Treatment Efﬁcacy and Resistance Mechanisms Using the … · Signal Transduction Treatment...

Signal Transduction

Treatment Efficacy and Resistance MechanismsUsing the Second-Generation ALK InhibitorAP26113 in Human NPM-ALK–Positive AnaplasticLarge Cell LymphomaM. Ceccon1, L. Mologni1, G. Giudici2, R. Piazza1, A. Pirola1, D. Fontana1, andC. Gambacorti-Passerini1,3

Abstract

ALK is a tyrosine kinase receptor involved in a broad range ofsolid and hematologic tumors. Among 70% to 80% of ALKþ

anaplastic large cell lymphomas (ALCL) are caused by theaberrant oncogenic fusion protein NPM-ALK. Crizotinib wasthe first clinically relevant ALK inhibitor, now approved for thetreatment of late-stage and metastatic cases of lung cancer.However, patients frequently develop drug resistance to Crizo-tinib, mainly due to the appearance of point mutations locatedin the ALK kinase domain. Fortunately, other inhibitors areavailable and in clinical trial, suggesting the potential forsecond-line therapies to overcome Crizotinib resistance. Thisstudy focuses on the ongoing phase I/II trial small-moleculetyrosine kinase inhibitor (TKI) AP26113, by Ariad Pharmaceu-ticals, which targets both ALK and EGFR. Two NPM-ALKþ

human cell lines, KARPAS-299 and SUP-M2, were grown inthe presence of increasing concentrations of AP26113, and

eight lines were selected that demonstrated resistance. All linesshow IC50 values higher (130 to 1,000-fold) than the parentalline. Mechanistically, KARPAS-299 populations resistant toAP26113 show NPM-ALK overexpression, whereas SUP-M2–resistant cells harbor several point mutations spanning theentire ALK kinase domain. In particular, amino acid substitu-tions: L1196M, S1206C, the double F1174VþL1198F andL1122VþL1196M mutations were identified. The knowledgeof the possible appearance of new clinically relevant mechan-isms of drug resistance is a useful tool for the management ofnew TKI-resistant cases.

Implications: This work defines reliable ALCL model systems ofAP26113 resistance and provides a valuable tool in the manage-ment of all cases of relapse upon NPM-ALK–targeted therapy.MolCancer Res; 13(4); 775–83. �2014 AACR.

IntroductionThe pharmacologic inhibition of the ALK (anaplastic lym-

phoma kinase) tyrosine kinase has become in the last years anissue of great interest, given its involvement in different malig-nancies and the recent development of several ALK inhibitors.ALK oncogenic role was recognized for the first time in the mid-1990s (1), when the NPM-ALK fusion protein was identified asthe main cause of a particular subset of anaplastic large celllymphoma (ALCL). After that, other oncogenic fusion proteinsinvolving the functional ALK kinase domain have beendescribed in different kinds of both solid and hematologictumors, such as 50% of inflammatory myofibroblastic tumors(IMT; ref. 2), about 5% cases of non–small cell lung cancer

(NSCLC; ref. 3), and at low frequency in other types of tumor,such as rhabdomyosarcoma (RMS; ref. 4), extramedullary plas-macytoma (5), renal cell carcinoma (6), thyroid cancer (7), basalcell carcinoma (8), breast cancer, and colorectal cancer (9, 10).Moreover, aberrant activation or overexpression of full-lengthALK has an oncogenic role in neuroblastoma (11, 12) andglioblastoma multiforme (13, 14). The oncogenic properties ofaberrantly activated ALK are mainly due to the deregulatedactivation of different downstream pathways such as RAS/RAF/MEK/ERK1/2 and PCLg , involved in cellular proliferation,and PI3K/AKT and JAK3/STAT3, that promote cell survival (15–17). The first clinically available drug able to efficiently targetALK was the dual ALK and MET inhibitor Crizotinib, nowapproved for the treatment of late-stage and metastatic ALKþ

NSCLC and in clinical trial for other ALK-related diseases. Thelatest clinical data about ALKþ NSCLC patients treated withCrizotinib reveal an increase ofmedian progression-free survival(PFS) and response rate compared with chemotherapy. Nosignificant advantage in overall survival (OS) was observed;however, Crizotinib-treated patients had a better quality of life(18). Very limited data are available on ALCL patients (19). Thefirst long-term follow-up of ALCL patients who received Crizo-tinib reported, after 2 years, a PFS of 63.7% and an OS of 72.7%,and the drugwas in generalwell tolerated (20).However, despitegreat success, as expected fromprevious experiencewith tyrosinekinase inhibitors (TKI; refs. 21, 22), the first cases of relapse due

1Department of Health Science, University of Milano-Bicocca, Monza,Italy. 2Tettamanti Research Centre, Pediatric Clinic, University ofMilano-Bicocca, Monza, Italy. 3Section of Haematology, San GerardoHospital, Monza, Italy.

Note: Supplementary data for this article are available at Molecular CancerResearch Online (http://mcr.aacrjournals.org/).

Corresponding Author:Monica Ceccon, University of Milano-Bicocca, Via Cadore48, 20900 Monza, Italy. Phone: 39-0264488362; Fax: 39-0264488363; E-mail:[email protected]

doi: 10.1158/1541-7786.MCR-14-0157

�2014 American Association for Cancer Research.

MolecularCancerResearch

www.aacrjournals.org 775

on July 22, 2021. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst November 24, 2014; DOI: 10.1158/1541-7786.MCR-14-0157





