropriate tool for using in the secondary classroom setting. I love using the packet for many reasons. 1. I only have to make copies one time each unit instead of copying handouts every

day. Even though it takes a while to copy the packets for each student, it saves so much time on the day to day. (Also the last few years I’ve recruited seniors to be my “Teacher’s Aide” and have trained them to copy all of my packets for me. I haven’t seen a copier in four years and it’s glorious!). NOW you can go DIGITAL and PAPERLESS, never making any copies ever again!

2. It puts responsibility back on the students to maintain their biology binder with their packet, while also aiding them in practicing organization skills. It has been incredibly effective for my lower level students. Even though it is a lot of papers at once, I can watch them put it in their binder and leave it there, rather than having to hang on to 100 individual papers passed out each day.

3. It makes it so easy to be absent last minute. If you or your child gets sick, sub plans are a breeze. You don’t have to send your teacher neighbor to make copies for you – because your students have everything they need. You just have to tell the sub which pages the students need to work on.

4. The structure is more suited to what students will be doing in college – and one of our goals as high school teachers should be to prepare our students for college. The packet helps students learn how to structure notes (I give students Cornell-style note outlines for each concept – more on that later) which I have found helps provide scaffolding for them to be able to write notes all on their own in later high school years.

5. Time saver in so many ways – no more time wasted regularly passing out handouts, or having to cut and paste things into a notebook.

6. Students do a better job keeping up with returned graded work because every page is numbered so they can put graded assignments right back into the packet where it came from.

7. You no longer need a filing cabinet – you can keep all of your curriculum and keys organized in binders! See picture on page 11.

© It’s Not Rocket Science

In short…The best evidence I have of why I love the packet strategy is that I had a 96% pass rate on the State standardized End-of-Course exam for non-honors students and a 100% pass rate for honors students. This was at a South Carolina Public School with over 50% of the students being below the poverty line. My average score on the EOC (all 200+ students combined that I taught over 2 years) was a 90%. I believe this success is due to multiple factors, but I attribute a lot of it to the packet curriculum I have designed, and the fact that all of my tests are cumulative (which you will see if you purchase further units!) Honestly, I could go on and on about the packet as a resource and why I love it so much, but I think you will find as you use it that you will fall in love with it too.

Next Generation Science Standard Alignment:This unit covers content related to the following NGSS Standards: HS-LS1-1. Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins, which carry out the essential functions of life through systems of specialized cells. HS-LS1-6. Construct and revise an explanation based on evidence for how carbon, hydrogen, and oxygen from sugar molecules may combine with other elements to form amino acids and/or other large carbon-based molecules. HS-LS3-1. Ask questions to clarify relationships about the role of DNA and chromosomes in coding the instructions for characteristic traits passed from parents to offspring. HS-LS3-2. Make and defend a claim based on evidence that inheritable genetic variations may result from: (1) new genetic combinations through meiosis, (2) viable errors occurring during replication, and/or (3) mutations caused by environmental factors.

Prior Knowledge: This is the fourth unit I teach in Biology after Biology Basics, Cells and Energy Flow. Because of this, I expect students to have prior knowledge on basic lab equipment, safety, measurement, scientific method, macromolecules, organelles, transport, mitosis, cancer, enzymes, atp, food webs, trophic pyramids, photosynthesis, and cellular respiration. You will see questions on this content in the cumulative section of the unit test. This is my last unit in the fall semester. Then in the spring I teach Heredity, Evolution, and Ecology, so I do not expect them have to have prior knowledge in these content areas.

When to use: This is designed to be the fourth and final unit before my midterm in my biology class, but it doesn’t have to be in yours. I believe the resources I have provided in this product are everything you need to teach this unit. However, if you know that your students don’t have the prior knowledge I’ve mentioned above, or if you teach through a section of this unit and realize your students need more of it, I strongly encourage you to add in some additional practice handouts to the packet I’ve designed. Every class is different and some will need more support than others – and that is totally okay! Although some components of this product (like the tests) are editable, I unfortunately cannot provide the packet as an editable resource in order to protect the integrity of my work and the time and effort I have put into creating it. I hope you understand!

© It’s Not Rocket Science

Teacher Notes:

Assessment: I did not include point values on any of the handouts in order to provide you the freedom to grade things how you so desire. On this page I am going to provide you an overview of my grading strategy for you to reference. Feel free to adopt this or make it entirely your own. It is completely up to you!

After much research and number crunching over the last few years, this is the most accurate grading technique that I have come up with. I divide the gradebook into two simple categories: MAJOR grades and MINORgrades. Within each category, different assessments are worth different amount of points, based on length, depth, and complexity. Below I will give you an idea of what goes into each category.

Major Grades = 60% of the student’s overall grade• Tests = 100 pts

– Unit 4 only has 1 test, which would count as a 100 pt major grade• Quizzes = 25 pts

– Unit 4 CP has one quiz on meiosis, which would count as a 25 pt major grade• Projects = 100 pts

– I like to do 1 project per quarter to give students an opportunity to show their understanding of the content in a non-traditional way. For this unit, my students complete the Create a Children’s Book Project to help them review for the midterm. It would count as a 100 pt major grade.

Minor Grades = 40% of the student’s overall grade• Labs/In-Class activities = 10-100 pts

– The amount of points I give students is completely dependent on the length and depth of the activity. I also do not grade every single in-class activity the students do. We would just go over them as a class. If I did feel like giving them a grade, I would just circle the class and do a 10-15 pt spot check grade for it before drawing names and going over the answers.