http://mcr.aacrjournals.org/



to the positive selection of mutant clones have already beendetected in several Crizotinib-treated NSCLC and ALCL patients(20, 23–26). To effectively overcome Crizotinib resistance, thedevelopment of second-generation ALK inhibitors is exponen-tially growing (27). Currently, several ALK inhibitors are alreadyin clinical trial: the phase II/III ceritinib (LDK-378, Novartis),the phase I/II alectinib (CH5424802, Roche), and the phase IASP3026 (Astellas). In this work, we decided to focus ourattention on the dual ALK/EGFR inhibitor AP26113 because,after Crizotinib, it was the first inhibitor that entered in clinicaltrials. Preclinical data showed that this inhibitor is 10-fold morepotent than Crizotinib and active against the gatekeeper mutantL1196M. In xenograft mouse model, lower AP26113 dosescompared with Crizotinib lead to complete tumor disappear-ance (28). Unfortunately, the chemical structure remains undis-closed. In this article, we selected 8 new human NPM-ALKþ celllines, 4 derived from KARPAS-299 and 4 from SUP-M2, able tolive and proliferate at high AP26113 doses (K299AR300A,K299AR300B, K299AR300C, K299AR300D, SUP-M2AR500A,SUP-M2AR500B, SUP-M2AR500C, and SUP-M2AR500D). ForKARPAS-299–derived cell lines, we observed oncogene over-expression as the main resistance mechanism, whereas in SUP-M2–derived cell lines, we identified several point mutationslocated within the NPM-ALK kinase domain, which couldexplain drug resistance. We also found an L1196M mutationin two of four SUP-M2–derived cell lines, but it had no role inconferring resistance at high drug doses. To find a way toovercome AP26113 resistance, we explored the cross-resistanceof our KARPAS-299–derived cell lines and mutated Ba/F3 NPM-ALK against other clinically relevant ALK inhibitors nowadaysavailable, namely Crizotinib, ceritinib, alectinib, ASP3026.KARPAS-299–derived cell lines are highly resistant to all inhi-bitors tested, whereas all mutants studiedwere targetable with atleast a compound, except S1206C. Collectively, our data predictin a human cell-based model the appearance of differentmechanisms of resistance to AP26113, andwe explored differentways to overcome resistance using a set of clinically relevant ALKinhibitors. This kind of knowledge is a powerful tool to manageclinical cases of Crizotinib and AP26113 relapse.

Materials and MethodsCell lines, inhibitors, and selection of AP26113-resistant celllines

The human NPM-ALKþ KARPAS-299 and SUP-M2 cell linesbearing the t(2;5) translocation and the pro-B murine cell lineBa/F3were purchased fromDSMZ,where they are routinely verifiedusing genotypic and phenotypic testing to confirm their identity.Cell lines were subcultured as previously described (29). AP26113was kindly provided by Ariad Pharmaceutical and added to themedium initially at 20 nmol/L. Medium was replaced with freshRPMI-1640 supplementedwith AP26113 every 48 or 72 hours, andcell number and viabilitywere assessed by TrypanBlue count. Ba/F3cells were maintained in RPMI medium supplemented with 10%FBS and CHO cells supernatant (1:2,000) as a source of IL3. Ba/F3cells were transduced with mutagenized pcDNA3.0-NPM/ALKplasmid (see below) by electroporation, as previously described(29) and selected first with G418 (Euroclone) 2 mg/mL, followedby IL3 withdrawal. Crizotinib was kindly provided by Pfizer,ceritinib (LDK-378) by Novartis, ASP3026 by Astellas, whereasalectinib (CH5424802) was purchased from Selleck Chemicals.

Site-directed mutagenesispcDNA3.0 bearing human WT NPM-ALK (pcDNA3.0 NA) was

kindly provided by Dr. S.W. Morris (St Jude Research Hospital,Memphis, TN). Site-directed mutagenesis on pcDNA3-NA wasperformed using the QuikChange II XL Site-DirectedMutagenesisKit (Stratagene), according to the manufacturer's instructions.Primers used for mutagenesis were as follows: NPM-ALK L1122VFW: 50-ATCACCCTCATTCGGGGTGTGGGCCATGGCGC-30; NPM-ALK S1206C FW: 30-GAGACCTCAAGTGCTTCCTCCGAGAGA-CCCGCC-50; NPM-ALK L1196M FW: 50-CTGCCCCGGTTCATCCT-GATGGAGCTCATGGCG-30; NPM-ALK F1174V FW: 30-GAA-GCCCTGATCATCAGCAAAGTCAACCACCAGAACATTG-50; NPM-ALK L1198F FW: 30-GTTCATCCTGCTGGAGTTCATGGCGGGGG-GAGAC-50. Reverse primers are reverse complementsof FWprimers.Sequence numbering is related to GenBank ID NM004304.

FISHInterphase FISH was performed using ALK Dual Color Break

Apart Rearrangement Probe (Cytocell). This probe consists of agreen 420-kb probe, which spans the majority of the ALK geneand a red 486-kb probe, which is telomeric to the ALK gene.Slides were prepared following standard cytogenetic procedures.Codenaturation/hybridization of the specimen slides and probeswere performed at 72�C for 2 minutes and at 37�C overnight,followed by washing in saline-sodium citrate (SSC) buffer pH 5.3(Vysis/ABBOTMolecular -Abbott Laboratories. Abbott Park, Illi-nois,U.S.A.) and counter stainingwith anti-fade solution contain-ing DAPI.

PCR, quantitative RT-PCR, and sequencingAn NPM-ALK fragment encompassing the breakpoint and

comprising the whole kinase domainwas amplified by PCR usinghigh-fidelity Taq polymerase (Roche), according to instructions.Primers used were FW: 50-TGCATATTAGTGGACAGCAC-30; REV:50-CTGTAAACCAGGAGCCGTAC-30. PCR products were sent toEurofins MWG Operon for sequencing. Quantitative real-timePCR (qRT-PCR) was performed as previously described (29).Housekeeping genes used for normalization were murine HPRTFW: 50–TCAGTCAACGGGGGACATAAA-30; REV: 50-GGGGC-TGTACTGCTTAACCAG-30 or human GAPDH FW: 50-Tgcaccac-cacctgcttagc-30; REV: 50–GGCATGGACTGTGGTCATGAG–30.Deep sequencing was performed as previously described (20).

Exome sequencingExome libraries were generated from 1 mg of genomic DNA

extracted with a PureLink Genomic DNA kit (Life Technology).Genomic DNA was fragmented to a size of 200 to 500 bp andprocessed according to the standard protocol for the IlluminaTruSeqDNASample Preparation Kit. Genomic libraries were thenenriched with the Illumina TruSeq Exome Enrichment Kit. Librar-ies were sequenced on an Illumina Genome Analyzer IIx with 76-bp paired-end reads using Illumina TruSeq SBS kit v5.

BioinformaticsImage processing and base calling were performed using the

Illumina Real Time Analysis Software RTA v1.9.35 or newer. Qseqfiles were deindexed and converted to the Sanger FastQ file formatusing in-house scripts. FastQ sequences were aligned to thehuman genome database (NCBI Build 36/hg18) using the Bur-rows-Wheeler NGS short-reads aligner tool. The alignmentfiles (SAM format) were processed with SAMtools (30): they

Ceccon et al.

Mol Cancer Res; 13(4) April 2014 Molecular Cancer Research776




were initially filtered by proper pair, then converted into thebinary BAM alignment format, sorted, and indexed. Removal ofduplicates was performed using the SAMtools rmdup command.Unique BAM files were then converted into the mPileup format.mPileup data generated from paired cancer and control sampleswere cross-matched using a dedicated in-house software tool.Copy number and allelic imbalance/loss of heterozygosity anal-yses from whole-exome data were performed using CEQer (31).