– An activity that lasts only half of a 50-minute class period would usually only be worth 25 pts. An activity that lasts an entire class period is usually worth 50 pts for me, and an activity that takes more than 1 class period to complete would be worth 100 pts for me. Examples: • Activity: Understanding DNA Structure – 25 pts• Activity: Building a Candy Model – 25 pts• Activity: Protein Synthesis Scavenger Hunt – 25 pts• Lab Stations: Putting it all together – 25 pts

© It’s Not Rocket Science

Teacher Notes:

Assessment (continued): Minor Grades = 40% of the student’s overall grade• Daily Quizzes/Bell Ringers = 5 pts per day, usually totaling 25 pts for the week (if

there is one every day)– This is something I have fallen in love with doing, but not every teacher does which is why I do

not include my daily quizzes/bell ringers with this product (if you would like to purchase, you can find them in my store. They are $5 per unit or cheaper if you buy as a bundle. Link to this product for Genetics on page 13.) I call my bell ringers “Prime Times” because I believe the first 5 minutes of class is the most important time of the day. I love that my students are in a routine and come in ready to work as soon as they get to my room because they know they will have a Prime Time. If you would like to know more about how I implement these, again, check them out in my store! The gist is that students have 3-5 questions a day on the board when they come in. They use the same sheet of paper each day to write their answers on. I give them 5 minutes at the start of class to answer the questions, then they pass them over and I collect them and grade each day. They count for 5 pts a day. At the end of the week I add up the points based on how many we did and give them a score for the week. I grade these for accuracy but I allow students to use their notes. This way I ensure students are writing good notes, keeping up when they are absent, and getting the basics of what we covered the day before. I also like it because I go over the answers as soon as I collect them so I know if the majority of students are getting what we did the day before so I can address issues before we move on to new material.

• Homework = Concept Study Guides = 10 pts each– Biology is so much memorization, so the most important use of a student’s time doing

homework (in my opinion) is to be studying. However, most students don’t know how to study! This is why I have students create their own study guides.

– I divide each unit into 3-6 concepts (Note: This unit only has 3 concepts.) Students make a study guide for each concept and turn them in at different points throughout the unit to be graded for 10 pts each. I return them within a day so they can have them to study for their unit tests.

– All unit tests provided in this product and future products are aligned with the objectives and vocabulary outlined on the front page of each packet. Because of this (and because students need lots of support, especially as 9th graders, to know how to study) I have students use this front page to make their study guides from. They have to answer each objective and define each vocabulary term in order to make an adequate study guide.

– I do allow them some freedom in this. Some students like to type these, some hand write them. I also encourage students to make them as visual as possible. They don’t need to write study guides in paragraph form. I encourage them to make Venn diagrams, tables, and other charts to make their study guides visually appealing – and something they would like to study from.

– For the vocabulary portion, a lot of students make flashcards or use Quizlet (an online flashcard making tool.) This is great, but I do make them turn these in with their study guide so I can check them. For Quizlet, students just print them out and staple to the back of their objectives.

– I find these especially useful because, as mentioned earlier, if you continue to purchase other units of mine you will find that my tests are all cumulative. At the end of each test there is a labeled “Cumulative” section that has questions from previous units. This is because biology builds upon itself, and because I want to encourage my students to really learn material for the long-term, and not just cram it in over night. If students make good study guides, they will be incredibly useful resources for them throughout the year as they review for the cumulative sections of future tests.

© It’s Not Rocket Science

Teacher Notes:

Materials:• Hole-punched Copies of packet for each student to put in their binders (or

distributed digital paperless packets to students via Google Drive™ or Microsoft OneDrive™)

• Markers, coloring pencils, tape, and scissors• Printed (and I prefer laminated) cards for Protein Syn-thingo game (in “Activities”

Folder)• Printed (and I prefer laminated) Lab Station Cards (in “Activities” Folder)• Headphones and/or additional devices for students to use to complete QR Code

Lab station activity (optional)• Copies of CP quizzes (I do these front and back to save paper)• Copies of tests (I print class sets of tests that students can’t write on and only give

them answer sheets in order to save copies for future years.)• **Note** Details for set-up and additional materials for the other more extensive

activities are included in a separate document in this folder, titled “Lab Set-up.”

Implementation:Over the next few pages I will be providing commentary for how to implement this curriculum, based on the unit plans included in the “Implementation” file folder. Be sure to have a copy of the unit plan open or printed out as you read through this so It makes the most sense. A lot of the content is included in both the CP and Honors packets. For general implementation, I give CP students a lot more support and guidance as I teach them, and the honors students are expected to work more independently. If there are any other differences between implementation for both levels, I will include those below. Check out the NGSS Alignment Overview document in this folder for tips for how to teach through this unit using NGSS phenomena.

Please use the unit plans and these notes as a guideline for your class. Teaching and plans have to be flexible and be able to be adjusted based on student needs. This unit is written to take 20 days for both my honors and CP classes. But I’ve seen it take up to 24 before due to a variety of reasons, so please adjust as needed! Editable versions of unit plans are provided for that exact reason!

Note: All unit plans and implementation notes are based off a 50-minute class period.

Day 1: I really like to start off this unit by watching “Cracking the Code of Life” video. I know a lot of people don’t show videos, which is why I included the video questions separate from the packet (they are in the “Implementation” folder) so you could easily not do this if you don’t want to or are short on time. I just think this video does a great job setting the stage for the relevance of this unit in terms of what the students will learn in the next unit about Heredity. My kids always seem to find it interesting! You can currently watch it for free on YouTube (click here) or buy it off of Amazon (click here) if you want it on DVD. It takes about 2.5 class periods to watch it all.