Western blotting and antibodiesCells were seeded in complete medium in 12-well plate, and

compounds were added at different concentrations. After 4 hours,cells were harvested, washed once in PBS at 4�C, and resuspendedin Laemmli buffer 1� supplemented with 10% b-mercaptoetha-nol (100 mL/106 cells) and denatured at 97�C for 20 minutesbefore electrophoresis. Equal volumes were loaded on 10% SDS-PAGE, transferred to nitrocellulose membrane Hybond ECL(Amersham), and incubated overnight at 4�C with primary anti-body (1:1,000 dilution in BSA 2.5%). Secondary horseradishperoxidase–conjugated anti-mouse or anti-rabbit antibodies(Amersham) were incubated for 1 to 2 hours and then visualizedby chemiluminescence as recommended by the manufacturer.Monoclonal anti–phospho-ALK (Y-1604), monoclonal anti-ALK(31F12), and monoclonal anti–phospho-STAT3 (Tyr 705) anti-bodies were from Cell Signaling Technology. Anti-ACTIN anti-body was purchased from Sigma; polyclonal anti-STAT3 is fromCalbiochem.

Proliferation assayFive thousand cells per well were seeded in 96-well plates in the

presence of serial dilutions (1:2 or 1:3) of each compound,starting from a concentration of 10 mmol/L or 1 mmol/L, basedon drug potency and specific cell line sensitivity. Incubation withradioactive-labeled thymidine and radioactivity detection wasperformed as previously described (29).

Software and statistical analysisDose–response curves were analyzed using GraphPad Prism 5

software. IC50 indicates the concentration of inhibitor that giveshalf-maximal inhibition. Densitometry values are calculated asfollows: total ALK level for each well is normalized on its ownloading control (ALK/ACTIN). Values are the average of at leastthree independent wells. P-ALK value is normalized both on theuntreated sample and on the total ALK level: (P-ALK treated/P-ALK untreated) divided by (ALK treated/ALK untreated). Rela-tive resistance (RR) index was calculated as the ratio betweenmutant and WT IC50 values (32). qPCR data were analyzed usingthe DDCt method, normalized on the proper housekeeping gene.ALK kinase domain was drawn using PDB viewer software (PDBcode:3LCS).

ResultsEstablishment and characterization of human AP26113-resistant cell lines

To obtain a reliable resistance model, we grew two differenthuman NPM-ALK–positive cell lines, KARPAS-299 and SUP-M2,in the presence of increasing AP26113 doses (29). We dividedeach cell line into four different flasks, assuming that a stochasticselection would occur in each independent population. Cellselection was started at a drug concentration close to the IC90

value, calculated with a preliminary proliferation assay as 13nmol/L for KARPAS-299 and 19.4 nmol/L for SUP-M2. Each cellline was challenged with five or six sequential drug doses (Sup-plementary Fig. S1). An independent cell line was establishedbefore each step increase of drug concentration. This process wasstopped at 300 nmol/L AP26113 for KARPAS-299 and 500nmol/Lfor SUP-M2 cells, based on the comparison between IC50 valuesfor resistant and parental cells. In our experience, for a highly drug-resistant population, an IC50 increase of at least 10-fold comparedwith parental cells was expected. In fact, all AP26113-resistantcell lines showed a RR index higher than 100 (Table 1). Amongall cell lines established, we decided to focus our attention onthe highest AP26113 dose–resistant populations, referred toas K299AR300A, K299AR300B, K299AR300C, K299AR300D(AP26113-resistant at 300 nmol/L) and SUP-M2AR500A, SUP-M2AR500B, SUP-M2AR500C, SUP-M2AR500D (AP26113-resis-tant at 500 nmol/L). For each cell line, NPM-ALK expression andactivation were assessed by Western blot (Fig. 1; SupplementaryFig. S7A) using specific antibodies for total ALK and phosphory-lated ALK (Tyr 1604). Although in parental cells 100 nmol/LAP26113 completely abrogates ALK activation, in all resistantpopulations, Tyr 1604 phosphorylation is still detectable at 100or even 300 nmol/L, indicating that drug resistance is due to amechanism that directly impairs ALK inactivation.

Identification of resistance mechanismWestern blot analysis revealed an increase in NPM-ALK expres-

sion, quantified by densitometry as 9.4� 2.1, 6.0� 1.3, 7.1� 1.8,and 6.5� 0.5-fold comparedwith parental cells for K299AR300A,K299AR300B, K299AR300C, andK299AR300D cells, respectively(Supplementary Fig. S2). Notably, in the first three cell lines (A, B,and C), the basal phospho-ALK signal was higher than in parentalcells (Fig. 1A). This hyperactivation could be simply due to theincreased NPM-ALK expression rather than to an intrinsic NPM-ALK hyperactivation, as highlighted in Supplementary Fig. S2. Tofurther confirm that in AP26113-resistant cell lines, NPM-ALKtargeting was ineffective, the phosphorylation status in Tyr705 ofthe NPM-ALK downstream effector STAT-3 was also assessed. Inall AP26113-resistant KARPAS-derived cell lines, STAT-3P-Tyr705was present at higher drug doses than the one observed forparental cells and correlated with the persistent NPM-ALK phos-phorylation (Fig. 1A). qRT-PCR confirmed that oncogene over-expression was present also at transcriptional level, because a23.7-, 16-, 25.5-, and 5.1-fold increase ofNPM-ALK transcript wasdetected in K299AR300A, B, C, and D, respectively, comparedwith parental (Fig. 2A; Table 2). Values are obtained uponnormalization on the proper housekeeping gene. Of note, proteinand mRNA levels correlated. Moreover, a FISH experiment

Table 1. IC50 values obtained for AP26113-resistant KARPAS-derived cell linesand SUP-M2–derived cell lines

Cell line IC50 (mmol/L) RR index

K299 0.001 1K299AR300 A 0.1799 179.9K299AR300 B 0.2015 201.5K299AR300 C 0.1324 132.4K299AR300 D 0.1804 180.4SUPM2 0.004 1SUP-M2AR500 A 0.9984 249.6SUP-M2AR500 B 0.9068 226.7SUP-M2AR500 C 0.4491 112.275SUP-M2AR500 D 0.4071 101.775

AP26113 Resistance in Human NPM-ALKþ Cell Lines

www.aacrjournals.org Mol Cancer Res; 13(4) April 2014 777




revealed that the increase in NPM-ALK overexpression is due togene amplification (Fig. 2B). Because the IC50 value observed forall resistant cell lines is extremely high, we explored the presenceof low-frequency point mutations in ALK kinase domain as anadditional resistance mechanism by deep sequencing. The resultsexcluded this hypothesis (data not shown).NPM-ALKoverexpres-sion in K299AR300D was less evident than in the other cell lines.Moreover, the band corresponding to P-Tyr1604 ALK disappearsat 300 nmol/L, suggesting low molecular resistance to AP26113,despite the fact that STAT-3 phosphorylation remains also at highdrugdoses and the cells RR indexwas 180.Whole-exome sequenc-ing and copy-number analysis of this cell line highlighted that the

increase in ALK expression was due toNPM-ALK amplification. Inaddition, some huge copy-number alterations were present. Alsomissense mutations were detected, but none of them involvedproteins clearly related to tumorigenesis or drug resistance (Sup-plementary Fig. S3).

Also in SUP-M2–derived resistant cells, we could observe agreat increase in IC50 value compared with SUP-M2 parental cellline, and, as expected, this corresponded to a persistent P-Tyr1604

Figure 1.Human cell lines characterization. Parental or resistant KARPAS-299 (A) orSUP-M2 (B) cell lines were incubated for 4 hours in the presence of increasingAP26113 concentrations: 0, 100, 300, and 1000 nmol/L. P-ALK (Tyr1604),ALK, P-STAT3 (Tyr705), STAT3, and bACTIN expression levels were assessedby Western blot.

Figure 2.Mechanism of AP26113 resistance in KARPAS and SUP-M2 cell lines. A, NPM-ALK expression at transcriptional level in KARPAS and SUP-M2 cells grownrespectively at AP26113 concentration of 300 and 500 nmol/L wereinvestigated by quantitative real-time PCR. B, gene amplification is shown byFISH analysis. C, chromatograms related to all mutations found in AP26113-resistant SUP-M2–derived cell lines are shown and compared with theparental SUP-M2 cells.

Ceccon et al.





ALK signal (Fig. 1; Supplementary Fig. S7A). No increase in totalALK or in basal ALK phosphorylation was evident in SUP-M2–derived cell lines (Table 2; Figs. 1B and 2A). We speculated thatSUP-M2 resistance could be due to the positive selection of pointmutations in the NPM-ALK kinase domain, so a fragment com-prising the whole kinase domain from total RNA was amplifiedafter retrotranscription and analyzed by direct sequencing. Inall resistant SUP-M2–derived cell lines, we found at least onepoint mutation as a possible resistance mechanism (Table3; Fig. 2C). Moreover, STAT-3 was still phosphorylated at thehighest AP26113 dose (Fig. 1B), confirming an aberrant upregu-lation of NPM-ALK–driven signaling. To confirm the role of thesepoint mutations in resistance to AP26113, all of them wereintroduced into the pro-B murine Ba/F3 cell line expressinghuman NPM-ALK model (Supplementary Fig. S4). The AP26113IC50 value was also calculated for the Ba/F3 cell line together withthe assessment of NPM-ALK P-Tyr1604 and STAT3 P-Tyr 705phosphorylation status in the presence of increasing drug doses(Tables 4 and 5; Fig. 3; Supplementary Fig. S7B). All mutants,except L1196M, showed intermediate to high resistance toAP26113, paralleled by persistent NPM-ALK phosphorylation.These data confirmed an effective role for these mutations inAP26113 resistance, except for the gatekeeper substitutionL1196M. Clonal sequencing of SUP-M2AR500A showed thesimultaneous presence of two mutations: F1174V and L1198F(Table 6), whereas in SUP-M2AR500B cell line revealed thesimultaneous presence of L1196M and at least another substitu-tion, mainly L1122V, found in 80% of clones analyzed, but alsoD1203N (6.7%; Tables 7). Notably, F1174V alone was unable toconfer AP26113 resistance, whereas the double-mutantF1174VþL1198F was highly resistant to the same compound.Similarly, L1122V alone was sufficient to induce AP26113 resis-tance (Table 4 and 5), thus supporting the idea that this was theeffective driver mutation, as well as the L1198F for the previousdouble mutant. Moreover, we could not select, after two experi-

ments, a Ba/F3 cell line expressing the single NPM-ALK D1203Nable to survive in the absence of IL3. Moreover, the doubleL1196MþD1203N mutant is highly AP26113 resistant, so it ispossible that both mutations are required for an advantageousselection and drug resistance.We detected also the presence of theP1139S mutation in one clone of 15, but it is not able to conferhigh AP26113 resistance (IC50¼ 0.015 mmol/L; RR index¼ 2.14).Interestingly, F1174V and L1198F mutations were not able toinduce resistance to AP26113 singularly, but their cooperationwas necessary.

Cross-resistance to other ALK inhibitorsTo explore a possible way to overcome AP26113 resistance,

we tested the sensitivity of KARPAS-derived cell lines andmutated NPM-ALK–expressing Ba/F3 cells to other clinicallyrelevant ALK inhibitors: Crizotinib, ceritinib, alectinib, andASP3026. As expected, all KARPAS-299–derived cell lines arehighly resistant to all inhibitors, according to the proliferationassay (Tables 8 and 9). These data are consistent with theobservation that in K299AR300A, B, and C cell lines, a generalmechanism of drug resistance, oncogene amplification, hasbeen selected.

We also challenged Ba/F3 NPM-ALKWT andmutated cell lineswith all the ALK inhibitors (Tables 4 and 5). Cells carrying theNPM-ALK L1122V mutation are moderately resistant to Crizoti-nib and resistant to alectinib, ceritinib, and ASP3026 (RR indexis 2.6, 5.3, 9.1, and 4.9, respectively); our data about the gate-keeper-mutant L1196M suggest a moderate resistance toAP26113, Crizotinib, and alectinib (RR ¼ 2.1, 3.4, and 2.9),confirming our previous data (29), resistance against ASP3026and sensitivity to ceritinib. Combination of L1122V with theL1196M substitution increases the resistance values of all drugs,especially of AP26113, thus giving an impressive advantage upontreatment with all compounds that directly inhibit the target. Ba/F3 NPM-ALK bearing the S1206C substitution are resistant tocrizotinib, alectinib, and ceritinib (RR ¼ 4.3, 5.7, and 4.1) andhighly resistant to ASP3026. The double F1174VþL1198Fmutantis resistant to all drugs except crizotinib, with an RR index of 12.2and 10 for AP26113 and ceritinib and 9.0 and 5.8 for alectiniband ASP3026, respectively. Interestingly, the single F1174Vmuta-tion is completely sensitive to all drugs, AP26113 included, but