Day 2: Continue watching Cracking the Code of Life. Students answer video questions as they watch. © It’s Not Rocket Science

Teacher Notes:

© It’s Not Rocket Science

Unit Plans (+ editable versions) for both CP and Honors

Includes 50-minute and 90-minute pacing

! © It’s Not Rocket Science !

Course: Biology Honors

Unit 4 Genetics

Learning Objectives Determination of Evidence Transferability Student will be able to… " Use!a!Venn!diagram!to!compare!and!contrast!DNA!and!RNA.!" Explain!the!base!pairing!rules!of!DNA.!Provide!an!example!of!a!strand!of!DNA!

with!its!complementary!pair.!" Draw!the!structure!of!a!nucleotide!and!label!the!parts.!" Describe!the!difference!between!purines!and!pyrimidines!and!list!which!

nitrogen!bases!are!which.!!!" Explain,!in!detail,!the!structure!of!a!DNA!molecule.!!!" Explain!the!differences!between!a!strand!of!DNA,!genes,!and!a!chromosome.!!" Summarize!the!process!of!DNA!replication.!" Describe!the!difference!between!the!leading!strand!and!the!lagging!strand!in!

DNA!replication.!!!" Explain!the!function!of!each!enzyme!in!the!process!of!DNA!replication.!!" Identify)a)nucleic)acid)as)DNA)or)RNA)based)on)a)description)or)diagram.)" Describe!the!relationship!between!genes!and!proteins.!" Explain!the!central!dogma.!!" Describe!the!roles!of!the!three!types!of!RNA!in!protein!synthesis.!!Draw!a!sketch!

of!what!each!type!looks!like.!!" Summarize,!in!detail,!the!steps!in!transcription!and!translation.!!Include!

location!of!process!and!enzymes!involved.!!" Transcribe!the!following!strand!of!DNA!to!mRNA,!and!translate!a!sequence!of!

amino!acids!from!the!mRNA:!TACACCGGAGCGTTTATT!" Explain!what!would!happen!if!a!mistake!is!made!during!protein!synthesis.!" Describe!the!difference!between!haploid!cells!and!diploid!cells.!" Explain!the!significance!of!crossing!over!during!prophase!I/metaphase!I.!" Describe!the!difference!between!somatic!cells!and!sex!cells.!" Describe!the!difference!between!autosomes!and!sex!chromosomes.!" Explain!the!purpose!and!results!of!meiosis!compared!to!mitosis.!" List!the!end!results!of!meiosis!I!and!meiosis!II.!" Draw!and!summarize!each!step!in!meiosis.!" Explain!what!would!happen!if!a!mistake!is!made!during!meiosis.!!!" Identify)a)cell)as)haploid)or)diploid)based)on)a)description)or)picture.

The following assessments will provide evidence of student learning: Classwork/Labs: " Video Questions: Cracking the Code of Life

(optional) " Activity: Understanding DNA Structure " Practice: DNA Structure and Replication " Practice: Transcribing and Translating " Activity: Building a Candy Model " Practice: Protein Synthesis " Activity: Protein Synthesis Scavenger Hunt " Game: Protein Syn-thingo " Practice: Haploid v. Diploid " Practice: Meiosis " Lab Stations: Putting it All Together Homework: " Concepts 1-3 Study Guides

Tests/Quizzes: " Unit 4: Concepts 1-3

Projects/Reports: " Children’s Book Project

Next Generation Science Standards by NSTA: HS"LS1"1!HS"LS1"4!HS"LS1"6!HS"LS3"1!HS"LS3"2!!

! © It’s Not Rocket Science !

Day Learning Objectives Methods/Activities Assessments Homework NSTA Standards

1 Introduce Genetics -Watch Cracking the Code of Life video, students answering video questions during

-Informal questioning and discussion

HSMLS1M1!HSMLS3M1!

2 Introduce Genetics -Watch Cracking the Code of Life

video, students answering video questions during

-Informal questioning and discussion

HSMLS1M1!HSMLS3M1!

3 DNA Structure and Function -Finish Cracking the Code of Life and

turn-in questions -Start Concept 1 Notes p.2-3 (stop before replication -Start coloring DNA Model p.5

-Cracking the Code of Life video questions -Informal questioning and discussion

-Work on Concept 1 SG

HSMLS1M1!HSMLS1M4!HSMLS3M1!

4 DNA Structure and Function -DNA Model p.5-6 – turn in p.6 when finished -Work on Concept 1 SG (if time)

-Activity: DNA Model p.5-6 -Work on Concept 1 SG

HSMLS1M1!HSMLS1M4!HSMLS3M1!

5 DNA Replication -Finish Concept 1 Notes p.4 on DNA

Replication -Practice: DNA Structure and Replication p.7

-Informal questioning and discussion

-Work on Concept 1 SG

HSMLS1M4!HSMLS3M1!

6 Protein Synthesis -Concept 1 SG due -Concept 2 Notes p.8-9 (stop after transcription, before translation) -Practice p.12 – do the transcribing only!

-Informal questioning and discussion

-Work on Concept 2 SG

HSMLS1M1!HSMLS1M6!

7 Protein Synthesis -Finish Concept 2 Notes p.9-11 on translation -Finish Practice p.12 – do the translating

-Informal questioning and discussion

-Work on Concept 2 SG

HSMLS1M1!HSMLS1M6!

8 Protein Synthesis

-Activity: DNA Candy Model p.13-14 -DNA Candy Model p.13-14 -Work on Concept 2 SG

HSMLS1M1!HSMLS1M6!

9 Protein Synthesis -Finish and turn in p.13-14 if you didn’t

day 6 -Practice: Protein Synthesis p.15-16 -Work on Concept 2 SG (if time)

-Informal questioning and discussion

-Finish Concept 2 SG HSMLS1M1!HSMLS1M6!

10 Protein Synthesis -Collect Concept 2 SG -Activity: Protein Synthesis Scavenger Hunt p.17-18

-Concept 2 SG -Informal questioning and discussion

-Study for test HS-LS1-1 HSMLS1M6!

32-page CP Packet with all student handouts for the entire unit

First page of packet splits the unit into 3 concepts: DNA Structure and Replication, Protein Synthesis and Meiosis. Each concept is

broken down into objectives and vocabulary that students will use to create study guides from.

Genetics Unit © It’s Not Rocket Science 2016 1

Unit Topic: Genetics

Essential Question: How is genetic information from a living organism passed on to its offspring?

Concept 1: DNA Structure and Replication

Objectives: 1. Use a Venn diagram to compare and

contrast DNA and RNA. 2. Explain the base pairing rules of DNA.

Provide an example of a strand of DNA with its complementary pair.

3. Draw the structure of a nucleotide and

label the parts. 4. Summarize the process of DNA

replication. 5. Explain the differences between a

strand of DNA, genes, and a chromosome.

6. Identify a nucleic acid as DNA or RNA

based on a description or diagram. Vocabulary: Nucleic acid Nucleotide Chromosome Gene DNA Semi-Conservative Model

Concept 2: Protein Synthesis

Objectives: 1. Describe the relationship between genes

and proteins. 2. Explain the central dogma. 3. Summarize, in detail, the steps in

transcription and translation. 4. Describe the roles of the three types of

RNA in protein synthesis. 5. Transcribe the following strand of DNA

to mRNA, and translate a sequence of amino acids from the mRNA.

TACACCGGAGCGTTTATT 6. Explain what would happen if a mistake

is made during protein synthesis. Vocabulary: Transcription Translation mRNA tRNA rRNA Genetic code Codon Anticodon Amino acid

Concept 3: Meiosis

Objectives: 1. Describe the difference between

haploid cells and diploid cells. 2. Explain the significance of

crossing over during prophase I/metaphase I.

3. Describe the difference between

somatic cells and sex cells. 4. Describe the difference between

autosomes and sex chromosomes. 5. Explain the purpose and results of

meiosis compared to mitosis. 6. List the end results of meiosis I

and meiosis II. 7. Draw and summarize each step in

meiosis. 8. Explain what would happen if a

mistake is made during meiosis. 9. Identify a cell as haploid or

diploid based on a description or picture.

Vocabulary: Karyotype Crossing over Somatic cell Sex cell (gamete) Autosome Sex chromosome Diploid Haploid Crossing-over

© It’s Not Rocket Science

35-page Honors Packet with all student handouts for the entire unit.

First page of packet splits the unit into 3 concepts: DNA Structure and Replication, Protein Synthesis and Meiosis. Each concept is

broken down into objectives and vocabulary that students will use to create study guides from.

Genetics Unit © It’s Not Rocket Science 2016 1

Unit Topic: Genetics Honors

Essential Question: How is genetic information from a living organism passed on to its offspring?

Concept 1: DNA Structure and Replication

Objectives: 1. Use a Venn diagram to compare and

contrast DNA and RNA. 2. Explain the base pairing rules of DNA.

Provide an example of a strand of DNA with its complementary pair.

3. Draw the structure of a nucleotide and

label the parts. 4. Describe the difference between

purines and pyrimidines and list which nitrogen bases are which.

5. Explain, in detail, the structure of a

DNA molecule. 6. Explain the differences between a

strand of DNA, genes, and a chromosome.

7. Summarize the process of DNA

replication. 8. Describe the difference between the

leading strand and the lagging strand in DNA replication.

9. Explain the function of each enzyme in

the process of DNA replication. 10. Identify a nucleic acid as DNA or RNA

based on a description or diagram. Vocabulary: Nucleic acid Nucleotide Chromosome Gene DNA Leading strand Lagging strand RNA primer Okazaki fragments Semi-Conservative Model

Concept 2: Protein Synthesis

Objectives: 1. Describe the relationship between genes

and proteins. 2. Explain the central dogma. 3. Describe the roles of the three types of

RNA in protein synthesis. Draw a sketch of what each type looks like.

4. Summarize, in detail, the steps in

transcription and translation. Include location of process and enzymes involved.

5. Transcribe the following strand of DNA

to mRNA, and translate a sequence of amino acids from the mRNA.

TACACCGGAGCGTTTATT 6. Explain what would happen if a mistake

is made during protein synthesis. Vocabulary: Transcription Translation mRNA tRNA rRNA Genetic code Codon Anticodon Amino acid

Concept 3: Meiosis

Objectives: 1. Describe the difference between

haploid cells and diploid cells. 2. Explain the significance of

crossing over during prophase I/metaphase I.

3. Describe the difference between

somatic cells and sex cells. 4. Describe the difference between

autosomes and sex chromosomes. 5. Explain the purpose and results of

meiosis compared to mitosis. 6. List the end results of meiosis I

and meiosis II. 7. Draw and summarize each step in

meiosis. 8. Explain what would happen if a

mistake is made during meiosis. 9. Identify a cell as haploid or

diploid based on a description or picture.