Table 2. Values obtained for NPM-ALK expression by QRT-PCR, in terms ofabsolute number and fold change compared with parental cells

Cell line mRNA expression value Normalization

K299 0.0222 1.0KAR300A 0.5261 23.7KAR300B 0.3546 16.0KAR300C 0.5653 25.5KAR300D 0.1129 5.1SUPM2 0.0134 1.0SUP-M2AR500A 0.0182 1.4SUP-M2AR500B 0.0314 2.3SUP-M2AR500C 0.0405 3.0SUP-M2AR500D 0.0368 2.7

Table 3. Mutations reported by direct sequencing

Cell line Mutation Substitution

SUP-M2AR500A 4472T>Gþ4544C>T F1174VþL1198FSUP-M2AR500B 4316C>Gþ4538C>A L1122VþL1196MSUP-M2AR500C 4538C>A L1196MSUP-M2AR500D 4569C>G S1206C

Table 4. IC50 values obtained by proliferation assay for each Ba/F3 NPM-ALK WT or mutagenized cell line are summarized

IC50 (mmol/L) AP26113 CRIZOTINIB CH5424802 LDK-378 ASP3026

WT 0.01165 0.1243 0.02911 0.0433 0.07159L1122V 0.09735 0.3229 0.1548 0.3933 0.3493P1139S 0.01798 0.1315 0.01881 0.1494 0.1333F1174V 0.01787 0.1182 0.1082 0.04105 0.2831L1196M 0.02491 0.4224 0.08548 0.04576 0.3552L1198F 0.06797 0.01249 0.3503 0.9623 0.3849S1206C 0.166 0.5337 0.1645 0.1785 1.227L1122VþL1196M 0.7582 0.945 0.5955 0.3762 1.85F1174VþL1198F 0.1421 0.005771 0.2628 0.4325 0.4161L1196MþD1203N 0.3863 0.7426 0.1226 0.1292 0.1187






resistant to alectinib and ASP3026, whereas the single L1198F isper se resistant to all drugs except Crizotinib. Together, these twomutations cooperate in conferring higher resistance to AP26113.Moreover, we explored the cross-resistance of other two muta-tions found at lower frequencies in SUP-M2AR500B cell line,namely P1139S and D1203N. Although P1139S mutant is sen-sitive to all drugs except ceritinib (RR index ¼ 3.5), we could notestablish an IL3-independent Ba/F3 cell line carrying the singleD1203N substitution. On the other hand, the double L1196M þD1203Nmutant is highly resistant toAP26113 (RR index¼33.2),confirming that the latter may be the driver mutation for thiscompound. Cell proliferation data are confirmed byWestern blotanalysis (Supplementary Fig. S5).

In conclusion, according to these data, we can foresee that foreachmutation, alone or in combination, except S1206C, there is aclinically available ALK inhibitor able to overcome acquiredresistance to AP26113.

DiscussionIn the last 4 years, the management of ALK-related diseases has

successfully changed, thanks to the availability of a new ALKinhibitor, Crizotinib. However, as expected, the problem arisingfrom drug resistance soon became reality, in fact several patientsrelapsed after Crizotinib treatment,mainly because of the positiveselection of point mutations. So, other different ALK inhibitorswere developed with the purpose of overcoming Crizotinibresistance. The first second-generation ALK inhibitor wasAP26113, a dual ALK and EGFR inhibitor by Ariad Pharmaceu-tical. In this work, we took advantage of a reliable cellular model,based on human NPM-ALKþ cell lines, to predict the possibleresistance mechanism to AP26113. We could establish eightAP26113-resistant cell lines, 4 derived by KARPAS and 4 fromSUP-M2 cell lines (Supplementary Fig. S1). All cell lines were lesssensitive to drug targeting than the parental one (Fig. 1; Table 1;Supplementary Fig. S7A), although for K299AR300D this obser-vation was less evident. KARPAS-derived cell lines A, B, and Cclearly showed oncogene amplification as the main cause ofresistance (Fig. 2A);moreover, we could exclude by deep sequenc-ing of the NPM-ALK fragment comprising the whole ALKkinase domain the presence of point mutations as an additionalmechanism. NPM-ALK overexpression was less evident inK299AR300D cells, both at protein and at transcriptional levels,and is clearly due to NPM-ALK amplification. The presence ofcopy-number alterations spread throughout all the genome mayexplain the drug resistance. However, further studies will benecessary to clarify this issue (Supplementary Fig. S3). For all

KARPAS-derived cell lines, we could not detect any point muta-tion in NPM-ALK kinase domain. On the other hand, in SUP-M2cell lines, we detected the presence of point mutations in theNPM-ALK kinase domain that could explain AP26113 resistance:L1122VþL1196M, L1196M, F1174VþL1198F, S1206C. Clonalsequencing of SUP-M2AR500B revealed the presence of otherpoint mutations at lower frequency, namely P1139S and thedouble L1196MþD1203N (Table 7).We introduced in the broad-ly used murine pro-B cell line Ba/F3 all these mutations, and

Table 5. RR index corresponding to each IC50 value is reported

AP26113 CRIZOTINIB CH5424802 LDK-378 ASP3026

WT 1 1 1 1 1L1122V 8.4 2.6 5.3 9.1 4.9P1139S 1.5 1.1 0.6 3.5 1.9F1174V 1.5 1.0 3.7 0.9 4.0L1196M 2.1 3.4 2.9 1.1 5.0L1198F 5.8 0.1 12.0 22.2 5.4S1206C 14.2 4.3 5.7 4.1 17.1L1122VþL1196M 65.1 7.6 20.5 8.7 25.8F1174VþL1198F 12.2 0.0 9.0 10.0 5.8L1196MþD1203N 33.2 6.0 4.2 3.0 1.7

NOTE: Green: RR < 2; yellow: RR¼ 2.1–4; orange: RR¼ 4.1–10; red: RR > 10. Dataare the average from at least 2 independent experiments.

Figure 3.NPM-ALK targeting by AP26113 in Ba/F3-mutant cell lines. All cell lines wereincubated for 4 hours in the presence of increasing doses of the compound,then ALK P-Tyr 1604, total ALK, STAT3 P-Tyr705, and total STAT3 level areassessed by Western blot. b-Actin was used as loading control.