Vocabulary: Karyotype Crossing over Somatic cell Sex cell (gamete) Autosome Sex chromosome Diploid Haploid Crossing-over

© It’s Not Rocket Science

Along with practice, lab station answer sheets, and lab investigation handouts, each packet also includes Cornell note outlines that go along with each

PowerPoint.

Cornell Notes leave a margin for students to highlight terms and write questions as they go back and study their notes. Cornell Notes also leave room at the end of notes for students to summarize what they learned. The CP summary sections

have questions to help them summarize.

Sample: Honors Concept 1 Notes (Cornell Notes Outline)

Genetics Unit © It’s Not Rocket Science 2016 2

Concept 1 Notes: DNA Structure and Replication Questions/Vocabulary

Nucleic Acids Two Types: Nucleotides Sugar Phosphate Nitrogen Base DNA Structure

Genetics Unit © It’s Not Rocket Science 2016 3

Nitrogen Bases (2 Types) DNA is antiparallel RNA Structure

Genetics Unit © It’s Not Rocket Science 2016 4

Basics of Heredity Chromosomes Genes DNA Replication

Background

Genetics Unit © It’s Not Rocket Science 2016 6

Leading strand Lagging strand

3. Semi-Conservative Replication Summary Concept 1

Genetics Unit © It’s Not Rocket Science 2016 5

1. 2. Step 2 only works with the help of enzymes Primase DNA Polymerase DNA Ligase

© It’s Not Rocket Science

Along with practice, lab station answer sheets, and lab investigation handouts, each packet also includes Cornell note outlines that go along with each

PowerPoint.

Cornell Notes leave a margin for students to highlight terms and write questions as they go back and study their notes. Cornell Notes also leave room at the end of notes for students to summarize what they learned. The CP summary sections

have questions to help them summarize.

Sample: CP Concept 3 Notes (Cornell Notes Outline)

Genetics Unit © It’s Not Rocket Science 2016 21

Concept 3 Notes: Meiosis Questions/Vocabulary

Our bodies have 2 types of cells: Somatic cells Gametes Our cells have 2 types of chromosomes: Autosomes Sex chromosomes

Homologous chromosomes

Sister chromatids During sexual reproduction, the number of chromosomes is important. Diploid cells Haploid cells

Genetics Unit © It’s Not Rocket Science 2016 22

Sexual Reproduction

Purpose of Meiosis

Meiosis I Before Meiosis I…

Prophase I Crossing over

Genetics Unit © It’s Not Rocket Science 2016 23

Metaphase I Anaphase I Telophase I (and Cytokinesis) End Result

Meiosis II

Prophase II Metaphase II Anaphase II

Genetics Unit © It’s Not Rocket Science 2016 24

Telophase II (and Cytokinesis) End Result Summary Concept 3 What is the purpose of meiosis? Why must PMAT happen twice?

© It’s Not Rocket Science

Packet also includes…5 practice sheets

3 engaging lab activities1 review game

QR Code lab station review1 project

Samp

le: U

nder

stan

ding

Dna

str

uctu

re

Acti

vity

Samp

le: T

rans

crib

ing

and

tran

slat

ing

prac

tice

Samp

le: M

eios

is P

ract

ice

Samp

le: P

rote

in s

yn-t

hing

ore

view

gam

e

Genetics Unit © It’s Not Rocket Science 2016 5

Activity: Understanding DNA Structure Overview: We are going to create a class DNA molecule. Your job is to make 4 nucleotides to contribute. Here is what you need to do:

1. Color the pieces below according to the key. 2. Cut them out. 3. Assemble 4 DNA nucleotides: A, T, C, and G. 4. Add them to the class molecule. 5. Answer the reflection questions on the next page.

Coloring Key:"

Deoxyribose = Red Adenine = Green Guanine = Orange Phosphates = Blue Thymine = Yellow Cytosine = Purple

Genetics Unit © It’s Not Rocket Science 2016 12

Practice: Transcribing and Translating

Transcribe and translate the following DNA molecules.

1. DNA: TACCGGATGCCAGATCAAATC mRNA: amino acids:

2. DNA: TACCTGTTAAGCTACAAAATT mRNA: amino acids:

3. DNA: AATACGGGGGCGTAACCACTA mRNA:

amino acids:

4. DNA: GCTAGTACGTGCACATTAGAA

mRNA:

amino acids:

Genetics Unit © It’s Not Rocket Science 2016 19

Game: Protein Syn-thingo

Use the list of amino acids below to fill in your board. You must use all of the amino acids once, then you can include duplicates to fill in the rest of the spaces. Once everyone’s boards are filled out, I will read off pieces of

DNA or mRNA. You must transcribe and translate (if it’s DNA) or just translate (if I give you mRNA.) If you get an amino acid on your board, mark it off with your pencil. When you get 5 in a row yell “Protein Syn-

thingo!!” Make sure you have a copy of your genetic code out to reference!

Amino Acids:

Alanine (Ala) Glutamine (Gln) Leucine (Leu) Serine (Ser) Arginine (Arg) Glutamic acid (Glu) Lysine (Lys) Threonine (Thr) Asparagine (Asn) Glycine (Gly) Methionine (Met) Tryptophan (Trp) Aspartic acid (Asp) Histadine (His) Phenylalanine (Phe) Tyrosine (Tyr) Cysteine (Cys) Isoleucine (Ile) Proline (Pro) Valine (Val)

Genetics Unit © It’s Not Rocket Science 2016 26

8. How did this organism get these chromosomes? Where did they come from?

9. Why are karyotypes useful diagrams? What can they show you about an organism?

10. Organisms have different numbers of chromosomes. Fill in the chart below about 5 different organisms.

Species # of chromosomes in diploid cells

(2n)

# of homologous chromosome pairs in

diploid cells

# of chromosomes in haploid cells

(n)

Humans 46 23 pairs

Bat 44

Monkey 21 pairs

Camel 35

Dog 78

11. The number of chromosomes during meiosis is incredibly important. Why is that?

12. Below you will sketch the difference between cells that go through mitosis versus meiosis. The focus is

on the number of chromosomes, not the specific steps, so you only need to draw the chromosomes in each circle. Do this drawing for a fruit cell, whose body cells have 8 chromosomes, or 4 homologous pairs.

© It’s Not Rocket Science

Includes access to Paperless Digital versions of the student packets that can be used in Google Drive™ or Microsoft OneDrive™

Perfect for teachers in 1:1 classrooms, looking to integrate more educational technology, or go PAPERLESS! Get all of the same content, organization, and ease of the paper packets, without all of the copies!

© It’s Not Rocket Science

6 Powerpoints of Notes3 different concepts – CP and Honors versions for each

Over 100 slides, all with editable textFully animated presentations in slide show mode

Sample: Honors Concept 1 Notes slides

Sample: CP Concept 2 Notes slides

Sample: Honors Concept 3 Notes slides

© It’s Not Rocket Science

3 different Lab Activities and 1 project + Editable Versions

Sample: Create a Children’s Book Project description

Sample: Review QR CODE Stations/Task Cards

Sample: Protein Synthesis Scavenger Hunt Activity

Genetics Unit © It’s Not Rocket Science 2016 30

Project: Create a Children’s Book

Description: So far this year we have learned some complex ideas about key topics in life science. In order to improve your own mastery of the topics and help elementary students start learning these concepts early on, you will create a children’s book about one of the five key topics we have covered so far this year. You must summarize the information for your topic while still including key details. However, you also must simplify the material in a voice that an 8-10 year old could understand. What to do:

1. Create a children’s book covering one of the following topics: Macromolecules, Photosynthesis, Cellular Respiration, Protein Synthesis, or Meiosis. See list below for details on each topic.

2. The book must have a. A cover page with a title and illustration b. A minimum of 10 pages, each page including an illustration and words c. Scientific explanations of key concepts (see list below) d. Maintain a scientific focus but in an appropriate voice for an 8-10 year old children’s book e. Neatly written or typed using appropriate spelling and grammar f. Neat, colorful, and appropriate illustrations to accompany your story g. All information must be accurate, informative, and clear

3. Use the checklist provided to make sure you have completed every aspect of the project. How you will be evaluated:

! This is a 100-point grade ! I will use the rubric on the following page to evaluate your work

List of Topics and Key Concepts

Macromolecules Must include… • Carbohydrates, Lipids, Proteins, and

Nucleic Acids • Purpose/functions of each

molecule/what they do for our bodies • Structure (monomer and polymer) • Examples (for kids, think of the food

we find carbs, lipids, and proteins in) • Energy Storage and the order of how

we break them down for energy, including reasoning

Photosynthesis Must include… • Purpose of the process for plants and

how it eventually is purposeful for us humans too!

• Chemical Equation • Location of the entire process and

each step • Description/Summary of Light-

Dependent Reaction and Independent Reaction

Cellular Respiration Must include… • Purpose of the process for us as

humans • Chemical Equation • Location of entire process and each

step • Description/Summary of aerobic

respiration (Glycolysis, Krebs Cycle, ETC)

• Description/Summary of anaerobic respiration in animals (Glycolysis and Lactic Acid Fermentation)

Protein Synthesis Must include… • Purpose of Protein Synthesis, including Central Dogma, and

why we need DNA and proteins • Location of the each step • Description/Summary of Transcription • Description/Summary of Translation • An actual example (can be interwoven throughout story, not

just on one page) of DNA going through the process of being transcribed and translated

Meiosis Must include… • Big picture context of when and why meiosis happens • Specific purpose of meiosis and reasoning behind halving the

end number of chromosomes in each cell • Description/Summary of Meiosis I • Description/Summary of Meiosis II • Illustrations of each step • Explanation of important vocabulary for understanding the

process (Ex. Haploid, diploid, homologous chromosomes, etc.)

Chromosomes( Karyotypes(

1.  What'is'DNA?'

2.  What'is'DNA'made'of?'

3.  What'is'its'purpose?'

4.  What'are'genes?''

5.  What'are'their'purpose?'

6.  Explain'the'structure'of'a'chromosome.''

7.  Summarize'the'relaDonship'between'DNA,'genes,'and'chromosomes'based'on'what'you'heard'in'the'video'clip.!

Scan!in!the!QR!code!below!and!watch!the!22minute!video!clip!before!answering!the!ques;ons.!! Scan!in!the!QR!code!to!the!

right.!!Look!at!the!different!pictures!and!read!their!

descrip;ons!before!answering!the!ques;ons!below.!