Table 6. Clonal sequencing of SUPM2AR500A

SUP-M2AR500AClone Mutations Substitutions

#1 4472 T>G 4544 C>T F1174VþL1198F#2 4472 T>G 4544 C>T F1174VþL1198F#3 4472 T>G 4544 C>T F1174VþL1198F#4 4472 T>G 4544 C>T F1174VþL1198F#5 4472 T>G 4544 C>T F1174VþL1198F

NOTE: For each clone, the mutations and consequent aminoacidic substitutionsare reported.

Ceccon et al.





further confirmed their effective role in drug resistance. Unfortu-nately, AP26113 structure is not available, so we could notperform any molecular modeling analysis. Residue L1122 islocated at the P-loop and extends into the drug binding pocket(Supplementary Fig. S6). To our knowledge, mutations involvingthis residue have never been observed thus far, neither for Cri-zotinib nor for AP26113 resistance. It is interesting to note thatL1122 corresponds to Abl L248,whose substitutionwith valine orwith arginine causes resistance to several TKIs (33). The gatekeeperL1196Mwas one of the first causes of Crizotinib resistance foundin patients. A moderate AP26113 resistance was predicted in vitro(29, 34, 35); however, the IC50 value is low enough to considerthis mutation sensitive to AP26113. Because in SUP-M2AR500Bcells both L1122V and L1196M were found, we hypothesize thatthe first is the mutation driving resistance, while the latter wasselected at low doses and never counterselected, remaining as apassenger in the high-dose–resistant clone. Topo-cloning per-formed on SUPM2AR500B cell line supported this hypothesis,in fact both mutations are simultaneously present in 12 of 15clones (80%); moreover, where L1122V is not detected, theD1203N is present (13% of cases), highlighting the weakness ofL1196M in conferring AP26113 resistance (Table 7). The fact thatwe could not establish an IL3-independent Ba/F3 NPM-ALKD1203N cell line means that this mutation alone is disadvanta-geous. However, the double L1196MþD1203N mutant was notonly able to grow upon IL3 withdrawal but also showed highAP26113 resistance, thus highlighting the fact that a cooperationbetween the two single mutations is favorable for drug resistance.Curiously, the double mutant is targetable by ASP3026, whereasthe single L1196M is not, but it is moderately resistant or resistantto all other inhibitors. P1139S alone, unique in SUP-M2AR300Bclone #9, is sensitive to AP26113 (RR index ¼ 1.8); thus, we canspeculate that, in this clone, other unknown mechanisms maycooperate in its positive selection. F1174 is located at the end of

the aC helix (Supplementary Fig. S6) and lies in a hydrophobiccluster composed by F1098, F1271, and F1245.Mutations involv-ing F1174 were recognized as activating in neuroblastoma andphenylalanine substitution with a leucine was found in an IMTpatient that relapsed after Crizotinib treatment (24). Clonescarrying cysteine, valine, or isoleucine in residue 1174 insteadof phenylalanine were selected at AP26113 100 nmol/L and 200nmol/L in a previous Ba/F3 screen (34). In our screening, Ba/F3cells bearing the single mutation are completely sensitive to alldrugs studied, including AP26113. L1198F alone in our Ba/F3cells was sufficient to confer resistance to AP26113, alectinib,ceritinib, and ASP3026; however, it was completely sensitive toCrizotinib. A methionine substitution in this position was pre-dicted to confer resistance at AP26113 at 100 nmol/L (34),whereas a proline was predicted to confer crizotinib resistancein an in vitro screening (36). This residue corresponds to the AblF317, a site that, if mutated, induces resistance to several TKIs.Notably, in our model, L1198F and F1174V cooperate in confer-ring resistance against AP26113. Finally, S1206 is located into theaD helix. A tyrosine substitution was found in an NSCLC patientthat relapsed after Crizotinib treatment, whereas substitutionswith an arginine, an isoleucine, or a glycine were predicted in vitroas resistant to AP26113. Notably, the S1206C was the onlymutation detected at AP26113 500 nmol/L, indicating that thisresidue has a key role in conferring high AP26113 resistance (34).All data obtained by 3H thymidine incorporation test were val-idated byWestern blot (Figs. 1 and 3), evaluating both NPM-ALKactivation by phosphorylation status of its tyrosine 1605 and itsdownstream target STAT3 phosphorylation in Tyrosine 705. Thepattern of STAT3 phosphorylation recapitulates the one found forNPM-ALK;moreover, in some cases it appears even stronger, likelybecause NPM-ALK–driven signaling is amplified while trans-duced. Targeting the molecular chaperon HSP90 has been pro-posed as an alternative way to hit NPM-ALK and overcome TKI'sresistance, because NPM-ALK is a well-known HSP90 client. Forthis reason, we tested all our NPM-ALK–overexpressing KARPAS-derived cell lines and Ba/F3 cells bearing all single and doublemutations against the HSP90 inhibitor 17-AAG (SupplementaryTable S1). AP26113-resistant KARPAS cells seemed to be moresensitive to 17-AAG than to other TKIs, whereas all mutationsexcept the S1206C were sensitive to the inhibitor, and this couldbe due to the vast heterogeneity of HSP90 clients, because othermolecules impaired by HSP90 inhibition may cooperate in cellsurvival and proliferation. Overall, our cross-resistance experi-ments revealed that, except for S1206C, all point mutationsdetected may be targeted simply switching to another inhibitor,already available in clinic. In the light of these data, we couldspeculate that most of the efforts should be directed in finding anew inhibitor, able to target mutations involving the S1206residue. This knowledge, together with all data nowadays avail-able on Crizotinib resistance, is a useful tool to manage cases of

Table 9. RR index corresponding to each IC50 value is reported

CRIZOTINIB CH5424802 LDK-378 ASP3026

K299 1 1 1 1K299AR300A >10 >10 >10 >10K299AR300B >10 >10 >10 >10K299AR300C >10 >10 >10 >10K299AR300D >10 >10 >10 >10NOTE: Green: RR < 2; yellow: RR ¼ 2.1–4; orange: RR ¼ 4.1–10; red: RR > 10.

Table 7. Clonal sequencing of SUPM2AR500B

SUP-M2AR500BClone Mutations Substitutions

#1 4316C>G 4538C>A L1122VþL1196M#2 4316C>G 4538C>A 4575T>C L1122VþL1196MþL1208P#3 4316C>G 4538C>A L1122VþL1196M#4 4316C>G 4538C>A L1122VþL1196M#5 4316C>G 4538C>A L1122VþL1196M#6 4316C>G 4538C>A L1122VþL1196M#7 4316C>G 4538C>A 4556G>A L1122VþL1196MþG1202R#8 4316C>G 4538C>A L1122VþL1196M#9 4367C>T P1139S#10 4316C>G 4538C>A L1122VþL1196M#11 4316C>G 4538C>A L1122VþL1196M#12 4316C>G 4538C>A L1122VþL1196M#13 4559G>A 4538C>A L1196MþD1203N#14 4316C>G 4538C>A L1122VþL1196M#15 4559G>A 4538C>A 4593G>A L1196MþD1203NþR1214H

Table 8. IC50 values obtained by proliferation assay for each AP26113-resistantKARPAS-299–derived cell line are summarized

IC50 (mmol/L) CRIZOTINIB CH5424802 LDK-378 ASP3026

K299 0.02179 0.00002644 0.00949 0.03651K299AR300A >1 0.01548 >1 >1K299AR300B >1 0.02255 >1 >1K299AR300C >1 0.04739 0.1114 >1K299AR300D 0.9646 0.3232 1.106 >1






AP26113 resistance, both for the oncologist and for the drugdesigner.

Disclosure of Potential Conflicts of InterestProfessor C. Gambacorti-Passerini is principal investigator of the trial

A8081013 sponsored by Pfizer. No potential conflicts of interest were disclosedby the other authors.

Authors' ContributionsConception and design: M. Ceccon, L. Mologni, C. Gambacorti-PasseriniAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): M. Ceccon, A. Pirola, D. FontanaAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): M. Ceccon, L. Mologni, R. Piazza, C. Gambacorti-PasseriniWriting, review, and/or revision of the manuscript: M. Ceccon, L. Mologni,C. Gambacorti-Passerini

Administrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): G. GiudiciStudy supervision: M. Ceccon

AcknowledgmentsThe authors thank Ariad Pharmaceutical, Pfizer, Astellas, and Novartis that

kindly provided all drugs used for this work.

Grant SupportThis work was supported by the Lombardy Region (ID14546A).The costs of publication of this article were defrayed in part by the

payment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received March 21, 2014; revised October 3, 2014; accepted November 12,2014; published OnlineFirst November 24, 2014.

References1. Morris SW, Kirstein MN, Valentine MB, Dittmer KG, Shapiro DN, Saltman

DL, et al. Fusion of a kinase gene, ALK, to a nucleolar protein gene, NPM, innon-Hodgkin's lymphoma. Science 1994;263:1281–4.

2. CoffinCM, Patel A, Perkins S, Elenitoba-JohnsonKS, PerlmanE,GriffinCA.ALK1 and p80 expression and chromosomal rearrangements involving2p23 in inflammatory myofibroblastic tumor. Mod Pathol 2001;14:569–76.

3. Soda M, Choi YL, Enomoto M, Takada S, Yamashita Y, Ishikawa S, et al.Identification of the transforming EML4-ALK fusion gene in non-small-celllung cancer. Nature 2007;448:561–6.

4. van Gaal JC, Flucke UE, Roeffen MH, de Bont ES, Sleijfer S, Mavinkurve-Groothuis AM, et al. Anaplastic lymphoma kinase aberrations in rhabdo-myosarcoma: clinical and prognostic implications. J Clin Oncol 2012;30:308–15.

5. Wang WY, Gu L, Liu WP, Li GD, Liu HJ, Ma ZG. ALK-positive extrame-dullary plasmacytoma with expression of the CLTC-ALK fusion transcript.Pathol Res Pract 2011;207:587–91.

6. Debelenko LV, Raimondi SC,DawN, Shivakumar BR,HuangD,NelsonM,et al. Renal cell carcinoma with novel VCL-ALK fusion: new representativeof ALK-associated tumor spectrum. Mod Pathol 2011;24:430–42.

7. Murugan AK, Xing M. Anaplastic thyroid cancers harbor novel oncogenicmutations of the ALK gene. Cancer Res 2011;71:4403–11.

8. Ning H, Mitsui H, Wang CQ, Suarez-Farinas M, Gonzalez J, Shah KR, et al.Identification of anaplastic lymphoma kinase as a potential therapeutictarget in Basal Cell Carcinoma. Oncotarget 2013;4:2237–48.

9. Lin E, Li L,GuanY, SorianoR, Rivers CS,Mohan S, et al. Exon array profilingdetects EML4-ALK fusion in breast, colorectal, and non-small cell lungcancers. Mol Cancer Res 2009;7:1466–76.

10. Lipson D, Capelletti M, Yelensky R, Otto G, Parker A, Jarosz M, et al.Identification of new ALK and RET gene fusions from colorectal and lungcancer biopsies. Nat Med 2012;18:382–4.

11. Mosse YP, Laudenslager M, Longo L, Cole KA, Wood A, Attiyeh EF, et al.Identification of ALK as a major familial neuroblastoma predispositiongene. Nature 2008;455:930–5.

12. Azarova AM, Gautam G, George RE. Emerging importance of ALK inneuroblastoma. Semin Cancer Biol 2011;21:267–75.

13. Powers C, Aigner A, Stoica GE, McDonnell K, Wellstein A. Pleiotrophinsignaling through anaplastic lymphoma kinase is rate-limiting for glio-blastoma growth. J Biol Chem 2002;277:14153–8.

14. Hudson L, Kulig K, Young D, McLendon R, Abernethy A. Abstract "A42:ALK and cMET expression in glioblastoma multiforme: Implications fortherapeutic targeting." Abstracts: AACR-NCI-EORTC International Con-ference: Molecular Targets and Cancer Therapeutics—Nov 12–16, 2011;San Francisco, CA.

15. Roskoski R Jr. Anaplastic lymphoma kinase (ALK): structure, oncogenicactivation, and pharmacological inhibition. Pharmacol Res 2013;68:68–94.

16. Chiarle R, Simmons WJ, Cai H, Dhall G, Zamo A, Raz R, et al. Stat3 isrequired for ALK-mediated lymphomagenesis and provides a possibletherapeutic target. Nat Med 2005;11:623–9.

17. Chiarle R, Voena C, Ambrogio C, Piva R, Inghirami G. The anaplasticlymphoma kinase in the pathogenesis of cancer. Nat Rev Cancer 2008;8:11–23.

18. Shaw AT, Kim DW, Nakagawa K, Seto T, Crino L, Ahn MJ, et al. Crizotinibversus chemotherapy in advanced ALK-positive lung cancer. N Engl J Med2013;368:2385–94.

19. Gambacorti-Passerini C, Messa C, Pogliani EM. Crizotinib in anaplasticlarge-cell lymphoma. N Engl J Med 2011;364:775–6.

20. Gambacorti Passerini C, Farina F, Stasia A, Redaelli S, Ceccon M,Mologni L, et al. Crizotinib in advanced, chemoresistant anaplasticlymphoma kinase-positive lymphoma patients. J Natl Cancer Inst2014;106:djt378.

21. Deininger MW, Holyoake TL. Can we afford to let sleeping dogs lie? Blood2005;105:1840–1.

22. Gambacorti-Passerini CB, Gunby RH, Piazza R, Galietta A, Rostagno R,Scapozza L. Molecular mechanisms of resistance to imatinib in Philadel-phia-chromosome-positive leukaemias. Lancet Oncol 2003;4:75–85.

23. Choi YL, Soda M, Yamashita Y, Ueno T, Takashima J, Nakajima T, et al.EML4-ALK mutations in lung cancer that confer resistance to ALK inhibi-tors. N Engl J Med 2010;363:1734–9.

24. Sasaki T, Okuda K, Zheng W, Butrynski J, Capelletti M, Wang L, et al. Theneuroblastoma-associated F1174L ALK mutation causes resistance to anALK kinase inhibitor in ALK-translocated cancers. Cancer Res 2010;70:10038–43.

25. Doebele RC, Pilling AB, Aisner DL, Kutateladze TG, Le AT, WeickhardtAJ, et al. Mechanisms of resistance to crizotinib in patients with ALKgene rearranged non-small cell lung cancer. Clin Cancer Res2012;18:1472–82.

26. Katayama R, Shaw AT, Khan TM,Mino-KenudsonM, Solomon BJ, HalmosB, et al. Mechanisms of acquired crizotinib resistance in ALK-rearrangedlung Cancers. Sci Transl Med 2012;4:120ra17.

27. Mologni L. Inhibitors of the anaplastic lymphoma kinase. Expert OpinInvestig Drugs 2012;21:985–94.

28. Rivera VM, Anjum R, Wang F, Zhang S, Keats J, Ning Y, et al. Efficacy andpharmacodynamic analysis of AP26113, a potent and selective orally activeinhibitor of Anaplastic Lymphoma Kinase (ALK). Washington, D.C.:AACR; 2010.

29. Ceccon M, Mologni L, Bisson W, Scapozza L, Gambacorti-Passerini C.Crizotinib-resistant NPM-ALK mutants confer differential sensitivity tounrelated Alk inhibitors. Mol Cancer Res 2013;11:122–32.

30. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. TheSequence alignment/map format and SAMtools. Bioinformatics 2009;25:2078–9.

31. Piazza R, Magistroni V, Pirola A, Redaelli S, Spinelli R, Galbiati M, et al.CEQer: a graphical tool for copy number and allelic imbalance detectionfrom whole-exome sequencing data. PLoS One 2013;8:e74825.

32. Redaelli S, Piazza R, Rostagno R, Magistroni V, Perini P, Marega M, et al.Activity of bosutinib, dasatinib, and nilotinib against 18 imatinib-resistantBCR/ABL mutants. J Clin Oncol 2009;27:469–71.


Ceccon et al.




33. Redaelli S, Mologni L, Rostagno R, Piazza R, Magistroni V, CecconM, et al.Three novel patient-derived BCR/ABLmutants show different sensitivity tosecond and third generation tyrosine kinase inhibitors. Am J Hematol2014;87:E125–8.

34. Zhang S, Wang F, Keats J, Ning Y, Wardwell SD, Moran Lauren, et al.AP26113, a potent ALK inhibitor, overcomes mutations in EML4-ALK thatconfer resistance to PF-02341066. AACR annual meeting, Apr 17–21,2010; Washington, DC.

35. Katayama R, Khan TM, Benes C, Lifshits E, Ebi H, Rivera VM, et al.Therapeutic strategies to overcome crizotinib resistance in non-small celllung cancers harboring the fusion oncogene EML4-ALK. Proc Natl Acad SciU S A 2011;108:7535–40.

36. Heuckmann JM,HolzelM, SosML,Heynck S, Balke-WantH, KokerM, et al.ALKmutations conferring differential resistance to structurally diverse ALKinhibitors. Clin Cancer Res 2011;17:7394–401.






Correction

Correction: Treatment Efficacy andResistance Mechanisms Using the Second-Generation ALK Inhibitor AP26113 in HumanNPM-ALK–Positive Anaplastic Large CellLymphoma

In this article (Mol Cancer Res 2015;13:775–83), which appeared in the April 2015issue ofMolecular Cancer Research (1), the grant support sectionwasmissing a fundingsource. The corrected grant support section is below. The authors regret the error.

This work was supported by the Lombardy Region (ID14546A) and the ItalianAssociation for Cancer Research (AIRC 2013 IG-14249).

Reference1. Ceccon M, Mologni L, Giudici G, Piazza R, Pirola A, Fontana D, et al. Treatment efficacy and

resistance mechanisms using the second-generation ALK inhibitor AP26113 in human NPM-ALK–positive anaplastic large cell lymphoma. Mol Cancer Res 2015;13:775–83.

Published OnlineFirst September 29, 2015.doi: 10.1158/1541-7786.MCR-15-0277�2015 American Association for Cancer Research.

MolecularCancerResearch

www.aacrjournals.org 1441

2015;13:775-783. Published OnlineFirst November 24, 2014.Mol Cancer Res M. Ceccon, L. Mologni, G. Giudici, et al. Positive Anaplastic Large Cell Lymphoma

−Second-Generation ALK Inhibitor AP26113 in Human NPM-ALK Treatment Efficacy and Resistance Mechanisms Using the

Updated version

10.1158/1541-7786.MCR-14-0157doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2014/11/21/1541-7786.MCR-14-0157.DC1

Access the most recent supplemental material at:

Cited articles

http://mcr.aacrjournals.org/content/13/4/775.full#ref-list-1

This article cites 33 articles, 12 of which you can access for free at:

Citing articles

http://mcr.aacrjournals.org/content/13/4/775.full#related-urls

This article has been cited by 5 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/13/4/775To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-14-0157

http://mcr.aacrjournals.org/content/suppl/2014/11/21/1541-7786.MCR-14-0157.DC1

http://mcr.aacrjournals.org/content/13/4/775.full#ref-list-1

http://mcr.aacrjournals.org/content/13/4/775.full#related-urls

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/13/4/775


Treatment Efﬁcacy and Resistance Mechanisms Using the … · Signal Transduction Treatment...

Documents

Transcript of Treatment Efﬁcacy and Resistance Mechanisms Using the … · Signal Transduction Treatment...