1.  The'first'picture'shows'what'type'of'chromosomes'in'what'phase'of'the'cell'cycle?''Is'this'cell'somaDc'or'a'gamete?'

2.  Looking'at'the'2nd'and'3rd'karyotypes,'what'is'the'difference'between'male'and'female'karyotypes?'

'

3.  How'many'chromosomes'are'autosomes'in'these'karyotypes?''How'many'are'sex'chromosomes?''What'is'the'difference?'

4.  Would'these'two'karyotypes'be'of'a'somaDc'cell'or'gamete?''Explain'how'you'know.'

5.  What'is'nondisjuncDon?'When'would'it'occur'and'what'is'the'result?'

6.  Look'at'the'karyotype'for'the'child'with'Down'syndrome.''What'is'different'about'it?''

7.  Look'at'the'karyotype'for'the'child'with'Klinefelter’s'syndrome.''What'is'different'about'it?'

8.  Is'nondisjuncDon'the'only'mistake'that'could'happen'during'meiosis?''Glance'through'the'other'karyotypes'on'this'page'and'provide'another'example'of'a'mistake'and'the'resulDng'problem.''

The Clues TACGCGTTCGCTGGTCAAGTGCAGCACGCCTTCCATGCAGGTCAAAATT

TTTTCATAGAAAAAACCCAGATC

TACTCATTGTAGCAAACAGCGGGGCAAGCTACAAAAACCGGGGAGAAA

TTGACT

TACGAGGGGCAAGATATGTTTTCAGCGACCTGGTAACAAGCAGGGCAAT

ATTTTTTCACAATT

TACCATGTGTTTCCACAAACGCTATTTGCTTTTTTAGCCGGGCAGGCACA

AAAAGATGGGCAGACGACCTAGCAGACCATAATC

TACCCGGGTAAAGCACCTTTCTCGTCAACCCAGGCTTTTCACTGGAGGG

GGGCTGAAGGACAAGTTTGGGAGAAGGTACATTGTACACAAACCACT

TACAAGACCATGGCGGGGCAAGCTCAAAAAGAGGGCCAGACGCTCTCGT

GTCAAGCTGTGCCCATT

TACAATCCCGCGGGGCAAAATAAAGAGATGCCGTGTTTGTAATTTCCGACT

TACGAATTTTTAAGAACGAAAGCGACCAGATTTACCCAACAGGCTGGGC

AGGCACAAAAAGATGGGCAGACGATT

taca

agcg

catt

acag

aaaa

cgct

ttgg

ccga

cgag

ttca

agag

atca

t

tacaagcgcattacagaaaacgctttggcaatcccataccat tacaagcgcattacagaaaacgctttggccgacgagttcaagagatcat tacaagcgcattacagaaaacgctttggcaatcccataccat

� It’s Not Rocket Science

© It’s Not Rocket Science

4 Multiple Choice and Open Response TestsCP and Honors

Versions A and B for both (MC rearranged to prevent cheating)

Answer Sheets and Detailed Answer KeysMeiosis Quiz for CP

+ Editable Versions

Samp

le: C

P Te

st

Samp

le: H

onor

s Te

st

Sample: Cp Answer Sheet

Biology Honors Test A

© It’s Not Rocket Science

Concept 1 Open Response 11. Label the nucleotide located on your answer sheet. (3 pts) 12. Compare and contrast DNA and RNA using the table found on your answer sheet. (3 pts) 13. Replicate the DNA strand on your answer sheet by writing its complementary strand below the one provided. (2 pts) 14. Explain the differences between purines and pyrimidines, list the purines and pyrimidines, and explain which ones

bond together. (3 pts)

15. Explain why DNA replication is said to be semi-conservative. You may draw a picture if that helps. (3 pts) 16. List what each enzyme does next to its name. (4 pts) Concept 2 Multiple Choice Base your answers to questions 17-20 on the diagram below, which represents an important cellular process.

17. The molecule copied directly from DNA is represented by number

A. 1 B. 2 C. 3 D. 4 18. What is an example of a molecule produced by the process shown above?

A. glucose B. glycogen C. a fatty acid D. a protein 19. Structure number 2 represents a

A. tRNA B. rRNA C. mRNA D. ribosome 20. The bond represented by number 5 is a ____ bond

A. covalent B. hydrogen C. ionic D. peptide

Test A

! © It’s Not Rocket Science

Genetics Unit Test: Concepts 1-2 Concept 1 Multiple Choice (2 points each) 1. In humans, where does DNA replication take place?

A. cytoplasm B. nucleus C. ribosome D. vacuole 2. A sequence of nucleotides found in the DNA of a chromosome codes for a specific protein or trait. This section of

DNA is known as a(n) A. allele. B. codon. C. gene. D. phenotype.

3. RNA from a chipmunk is compared to RNA from a worm. Both will contain the

A. sugar deoxyribose and the base thymine. B. sugar deoxyribose and the base uracil. C. sugar ribose and the base thymine. D. sugar ribose and the base uracil.

4. A scientist is doing an experiment to identify different molecules.

Some components of these molecules are listed in this table. Which of the four molecules is the DNA, based on the table to the right? A. molecule 1 B. molecule 2 C. molecule 3 D. molecule 4

5. The diagram shown here represents a portion of a nucleic acid molecule.

The part indicated by the arrow could be A. adenine B. uracil C. deoxyribose D. phosphate

6. A DNA nucleotide could contain the following molecules

A. deoxyribose, cytosine, and a lipid B. deoxyribose, thymine, and a phosphate group C. ribose, uracil, and a polypeptide D. ribose, adenine, and thymine

7. Which of the following nucleic acids contains thymine?

A. DNA only B. messenger RNA only C. transfer RNA only D. all of the above

8. Base your answer to this question on the diagram shown to the right AND on your knowledge of

biology. Structures 3 and 4 are held together by A. weak peptide bonds B. strong hydrogen bonds C. weak hydrogen bonds D. strong peptide bonds

9. DNA is a polymer consisting of monomers known as

A. peptides B. nucleotides C. amino acids D. phosphates

10. In nucleotides, the letters A, G, C, and T represent

A. phosphate groups B. deoxyribose sugars C. nitrogen bases D. ribose sugars 11. The cellular process of creating two new DNA molecules from one original copy is called replication. Which

statement is the BEST description of this process? A. DNA opens up and RNA copies it. B. DNA opens up and completely unwinds to make two new molecules. C. DNA opens up and each strand is used as a template for making a new strand. D. RNA opens up the DNA and uses each strand as a template for a new strand.

Test A

! © It’s Not Rocket Science

Genetics Test: Concepts 1-2 Answer Sheet Concept 1: 1. ________ 2. ________ 3. ________ 4. ________ 5. ________ 6. ________ 7. ________ 8. ________ 9. ________ 10. ________ 11. ________ 12. 13. 14.

DNA RNA Nucleotides used

Sugar used

Structure

15. Replicate the following strand of DNA by listing its complementary strand below it.

A T C T T G C A A A G G C T Concept 2: 16. ________ 17. ________ 18. ________ 19. ________ 20. ________ 21. ________ 22. ________ 23. ________ 24. ________ 25. ________ 26. ________ 27. ____________________ ____________________ ____________________

28. ________ 29. ________ 30. ________ 31. ________ 32. ________ 33.

Transcription Translation Type(s) of RNA involved in the process

Location in the cell where the process occurs

The result (what is created)

Test A

! © It’s Not Rocket Science

34. 35. _________________ 36. _________________ 37. _________________ 38. _________________ 39. DNA: A T A T A C T T T G C G A T G G C T A T T C A G A C T

mRNA:

Amino Acids: Cumulative: 40. ________ 41. ________ 42. ________ 43. ________ 44.

Light-dependent reactions

Light-independent reactions

Overall Purpose

Location

Reactant Product

45. Macromolecule

1. 2. 3. 4.

Function

46.

Word Bank:

A. Capture energy B. CO2 C6H12O6 C. H2O O2 D. Make sugar E. Stroma F. Thylakoid

© It’s Not Rocket Science

© It’s Not Rocket Science

NGSS Alignment Overview

A helpful resource for teachers using the Next Generation Science Standards* that shows alignment of the unit to Next Gen standards,

science and engineering practices, and crosscutting concepts.

Document also includes a list of suggested introductory phenomena. Tips for transitioning to NGSS can be found on my

blog here. Tips for using phenomena can be found here.

*Note: NGSS is a registered trademark of Achieve. Neither Achieve nor the lead states andpartners that developed the Next Generation Science Standards were involved in the

production of this product, and do not endorse it

THANK YOU!

LEGAL NOTICEThank you for protecting the hard work that went into this resource. By purchasing this resource, you are agreeing that the contents are licensed to you for your classroom/personal use only as a SINGLE user. In accordance with the Digital Millennium Copyright Act, I retain the copyright and reserve all rights to this product. With the license you purchased:You may:• Use this item for your own classroom,

students, or for your own personal use.• Buy additional licenses for others to use

this product (at a discount) by visitingyour TpT “My Purchases” page.

• Review this product to recommendothers buy it in blog posts, at PDworkshops, or other venues as long ascredit is given to my store with a directlink to my store/product.

You may NOT:• Upload this product to any unsecured

website or server that other teacherscould access for free.

• Give this product to others without thepurchase of an additional license forthem (this includes emailing, printingcopies, or sharing through a website,cloud or other network.)

• Copy or modify any part of thisdocument for others for free or for sale.

CREDITS FOR GRAPHICS AND FONTS

WANT TO SHARE YOUR THOUGHTS?

If you enjoy this resource, PLEASE leave feedback for me! I’d love to hear specifically what you enjoyed and how you used this in your classroom so that I can continue to create resources that are beneficial to you and your students. Your encouragement and feedback mean so much to me!

If you have negative feedback, I would love for you to email me first (itsnotrocketsciencestore@gmail.com) so that I can serve you best on an individual basis to guarantee your satisfaction with my products. I will make any changes to the product you need so you can best use it in your classroom!

Earning TpT credit saves you money on future purchases! You can apply the credits you earn when you check out to a future purchase.

• Log into your Teachers Pay Teachers account. Go to ”MyPurchases.”• Beside each purchase, you'll see a ”ProvideFeedback” button. Simply click it, and you will be taken to apage where you can give a quick rating and leave a shortcomment for the product. This is both helpful for you ANDme! Win win!

I hope you find this resource to be useful to you in your classroom and that your students

enjoy it as well!

WANT TO STAY CONNECTED AND IN THE LOOP? • FOLLOW ME ON TpT: Look for the green star near the top of any page within my TpT store. Clickthe “Follow Me” button to become a follower of my shop. I add new products often so this is thebest way to stay up to date on what is going on at It’s Not Rocket Science!

• FOLLOW ME ON SOCIAL MEDIA: Click the links to the right!

WANT TO SAVE MONEY ON FUTURE PURCHASES?

Thank You!Thank you for previewing this product by © It’s Not Rocket ScienceⓇ! Be

sure to read the Terms of Use on the previous page fully prior to purchasing and using!

Want to see more from © It’s Not Rocket ScienceⓇ? Follow Me on TpT or Join my email list! These are the best ways to be

updated when new products and blog posts get posted!

Supplemental Resources for this unit: 20% off Biology Curriculum Bundle:

Or find other available Biology units below: