Thesis April 2011 Lyx

Drug Delivery Systems for TissueEngineering Applications

João Reina Maia e Silva

April 27th 2011

A Thesis presented to Faculdade de Ciências e Tecnologia da Universidade de Coimbra to

obtain the degree of Doctor in Chemical Engineering in the Speciality of Chemical Processes

I gratefully acknowledge the financial support provided byInstituto de Investigação InterdisciplinarIII/BIO/20/2005

AdvisorProf. Dr. Maria Helena Gil

RefereesProf. Dr. Miguel GamaProf. Dr. Pedro L. GranjaProf. Dr. Hermínio C. SousaProf. Dr. Lino FerreiraProf. Dr. Margarida Figueiredo

In the beggining there was nothing.Then even that exploded ...

(Unknow author)

Para a Sofia, pela paciênciaPara os meus pais, pelo apoio de sempre

Agradecimentos

Gostaria de agradecer à Professora Helena Gil por me ter aceite, novamente, como seualuno. Estes anos ao seu lado foram muito enriquecedores e animados. Queria tambémreconhecer o seu contributo para o meu amadurecimento científico e pessoal. O seuincentivo, para que eu terminasse o trabalho e ultrapassasse as minhas crises existenciaisdurante este período, foi extremamente importante.

Quero deixar uma palavra de agradecimento a todos os colegas e amigos com que mecruzei ao longe destes anos. Não só dentro da Universidade de Coimbra, mas tambémnas várias instituições por onde fui passando. Felizmente, são bastantes. Espero queme perdoem não vos nomear aqui a todos. A vossa ajuda foi fundamental em todosos planos, não só no quotidiano laboratorial mas também fora dele, essencial para amanutenção da sanidade mental!

Gostaria de agradecer aos amigos Andrade Ramos e Jorge Coelho pela leitura crítica datese e à comunidade de utilizadores Lyx, mas em especial ao Uwe Stöhr, pela ajuda naelaboração tipográfica do manuscrito.

Um sincero obrigado à Ann Daugherty e ao Tom Patapoff pela ajuda na cedência deVEGF pela Genentech, Inc.

Mas acima de tudo, ao Lino Ferreira, por me ter acolhido no seu grupo e pela novaoportunidade que me deu de colaborarmos, sem dúvida, determinante para levar esteprojecto a bom porto.

vii

Abstract

The concept of controlled drug delivery arose in the mid-sixties, quickly leading to thefirst commercial devices composed of poly(ethylene-co-vinyl acetate). Since then, thefield has suffered a tremendous evolution. As the knowledge on cell biology, physiologyand materials sciences increased, better approaches were developed. Today we standon the nanometric level of controlled delivery devices. These approaches rely on highly-innovative materials, with increasing biological accuracy, having has an ultimate goal theachievement of personalised medicine.

Impaired-angiogenesis associated pathologies, such as ischemic heart disease, chronicwounds or stroke, have a high-burden on society. Pro-angiogenic therapies aim at recov-ering vascularised impaired tissues. Among other approaches, the use of specific growthfactors, like vascular endothelial growth factor (VEGF), is one of the most attemptedapproaches found on the literature. However, the results in clinical trials, using bolusdelivery of VEGF, did not meet the desired therapeutic efficacy. Part of this failure wasattributed to suboptimal delivery strategies, allied to the short half-life and fast clear-ance rates of the growth factor. Cardiovascular diseases and wound healing are hugeummet medical needs which would benefit tremendously of successful delivery strategiesfor VEGF.

We have previously synthesised and characterised oxidised dextran (dexOx) hydrogels(Maia et al. Polymer 2005;46:9604-9614). We have used this system as a benchmarkand continued its characterisation in an attempt to improve it for the desired drugdelivery approaches. A deeper analysis of oxidised dextran was performed, focused onthe oxidation degree effect and its direct influence on the microscopic and macroscopiccharacteristics of the material. As a result, we observed how the oxidation degree stronglyinterferes with the viscosity of dexOx aqueous solutions and how the thermal degradationprofiles, of the different samples, reflect the damage that low and mild oxidations couldoriginate, on the polymeric backbone.

DexOx cross-linked with adipic acid dihydrazide hydrogels were further characterised

ix

having in mind the future incorporation of a therapeutic biomolecule and the integrationin more complex systems. Different geometries were approached, like microgels, of whichwe present some early studies.

The natural reactivity of oxidised dextran toward N-nucleophiles render this vehicle ap-propriate for an effortless and straightforward conjugation with a proteinaceous growthfactor, conferring protection and extending the protein half-life by inhibiting fast cellu-lar consumption. VEGF is able to maintain its bioactivity, however the conjugation todexOx, severely hinders the interaction with VEGF receptors and antibodies, delayingthe VEGF consumption. The hydrogels release profile of VEGF was studied and observedto be quite different from other systems described on the literature. The initial burstrelease could be fine tuned from one to forty five percent of the total initial drug.

Fibrin hydrogels were shown, elsewhere, to be appropriate carriers of endothelial cells.They improved the survival and proliferation of such cells. Therefore, a novel hybridconstruct was designed. The dexOx hydrogels were entrapped inside the fibrin hydrogels.The combination of both platforms in a hybrid matrix supported the attachment ofvascular cells and allowed their migration, organisation and proliferation, supported bya possible gradient created by the controlled delivery of VEGF. This novel constructgeometry opens interesting perspectives for pro-angiogenic therapies.

Finally, we have explored the delivery of small hydrophobic therapeutics. The ultimatefrontier in drug delivery is the cells cytoplasm and the different cellular organelles. Theability to reach this target allows the manipulation and control of cell fate, highly rele-vant on the context of stem cells. Retinoic acid (RA) is a hydrophobic molecule whichhas tremendous potential in cancer prevention and is a regulator of stem cells differenti-ation. RA acts upon nuclear receptors, therefore, the intracellular delivery is demandedfor a successful application. We addressed this issue, by recurring to polyelectrolyte-based nanoparticles, composed by polyethylenimine and dextran sulfate. The balancebetween the different components was shown to affect the RA loading capacity and thenanoparticles size. This system allowed the delivery of a significant amount of RA tothe subventricular zone neuronal stem cells cytoplasm and differentiate this cells into theneuronal lineage more significantly than blank nanoparticles or by RA released outsidethe cells. We antecipate that such system could be delivered through the nasal cavity,straight to the brain, opening new perspectives on the treatment of neurodegenerativediseases.

x

Resumo

O conceito de libertação controlada de fármacos nasceu nos anos sessenta, o que seriatraduzido rapidamente em produtos comerciais compostos por dispositivos com base empoli(etileno-co-vinil acetato). Desde essa altura, o campo evoluiu substancialmente. Àmedida que os conhecimentos de biologia celular, fisiologia e ciência dos materiais foramcrescendo, abordagens mais eficazes foram sendo criadas. Hoje em dia, os dispositivosde libertação controlada de entidades terapêuticas ou mesmo células, atingiram a escalananométrica. Estas abordagens apresentam elevada precisão biológica, o que nos levará,eventualmente, a uma medicina mais personalisada.

Determinadas patologias são caracterizadas por vascularização deficiente, após o mo-mento do insulto. Exemplos como o enfarte do miocárdio, feridas crónicas ou acidentesvasculares cerebrais tem um elevado peso na sociedade. A angiogénese terapêutica temcomo objectivo a recuperação de tecidos lesionados com uma vascularização deficiente.Entre outras abordagens, o uso de factores de crescimento específicos, como o factorde crescimento do endotélio vascular (VEGF), é uma das abordagens mais frequentesencontradas na literatura e abordada em ensaios clínicos. No entanto, os resultados emensaios clínicos, utilizando apenas VEGF, não atingiu a eficácia terapêutica pretendida.Parte deste falhanço foi atribuído a uma entrega deficiente do factor bioactivo aos teci-dos comprometidos, aliado ao tempo de semi-vida curto e à rápida filtração por partedo organismo. A cura de feridas cutâneas e doenças cardiovasculares são necessidadesmédicas que beneficiariam muito com estratégias eficientes de entrega e libertação deVEGF.

Recentemente, o nosso grupo descreveu a síntese e caracterização de hidrogeis de dex-trano oxidado (dexOx) (Maia et al. Synthesis and characterization of new injectableand degradable dextran-based hydrogels Polymer 2005;46:9604-9614). Este sistema foiusado como referência padrão e durante este estudo foi feito um esforço de realizar umacaracterização mais exaustiva de modo a melhorá-lo. Uma análise mais profunda dodextrano oxidado foi feita, focada na influência do grau de oxidação nas características

xi

microscópicas e macroscópicas do material. O grau de oxidação também foi estudadono contexto de um transporte eficiente de factores bioactivos, bem como na síntese demicrogeis e hidrogeis após reticulação com ácido adípico dihidrazida.

A questão de libertação de VEGF foi abordada, usando o dextrano oxidado como trans-portador. A reactividade natural do dextrano oxidado para N-nucleófilos torna estevector bastante apropriado para uma conjugação simples e directa, conferindo protecçãoe aumentando o tempo de semi-vida, por inibição do rápido consumo celular. O perfilde libertação do VEGF observado é bastante diferente de outros sistemas descritos naliteratura. A libertação inicial pode ser moldada para ocorrer entre um a quarenta ecinco por cento da totalidade da proteína inicial. O VEGF é capaz de preservar a suabioactividade, no entanto a conjugação ao dextrano oxidado, limita severamente a in-teracção com os receptores celulares e anticorpos específicos, retardando o seu consumoa nível celular.

Hidrogéis de fibrina foram identificados, num outro trabalho, como sendo transporta-dores eficazes de células endoteliais. Foi mostrado que melhoravam a sobrevivência eproliferação dessas mesmas células. Nesse contexto, os hidrogéis de dexOx foram incor-porados dentro dos hidrogéis de fibrina. A combinação de ambas as plataformas, numamatriz hibrída, suportou a adesão das células endoteliais e permitiu a sua migração, or-ganização e proliferação, apoiada num possível gradiente criado pela libertação de VEGFdo hidrogel de dexOx. Esta nova geometria abre perspectivas interessantes para novasterapias pro-angiogénicas.

Por último, foi explorada a libertação controlada de agentes terapêuticos de baixo pesomolecular e hidrofóbicos. A última fronteira em libertação de drogas é o ambientecitoplasmático e os diferentes organelos celulares. A capacidade de atingir este espaçopermite a manipulação e controlo do destino celular, altamente relevante no contextode células estaminais. O ácido retinóico é uma molécula hidrofóbica com um potencialtremendo na prevenção do cancro e como regulador da diferenciação de células estami-nais. O ácido retinóico actua sobre receptores localizados no núcleo celular, nascendo anecessidade de entrega citoplasmática para uma aplicação bem sucedida. Este problemafoi abordado, recorrendo a nanoparticulas baseadas em polielectrólitos (polietileniminae dextrano sulfato). O balanço entre os diferentes componentes afecta a capacidade detransportar ácido retinóico bem como o tamanho final das nanopartículas. Este sistemapermitiu a entrega de uma quantidade significativa de ácido retinóico no citoplasmade células estaminais neuronais da região subventricular promovendo a diferenciação em

xii

células da linhagem neuronal, ao contrário de nanopartículas vazias ou de ácido retinóicolibertado fora das células. Antevemos que este sistema possa ser entregue ao cérebroatravés da cavidade nasal, surgindo como uma nova oportunidade no tratamento dediversas doenças neuro-degenerativas.

xiii

Thesis Outline

The research project “Polysaccharide hydrogels for vascular tissue engineering applica-tions”, which was presented and accepted by “Instituto de Investigação Interdisciplinar”,had as main goal, the development of “(...) a new hydrogel formulation to be studiedas a scaffold for vascular tissue growth, and that could also improve implantable-devicesacceptance by the organism”. This project was designed on the shoulders of an earlierwork, which characterised the synthesis of oxidised dextran (dexOx) hydrogels cross-linked with a dihydrazide (Maia et al. Polymer 2005;46:9604-9614). This work was setas our benchmark.

Throughout the period of research, the main goals were slightly shifted in other direc-tions. The polymeric-based materials were still on the main core of the technologiesapproached, however, the focus of research was oriented, towards drug delivery. Toachieve this goal, a material transfer agreement for vascular endothelial growth factor,was arranged. Later on, the possibility of developing and characterising nanoparticles,opened the door for the intracellular delivery of retinoic acid, to neuronal stem cells.

Several months were applied in developing different polysaccharide-based formulations.After several failed strategies, the research focused on further characterising that pre-viously studied system. The adipic acid dihydrazide (AAD) cross-linked dexOx systempresented many of the characteristics which we were trying to achieve. An injectableand initiator-free hydrogel, of aqueous base and which could carry therapeutic molecules.Therefore, it was decided to continue the characterisation of said system and advanceto the aimed goal of vascular therapies.

The general hypothesis was that an injectable hydrogel system, able to carry specifictherapeutic entities, would improve the therapeutic efficacy and benefit the recovery ofthe injured tissue. Such carrier could be applied in a high number of clinical settings. Thedevelopment of such work represents a collaboration between traditional disciplines asdiverse as polymer chemistry and polymer physics to drug delivery and cellular/molecularbiology. It is impossible to address tissue engineering and drug delivery from only one

xv

prism, without having to face the challenges arising on other research fields.

From the biomaterials perspective, a thorough structural characterisation of dexOx wasperformed. On chapter 1 we review the background of oxidised dextran on the biomedicalfield, in order to contextualise the experimental issues approached. The oxidation degree,which deeply affects the macroscopic and microscopic properties of the oxidised dextrans,was thoroughly analysed by several techniques (chapter 4 and chapter 5), but especially,bidimensional NMR, which unveiled interesting reactivity trends of the different aldehydeson oxidised dextran (chapter 4). The consequences of the oxidation degree on thedesign of hydrogels and microgels is presented on chapter 5 and chapter 6, respectively.The chapter 5 results were oriented towards an injectable ocular application, due tothe context of the collaboration that was established during that period. Though, theocular delivery is out of the specific context of this thesis, the technical needs of suchapplication, regarding the hydrogels properties, are quite similar. This work work will bepresented without modifications from the published version.

Pro-angiogenic therapies are reviewed on chapter 2. The relevance of VEGF as a thera-peutic molecule is addressed and the challenges faced on the controlled delivery are alsooverviewed. A glimpse over the use of vascular progenitor cells or stem cells on pro-angiogenic therapies is also addressed on this chapter. We have explored the delivery ofVEGF, on the context of this dexOx-based hydrogel system but also as simple drug con-jugate to dexOx and the implications that it could have on the VEGF denaturation andbioactivity (chapter 7). The conjugation to dexOx protects VEGF, without denaturat-ing, extending its half-life by inhibiting fast cellular consumption. This system presentedan interesting release profile, which could be advantageous on a wound healing clinicalcontext. However, a new hybrid hydrogel construct is proposed, where the controlleddelivery of VEGF apparently guides the migration and proliferation of endothelial cellsinside a fibrin hydrogel.

New opportunities in drug delivery by nanoparticles arose due to our last collaboration.The impact of nanoparticulate delivery systems is addressed on chapter 3 and someinsights on the challenges of nanoparticles design is addressed as well as the most in-novative approaches. The intracellular delivery of retinoic acid was approached with apolyelectrolyte nanoparticle system and the potential in differentiating neural stem cellswas assessed and described on chapter 8. We show that our NP formulation is veryeffective in loading RA, a small molecule with low aqueous solubility, and to release RAat concentrations higher than its solubility limit. Importantly, our results show that the

xvi

intracellular internalisation of RA positive nanoparticles contribute for neurogenesis andtherefore highlighting the importance of drug spatial positioning and concentration interms of stem cell differentiation.

The experimental section chapters were all prepared in the form of independent publish-able manuscripts. The author apologizes for the redundancy of some sections.

Published Work

Chapter 4 was published in the journal Polymer. João Maia, Jorge FJ Coelho, Rui ACarvalho, Pedro N Simões, Maria H Gil. Insight on the periodate oxidation of dextranand its structural vicissitudes. Polymer 2010; doi:10.1016/j.polymer.2010.11.058

Chapter 5 was published in the journal Acta Biomaterialia. João Maia, MaximianoP Ribeiro, Carla Ventura, Rui A Carvalho, Ilidio J Correia, Maria H Gil. Ocular in-jectable formulation assessment for oxidized dextran-based hydrogels. Acta Biomaterialia2009;5(6):1948-1955; doi:10.1016/j.actbio.2009.02.008

Chapter 8 was published in the journal ACS Nano. João Maia, Tiago Santos, Sezin Aday,Fabienne Agasse, Luísa Cortes, João O. Malva, Liliana Bernardino, Lino Ferreira. Con-trolling the neuronal differentiation of stem cells by the intracellular delivery of retinoicacid-loaded nanoparticles. ACS Nano 2010; doi: 10.1021/nn101724r.

xvii

Contents

Agradecimentos vii

Abstract ix

Resumo xi

Thesis Outline xv

List of Symbols and Acronyms xxv

List of Figures xxxi

List of Tables xxxiii

I. Introduction 1

1. Oxidised Dextran 31.1. Dextran in Biomedical Industry . . . . . . . . . . . . . . . . . . . . . . 31.2. Dextran Oxidation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4

1.2.1. Oxidation Degree . . . . . . . . . . . . . . . . . . . . . . . . . 61.2.2. DexOx Reactivity . . . . . . . . . . . . . . . . . . . . . . . . . 71.2.3. Oxidation Consequences . . . . . . . . . . . . . . . . . . . . . 8

1.2.3.1. Physico-Chemical . . . . . . . . . . . . . . . . . . . . 81.2.3.2. Biological . . . . . . . . . . . . . . . . . . . . . . . . 8

1.3. DexOx Applications . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91.3.1. DexOx-Drug Conjugation . . . . . . . . . . . . . . . . . . . . . 9

1.3.1.1. Small Molecules . . . . . . . . . . . . . . . . . . . . . 91.3.1.2. Proteins . . . . . . . . . . . . . . . . . . . . . . . . . 101.3.1.3. Immunoconjugates . . . . . . . . . . . . . . . . . . . . 12

xix

1.3.1.4. Gene-Delivery . . . . . . . . . . . . . . . . . . . . . . 131.3.2. Hydrogels . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171.3.3. Particles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191.3.4. Surfaces . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19

1.4. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24

2. Pro-Angiogenic Therapies 252.1. VEGF in Health and Disease . . . . . . . . . . . . . . . . . . . . . . . . 252.2. VEGF Biology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 262.3. Therapeutic Angiogenesis . . . . . . . . . . . . . . . . . . . . . . . . . 29

2.3.1. Polymeric Matrices-Based Strategies . . . . . . . . . . . . . . . 312.3.1.1. Diffusion Controlled . . . . . . . . . . . . . . . . . . . 312.3.1.2. Covalent Immobilisation . . . . . . . . . . . . . . . . . 322.3.1.3. Composite Constructs . . . . . . . . . . . . . . . . . . 322.3.1.4. Multiple Release . . . . . . . . . . . . . . . . . . . . . 332.3.1.5. Stimuli-Sensing . . . . . . . . . . . . . . . . . . . . . 35

2.3.2. Cell-Based Therapies . . . . . . . . . . . . . . . . . . . . . . . 372.4. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39

3. Nanotechnology: Novel Delivery Frontiers 413.1. NanoBiotechnology . . . . . . . . . . . . . . . . . . . . . . . . . . . . 413.2. Nanoparticle Design . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43

3.2.1. Synthesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 433.2.2. Stimulus Sensitivity . . . . . . . . . . . . . . . . . . . . . . . . 453.2.3. Targeting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46

3.3. Nano Delivery . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 473.3.1. Proteins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 473.3.2. Small Drugs . . . . . . . . . . . . . . . . . . . . . . . . . . . . 483.3.3. Intracellular Targeting . . . . . . . . . . . . . . . . . . . . . . . 49

3.4. Nano Tissue Engineering . . . . . . . . . . . . . . . . . . . . . . . . . . 503.5. Conclusions. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52

II. Results and Conclusions 53

4. Insight on the Periodate Oxidation of Dextran 55

xx

4.1. Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 554.2. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 554.3. Material and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . 57

4.3.1. Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 574.3.2. Dextran Oxidation . . . . . . . . . . . . . . . . . . . . . . . . 574.3.3. Nuclear Magnetic Resonance . . . . . . . . . . . . . . . . . . . 574.3.4. DexOx’s Solubility and Solutions Viscosity . . . . . . . . . . . . 584.3.5. Size Exclusion Chromatography . . . . . . . . . . . . . . . . . . 584.3.6. Dynamic Mechanical Thermal Analysis . . . . . . . . . . . . . . 594.3.7. Thermogravimetric Analysis . . . . . . . . . . . . . . . . . . . . 59

4.4. Results and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . 594.4.1. DexOx Characterisation . . . . . . . . . . . . . . . . . . . . . . 594.4.2. Bidimensional Nuclear Magnetic Resonance . . . . . . . . . . . 604.4.3. Macroscopic Consequences of the Oxidation . . . . . . . . . . . 644.4.4. Thermal Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . 66

4.5. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70

5. Oxidised Dextran-Based Hydrogels 735.1. Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 735.2. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 735.3. Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . 75

5.3.1. Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 755.3.2. Dextran Oxidation . . . . . . . . . . . . . . . . . . . . . . . . . 765.3.3. Nuclear Magnetic Resonance and Size Exclusion Chromatography 765.3.4. DexOx’s Solutions Viscosity . . . . . . . . . . . . . . . . . . . . 775.3.5. Hydrogel Preparation and Characterisation . . . . . . . . . . . . 775.3.6. Dynamic Swelling Experiments . . . . . . . . . . . . . . . . . . 775.3.7. Rheological Analysis . . . . . . . . . . . . . . . . . . . . . . . . 785.3.8. Cell Source and Growth . . . . . . . . . . . . . . . . . . . . . . 785.3.9. Cell Culture and In Vitro Cytotoxicity Studies . . . . . . . . . . . 78

5.4. Results and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . 795.4.1. DexOx Characterisation . . . . . . . . . . . . . . . . . . . . . . 795.4.2. DexOx Solutions Viscosity . . . . . . . . . . . . . . . . . . . . . 805.4.3. Hydrogels Characterisation . . . . . . . . . . . . . . . . . . . . . 825.4.4. Assessment of Cytotoxic Potential . . . . . . . . . . . . . . . . . 85

xxi

5.5. Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87

6. Dextran-Based Microgels 896.1. Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 896.2. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 896.3. Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . 91

6.3.1. Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 916.3.2. Preparation of Microspheres . . . . . . . . . . . . . . . . . . . . 916.3.3. Scanning Electron Microscopy and Particle Sizing Analysis . . . . 92

6.4. Results and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . 926.5. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94

7. Pro-angiogenic Hybrid Hydrogels 977.1. Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 977.2. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 977.3. Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . 99

7.3.1. Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 997.3.2. Dextran Oxidation and Characterisation . . . . . . . . . . . . . . 997.3.3. VEGF Labelling . . . . . . . . . . . . . . . . . . . . . . . . . . 1007.3.4. Characterisation of VEGF Conjugates by Gel Electrophoresis . . . 1007.3.5. Characterisation of VEGF Conjugates by Circular Dichroism . . . 1017.3.6. Evaluation of VEGF Conjugates Bioactivity . . . . . . . . . . . . 1017.3.7. Release of VEGF from DexOx Hydrogels . . . . . . . . . . . . . 1027.3.8. Hybrid Hydrogels of DexOx and Fibrin . . . . . . . . . . . . . . 1027.3.9. Viability of Encapsulated Endothelial Cells . . . . . . . . . . . . 1037.3.10. Quantitative Real time Reverse-Transcription Polymerase Chain

Reaction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1037.3.11. Statistical Analysis . . . . . . . . . . . . . . . . . . . . . . . . 104

7.4. Results and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . 1047.4.1. VEGF Conjugation to DexOx . . . . . . . . . . . . . . . . . . . 1047.4.2. Structure Stabilisation of VEGF . . . . . . . . . . . . . . . . . 1067.4.3. Intracellular Ca2+ Uptake in Endothelial Cells . . . . . . . . . . . 1087.4.4. Phosphorylation of Akt and ERK in Endothelial Cells . . . . . . . 1107.4.5. VEGF Controlled Release from Hydrogels . . . . . . . . . . . . 1127.4.6. Endothelial Cells Encapsulation in Hybrid Hydrogels Containing

VEGF . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 114

xxii

7.5. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117

8. Retinoic Acid-Loaded Nanoparticles 1198.1. Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1198.2. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1198.3. Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . 120

8.3.1. Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1218.3.2. Fluorescent Labeling of PEI . . . . . . . . . . . . . . . . . . . . 1218.3.3. Preparation of Nanoparticles . . . . . . . . . . . . . . . . . . . . 1218.3.4. Characterisation of the Nanoparticles . . . . . . . . . . . . . . . 1228.3.5. Determination of Weight Ratio of Cationic to Anionic Polymer in

Nanoparticles . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1228.3.6. Loading Efficiency of RA in Nanoparticles . . . . . . . . . . . . . 1238.3.7. RA Release from Nanoparticles . . . . . . . . . . . . . . . . . . 1238.3.8. In vitro Degradation of Polymeric Nanoparticles . . . . . . . . . 1238.3.9. SVZ Cell Cultures and Experimental Treatments. . . . . . . . . 1248.3.10. Single Cell Calcium Imaging . . . . . . . . . . . . . . . . . . . . 1248.3.11. Internalisation Studies . . . . . . . . . . . . . . . . . . . . . . . 1258.3.12. Western Blots . . . . . . . . . . . . . . . . . . . . . . . . . . . 1268.3.13. Immunocytochemistry . . . . . . . . . . . . . . . . . . . . . . . 1268.3.14. TUNEL Assay . . . . . . . . . . . . . . . . . . . . . . . . . . . 1278.3.15. Propidium Iodide Incorporation . . . . . . . . . . . . . . . . . . 1288.3.16. Statistical Analysis . . . . . . . . . . . . . . . . . . . . . . . . 128

8.4. Results and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . 1288.4.1. High-Loading Capacity and Positive-Net Charge Nanoparticles . . 1308.4.2. Nanoparticles Internalisation in SVZ Cells . . . . . . . . . . . . . 1338.4.3. RA+NPs Promote Neuro-Differentiation . . . . . . . . . . . . . 137

8.5. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 140

III. Final Remarks 143

9. General Conclusions 145

Bibliography 149

xxiii

List of Symbols and Acronyms

1H-NMR Proton nuclear magnetic resonance spectroscopy

AAD Adipic acid dihydrazide

Akt Protein Kinase B, Multifunctional serine-threonine protein kinase

Ang Angiopoietin

APDES Aminopropyldimethylethoxy silane

APTES Aminopropyltriethoxy silane

BSA Bovine serum albumine

CEC Carboxyethyl chitosan

CMC Carboxymethyl cellulose

COSY Correlation spectroscopy

DDD Drug delivery devices

dexOx Oxidised dextran

DMSO Dimethyl sulfoxide

DMTA Dynamic mechanical thermal analysis

DNA Deoxyribonucleic acid

DS Dextran sulphate

DTG Differential thermogravimetric

EBs Embryoid bodies

xxv

ECM Extracellular matrix

EGF Epidermal Growth Factor

EPC Endothelial progenitor cells

ERK Extracellular signal-regulated protein kinase

EtC Ethyl carbazate

FGF Fibroblast growth factor

FITC Fluorescein isothiocyanate

Flk1 Fetal liver kinase 1; Same as KDR and VEGFR-2

Flt1 fms-related tyrosine kinase 1; Same as VEGFR1

HA Hyaluronic acid

HCl Hydrochloric acid

HEMA Hydroxyethyl methacryate

hESC Human embryonic stem cells

HGF Hepatocyte growth factor

hGH Human growth hormone

HMQC Heteronuclear multiquantum coherence NMR spectroscopy

HPMA N-(2-hydroxypropyl)methacrylamide

HPMC Hydroxypropylmethyl cellulose

HUVEC Human umbilical vein endothelial cells

IC50 Half maximal inhibitory concentration

IKVAV laminin-based peptide

IL-8 Interleukin 8

xxvi

KDR Kinase insert domain receptor; Same as Flk1 and VEGFR-2

KGF Keratinocyte growth factor

mab Monoclonal antibody

MAPK Mitogen-activated protein kinase

MC Methyl cellulose

MCP1 Monocyte chemotactic protein 1

MMA Methyl methacrylate

MPEG Methyl polyethylene glycol

NP Nanoparticles

NR1 NMDA receptor subunit type 1

NRP Neuropilin

OD Oxidation degree

pab Polyclonal antibody

PDGF Platelet-derived growth factor

PEG Polyethylene glycol

PEGDA Polyethylene glycol diacrylate

PEI Polyethylenimine

PI3K Phosphatidylinositol 3-kinase

PLA Polylactic acid

PLGA Poly(lactic-co-glycolic) acid

PlGF Placental growth factor

qRT-PCR Quantitative real time reverse-transcription polymerase chain reaction

xxvii

RA Retinoic acid

RAR Retinoic acid receptor

RARE DNA sequence called retinoic acid-response element

RGD Arg-Gly-Asp peptide, used as a recognition epitope on cell adhesion

SEC Size exclusion chromatography

SMC Smooth muscle cells

sms Somatostatin

SVZ Subventricular zone - Neurogenic niche of stem cells

tBC tert-butyl carbazate

TG Thermogravimetric

TGF Transforming Growth Factor

TNBS Trinitronenzenosulfonic acid

TNF Tumour necrosis factor

UCB Umbilical cord blood

VEGF Vascular endothelial growth factor

VEGFR1 VEGF receptor 1; Same as Flt1

VEGFR2 VEGF receptor 2; Same as Flk1 and KDR

VPF Vascular permeability factor

vWF Von Willebrand factor

xxviii

List of Figures

1.1. Single and double oxidation of dextran by the metaperiodate ion . . . . . 51.2. Oxidised dextran reactivity . . . . . . . . . . . . . . . . . . . . . . . . . 71.3. Schematic example of oxidised dextran conjugates to small drugs and

proteins. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111.4. Examples of oxidised dextran based hydrogels and microparticles . . . . . 181.5. Surface coating of biomedical devices by dexOx . . . . . . . . . . . . . . 20

2.1. Schematic organisation of the VEGF gene and most common VEGF iso-forms. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27

2.2. The role of the different VEGF receptors. . . . . . . . . . . . . . . . . . 282.3. VEGF pathways. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 292.4. β1-integrin is required for clustering and continued internalisation of

VEGF-R2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 302.5. Schematic example of different VEGF immobilisation approaches and im-

pact on release profile. . . . . . . . . . . . . . . . . . . . . . . . . . . . 342.6. Postnatal stem and progenitor cells. . . . . . . . . . . . . . . . . . . . . 38

3.1. Publication counts for nanobiotechnology on the ISI WoK database. . . . 423.2. Different designs in nanoparticles assembly. . . . . . . . . . . . . . . . . 453.3. Different aspects of nanoparticles composition . . . . . . . . . . . . . . 463.4. Cellular internalisation pathways of NP . . . . . . . . . . . . . . . . . . 493.5. Nanoparticles suprastructures. . . . . . . . . . . . . . . . . . . . . . . . 51

4.1. Dextran’s α-1,6 glucose residue possible periodate oxidations. . . . . . . 564.2. Possible hemiacetal structures and tBC reactions for the different oxidised

residues. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 604.3. Bidimensional NMR spectra of dexOx reacted with tBC. . . . . . . . . . 614.4. NMR spectra acquired at alkaline pH . . . . . . . . . . . . . . . . . . . 634.5. Dissolution time and viscosity profiles according to the oxidation degree. 66

xxix

4.6. DMTA thermoanalytical curves for the different oxidised samples. . . . . 684.7. TGA thermoanalytical curves for the different oxidised dextrans. . . . . . 69

5.1. Oxidised dextran crossliking by adipic acid dihydrazide. . . . . . . . . . . 815.2. Viscosity profiles of dexOx solutions dependency of oxidation degree and

concentration. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 825.3. Swelling index profile of dexOx based hydrogels. . . . . . . . . . . . . . 845.4. Endothelial cells seeded on top of dexOx-based hydrogels. . . . . . . . . 865.5. Metabolic activity, assessed by MTS, of endothelial cells seeded on top

of dexOx-based hydrogels. . . . . . . . . . . . . . . . . . . . . . . . . . 87

6.1. Oxidised dextran and adipic acid dihydrazide reversible cross-linking reaction 906.2. Freeze-dried microparticles morphology with varying concentrations of

AAD and the effect of Tween 60. . . . . . . . . . . . . . . . . . . . . . 936.3. Differential volume percentage for microgels synthesized with different

oxidised dextrans. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94

7.1. Conjugation of oxidised dextran to VEGF followed by SDS-PAGE . . . . 1057.2. Circular Dichroism spectra of VEGF and D25-VEGF conjugates. . . . . . 1077.3. VEGF dose-dependent Ca2+ uptake. . . . . . . . . . . . . . . . . . . . . 1087.4. Intracellular Ca2+ uptake as determined by Fura-2-loaded ECs. . . . . . . 1097.5. Phosphorylation pathways expression by VEGF and the dexOx conjugates. 1117.6. DexOx based hydrogels swelling and VEGF release followed by ELISA

and radioactivity. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1137.7. Hybrid hydrogels fluorescent images and cellular viability . . . . . . . . . 1157.8. Contrast phase images from endothelial cells encapsulated in the fibrin

section of the hybrid hydrogels. . . . . . . . . . . . . . . . . . . . . . . 1157.9. Genetic profiling of endothelial cells after six days. . . . . . . . . . . . . 116

8.1. Physico-chemical properties of the nanoparticles. . . . . . . . . . . . . . 1298.2. Diameter and release profile of RA+-NPs . . . . . . . . . . . . . . . . . 1328.3. UV spectral scan of RA . . . . . . . . . . . . . . . . . . . . . . . . . . 1338.4. Cellular nanoparticle uptake. . . . . . . . . . . . . . . . . . . . . . . . . 1348.5. Scheme of the SVZ cell cultures experimental protocols . . . . . . . . . 1358.6. Cell viability after RA+/−-NPs uptake. . . . . . . . . . . . . . . . . . . 1368.7. Proliferation of SVZ cells . . . . . . . . . . . . . . . . . . . . . . . . . 1368.8. RA+-NPs have a proneurogenic effect. . . . . . . . . . . . . . . . . . . 138

xxx

8.9. RA+-NPs induce differentiation of SVZ cells into functionally neurons. . . 140

xxxi

List of Tables

1.1. Price comparison for different clinical grade polysaccharides . . . . . . . 41.2. DexOx-based drug delivery strategies . . . . . . . . . . . . . . . . . . . 141.4. DexOx-based applications involving 3D matrices or surface coatings. . . . 20

2.1. VEGF delivery from polymeric matrices. . . . . . . . . . . . . . . . . . . 35

4.1. Macroscopic characteristics of native dextran and the several oxidisedsamples. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65

4.2. Glass transition temperatures obtained from the DMTA curves and char-acteristic quantities. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70

5.1. Oxidation degree estimation and Mw of several oxidised dextrans. . . . . 805.2. Gelation periods estimated for each dexOx with different AAD concen-

trations. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83

7.1. Primer sequences used for rtPCR. . . . . . . . . . . . . . . . . . . . . . 1047.2. Estimation of rhVEGF secondary structure percentage from circular dichro-

ism. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 107

8.1. Physico-chemical characteristics of DS/PEI nanoparticles either with orwithout RA. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131

xxxiii

List of Tables

xxxv

Part I.

Introduction

1. Oxidised Dextran

Dextran is not the sexiest of the biomedical polymers out there. It is linear, neutraland cheap. Nevertheless, it is an interesting substracte for chemical modifications andthroughout the last decades, has been a reliable resource with broad applications in thebiomedical industry.

1.1. Dextran in Biomedical Industry

Since the late nineteen forties, when dextran from Leuconostoc mesenteroids (strainB-512; US clinical standard [1]) was accepted as a plasma volume expander (i.e. plasmasubstitute) that the biomedical industry is using this polysaccharide [1, 2, 3]. From theeconomical perspective, concerning the biomedical industry, when comparing dextranto other polysaccharides of biomedical interest, such as hyaluronic acid, chitosan oralginate, dextran is competitively priced (Tab. 1.1).

The dextran from this strain was chosen based on the high percentage (>95%) of α-1,6linkages, more relevant to the initial application, due to the slower hydrolysis by bodyenzymes, compared to the α-1,4 linkage (e.g. glycogen). The high density of hydroxylgroups present in dextran, allows different kinds of chemical modifications [4]. Suchapproaches aim at using dextran from drug conjugation [5] to particles or hydrogelssynthesis [6], easily adding value to the starting material and broadening the potentialapplications. Among the chemical modifications described in the literature, one findsdifferent degrees of complexity. They can involve organic solvents, hazardous monomersand troublesome procedures which may counter-balance the added value of such ap-proaches. The dextran periodate oxidation is a simple, straightforward chemical modifi-cation, which yields a highly versatile biomaterial with reproducible qualities. Oxidizeddextran has mild cytotoxicity, which can be mitigated [7], but still has brought valueto most therapeutic applications studied so far. Most importantly, it has entered the

3

Chapter 1 Oxidised Dextran

clinical trials stage before, demonstrating oxidised dextran (dexOx) as a valid low-costbiomaterial option [8].

Table 1.1.: Price comparison for different clinical grade polysaccharides. Wheneverpossible the bulk price was presented, which obviously lowers the €/gram. There isno conflict of interests between the authors and the mentioned companies.

Material Price range€/gram Grade Companies

scanned

Dextran 0.5 – 0.85 Ultrapure; clinical Pharmacosmos1;Polydex1

Chitosan ~ 45 Ph. Eur.3 Novamatrix2

Hyaluronan ~ 45 Ph. Eur.3 Novamatrix2

Hyaluronan ~100 Medical grade Lifecore1

Alginates ~ 45 Ph. Eur.3 Novamatrix2

1 - Through cotation; 2 - Through company’s website; 3 - European Pharmacopoeia

1.2. Dextran Oxidation

The dextran oxidation by periodate ion is a catalysis-free aqueous reaction which yields apurified product with a simple dialysis step, followed by freeze-drying. Initially describedby Malaprade in 1928 [9], this method was used for the characterisation and elucidationof the polysaccharide structure, through the complete oxidation and consequent analysisof the degradation products [10, 11, 12, 13]. Dextran’s glucose residue, has vicinal diols(on α-1,6 residues), presenting two different oxidisable bonds, within the same residue.The oxidation of any of those bonds yields an aldehyde on C3, which is also susceptibleto periodate oxidation due to the neighbouring hydroxyl on C2 or C4, eventually leadingto a double oxidation of that same residue (Fig. 1.1A). This process can be observed bythe pH decrease, due to the release of the C3 as formic acid [14]. As clearly explained byTiziani [15], in the first oxidation step, one of the I-O bonds of the periodate ion, attacksone of the two hydroxyl groups of the vicinal diol; the second step is the formation of theplanar cyclic ester as part of an octahedral intermediate, the rate of which, must dependon the acidity of the oxygen of the OH groups and their relative positions. Regardingthe first oxidation step, this oxidative attack, on aqueous environment, is sensitive tothe carbon bond. The cleavage of the C3-C4 bond was described to be favoured 7.5-foldcompared to the C2-C3 bond. However, the second oxidation step was reported to havesimilar kinetics [16].

4

1.2 Dextran Oxidation

Figure 1.1.: (A) Single and double oxidation of dextran by the metaperiodate ion; (B)hemiacetal structure proposed by Ishak and Painter [16]; (C) aldo-enol tautomerismproposed by Drobchenko [17, 18].

When the oxidation is held in dimethyl sulfoxide (DMSO), a non-selective, single ox-idation was described to occur. The second oxidation inhibition was explained by aprotective intra-residual hemiacetal formation [19], which does not allow further oxida-tion on the same residue. This phenomenon, was also considered to occur in aqueousenvironment, but was suggested that it is not stable enough to prevent complete dex-tran oxidation [16]. The hemiacetals, as well as hemialdals, should be responsible forthe spectroscopic disappearance [14] of the aldehyde moiety. These structures exist inequilibrium, allowing the aldehydes to be reactive towards their natural counterparts(proposed hemiacetal structure for the doubly oxidised residue depicted on Fig. 1.1 B[16]). Another set of studies focused on the spectral characteristics of the mildly oxi-dised dextrans at different pH conditions, suggested alternative structures to hemiacetals.The UV analysis, disclosed the presence of bands, indicating that the hemiacetals mightexist in a restricted pH window, between 4.0 and 5.2. Below pH 4, the bands wereattributed to aldehydes and above pH 5.2, to enols and enolate ions. The authors pro-pose a pH-dependent aldo-enol tautomerism (Fig. 1.1 C) [17]. The 1H-NMR analysis of

5


dexOx at different pH’s revealed the appearance of new peaks (7.5 – 9.5 ppm), whichdisappeared after treatment with a borohydride salt, therefore being attributed to thealdo-enol transition populations and hemiacetals [18, 20, 21]. However, when the dexOxoxidation reaction is followed by 1H-NMR a putative aldehyde at ~9.7 ppm is observed.At that moment, the pH is close to 2.5, but the following spectra failed to capture thealdehydes again [14].

1.2.1. Oxidation Degree

The control over the modification extension is of utmost importance on the final macro-scopic and microscopic properties of mildly oxidised dextran. The aldehyde groups gen-erated can be easily titrated and quantified either by colorimetry or by potentiometry.The most common methods described in the literature, involve the titration with car-bazates [14, 22] and its indirect quantification of the excess with trinitrobenzenosulfonicacid (TNBS). The dinitrosalycilic acid method, developed for estimating sugars in urine[23], can also be approached to oxidised dextran and assess the reducing strength, hence,the oxidation degree (OD) [24]. Another common method uses potentiometric titrationto quantify the released equivalents of HCl, after hydroxylamine hydrochloride reactionwith the aldehydes [25]. Interestingly, the less used colorimetric method with oxidiseddextran is the method developed by Hugo Schiff [26]. The complex between aldehydesand fuchsin can be quantified by its absorption at 556 nm, and to the best of our knowl-edge it was used once involving oxidised dextran [27]. As the dextran structure is veryhomogenous, the 1H-NMR spectrum is well resolved, when compared to other polysac-charides. The carbazone formed, after titration with slight excess of tert-butyl carbazate(tBC) (taking into account two aldehydes per residue), yields a new non-exchangeableproton, visible on D2O, around 7.3 ppm [14]. The ratio between this peak integraland the anomeric peak, correlated well with the data from the TNBS assay, validat-ing this 1H-NMR approach. Intuitively, the reaction stoichiometry is expected to havetwo aldehydes per oxidised residue, hence, yielding two carbazones per oxidised residue.However, the visualisation of a single correlation on the HMQC [14] suggests otherwise,because only one population of aldehydes appears of being attacked [14]. Therefore, theoxidation degree determination could be masked by this phenomenon, which we will tryto clarify on chapter 4.

6

1.2 Dextran Oxidation

1.2.2. DexOx Reactivity

The attractiveness of aldehyde-activated dextran is inherently connected with the propen-sity of this chemical group to react promptly with N-nucleophiles, forming a stable co-valent link, yet, reversible. Amines are ubiquitous throughout a broad variety of smalltherapeutic molecules and a regular presence in proteins, especially through the amino-acid lysine. Hydrazides can be incorporated easily on several compounds [28], empower-ing the target molecule with dexOx reactivity. The outcome from the reaction betweendexOx and amines results in an imine (widely known has Schiff base; Fig. 1.2 A) whereasthe reaction with hydrazides results in a hydrazone (Fig. 1.2C). Hydrazones are morestable and resistant to hydrolysis than imines, which results from the delocalisation ofthe π-electrons [29]. Theoretically, imines on single oxidised residues, formed on C3, canundergo an Amadori rearrangement (Fig. 1.2B) forming stable ketoamines [30, 31].

The imine bond is susceptible of reduction, leading to a non-hydrolizable bond. Thepreferred approach is performed by reductive amination, through sodium borohydrideor sodium cyanoborohydride. The reaction yields an irreversible amine covalent bond.Cyanoborohydride is more selective, because it does not reduce aldehyde bonds as boro-hydride does [32] and can limit the number of reduced bonds between dexOx and thetarget molecule [33]. Another option is pyridine borane which has slightly greater reduc-ing strength than sodium cyanoborohydride [34].

Figure 1.2.: (A) DexOx conjugation to amines with consequent formation of imines and(B) the possibility of an Amadori rearrangement on C3; (C) reaction with hydrazidesand consequent hydrazone formation.

7


1.2.3. Oxidation Consequences

1.2.3.1. Physico-Chemical

The periodate oxidation, promotes dextran degradation and consequent Mw decrease.This effect can be observed by size exclusion chromatography [14, 35]. The dexOxpresents longer retention times and increased polydispersity. Usually, the polymers Mw

trend, directly influences the resistance to flow, due to the hydrodynamic radio. There-fore, the oxidation related decrease of the Mw, should yield less viscous solutions. How-ever, as we will demonstrate on chapter 5, the concentration increase, results in a reverseeffect, attributed to the interchain cross-linking, artificially, increasing the Mw and con-sequently the viscosity .

1.2.3.2. Biological

From the biomedical device perspective, the excessive oxidation could bring poor qualitiesconcerning the macro-monomer handling. However, a high reactive molecule couldbe useful for high loading efficiency hence, high payload. The biological impact ofthe dextran oxidation degree has been reported across several aspects. Concerningthe release of therapeutic agents on target tissues, where the release is dextranase-dependent, the oxidation degree was reported to confer resistance to enzymatic hydrolysisand consequent drug release [36].

Some works have described dexOx to be toxic and inhibit cell growth of different celllines. It has been suggested to be directly associated with the concentration of aldehydegroups. The mouse leukaemic monocyte macrophage cell line was shown to be sensitiveto the aldehyde concentration (IC50 3 μmol/mL of aldehydes), though mitigated afterreaction with ethanolamine [7]. The evaluation of cytotoxicity by specific assays alsogave indications of possible dexOx toxicity towards keratinocytes, endothelial cell andfibroblasts, though it could be related to interference of dexOx with the mentionedtechniques [37]. Nevertheless, the cross-linked dexOx, in the form of hydrogels, hasbeen reported several times as cytocompatible [37, 38, 39] as well as in this work, withendothelial cells from rabbit cornea (chapter 5).

8

1.3 DexOx Applications

1.3. DexOx Applications

The rise of pharmaceutical and biotech industries brought to the market an impressiveportfolio of new drugs of different natures for all sorts of unmet medical needs. The fieldof drug delivery aims at delivering any drug at the right time in a safe and reproduciblemanner to a specific target in a given concentration level. However, issues such as lowstability in vivo, short half-life and immunogenicity limitations are common. Amongseveral approaches to overcome these issues, the polymer conjugation has been one ofthe preferred methods and has seen some products entering the market [5]. Polymericconjugation allows the increase of the hydrodynamic volume, decreasing the excretionrate, hence, prolonging the plasma half-life and increasing the bioavailability. This effectis remarkable when dealing with hydrophobic drugs, due to the deliverance of a higherpayload. It can also confer protection against the host immune system by shielding thetherapeutic protein [5]. The industry gold standard is a process known as PEGylation,characterised by the grafting of polyethylene glycol (PEG) [40]. Most of the availablepolymer-drug conjugates on the market, present this FDA approved polymer. Currently,on clinical trials, one can also find N-(2-hydroxypropyl)methacrylamide (HPMA) copoly-mer and polyglutamate to serve such purpose [5].

1.3.1. DexOx-Drug Conjugation

The characteristics of dexOx have been explored under the perspective of drug conju-gation. Several studies, regarding the use of dexOx as the polymeric conjugate, will bepresented, focusing on the nature of the therapeutic entity and complexity of the system.

1.3.1.1. Small Molecules

Many antibiotics and anticancer agents suffer from hydrophobicity, which can be over-come through conjugation to water-soluble polymers. The most straightforward strategyis by direct conjugation to the ubiquitous chemical group, the amine group. Doxorubicinwill be used as an example of small drug delivery conjugated to dexOx, due to the highnumber of studies found on the literature. Doxorubicin (a member of the anthracyclinering antibiotics) has been used in the treatment of solid tumours and leukemias. How-ever, due to the clinical limitation of potentially developing dose-related cardiotoxicity,it has been coupled to dexOx through its amine group (Fig. 1.3A), which can decrease

9


the sub-acute toxicity compared to the free drug [41]. The retention profile on differenttissues of the dexOx - Doxorubicin amine conjugate, was demonstrated to increase thesystemic circulation and decrease the total body clearance of the drug. Higher liver ac-cumulation of the conjugate but decreased cardiac accumulation, was described, whichimproved the issue of doxorubicin associated cardiactoxicity [42].

This and other set of studies (Tab. 1.2) demonstrate dexOx to be able to overcome someof the most chronic issues in small pharmaceuticals delivery. The lack of a N-nucleophileis not impairment for dexOx conjugation, though it makes the process straightforwardand highly efficient. It enables the delivery of hydrophobic drug in higher percentagesand generally, increases the plasma circulation half-life, reducing systemic toxicity andincreasing therapeutic efficacy.

1.3.1.2. Proteins

Proteins, when compared to the small drugs, have higher degrees of complexity. The pro-tein’s native conformation defines its identity and the protein’s preservation is of utmostimportance for the activity maintenance. Generally, proteins are sensitive to temperature,organic solvents and mechanical stress, which can promote protein denaturation and leadto stability/activity lost. The exposed lysines (Fig. 1.3B) will determine the extensionof the interaction with dexOx [33]. This interaction will depend not only on the ratiobetween aldehydes and amines but also on the molecular weight difference between thepolysaccharide and the protein. Three different enzymes were conjugated with dexOx’swith variable Mw and were successful in preserving enzymes activities and stabilities, onthe presence of organic and air interfaces [43]. On the case of multimeric enzymes, thestability and activity, the quaternary structure of bovine catalase [44] or L-asparaginase[45], was also preserved by dexOx conjugation. The last examples demonstrate theprotein stabilising potential of dexOx. However, most examples were performed underreductive amination conditions, which irreversibly bind the protein-dexOx conjugate. Theprotein’s bioactivity can be partially/totally impaired by steric hindrance of the activesite.

DexOx has reached a phase III clinical trial1 as a conjugate to somatostatin (sms).Somatostatin-receptors positive tumours can be targeted by sms which triggers cyto-static and cytotoxic effects. However, natural sms has a short in vivo half-life due to1Personal communication from Anders Holmerg “During 2010 sms-D70 will enter a registration phase(in Mexico) and will hopefully be given "orphan drug status"”.

10


enzymatic degradation. The conjugation to a mildly oxidised dextran, recurring to re-ductive amination, was able to achieve ~27 hours of plasma residency in mice [46] andwas still able to maintain the same degree of affinity with every receptor [47]. The phaseI clinical trial assessment of plasma concentrations and tolerability, showed the conjugateto be well tolerated but the limiting dose was not established. However, no responseswere found [8]. Though, the concept of increasing the plasma half-life of a small proteinwas demonstrated, a few issues related with the conjugate nature, were not addressed.The authors estimated a ratio of four sms per dexOx chain. This high ratio might havehelped retaining the conjugate activity, because the sms active site has a lysine, likelyreacting with the aldehydes.

Figure 1.3.: Schematic example of oxidised dextran conjugated to (A) small molecules(doxorubicin); (B) proteins; (C) antibodies, used in immunoconjugation. Aldehydehighlighted with red circle

A more detailed study, involving the human growth hormone (hGH) - dexOx conjugate,successfully yielded a pro-drug formulation with sustained release. The release wasdependent on the imine bond, while the reduced imine failed to release any hGH. Theconjugate was shown to be stable at 4 °C for up to 10 days and that could be storedfrozen (-70 °C) without activity loss. This evidence broadens the thermo-stability windowconferred by dexOx. The release kinetics of hGH from dexOx is correlated with thedextran oxidation degree and directly affects the half-life of the conjugate. The in

11


vivo studies confirmed the increased circulation period, at higher dose, for two days,when compared to the bolus injection [48]. The authors established a strong correlationbetween the oxidation degree and the extent of complex formation, which they believeis favoured by the higher percentage of doubly oxidised residues, compared to the singlyoxidised residues, which are suggested to be under hemiacetals.

DexOx appears to be an interesting alternative to PEG, the industry gold standardfor protein pharmacokinetics modulation. The simple mix reaction yields a reversibleconjugate, which can be reduced to a stable and irreversible amine in one simple step.The half-life of such conjugates is dependent on the nature of that bond, but mostimportant is the stability and environmental protection conferred by dexOx, enhancingthe delivery to target sites, with reduced systemic toxicity. Other examples of protein –dexOx conjugates can be found on Tab. 1.2.

1.3.1.3. Immunoconjugates

The linearity of dextran’s chain and the wide range of molecular weights available, asso-ciated to the multiple functionalities brought by periodate oxidation, allows the multipleconjugation of different chemical entities. As described earlier, small pharmaceuticals,are devoid of tissue specificity, leading to systemic toxicity. However, the simultaneousconjugation with an antibody (immunoconjugate), can increase the therapeutic efficacyon the target tissue (Fig. 1.3C).

To overcome the toxicity of the chemotherapeutic agents, and to improve their tis-sue selectivity, antibodies directed against the tumour cells can be used. Daunomycin(similar to doxorubicin) was the chosen anticancer agent. The tumours were injectedintraperitoneally, so as the immunoconjugates. But the intravenous route was found toyield better results for the immunoconjugates and has being important on the therapysuccess. However, the immunoconjugates still failed to achieve better results than thedrug – dexOx conjugate alone, in two experimental murine tumour systems [49]. Onother study by the same authors, they achieved improved results with the immunocon-jugate, this time with the monoclonal antibody (mab) against rat α-fetoprotein. Underthe experimental conditions used, the immunoconjugate was more efficient impairing thegrowth of α-fetoprotein-producing tumour cells, than daunomycin alone or conjugatedto dexOx [50, 51]. Indeed, this system was successful in decreasing, hepatoma cellstransplanted intraperitoneally, in rats. When administered intravenous, the immunocon-jugate achieved better results, than through the intraperitoneal route. The success was

12


attributed to the lower toxicity of the daunomycin on the conjugated form and the higherspecificity of the antibodies [52].

These last set of examples, render dexOx as an interesting choice to increase the efficiencyof pro-drugs. The final setup has extended plasma residency periods, reduced systemictoxicity, improved the target specificity and increased therapeutic activity.

1.3.1.4. Gene-Delivery

Gene therapy expectations, as the next medicine revolution, have had their downturns.The promising viral gene therapy, still with the highest transfection efficiencies of allthe available techniques, suffered major setbacks, in a pioneering treatment for severecombined immunodeficiency diseases [53]. Therefore, while viral gene therapy is beingimproved, other less pathogenic and immunogenic non-viral approaches have been ex-plored. A comprehensive review on this subject can be found elsewhere [54]. Withinthe context of polyplexes (DNA/polymer complexes), polyethylenimine (PEI) has beenconsidered the gold standard in gene delivery, because of its excellent transfection ef-ficiencies [55, 56]. The dexOx-based strategy grafted oligoamines to the dexOx chain,capable of complexing genetic material. The influence of dextran molecular weight, theoxidation degree extension, several oligoamines and the transfection efficiencies of theobtained polyplexes were screened [57, 58]. Despite most of the combinations, yieldstable polyplexes, only a few were active in transfecting cells. The tetramine, spermine,conjugated to dexOx, was identified as the best transfection vector [57, 59]. Histopatho-logical assessment revealed mild toxicity in the muscle and no abnormal finding in liveror lung, as well as no systemic toxicity was observed [60]. Certain conditionings mayincrease the transfection yield, not only formulation-wise but as well environmentallyrelated. Mesenchymal stem cells, cultured on 3D scaffolds (collagen reinforced withpolyglycolic acid) were more susceptible to transfection than when cultured on normalsurfaces. The 3D environment provides higher surface area for cell attachment, spread-ing and proliferation, strongly affecting and increasing these cell events, periods whencell are more susceptible to transfection [61].

Interestingly, the same polycations, were identified as being effective in eliminating thepathological conformation of the cellular prion protein, responsible for self-propagatingthe refolding of the normal prion protein and developing into neurodegenerative diseases,known as spongiform encephalopathies [62].

13


Table 1.2.: DexOx-based drug delivery strategies, overviewing the conjugation method,strategy followed and dexOx characteristics.

Active factor Conjugation KindTherapeutic Application

Scope

Mw1

(kDa)

OD2

(%)Ref.

Acyclovir ImineAnti-viral; Hepatitis B; Increase

circulation32 - 42 (200) [63]

ProcainamideImine / Amine

(NaBH3CN)Antiarrhythmic agent; Prodrug 43 33 - 90 [64]

Amphotericin BAmine

(NaBH4)

Antifungal agent; Assessment of

conjugate stability and activity40 1.5 - 52 [7]

Amphotericin B Imine Antifungal agent; Injectable hydrogel 100 - 200 33 – 75 [65]

NystatinImine / Amine

(NaBH4)

Antifungal agent; Stable water-soluble

conjugate9 - 74 5 - 50 [66]

5-aminosalicylic

acid

Amine

(pyridine–borane)

Chron’s disease; Sustained and targeted

delivery6 - 500 12 – 93 [36]

Asulacrine /

EllipticineHydrazide spacer

Anticancer agent; Increase solubility

and targeting40 ~18 [28]

Cationic

dextranAmine (NaBH3CN)

Anticancer; Attack cell surface sialic

acid70 (57) [67]

DoxorubicinAmine

(NaBH4)

Cancer chemotherapy; Nanoparticles

with antitumor efficacy10 n.a. [68]

Doxorubicin-

HCl

Hydrogen bonds; to

tertiary amines

(NaBH4)

Anti-tumor specific delivery; DexOx as

the core of polypropylene amine

dendrimers.

60 (100) [69]

PingyangmycinPhysical

entrapment

Chemoembolisation; Gelatin

microparticles40 78.8 [70]

Indomethacin

Hydrophobic

interaction with

cholic acid

Non-steroidal anti-inflammatory drug;

DexOx/Cholic acid hydrazide micelles.

Self aggregating particles

4029.2;

46.5[71]

NaproxenInclusion complexes

in ß-Cyclodextrins

Anti-inflammatory; Improve in vivo

efficacy; DexOx grafted with

ß-Cyclodextrin. (NaBH4)

70 (~76) [72]

14



Scope

Mw1

(kDa)

OD2

(%)Ref.

Mitomycin C ImineSolid tumours; oxidised sulfopropyl

dextran microspheresSephadex n.a. [73, 74]

DoxorubicinAmine

(NaBH4)

Anticancer; Systemic accumulation

profile

10; 70;

500n.a. [42]

Kanamycin,

Isonyazide

Imine and

hydrazoneTuberculose; Sephadex drug reservoir Sephadex n.a. [75]

Oligosaccharides HydrazoneStudy carbohydrate mediated

interactions500 50 [76]

Iron (III)Complexation in

alkaline solutionAntianemic; Iron repository n.a. 26 - 43 [77]

Rhenium-188

Cysteine grafting

(NaBH3CN).

Gluconate as

transchelator

Contrast agent; Nuclear oncology;

Improve contrast agent availability70 (22) [78]

99mTc

Complexation

through cysteamine

grafting (NaBH4)

Contrast agent; Nuclear oncology;

Improve contrast agent availability60 - 90 ~ 6 [27]

Histidine Amine (NaBH4)Controlled release system; Enhance

osmotic activity40 ~ 100 [79]

Aminoguanidine;

AgmatineAmine (NaBH3CN)

Anti-tumour agent; Increase therapeutic

efficacy70 (59) [80]

Glucose oxidase Amine (NaBH4)Interfacial protection; Activity

preservation

6; 20;

150;

1000

(100) [43, 81]

Catalase Amine (NaBH4)Activity preservation; Stabilisation of

multimeric proteins6 20; 100 [44]

L-asparaginase Amine (NaBH4)Activity preservation; Stabilisation of

multimeric proteins20 (100) [45]

Several proteins Amine (NaBH4)Protein stabilisation. Detect

protein-protein interactions1.5; 6; 20 (100) [82]

15



Scope

Mw1

(kDa)

OD2

(%)Ref.

Pullulanase,

Amylase,

Cellobiase

Amine (NaBH4;

NaBH3CN)

Thermal stabilisation; Enzyme activity

preservation

10; 40;

70; 500;

2000

(100) [83, 24]

Cellobiase

Amine (NaBH4;

NaBH3CN;

(CH3)2NBH3)

Stabilisation and rigidification of the

protein 3D structure70 (100) [33]

Lipase B

Amine

(NaBH4;

NaBH3CN)

Improve thermal stability activity 40, 250 (>100) [84]

SomatostatinAmine

(NaBH3CN)

Somatosatin receptor positive tumours;

Improve circulation time, maintain

activity

70 - 75 (25)[46, 8,

47]

Growth

HormoneImine

Increase therapeutic efficacy; Sustained

release, reduce high-dosing1 - 100

6, 31,

50, 64[48]

Hemoglobin ImineBlood substitution; Plasma

expander/oxygen delivery200- 275 (56) [85]

Hemoglobin;

deoxyhe-

moglobin

Imine / Amine

(NaBH3CN/NaBH4)

Blood substitution; Plasma

expander/oxygen delivery10 – 40 n.a.

[86, 87,

31, 88]

Factor IX;

Protein CImine

Blood clotting; Increase plasma

residency10 n.a. [89]

mabT101 Amine (NaBH3CN)Tumour targeting; Reduce

immunogenicity6 (190) [90]

Fab fragments Amine (NaBH3CN)Tumour targeting; Reduce

immunogenicity6 (190) [91]

mabT1010;

DoxorubicinAmine (NaBH3CN) Solid tumours; Immunoconjugate n.m. n.a. [92]

nucleotide

analogue;

anti-IgM

Amine (NaBH3CN) B leukemia cells; Immunoconjugate10, 40,

50n.a. [93]

Daunomycin; 2

6= antibodiesAmine (NaBH4) Solid tumours; Immunoconjugate

10, 40,

50n.a. [49]

16



Scope

Mw1

(kDa)

OD2

(%)Ref.

Daunomycin;

mab/pabAmine (NaBH4) Solid tumours; Immunoconjugate 10 n.a.

[50, 52,

51]

Adriamycin

(Doxorubicin);

mab

Amine (NaBH4) Tumour targeting; Immunoconjugate 40 25 [94]

99mTc; EGF Amine (NaBH3CN)

Radiotherapy of EGF receptors

expressing tumours;

Immunoconjugate-like

10 (46) [95]

99mTc;

anticytokeratin

mab

99mTc-dextran

complex; Imine

Radio imaging

Immunoconjugate10 n.a. [96]

p-Nitroaniline Amine (NaBH4)nonlinear optical chromophores

Increase thermo and photostability150 ~7 [97]

1 - Native dextran molecular weight; 2 - When the real OD was not determined, the theoretical OD is

mentioned in brackets; n.a. – not applicable; n.m. – not mentioned

1.3.2. Hydrogels

The hydrophilic nature and reactivity of oxidised dextran has been exploited on thesynthesis of hydrogels (Fig. 1.4A), either has the main backbone or has a cross-linker.The existing aldehydes, offer complementary reactivity towards amines, hydrazides andhydroxyl (on acidic media) groups, avoiding the need for chemical initiators or otheradjuvants. Other initiator-free cross-linking methods, include the pairs thiol/acrylate[98] or hydroxyl/isocyanate [99], however, the latter has to be prepared on an aproticsolvent, because of the prompt reaction of water towards the isocyanate group. A verycomprehensive review on cross-linking methods of hydrogels can be found elsewhere[100, 101], as well as a more specific review on biodegradable dextran hydrogels [6].

Gelatine was one of the first materials, cross-linked by dexOx, to yield a hydrogel [30].As a protein, it contains lysines, responsible for the cross-linking. This initial study,identified a set of conditions, related to dexOx, responsible for the decrease in gelationtime, such as the increase of the oxidation degree and the increase of the dextran Mw.

17


The OD increase presents higher concentration of reactive species, speeding up thereaction and reducing gelation time. The onset of reaction can also be controlled by themedia pH, ionic strength and temperature [30, 102]. This formulation was evaluatedas a hydrogel film, for the controlled release of several proteins (BSA and EGF). Theprotein molecular weight and the lysine content influenced their release profiles. Asthis system is susceptible to interact with proteins, it retained BSA much easier (68kDa; 60 Lys residues) than EGF (6 kDa; 2 Lys residues) [103]. This system proved tohave an acceptable biocompatibility, after direct comparison with commercially availablewound dressing materials, after in vitro cytotoxic evaluation and by in vivo subcutaneousimplantation in mice [37].

The chitosan derivative, carboxyethyl chitosan (CEC) which, contrary to the native chi-tosan, is readily soluble in non-acidic aqueous media, yields versatile hydrogels [104]. Thehydrogels of dexOx and CEC have fast gelation rates (30 – 600 seconds), depending onthe polymers concentration, feed ratio and mixing temperature and could be modulatedto closely match the mechanical properties of the tissue of interest. The growth factorsfree hydrogel, promoted adhesion and growth of encapsulated mouse fibroblasts. It alsoaccelerated wound healing on a mice full-thickness transcutaneous wound model [105].

Our research group has approached the dexOx cross-linking with adipic acid dihydrazide(AAD). That formulation yields hydrogels with tuneable gelation rates, mechanical prop-erties, porosity, swelling ratios and dissolution profiles. The feed concentration of dexOxor AAD as well as the dexOx OD, control the hydrogels characteristics [14], furthercharacterised on chapter 5. Other compatible crosslinkers (such as PEI) were also ap-proached (Fig. 1.4A), but without complete characterisation.

Figure 1.4.: (A) DexOx-based hydrogels cross-linked with nanoparticles of PEI (unpub-lished data); (B) SEM imaging of dexOx-based microparticles, cross-linked with AADand prepared in an all-water emulsion as described in chapter 6.

18


1.3.3. Particles

The use of dexOx on other configurations such as particles (Fig. 1.4B) can be useful ondrug delivery and could have advantages, over prodrugs or hydrogels matrices, yieldinghigher therapeutic efficacy. Particles have higher surface to volume ratios, than hy-drogels, allowing higher control over the drug release. Like the hydrogels, the dexOxparticles, can be prepared by cross-linking with N-nucleophile polymers, such as chitosan[68] or gelatine [70, 106]. As with the several strategies described on the design of pro-drugs, dexOx is susceptible of modification, broadening the strategies on the productionof particles. The grafting of moieties that promote self-aggregation and stabilisation ofthe particles, is commonly used with polymeric biomaterials and some examples can befound with dexOx as the core polymer. Methyl polyethylene glycol (MPEG) was graftedto dexOx, sterically stabilising the nanoparticles, allowing the aldehydes to bind BSA[107]. A micro emulsion method was used to prepare nanoparticles of chitosan and adexOx-doxorubicin reduced conjugate, which yielded monodispersed particles with ~100nm of diameter [68]. Other interesting approach for doxorubicin, used dexOx as thedendrimeric core [69]. The several aldehyde moieties were reacted with polypropyleneamine, which was subsequently reduced with sodium borohydride.

A more detailed review on nanoparticles will be presented on chapter 3.

1.3.4. Surfaces

Biomedical devices require surface biocompatibility as they will be in contact with physio-logical environment. Therefore, the inertness of dextran render it appropriate for surfacecoating strategies. Silicon is a widespread material in biomedical devices, which can befurther modified. The silanisation, for example, with aminopropyldimethylethoxy silane(APDES) [108] or aminopropyltriethoxy silane (APTES) [109, 110, 111, 112], can beused as an intermediary step for the consequent coating of the aminated surfaces. Byreductive amination, dexOx can be reverted to a dextran-like inert state, limiting celladhesion and spreading [109]. However, after a second periodate oxidation and graftingof specific peptides, such as RGD [111], it is possible to redirect the dexOx coating toany kind of specific surface bioactivity, by the proper grafting of specific biomolecules.Indeed, the grafting of the laminin-based peptide, IKVAV, promoted substantial neu-ral cell adhesion and reduced fibroblast and glial cell adhesion. This kind of approachcould lead to the development of guiding surfaces for the neurite outgrowth [112]. But it

19


could also be used to minimise the effects of glial scar tissue on neural recordings in deepbrain electrodes. On another work, dexOx was used to bridge a polylysine surface andlaminin/TGF-ß1 (transforming growth factor). The grafted TGF-ß1 was successful inavoiding the glial scar through decrease of the astrocytes proliferation on the electrodes(Fig. 1.5) [113].

Figure 1.5.: Surface coating of biomedical devices by dexOx, bridging laminin/TGF-ß1.Adapted with permission from reference [113], artwork by Matthew Kruback.

A final and different example, where the coated surface was not aminated, came from thegecko-inspired surface based on poly(glycerol sebacate acrylate), which was spin-coatedwith dexOx. It increased the interfacial adhesion on biological tissues [114], through theexposed amine groups of the target tissue, skin.

Table 1.4.: DexOx-based applications involving 3D matrices or surface coatings.

ApplicationApplication /

DrugScope & Strategy

Mw1

(kDa)

OD2

(%)Ref

Hydrogel NoThorough characterisation; Gelatine XL;

Imine10 - 500 5 - 70

[30,

102]

Hydrogel NoThermal and rheological properties;

Gelatine XL; Imine70 5 – 20 [115]

Hydrogel EGF; BSAIn vitro release study; In vitro and in vivo

biocompatibility; Gelatine XL; Imine70 5 – 20

[37,

103]

20




Mw1

(kDa)

OD2

(%)Ref

Hydrogel Tissue adhesive

Characterisation and comparison to fibrin

glue; Ethylenediamine modified gelatine XL;

Imine

200 15 - 70 [116]

Hydrogel

3D vascular

tissue

engineering

EC growth on 2D; SMC growth on 3D;

Gelatine XL; Imine; IPN with glycidyl

methacrylate

400 –

50014 (9) [117]

HydrogelSupport in vitro

growth

General characterisation; Gelatine, chitosan

or BSA as XL; Amine (NaBH4)40 n.a. [118]

HydrogelEnhanced

wound healing

Mechanical; physico-chemical; biological

characterisation; N-carboxyethylchitosan

XL; Imine

765, 15,

25

[104,

105]

Hydrogel None Gelation rate; Succinyl-chitosan XL; Imine 60 – 90 16 - 82 [119]

Hydrogel Bone glue

Chemical, biological and biomechanical

characterisation; Modified chitosan XL;

Imine

15 – 20 40 [120]

Hydrogel

Corneal

incisions and

tissue adhesive

Biological and functional characterisation;

8-arm PEG amineXL; Imine10 50

[121,

122,

123,

124, 39]

HydrogelHemorrhage

sealant

Physico-chemical, mechanical and blood

coagulation characterisation; Polyallylamine,

Chitosan or Glycol chitosan XL; Imine

100 –

20036 - 88 [125]

Hydrogel Amphotericin BSelf-gelling hydrogel;

Carboxymethylcellulose hydrazide XL

100 –

2005 – 75 [65]

Hydrogel

Prevent

peritoneal

adhesions

Self-gelling hydrogel;

Carboxymethylcellulose hydrazide XL70 n.a. [38]

HydrogelClinical

diagnostics

Protease detection by degradation rate;

Protease-sensitive peptides XL2000 107 [126]

Nanoparticles DoxorubicinImprove therapeutic efficacy (ø ≈ 100 nm);

Chitosan XL; Amine (NaBH4)10 n.a. [68]

21




Mw1

(kDa)

OD2

(%)Ref

Microparticles PingyangmycinSynthesis, characterisation & in vitro

release (ø ≈ 50 - 200 µm); Gelatine XL40 78.8 [70]

Microspheres

AIDS related

pneumonia;

TAPP-Br

Synthesis, characterisation & in vitro

release (ø ≈ 80 - 120 µm); Gelatine XL70 81.7 [106]

NanospheresProteins

delivery; HSA

Synthesis and characterisation; (ø < 200

nm); MPEG modified dexOx; Albumin XL70 47 [107]

Micromicelles Indomethacin

Self-aggregating particles. Synthesis,

characterisation & in vitro release (ø ≈ 500

nm); DexOx-grafted cholic acid

40 46 [71]

Microparticles Mitomtcin C

High-load delivery, drug stability and

reduced toxicity (ø ≈ 100 µm); Oxidised

sulfopropyl dextran

Sephadex n.a.[127,

73, 74]

Magnetic

nanoparticles

Delivery of

biomolecules

Synthesis and (ø ≈ 8 nm); Iron-dextran

conjugated particles, activated by oxidation40 48 [128]

Dendrimers Doxorubicin

Synthesis, biological characterisation, drug

release and selective cell-uptake;

Polypropylene imine-grafted dexOx

(NaBH4) with encapsulated drug

60 (100) [69]

NP coatingProtein

stabilisation

Prevent GOX inactivation, immobilized on

magnetic nanoparticles; DexOx coating

(NaBH4)

20 (180) [81]

Surface

Possible

immobilisation

of proteins

Modification of aminated matrices;

Aminated matrices; Enzacryl AA/AH10, 40

(6 –

20)[129]

Surface

Biocompatible

non-fouling

surfaces

Prevent protein fouling; Functionalised

silicon with APDES; dexOx coating

(NaBH3CN)

10 6 – 100 [108]

Surface

Control

interactions at

tissue/material

interface

Control surface reactivity by oxidation

extension; Functionalised silicon with

APTES; dexOx coating (NaBH3CN)

110 20 - 50 [110]

22




Mw1

(kDa)

OD2

(%)Ref

Surface

Control cell

adhesion; RGD;

IKVAV)

Limit and promote specific cell adhesions

and growth; Functionalised silicon with

APTES; dexOx coating (NaBH4)

40, 70 (50)

[109,

111,

112]

Surface TGF-ß1

Decrease astrocyte adhesion and

proliferation; Functionalised silicon with

APTES, or poly-L-Lysine; dexOx coating

(NaBH4)

40 (20) [113]

SurfaceBiomedical

devices coating

Gas-plasma n-heptylamine deposition;

dexOx coating of aminated surface

(NaBH3CN)

9, 74,

515,

2000

17 -

100[130]

SurfaceImmunochemical

microarrays

Increase detection sensitivity; Aminated

surface (APTES) dexOx dipped

(NaBH3CN)

20 4 [131]

SurfaceOligosaccharide

probes

Improve carbohydrate-mediated molecular

interactions; Hydrazide-linked

monosaccharides to dexOx

500 (50) [76]

SurfaceRennin &

Protein A

Improve performance as hydrophilic spacer;

Aminated Agarose support; (NaBH4)6; 20 (50) [132]

Surface Lysozyme

Particles coated with dexOx for the

immobilisation of lysozyme; Amino-Silicate

carrier

35, 170

2000(200) [133]

Surface

Improve ELISA

hapten immuno

detection

dexOx acts as long spacer, permitting easy

hapten recognition; DexOx bridging hapten

and BSA for immobilisation

20 20 [134]

SurfaceGecko-inspired

tissue adhesive

Topography and dexOx reactivity (tissue

amines) provide adhesiveness; poly(glycerol

sebacate acrylate) surface, coated with

dexOx, hemiacetal bonding

70 14 [114]

1 - Dextran native molecular weight; 2 - Real oxidation when estimated or theoretical oxidation in brackets; XL - cross-linker; n.a. - not available

23


1.4. Conclusion

Since the approval of dextran as a plasma expander, over 60 years ago, this polysaccharidehas seen many different uses in pharmaceutical sciences. The mild oxidation of dextran,by the periodate ion, yields a very reactive macro-monomer towards N-nucleophilescompounds. It does an interesting job in increasing the solubility, half-life and therapeuticefficacy of small pharmaceuticals. Concerning proteins, dexOx preserves the stability andactivity across a wide range of temperatures, providing sustainable release in vivo, aslong as the imine bond is not reduced. In fact, dexOx has entered the clinical stage,as a carrier of somatostatin, opening the door for other suitable formulations to becommercialised, with the advantage of having a very competitive price compared toother biomedical relevant polysaccharides. The properties of oxidised dextran have alsobeen used on series of different approaches for the design of hydrogels, particles and isan interesting option in surface coating.

However, the consequences of mild periodate oxidation are not fully understood. Theperiodate oxidation leads to dextran degradation which has strong consequences on themacro-monomer’s characteristics affecting the solutions viscosity and affecting injectabil-ity.

The assessment of the real OD after periodate oxidation is vital for the design of drug-conjugate formulations, hydrogels or other approaches, therefore, the questions raisedabout the amount of aldehydes reacting is extremely important.

Some of these issues will be approached on chapter 4 and chapter 5.

24

2. Pro-Angiogenic Therapies

Impaired-angiogenesis associated pathologies, such as ischemic heart disease (leadingcause of death worldwide in 20041), wound healing or stroke, have a high-burden onsociety. Regenerative medicine is getting closer to offer some solutions, however, theregeneration of vascular tissues via polymeric-based strategies is yet to see successfuloutcomes [135]. Different approaches can be found on the literature, which include thedelivery of one or more specific growth factors [136], the incorporation of bio-mimeticmotifs on the polymeric structure [137] or the delivery of specific cells [138, 139]. Usually,the design strategy of polymeric matrices contemplates, not only the final application, butas well the specific growth factors or cell type which are being delivered. In this section,the VEGF biology, VEGF-delivery-based approaches, as well as cell-based strategies, onpro-angiogenic therapies, will be overviewed.

2.1. VEGF in Health and Disease

Angiogenesis is the phenomenon by which de novo blood vessels are formed. It is ob-served during embryogenesis, constituting the first organ in the embryo. In the adultstage, when dysregulated, the newly formed blood vessels contribute to numerous ma-lignant disorders, such as tumours and some non-tumoural pathologies, like age-relatedmacular degeneration [140]. The existence of angiogenic factors was initially postu-lated on the basis of the strong neovascular response induced by transplanted tumours[141]. Many molecules have been implicated as positive regulators of angiogenesis, in-cluding acidic or basic fibroblast growth factor (FGF), TGF α and β , hepatocyte growthfactor (HGF), tumour necrosis factor α (TNF-α), angiogenin, interleukin 8 (IL-8) andangiopoietins [142]. Over the past 20 years most of the research has been devoted tothe research and understanding of the biology of the vascular endothelial growth factor(VEGF). VEGF is a heparin-binding growth factor specific for vascular endothelial cells1World Health Organisation. The Global Burden of Disease - 2004 update

25

Chapter 2 Pro-Angiogenic Therapies

that is able to induce angiogenesis in vivo, described for the first time in 1983 [143] andfully characterised and sequenced in 1989 [144]. A very comprehensive historic perspec-tive of the quest for angiogenesis and its most important players can be found elsewhere[145].

The identification of clear targets on the development of angiogenesis, such as VEGF,allowed the design and development of new therapies. Such anti-angiogenic therapiesaddress pathologies where the dysregulated blood vessel formation could be hindered,preventing pathology development and hopefully leading to cure. The predominant roleof VEGF in angiogenesis led to the development of anti-angiogenic agents targetingsoluble VEGF (e.g. Avastin - humanised variant of an anti-VEGF antibody), arrestingangiogenesis and stoping the blood flow to nourish the growing tumour [146].

VEGF has been related to vascular permeability events in acute/chronic inflammation,cancer and wound healing. Indeed, it was formerly called vascular permeability factor(VPF), exactly because of its propensity in inducing vascular permeability and leakage.The use of VEGF, in clinical settings, where a pro-angiogenic response is necessary, hasalso been addressed. Unfortunately, clinical trials testing the pro-angiogenic potentialof VEGF alone, have not had the expected results [147, 148]. Part of this failure isattributable to suboptimal delivery strategies. Stimulating the growth of durable andfunctional vessels is a more formidable challenge than previously anticipated. Recentadvances in therapeutic neo-vascularisation, applied to ischemic disease states, focuson better delivery of growth factors or combination of several angiogenic entities, ad-dressing better mimicking of natural healing processes. These strategies can involvemulti-growth factor delivery in different spatio-temporal windows and encapsulation ofcells in bioresponsive polymeric matrices.

This review will briefly overview VEGF’s biology and role in the complex and coordinateprocess of angiogenesis. The main focus will be on the most recent and relevant studiesdealing with the VEGF delivery on a therapeutic setting and new perspectives on cell-based therapies.

2.2. VEGF Biology

Vascular endothelial growth factor is a homodimeric glycoprotein with a variable Mw. TheVEGF family includes VEGF121, VEGF165 (usually referred solely as VEGF), VEGF189,VEGF206 (among other isoforms) and a structurally related molecule, placental growth

26

2.2 VEGF Biology

factor (PlGF). This gene family has a unique role in controlling growth and differentiationof multiple components of the vascular system. Lymphatic angiogenesis, for instances,is regulated by VEGF189 and VEGF206 [149, 150]. The VEGF gene is split among eightexons and the different isoforms arise from alternative exon splicing events [151, 152].The shortest isoform, with 121 amino-acids is an acidic protein with no affinity towardsheparin (low extracellular matrix affinity) and is freely diffusible. The 165-amino-acidsisoform (38 kDa) has some heparin affinity and is the most similar to the native VEGF (45kDa). The other isoforms (189 and 206) are highly basic and are completely arrested bythe extracellular matrix (ECM) [153]. The ECM bound isoforms have plasmin cleavablesites which allow to reestablish the soluble VEGF pool upon ECM remodelation anddegradation by growing vascular vessels (Fig. 2.1) [154]. This plasmin-cleavable VEGF

Figure 2.1.: Schematic organisation of the VEGF gene and most common VEGF iso-forms, result of alternative splicing events. Adapted from [155].

fragment, has no affinity towards heparin, compared to VEGF165 [153]. This isoform isnot so strongly bound to the ECM as the heavier isoforms, existing on an equilibrium witha soluble form, showing optimal characteristics of bioavailability and biological potency.The different isoforms with differential affinity towards the ECM allow the creation ofa VEGF gradient able to guide new vessel growth, having impact on development andpatterning of the vascular system [155].

There are several cell receptors which are responsible for mediating VEGF activity [142](Fig. 2.2). The VEGF receptor 1 (VEGFR1 or Flt1) binds preferentially to VEGF165 andVEGF121 but also to PlGF. The signalling properties seem to evolve throughout the de-velopment stage, but it was also proposed that it could lure VEGF from any mitogenicactivity by preventing from binding to other receptors [156]. This down-regulation is

27


Figure 2.2.: The role of the different VEGF receptors. Based on reference [142]

accompanied by a soluble spliced variant of VEGFR1 (sVEGFR1). The major media-tor of the angiogenic enhancing effects is VEGF receptor 2 (VEGFR2, Flk1 or KDR).Upon VEGF binding, VEGFR2 dimerises and propagates its signalling through severalphosphorylation cascades, resulting in mitogenic, chemotactic and prosurvival responses(Fig. 2.3) [157, 158, 159]. Other interesting receptors are Neuropilins (NRP 1 and 2)which are also implicated in neuronal guidance. Neuropilin dimerises with VEGFR2 uponVEGF165 binding, mediating chemotaxis. The interesting similarities between the vascu-lar and neuronal networks throughout the body and the shared processes are reviewedelsewhere [160].

VEGF is known to activate most of the signalling pathways in endothelial cells andguiding cell fate (Fig. 2.3). It plays an important role in non-pathological conditions, asautocrine VEGF is necessary for in vivo cell survival and consequently, for the homeostasisof blood vessels in the adult [161]. After subjecting endothelial cells to serum starvation,it was observed that VEGF acts as an important survival factor. Promotes survivalactivity through, phosphatidylinositol 3-kinase (PI3K)/Akt signal transduction pathway,preventing apoptosis induced by serum starvation [157]. It was also shown to haveneuroprotective activity, by increasing the VEGFR2 expression, stimulating the activationof the PI3K/Akt and ERK-1/2 pathway [162].

The VEGF binding to VEGFR2 leads to receptor dimerisation, internalisation through

28

2.3 Therapeutic Angiogenesis

Figure 2.3.: VEGF pathways taken from http://david.abcc.ncifcrf.gov/.

endocytosis and consequent signal transduction. The VEGF matrix immobilisation, im-pairs this event, but leads to prolonged activation kinetics of VEGFR2 which recurs to β1-integrin dimerisation for signal transduction. This phenomena leads to different VEGFR2

phosphorylation patterns and enhancement of the p38/MAPK (Mitogen-activated pro-tein kinase) cascade [163], leading to actin reorganisation and inducing cell migration(Fig. 2.4).

The thorough knowledge of VEGF’s biology is of utmost importance on the design ofdelivery strategies. VEGF is a very potent mitogen, with half-lifes below 30 minutes[164] and the fast consumption leads to low therapeutic efficacy, claiming for betterdelivery efficiency [147, 148].

2.3. Therapeutic Angiogenesis

Several unmet medical needs strive for normal vascular perfusion. Pro-vascularisationtherapies are expected to bring benefit on the healing response, by the organism. Patholo-gies like peripheral vascular disease, ischemic heart disease, wound healing, as well ascell and tissue transplants, could be addressed by such therapies [135].

In the complexity of the angiogenic process, VEGF is one of the most important players.It induces activation, promotes the migration and guides the proliferation of endothelialcells on the sprouting of new vessels. However, the sprout and proliferation of endothelialcells is not enough to yield mature vessels. Smooth muscle cells (SMCs), are alsoessential on the development of mature vessels. These cells will accommodate and

29


Figure 2.4.: β1-integrin is required for clustering and continued internalisation of VEGF-R2. Adapted from [163].

stabilise the new vessels, forming new extracellular matrix and inhibiting the new sproutsregression [165]. Approaches, such as the dual delivery of VEGF and SMC specific growthfactors, with distinct release profiles, can lead to the formation of mature vasculature ascompared to either of the growth factors delivered alone or simultaneously [166, 136].

Parallel to this research, the last decade has seen the rise of improved pro-angiogenic cell-based therapies, due to the identification of new cell populations from different sources,with high therapeutic potential. The identification of endothelial progenitor cells (EPC),among peripheral blood mononuclear cells, which migrate/proliferate to neovascularisa-tion sites and differentiate into endothelial cells in situ, oppened new lines of research[167]. This event has been observed to be induced by angiogenic factors, includingVEGF [168]. The therapeutic potential of EPCs was first assessed in a mice hindlimbischemia model, where exogenously administered EPCs improved neovascularisation andenhanced functional recovery [169].

It is highly relevant to be aware of the pathological settings and the disease’s biol-ogy, upon delineating strategies for regenerative medicine approaches in order to mimicphysiological signalling and achieve biologic functionality. Some of the most relevant ap-proaches involving VEGF polymeric delivery systems will be addressed, as well as recent

30


achievements in cell-based approaches, in the context of therapeutic angiogenesis.

2.3.1. Polymeric Matrices-Based Strategies

The tissue regeneration/engineering strategies usually fall into three categories, con-duction, induction and transplantation of cells. Conductive strategies design implantablebiomaterials that can provide structural support for ingrowth of the desired healthy hostcells. Inductive strategies, include growth factors within the polymeric matrices, toenhance cellular ingrowth events, promoting better tissue regeneration. The transplan-tation of cells, together with the constructs, expects their participation on the tissueregeneration process [170]. Most of the strategies to be reviewed shortly, fall within thelatter two categories.

A key challenge in engineering functional tissues is the limited capacity of oxygen andnutrients transport into the tissue, which is confined to the maximum diffusion distanceof oxygen and nutrients ≈ 100 μm [171, 172]. The use of VEGF within the scaffolds hasbeen seen as a key factor in promoting angiogenesis and initiate the vascularisation pro-cess. The rationale is to mimic key aspects by which the ECM controls the bioavailabilityand signalling activity of VEGF in the body.

2.3.1.1. Diffusion Controlled

The incorporation of VEGF in polymeric matrices leads to a diffusion-dependent release,controlled by the hydrogel’s micro-viscosity, unless the matrix has some kind of affinitywith the growth factor. Several cellulose derivatives, with or without ionic charge, havebeen assessed for the topical delivery of VEGF. More than viscosity or micro-viscosityof the hydrogels, the release can be controlled by the interactions of VEGF with thepolymeric chain. Possible structural similarities between carboxymethyl cellulose (CMC)and heparin have been observed to retard the release of VEGF, when compared tohydrypropyl cellulose (HPMC) or methyl cellulose (MC) [173].

More complex hydrogels, prepared by UV-cross-linking in the presence of polyethyleneglycol diacrylate (PEGDA) and allyl isocyanate-grafted dextran, having VEGF mixedwith the feeding solutions, were studied. Dextran was further modified with amine,carboxilic and methacrylate moieties to increase the hydrogel potential. The differentfunctionalities were able to modulate the VEGF release. The aminated matrices showed

31


a 20% burst release, compared to all the other ones, where VEGF remained mostlyentrapped within the scaffold [174].

However, none of this strategies relies on a strong interaction of VEGF with the matrixand the release mechanism is mainly diffusional.

2.3.1.2. Covalent Immobilisation

Providing a sustained release by simple diffusion usually leads to non-controlled burstreleases and high VEGF concentrations on the implantation loci which could promotevessels malformation. The rationale, behind VEGF immobilisation is related with theinduction of cell growth, mimicking the ECM-immobilised VEGF isoforms. The immo-bilisation can be based on reversible or irreversible covalent bonds, regulating VEGFrelease or not.

An uncommon approach immobilised VEGF by recurring to glycosilated species of VEGF.The carbohydrate moiety was periodate-oxidised and further covalently linked to a hy-drazide modified PLGA surface by the reversible hydrazone. VEGF was also boundby carbodiimide chemistry to the PLGA surface. The immobilisation was mediated bydihydrazide spacers of different lengths, which modulated the amount of immobilisedprotein as well as its accessibility to soluble specific antibodies and receptors, stressingthe importance of the non-random immobilisation of VEGF [175].

A more traditional approach, used carbodiimide chemistry to immobilize VEGF. Collagenis a widely used material in tissue engineering-based applications due to their growthsupport of several cell types. Immobilised VEGF on porous collagen scaffolds, maintainedbiological activity and promoted the infiltration and proliferation of endothelial cells inthe 3D scaffold. The system was able to promote human umbilical vein endothelial cells(HUVEC) penetration and proliferation at deeper distances within the hydrogel comparedto when only soluble VEGF was present [176].

2.3.1.3. Composite Constructs

The assembly of scaffolds with materials of different nature, composites, is a commonapproach. In nature, the bone tissue, is an example of a composite material, where acomplex mix of inorganic versus organic materials is found, deeply irrigated by bloodvessels. Commercially available bone grafts, usually do not contemplate a strategy forthe graft vascularisation throughout the regeneration process.

32


To overcome this issue, VEGF was entrapped in alginate microspheres, easily preparedby dropping an alginate solution on a Ca2+ solution. To control the initial burst release,the microspheres were later encapsulated in several combinations of alginate, chitosanor chitosan/polylactic acid (PLA) scaffolds. The former construct presented the mostinteresting release results, with low burst release and sustained release of VEGF (≈ 50%)during 4 weeks, leaving good indications for bone grafting [177].

The use of calcium phosphate bone cements is commonly used for replacement of autol-ogous bone grafts. The physical adsorption of VEGF to an unmodified bone cement orto the same material modified with collagen or O-phospho-L-serine was performed. Thecomposites achieved a good binding capacity to VEGF, though with moderate initialburst releases. However, the VEGF biological efficacy was higher for the O-phospho-L-serine modified cements, compared to the blank samples [178]. The further modificationof the same cements with heparin, was able to improve and reduce the initial burst re-lease of VEGF. Furthermore, the presence of heparin, not only had a higher impact onVEGF’s biological activity, as even favoured good endothelial cells adhesion and prolif-eration [179].

2.3.1.4. Multiple Release

The angiogenesis process, relies on several timely events, from the sprouting moment upto the maturation stage. The breakthrough study, mentioned earlier [166] was performedwith PLGA scaffolds. VEGF was mixed with the polymer and platelet-derived growthfactor (PDGF) was entrapped within PLGA microspheres. This approach temporallycontrols the release of both growth factors. On an initial stage, occurs a rapid release ofVEGF, followed by the slower release of PDGF, triggering different events and promotinga better maturation of the induced angiogenesis.

Hyaluronic acid (HA) was thiolated and further cross-linked by PEGDA, as a matrix forthe dual release of VEGF and keratinocyte growth factor (KGF) [180]. Animals receivinghydrogel implants with both GFs developed more mature micro-vessels networks thanin any of the other study conditions, even in the absence of HA, demonstrating therelevance of the polymeric matrix. A similar approach used HA-thiolated, but alsothiolated gelatine and heparin, cross-linked with PEGDA. Heparin was included to delaythe GF release, based on their natural interaction. Indeed, the concentration of heparin,modulated the VEGF/bFGF release, extending the angiogenic response over a period ofweeks and providing better micro-vessel formation [181]. The same approach, involving

33


HA, gelatine and heparin, studied the loading of VEGF in combination with a secondGF, like angiopoetin 1 (Ang-1), KGF or PDGF to promote neo-vessel maturation. Theinclusion of heparin, showed a growth factor specific effect, promoting higher micro-vessel maturity for the VEGF/PDGF combination, followed by KGF, but inhibiting forthe pair VEGF/Ang-1 [182].

The multiple delivery commonly addresses several growth factors for different cell lin-eages. However, certain cellular pathways, if down-regulated, could enhance neoan-giogenesis. In that sense, injectable alginate matrices were used to release DATP (γ-secretase inhibitor; inhibition of the Notch signalling pathway may enhance regionalneovascularisation [183]) and VEGF promoted increased cell migration and sprout for-mation and induced faster recovery of blood flow on an ischemic hindlimb model [184].

Figure 2.5.: Schematic example of different VEGF immobilisation approaches and im-pact on release profile. Coloured arrows on the timeline indicate the triggering releasestimulus on the respective system.

34


2.3.1.5. Stimuli-Sensing

A research trend in the last few years has been based on taking advantage of the hosttissue feed-back, for releasing growth factors on-demand. Some ambitious approaches,involve the production of VEGF variants, with bioactive amino-acid sequences. Hubbell’sgroup has been developing several strategies, involving fibrin as the biomaterial andmodulating material responses to the wound environment. A modified version of VEGF(VEGF-TG), which cross-links to fibrinogen by the transglutaminating activity of factorXIII during fibrin polymerisation, but also has a proteolytic sensitive sequence, is releasedby the fibrinolytic activity of the wound environment. This form of VEGF active releaseshowed to have superior results compared to passively released VEGF [185, 186, 187].

Simpler approaches, took advantage of the dimeric nature of VEGF to cross-link a low-molecular-weigh-heparin-modified star PEG. The formed hydrogel is sensitive to immo-bilised VEGF-receptors, promoting the erosion of the matrix and releasing VEGF [188].However, VEGF can be chemically bound to plain PEG diacrylate hydrogels, engineeredwith protease sensitive peptides and adhesion peptides (RGD) to induce new vasculaturegrowth inside the implant. The success of this approach was due to a cell-demandedvascularisation [137].

The necessity of overcoming the bolus delivery of VEGF, providing an effective andcontrolled spatio-temporal presentation to the target tissues, has seen many differentstrategies arise. We have mentioned approaches that simply confine VEGF in polymericmicrospheres or matrices to the promotion of VEGF binding through chemical or physicalmeans to the scaffold. The sketch on Fig. 2.5 resumes the most common ways of VEGFincorporation. Classical release profiles for the different situation are pictured, for bettervisualisation of the impact of each of those strategies.

Table 2.1.: VEGF delivery from polymeric matrices.VEGF delivery from polymeric ma-trices. Other significant literature on the past years (≥2006).

Delivery strategy VEGF integration;

Concentration

Remarks Ref.

Bioactive PEGDA hydrogel with

RGD and collagenase sensitive

peptides

PEGylated and matrix

immobilised

Promoted HUVEC motility and

matrix remodeling

[189]

35



Concentration

Remarks Ref.

Chitosan hydrogels coated with

collagen IV

EDC-immobilised on collagen

0.22 ng/mm2

Flk1+ progenitor cells adhere

and differentiate into EC;

without VEGF occurs

differentiation into SMC

[190]

Collagen hydrogels EDC-immobilised on collagen Scaffolds with immobilised

VEGF and Ang1 promoted

better EC infiltration

[191]

Collagen matrices immobilised through PEG

crosslinker; 10 ng/gel

Enhanced angiogenic potential [192]

Collagen matrices; heparinized Mixed; 10 ng/gel Differential release [193]

PLA scaffolds created by

supercritical technology

Supercritical encapsulation

1.7µg/0.13g PLA

Promoted significant bone

regeneration

[194]

Oxidised alginate crosslinked

with Ca2+

Mixed; 250 ng/mL Long term in vivo therapeutic

benefit

[195]

Oxidised alginate crosslinked

with Ca2+

Mixed; 3 - 10 μg/gel Significance of temporal

gradients

[196]

Alginate sulphate/alginate

scaffolds

Binding affinity to alginatesulphate;

Also loaded with PDGF-BB and

TGF-β1;

Release controlled by

differential binding affinity;

improved maturation of

vasculature in implanted rats

[197]

Alginate/HPMC microparticles Entrapped upon microparticles

preparation

Zn2+/Ca2+ balance controls

diffusional release

[198]

Fibrin/collagen hydrogels Dual delivery of VEGF and

MCP1

Improved survival of

encapsulated ECs and SMCs

recruitment

[136]

Scaffolds from particulate PLG

and PLA microspheres

Mixed; 3µg / pellet 125I-VEGF [199]

PLGA microspheres loaded into

ionic crosslinked alginate gels

Entrapped in microspheres Injectable system with

sustained delivery of VEGF

[200]

Fibrin matrix + heparin coated

PLGA nanoparticles

Simply dissolved in the fibrin

matrix or conjugated to the

NPs

Release dependent on diffusion

or heparin affinity

[201]

36



Concentration

Remarks Ref.

HEMA-MMA hydrogels VEGF-secreting encapsulated

fibroblasts

Promoted higher local

angiogenesis in vivo

[202]

Polyelectrolyte nanoparticles

from dextran sulphate and

chitosan/PEI/poly-L-lysine

Affinity to dextran sulphate High encapsulation efficiency;

extended release and bioactivity

preservation

[203]

PGA matrices with PLGA

microspheres

Entrapped in PLGA

microspheres

Sustained VEGF release and

improved EC proliferation and

cappilary density

[204]

2.3.2. Cell-Based Therapies

The potential of cell-based therapies in the treatment of ischemic diseases, is reflectedby the 322 studies retrieved at ClinicalTrials.gov2. Most cells in adult organisms arecomposed of differentiated cells. However, each tissue has its own set of quiescent stemcells or progenitor cells, which can be activated under certain environmental stimuli,participating on the tissue regeneration if an insult is identified. One of the first studies,used endothelial progenitor cells, derived from the bone marrow, which can be isolatedfrom the peripheral blood and expanded ex-vivo. This cell population was administeredsystemically to enhance neovascularisation and was observed to increase the chance ofa healing response [169]. As these type of cells are not abundant, umbilical cord blood(UCB) has become a popular source of EPCs and other cell types (Fig. 2.6), to be usedon therapeutic vascularisation [205]. Indeed, several studies have demonstrated thatthe transplantation of EPCs or vascular cells, increases significantly the vascularisationof ischemic tissues in animal models of hindlimb ischemia [206, 139, 207], myocardialischemia [208, 209, 210] and diabetic chronic wounds [138].

Material-based approaches for the delivery of cells have also been proposed. An in vivovascular progenitor cells depot was used to promote repopulation of the damaged tissueand participate in neovascularisation [139]. Polymeric hydrogels can be manipulated tooffer an ECM-like microenvironment by the incorporation of biological cues, in otherwords, biomimicking the scaffold, for the best spatio-temporal presentation of informa-tion and improved therapeutic outcome. In this study, Silva et al [139] designed alginate2Search terms “cell therapy ischemia“ on the November 28th of 2010. http://clinicaltrials.gov

37


Figure 2.6.: Postnatal stem and progenitor cells from the variou tissues. EPCs high-lighted in gray. Adapted from [167].

macroporous scaffolds doped with RGD cues, to present cell adhesion ligands, and VEGFto maintain cell viability and induce cell migration out of the scaffold. Endothelial pro-genitors isolated from human cord blood to treat ischemic muscle tissue were used onthis approach and this system was demonstrated to dramatically improve vascularisationand perfusion of ischemic murine hindlimb musculature, and prevented toe and footnecrosis. These results suggest that an effective endothelial progenitor cell utilisation,highly depends on the mode of delivery and control over cell fate after transplantation.

The bioactive scaffolds can also be used for enhancement of vascular differentiation ofprogenitor vascular cells or stem cells. Vascular progenitor cells, isolated from humanembryonic stem cell aggregates (embryoid bodies), can be directed to endothelial-likecells after exposure to VEGF [211]. Embryoid bodies (EBs) are aggregates of humanembryonic stem cells (hESC), frequently used to simulate embryonic stages in vitro.However, the heterogenous size and spontaneous differentiation into the several germ

38

2.4 Conclusion

layers of the embryo, turns it difficult to control their differentiation [212]. An ingeniousway of controlling such differentiation was achieved by mixing growth-factor-releasingmicroparticles with the EBs [213]. This system uses biodegradable and biocompatiblecomponents and allows for the control of several variables in cell differentiation, such as,concentration, spatial localisation and combinatorial release of growth factors. Hydrogelplatforms have also been studied, for the controlled differentiation of hESC. Hyaluronicacid hydrogels were able to maintain the self-renewal state of the hESC, for a long termperiod, in the presence of conditioned medium from mouse embryonic fibroblasts. Dif-ferentiation could be induced by supplying the appropriate soluble growth factors [214].The immobilisation of EBs in agarose hydrogels with covalently linked VEGF was ableto guide the aggregates into blood progenitor cells. The induction by immobilised VEGFwas more efficient in guiding hESCs differentiation than soluble VEGF [215]. The authorsbelieve that this system would be suitable for an up-scale and consequent collection oflarge numbers of differentiated cells. However, other strategies have demonstrated thatthe use of EBs may not be the most efficient. The enhancement of vascular differentia-tion of hEBSs was also achieved by encapsulating them in bioactive RGD-functionaliseddextran-based hydrogels. The growth factor, VEGF, was microencapsulated in PLGAmicroparticles, further entrapped inside the hydrogels. The 3D scaffold promotes thestem cell differentiation into vascular lineages, more than the 2D systems. After remov-ing the cells from these networks and promoting further vascular differentiation, theycontained higher fraction of vascular cells than the spontaneously differentiating EBs.This approach increased the vascular differentiation of human embryonic stem cells whencompared to embryoid bodies [216].

2.4. Conclusion

The vascular endothelial growth factor is a major regulator of physiological and patholog-ical angiogenesis, acting upon most of the metabolic pathways in endothelial cells. Theuse of VEGF in therapeutic approaches relied mostly on the bolus injection, but failedto restore compromised tissue functions. The implementation of new delivery strategies,such as polymeric systems, to overcome the limitations of the bolus delivery and supplyVEGF in a localised and sustained way to the target site, is giving new expectations forthe utilisation of this growth factor. The use of such systems allow for different sorts ofcontrolled release, which could mimic the complex and sophisticated endogenous VEGFdelivery, which uses different isoforms with variable affinity towards the ECM and specific

39


proteases cleavable sites. Several reviewed strategies successfully mimicked this VEGFinterplay with the endogenous environment, enabling control over spatial and temporalrelease. The release in the context of other growth factors and their spatio-temporal pre-sentation will need better fine tuning. The upgrade of these systems with the integrationof cells is also a challenge which could bring highly effective therapeutic benefits. Recentstudies suggest a different approach for endothelial progenitor cell-based therapies thatmay be applicable in the treatment of ischemic diseases and more broadly in regenerativemedicine. Strategies involving bioactive materials for the delivery of vascular progenitorcell populations, which could provide a microenvironment to enhance cell survival, andthe sustained release and repopulation of the surrounding tissue by outbound migratingcells.

40

3. Nanotechnology: Novel DeliveryFrontiers

Nanotechnology usually refers to any man-made structure with dimensions below the100 nanometers, in at least one dimension, however, this range is usually broader, reach-ing the 500 nanometers. Among the myriad of possible applications, drug delivery, ina biomedical setting, is growing substantially. This chapter will briefly contextualisethe challenges of designing and preparing nanoparticles for accurate and efficient drugdelivery.

3.1. NanoBiotechnology

Nanobiotechnology, is a field located at an intersection between chemical, physical, en-gineering and biological sciences. The research of nanotechnologies integrated with thebiomedical sciences has seen a rapid growth in the new millennium (Fig. 3.1) and is ap-proaching the 20-years gestation period (generic interval for transition of science discov-ery into commercial applications) after which innovative technologies will be translatedinto biomedical applications [217].

Nanotechnologies, such has nanoparticles (NP) have been around for some time [218].However, new technologies are achieving great expression, such as quantum dots [219,220], nanotubes [221] or nanowires [222]. This new area of nanobiotechnology is gen-erating new applications from molecular imaging to anticancer therapies with new toolsthat are reaching new frontiers within cells and opening new biomedical perspectives[223].

Drug delivery issues, such as poor drug efficacy, low drug bioavailability or systemictoxicity are the main barriers to overcome. In the last decade, the integration with newand alternative nanotechnologies for the improvement of drug delivery, has seen a huge

41

Chapter 3 Nanotechnology: Novel Delivery Frontiers

rise in research. Some of the technologies reviewed earlier, involving polymeric-basedmaterials can be adapted with new processing techniques, bringing the approach to thenano level. The advantages of nanoparticulate drug delivery systems are their small size,which allows them to pass through many biological barriers and the high density of ther-apeutic drug that can be encapsulated, dispersed or dissolved, within the carrier [224].Nanoparticulate systems can improve the physicochemical properties by optimising sol-ubility, diffusivity, biodistribution, release characteristics and immunogenicity, targetingspecific tissues without major systemic toxicity [225]. Depending on the composing ma-terials and the preparation strategy, surface functionalities can be incorporated at thenanoparticle surface, facilitating the protection of the nanoparticles in the organism, butalso the targeting to specific cells or tissues.

An overview on the design of polymeric-based nanoparticles will be made, focusing onthe assembly strategies regarding synthesis, response to external stimulus and surfacereactivity. It will be followed by a brief overview about nanodelivery of VEGF and retinoicacid, as bioactive representatives of proteins and small drugs, respectively, and the lastdelivery frontier, the cellular organelles. For last, a brief overlook about the use ofnanostructures as building blocks in tissue engineering applications will be given.

Figure 3.1.: Publication counts from Thompson ISI Web of Knowledge(www.isiknowledge.com; Search performed on the 29th November 2010). Searchesunder topic for “nano*” (black; left axis), “nano*+bio*” (red; right axis).

42

3.2 Nanoparticle Design

3.2. Nanoparticle Design

Nanoparticles can be defined as solid colloidal particles containing or not an active sub-stance. Traditional techniques, such as emulsification evaporation, solvent displacement,salting-out and emulsification diffusion are somewhat outdated. These approaches in-volve high volumes of organic solvents or oils and often, toxic chemical cross-linkingagents, impairing the use of many pharmaceutical drugs [226], potential downstreamtoxicity, but also the possibility of reaching smaller sizes. Newer techniques rely on lesssevere approaches through usage of carefully chosen starting materials more appropriatefor less aggressive synthesis strategies.

Polymers, either of synthetic or natural origin, provide great flexibility on the designof nanoparticles. Not only due to their native physicochemical properties but as wellthrough the variety of possible modifications yielding new functionalities. The polymerschemistry drive the processing reaction and the final outcome can yield nanocapsules[227], nanogels [228], dendrimers [69], nanocoacervates [203] or other structures asdepicted on Fig. 3.2.

Nanoparticles design should also take in account that they will necessarily interact withthe physiological environment by binding to serum proteins, which can be dictated bythe surface chemistry necessarily influenced by the polymeric constituents [229]. Thisphenomena will interfere with the bioavailability and biodistribution of the NP beingreflected on the therapeutic efficacy [230]. Indeed, what the “cells see” is a mix ofphysiological proteins adsorbed to the NP surface. Likely, this protein layer confers theNP its identity, rather than the NP surface itself [231].

3.2.1. Synthesis

Most of the approaches used on the nano-assembly of such structures can be dividedinto two main categories of chemical and physical nature.

• Chemical nature

Chemicalwise, one of the most popular functionalisation of polymers, recurs to vinylmonomers for posterior radical or photo-polimerization [232]. Other approaches involvethe mixture of polymers with cross-reactive chemical moieties, which promptly reactselectively establishing a covalent bond. Common examples are Michael-type additions,

43


where the previously mentioned vinyl functionalisation can be used to react with thiol-modified substrates [233] or the previously mentioned reversible Schiff bases by thecombination of aldehydes and amines [104, 234]. These sort of reactions can be termed“click chemistry”, referring to the facile, efficient, selective and versatile chemical reac-tion which leads to a single reaction product [235], however, it is the copper (I) catalysedazide-alkyne cycloaddition that has almost exclusively adopted this terminology [236].

• Physical nature

The spontaneous formation of physical nanostructures relies on weak secondary forcessuch as Van der Waals mediated stereo-complexes formation [237], hydrophobic [71],ionic interactions [238], or hydrogen bonding between water soluble polymer chains [239].The most interesting approaches involve self-assembly of nanoparticles, characterisedas the spontaneous formation of higher order structures from simpler building blocks,driven thermodynamically [240]. The self-aggregation of the nanoparticles constituentscan simply rely on the physical properties of the polymers or appropriate moieties canbe grafted to promote the self-assembly of the system.

A simple example are nanoparticles formed via coacervation by recurring to oppositelycharged polyelectrolytes. In nature, the class of polysaccharides exhibits differentlycharged molecules which can be used for this purpose. Chitosan has been preferred asthe polycation in several applications and complexed with polyanions such as carrageenan[241], dextran sulphate [203] and heparin or hyaluronan [242]. The variation of the massratios of the polyelectrolytes regulates the charge density of the final nanoparticles, whichcan be used to achieve higher uploads of drug. On one series of works, polyethylenimine(PEI) was complexed to dextran sulphate in different mass ratios, customised accordingto the cargo properties. The system was custom designed to accommodate DNA [238],insulin [243] or amphotericin B [244].

Neutral and water-soluble polymers, like dextran or pullulan, can be modified withhydrophobic moieties, leading to nanoparticles formation by self-aggregation of thehydrophobic moieties, like in cholesterol-grafted pullulan [245], cholic acid-grafted tooxidised dextran [71] or by chemical conjugation of hydrophobic 5β-cholanic acid tohyaluronic acid [246].

A second level on the design strategy of NP, deals with conferring specific characteristics,which will improve the NP performance for the desired application. Examples of suchstrategies are resumed on Fig. 3.3.

44

3.2 Nanoparticle Design

Figure 3.2.: Different designs in nanoparticles assembly.

3.2.2. Stimulus Sensitivity

Assembling nanoparticles that are sensitive to one or more external stimulus and thatcould trigger a reaction, like swelling or degradation, has many applications in biomedicalsciences. Such characteristics allow the carrier to deliver or not the cargo after reachingthe target site. The sensitivity to pH is one of the most studied. Nanoparticles of dextrangrafted with polyacrylic acid were designed to swell upon pH elevation [247] whichcould possibly release an entrapped cargo by diffusion. Degradation can be achievedby incorporation of acid-sensitive monomers in the NPs [248]. NPs that could supportexternal stimulus, other than the environmental stimulus, offer the possibility of externalguidance or actuation by the operator. Magnetic nanoparticles could be guided through

45


Figure 3.3.: Different aspects of nanoparticles composition, commonly addressed forimproved performances and increased versatility.

the body up to the desired target place. Different polymers, like dextran, chitosanor polyacrylic acid, can be activated with Fe3+ for the preparation of magnetic NPs,and present low cytotoxicity and good biocompatibility [249]. The cross-linking of N-isopropyl acrylamide monomer with PEG-diacrylates originates NP which are temperaturesensitive [250].

3.2.3. Targeting

The tissue targeting specificity of the nanoparticles can be increased by introducingspecific ligands, able to recognise particular cell surface entities (Fig. 3.3). An obvi-ous choice, are antibodies due to their high specificity. The chemical conjugation tonanoparticles is straightforward and drastically increases the tissue specificity [251]. Non-chemical coatings of NP with ligands, employing electrostatic interactions, for example,can avoid the change of the biophysical properties of the nanoparticles [252], producedby chemical grafting of ligands. The use of specific ligands on NP surfaces, has foundapplications other than target questing. Some tissues, like cartilage, lack vasculature,limiting the bioavailability of drugs. By controlling the nanoparticles size (< 40 nm),it is possible to achieve high yields of nanoparticles penetration within the cartilage,furthermore, the incorporation of a targeting peptide, prevents the nanoparticles from

46

3.3 Nano Delivery

leaving the tissue providing an intra-tissue releasing system [253].

3.3. Nano Delivery

An interesting review on drug delivery devices was written recently by Alan Hoffman [254]contextualising the evolution from the “macro era” of drug delivery devices (DDD), withzero-order release, to the “nano era” of targeted and site-controlled drug delivery sys-tems, which will eventually lead to personalised medicine. The ideas described earlier(sec. 1.3), concerning polymer-drug conjugates, can also be considered nano-delivery.However, next we will present some studies using nanoparticles, for the delivery of pro-teins and small pharmaceuticals and the implications and potential that such strategiesenclose.

3.3.1. Proteins

Proteins with therapeutic interest, like antibodies or growth factors, display a shorthalf-life in circulation, usually of several minutes [164, 255, 256]. They undergo rapiddegradation in vivo and the systemic or local delivery will result in low availability.The high doses usually applied, may lead to systemic toxicity due to the non-specificdistribution. The use of nanoparticulate systems can help improve the therapeutic action,since they can help penetrate deeper into tissues, through the epithelial lining. Thenanoparticles will be responsible for the physicochemical properties of the system.

Among the described studies in the literature, nanoparticulate systems for growth factordelivery include lipossomes, polymers, micelles, dendrimers among other material com-binations [225]. Focusing on VEGF, it has been formulated in PLGA [257, 199, 204],PLGA/PEG [258] or alginate [259, 198] particles to control its release on a localisedarea, however, such formulations yield particles in the micrometer range. Therefore,PLGA nanoparticles with sizes below 200 nm, negative zeta-potentials and heparin-functionalisation [260], appear to be interesting carriers for VEGF. Indeed, the incor-poration in commercial fibrin hydrogels, enhanced the therapeutic efficacy in a rabbitischemic hind-limb model, when compared to soluble VEGF [201]. A polyelectrolytecomplex, where dextran sulphate is the polyanion and the polycation role was performedby chitosan, PEI or poly-L-lysine was adapted for the loading of VEGF [203]. The dex-tran sulphate structural similarities to heparin were used to promote a higher loading

47


efficiency, through electrostatic complexation. In the presence of the polications, self-assembly occurs through coacervation of oppositely charged polyelectrolytes. Negativelycharged nanoparticles, with sizes below the 300 nm were obtained. The formulation wassuccessful in protecting VEGF’s bioactivity, sustaining its release and showed improvedefficacy in inducing endothelial cells proliferation [203]. A less traditional approach usedlecithin (from soy bean) to create anionic nanolipids, with a lipid core and an outersurface that binds electrostatically to the positive VEGF. Pluronics F127 was used toconfer a shell to the complex. The manipulation of the components mass ratios allowscontrol over size, zeta-potential and the VEGF release profile [261].

3.3.2. Small Drugs

As stressed earlier (sec. 1.3.1.1), the systemic delivery of small drugs leads to issues suchas lack of activity towards the target tissue and toxicity on other tissues were the drugscan accumulate during the process of clearance from the organism. As with pro-drugs,nanoparticles can increase the concentration of small pharmaceuticals and improve thedelivery efficacy. Retinoic acid, is a small lipophilic derivative of Vitamin A [262], whichhas a tremendous therapeutic potential in cancer prevention [263] and could be usedto control the differentiation of stem cells. All-trans retinoic acid is a water-insolublemolecule (0.21 μM [264]) which can see its water solubility increased by the simplecomplexation with certain polymers like polyaminoacids [265] or PEI [266], which inthe presence of the dispersing agent poloxamer 188, forms nanoparticles. Poly(ethyleneoxide)-b-poly(L-lysine) also complexes with RA forming core-shell type micelles whereretinoic acid forms the hydrophobic core [267]. The natural polycation chitosan is alsosuitable for RA delivery. Low molecular weight water soluble chitosan was able to formcomplexes with RA, achieving loading efficiencies above 90% and nanoparticles sizesbelow 200 nm [268]. The grafting of methoxy poly(ethylene glycol) to chitosan allowsthe delivery of RA in the form of nanoparticles [269] or micelles [270] with diameters of100 and 100 - 500 nm, respectively.

These systems are able to increase substantially the concentration of RA presented tothe cells, however, the RA actions are transmitted through the RA receptors, which arelocated on the cell nucleus [263]. When delivering molecules with intracellular targets,it is rather important, that the nanoparticles overcome the tissues and cellular barriersand deliver the payload on the cells cytoplasm. The release outside the cell, might notbring any action.

48

3.3 Nano Delivery

3.3.3. Intracellular Targeting

Many therapeutic agents have specific intracellular molecular targets, which are locatedin the cytoplasm, nucleus, mitochondria or other cell organelles. The targeting of anyof these intracellular destination, implicates a higher degree of complexity on the de-sign of the nanomaterials. Several barriers must be taken into account, in order toreach the site of action, where the payload has to be delivered. The efficiency of drug-carriers for cytosolic delivery is limited mainly by their interaction with cell membranesand the endosomal release of therapeutics [271]. The ability of nanoscale materials to

Figure 3.4.: Cellular internalisation pathways of NP. (A) Diffusion, usually onendocytosis-inhibiting conditions; (B) Phagocytosis; (C) Macropinocytosis; (D)Clatrin-dependent endocytosis; (E) Receptor-mediated endocytosis. Adapted from[272].

autonomously escape from endosomal compartments can be used to deliver cargo thatcan alter cell metabolism and function and regulate signalling pathways. Hydrophobic-functionalised silica NPs were able to carry specific protein, which were shown to interferewith cellular pathways [273]. The cellular internalization can follow several pathways,such as receptor-mediated endocytosis, non-specific endocytosis and internalization un-der endocytosis-inhibiting conditions (Fig. 3.4) [272, 274]. The receptor-mediated endo-cytosis is probably the most attractive and efficient method for the specific uptake ofnanocarriers, which can be designed to incorporate a given complementary cell-surface

49


receptor, enabling an increase of up to 1000-fold [274]. The nanoparticles uptake inendosomes (mild pH’s; 5 - 6.5) goes through a maturation process up to late endosomesthat could later fuse with other endosomes and lysosomes (even more acidic pH’s), ex-periencing degradation conditions [274]. Escaping this barrier, avoids degradation orexocytosis, releasing the therapeutic agent within the cytosol and enabling its actuation[272].

The awareness of the endosomal pathway as lead research towards pH-sensitive carriers,which could rapidly release their payload, facilitating its delivery into the cytoplasm.Polymeric cations, are efficient transfection agents without recurring to cell-targetingor membrane-disrupting agents, being PEI a gold-standard of polyplexes [56, 55]. Thehigh concentration of primary and secondary amines turns PEI into a proton-sponge atvirtually any pH. On the endosomal context, it possibly buffers that small compartment,protecting the carrier from degradation, eventually promoting swelling and rupture [56].

3.4. Nano Tissue Engineering

Biological tissues are often observed as small repeating units assembled over severalscales. Therefore, the ability to synthesise and control materials on the nano scale opensnew frontiers in tissue engineering. Designing nanomaterials as building blocks may leadto suprastructures that can be obtained by several processing techniques or just by self-assembly of the building blocks. These structures can be used to host and/or delivercells in several contexts, just as some of the 3D structures described earlier, though,offering new control variables as well as improved macroscopic qualities.

As reviewed recently by Wan et al. 2010 [275], nanomaterials can be divided in severalclasses, with chemical and physical properties which enable them to be processed or func-tion in different contexts of tissue engineering. Commonly used nanomaterials found inthe literature enclose peptide amphiphiles, self-assembled peptides, nanoparticles, carbonnanotubes, electrospun fibres or layer-by-layer structures. Our focus will fall on strategiesdescribing the preparation of nanoparticles which are able to yield suprastructures.

As illustrated on Fig. 3.2 and Fig. 3.3, the limit for nanoparticles decoration is imagina-tion. If properly designed, ingenious suprastructures can be originated, taking advantageof the different properties of the several components, which can be prepared either byself-assembly or by external stimuli. Materials with several hierarchical structures maypresent improved networks. Polymeric gels, for example, can be made in several sizes.

50

3.4 Nano Tissue Engineering

Figure 3.5.: Nanoparticles suprastructures. (A) Polymer gel nanoparticle network; (B)Nanoparticle-cross-linked hydrogels; (C) Self-assembly by external stimuli.

Bulk hydrogels are easy to handle, but have a slow response to external stimuli, whilenanogels act much quicker, due to the higher ratio of the surface area versus volume.However, co-nanoparticle networks can retain the properties of each polymer nanopar-ticle, resulting that such network could perform several tasks on a given application(Fig. 3.5A) [276]. Other example is the polystyrene nanoparticles which were used ascross-linkers of polyacrylamide to synthesise hydrogels. The hydrophobic character of thenanoparticles deeply influenced the swelling behaviour, conferring excellent elasticity andpredictable swelling properties, appropriate for several human tissues (Fig. 3.5B) [277].The rationale is that the physical properties of the nanoparticles core are transmitted tothe upper hierarchical level, while the surface is grafted with reactive pendant groups,enabling the cross-reactivity. Gold-cross-linked pNIPAAm hydrogels display remarkablydifferent bulk properties of equilibrium swelling and thermo-responsive phase transitionwhen compared to the gold-free hydrogels [278]. Other example is the nanostructuredhyaluronic acid hydrogel, prepared by cross-linking thiol-grafted hyaluronan with acry-lated nanogels, via Michael addition. The nanogels are sensitive to hydrolysis, propa-gating such property to the bulk hydrogel. Gelation occurs at physiological conditionsand can be used as a cell delivery scaffold or other biological agents (Fig. 3.5B) [279].Physical interactions are more appropriate for the self-assembly of the suprastructures.

51


Usually, an external stimuli sets the trigger for the sol-gel transition. The amphiphilicmacromer constituted by PEG-PPG-PEG, self-assembles into micelles subsequently poly-merised into nanogels. These nanogels, when concentrated, form macroscopic physicalgels upon heating (Fig. 3.5C) [280]. Fancier approaches used NPs covered with only afew photoactive ligands, which formed metastable crystals that can be assembled anddisassembled ‘‘on demand’’ by using light of different wavelengths. For higher sur-face concentrations, self-assembly is irreversible, and the NPs organise into permanentlycross-linked structures including robust supracrystals and plastic spherical aggregates[281].

3.5. Conclusions.

Improving the half-life of growth factors has been achieved by several nanoparticulatestrategies. It is however beneficial to understand exactly the release mechanism anddegradation involved in each strategy. The winning strategy will find a balance betweenthe resiliency of nanoparticles to reach the target site, target specificity and the sustainedrelease of the growth factors. This will inevitably lead to more complex systems withtargeting cues and environmental/external degradation-sensitive mechanisms.

As the knowledge in disease biology increases, the more demanding the nano-scale designof DDD will be. Allan Hoffman suggested that the evolution of DDD will become morebiological and less materials-oriented in character [254]. In fact, the trend in literatureis oriented to the seeding of biomaterials with biological cues able of mimicking andpermeating those drug delivery vectors in biological systems. This biological accuracywill eventually lead the field into personalised medicine, where tailor-made DDD will bethe ultimate goal.

Nanoparticles will likely have a relevant role in bottom-up tissue engineering, providingimproved scaffolds that can be highly biomimetic and possibly overcome most of thechallenges faced in this field.

52

Part II.

Results and Conclusions

4. Insight on the periodate oxidationof dextran and its structuralvicissitudes

4.1. Abstract

Periodate oxidised dextran has been widely studied in a broad range of biotechnologicalapplications, regardless of this, usually little attention is paid to the oxidation extensionconsequences on the properties of the final modified dextran. Based on a bidimensionalNMR analysis, we suggest that the two aldehydes groups, resulting from the periodateoxidation, are not fully reactive with N-nucleophiles, under certain pH conditions. Thealdehyde group bonded to C3 appeared to be the only prone to react. The other alde-hyde might be arrested in more stable hemiacetal structures. The hemiacetals are alsoresponsible for oxidised dextran cross-linking, interfering in simple processing steps, suchas dissolution and solubility, as well as increasing the viscosity of the solutions. Themolecular weight variation on the oxidised samples can be followed by dynamic mechan-ical thermal analysis in consequence of the variation of glass transition temperature withthe molecular weight, which was corroborated by the onset temperature of the thermaldegradation.

4.2. Introduction

Dextran is a polysaccharide synthesised by a large number of bacteria, when grownon sucrose-containing media [3]. Nowadays, Leuconostoc mesenteroids (strain B-512)[1] is responsible for the majority of the commercially available dextrans. They arecharacterised by having over 95% of α-1,6 linkages and some low degree of branching.

55

Chapter 4 Insight on the Periodate Oxidation of Dextran

From the late nineteen forties, dextrans have attracted attention from the biotechnologyworld. They were accepted as a plasma volume expander, due to its linear structure,high water solubility, and especially owing to its α-1,6 linkage, more relevant to biologicalapplications, in virtue of the slower hydrolysis by body enzymes, compared to the α-1,4linkage (e.g. glycogen) [1, 2].

The dextran oxidation by the periodate ion is a catalysis-free aqueous reaction whichyields a purified product with a simple dialysis step. The periodate ion attacks vicinaldiols promoting bond breaking. Typically, the α-1,6 residues in dextran are attackedbetween carbons C3- C4 or C3- C2, breaking the C-C bond and yielding aldehyde groups,being able to be further reduced on a second and independent oxidation reaction (Scheme1) (Fig. 4.1)[282]. Initially, this method was used in the characterisation and elucidationof the polysaccharide structure, through the complete oxidation and consequent analysisof the degradation products [10]. Nowadays, low and mild periodate oxidations are usedto confer the dextran chain with aldehyde functionalities, which have as main charac-teristic the highly reactive nature towards N-nucleophiles, such as amines, hydrazines orcarbazates [29].

Figure 4.1.: Dextran’s α-1,6 glucose residue possible periodate oxidations. Periodateattack at C3-C4 (A); C3-C2 (B) and double oxidation (C).

Concerning the dexOx application on a biomedical perspective, the accurate assessmentof the periodate oxidation consequences in mild oxidation conditions is of utmost impor-tance in predicting the extent of drug loading [65] or the final physicochemical propertiesof hydrogels [35]. Due to the highly reactive nature of the formed aldehydes, they areeasily attacked by neighbouring hydroxyl groups, leading to the formation of hemiacetals[16]. These hemiacetals are the most consensual resulting structures, even taking intoaccount that some studies restrict these structures to a narrow pH window (4.0 – 5.2)[17]. Other consequences of the dextran oxidation are the decreased average molecularweight and polydispersity increase [14].

56

4.3 Material and Methods

Herein we address the consequences of low and mild dextran oxidation and try to furtherelucidate the structural nature of dexOx through bidimensional NMR, upon reactionwith tert-butyl carbazate. Our data suggest that only one aldehyde per residue mightbe involved on this reaction, while the second aldehyde could be arrested to a stablehemiacetal structure. We will explore the oxidation influence on simple manipulationsteps, such as aqueous dissolution and the solutions viscosity outcome. Dynamic me-chanical thermal analysis (DMTA) data on dexOx are discussed and correlated with themolecular weight trend. The relative thermal stability of dexOx samples was evaluatedby thermogravimetric (TG) measurements.

4.3. Material and Methods

4.3.1. Materials

Dextran (from Leuconostoc mesenteroides; Mw 60 kDa, according to Fluka’s specifica-tion), sodium periodate, AAD, tBC, ethyl carbazate (EtC), phosphate buffered saline(PBS; pH 7.4), dialysis membranes (MWCO 12 kDa) and NaOD were purchased fromSigma (Sintra, Portugal) and used as received.

4.3.2. Dextran Oxidation

An aqueous solution of dextran (1 g; 12.5% (w/v) ~ pH 5.5) was oxidised with 2 mLof sodium periodate solution with different concentrations (33 – 264 mg/mL) to yieldtheoretical oxidations from 5 to 40%, at room temperature (The oxidation degree (OD)of dexOx is defined as the number of oxidised residues per 100 glucose residues). Thereaction was stopped after 4 hours. The resulting solution was dialysed for 3 days againstwater and lyophilised (Snidjers Scientific type 2040, Tillburg, Holland). The scale-upof the reaction was done using the same procedure albeit using 30 g of dextran and acalculated amount of periodate to yield a theoretical oxidation of 5, 10, 25 and 40%,referred hereafter as D5, D10, D25 and D40, respectively.

4.3.3. Nuclear Magnetic Resonance1H spectra were acquired on a Varian 600 NMR spectrometer (Palo Alto, CA) using a3 mm indirect detection NMR probe. 1H NMR spectra were recorded in D2O (20-25

57


mg in 0.2 mL; pD of c.a. 4.5 or 10.2 after addition of NaOD) using a 90° pulse and arelaxation delay of 30 s. The water signal, used as reference line, was set at δ 4.75 ppmand was partially suppressed by irradiation during the relaxation delay. A total of 32scans were acquired for each 1H NMR spectra. Bidimensional spectra were recorded onthe same magnet. 1H-1H correlation spectroscopy (COSY) spectra were collected as a2048 × 1024 matrix covering a 5 kHz sweep width using (32) scans/increment. BeforeFourier transformation, the matrix was zero filled to 4096 × 4096 and standard sine-bell weighting functions were applied in both dimensions. 1H-13C heteronuclear multiplequantum coherence (HMQC) spectra were collected as a 2048 × 1024 matrix coveringsweep widths of 5 and 25 kHz in the first and second dimensions, respectively. BeforeFourier transformation, the matrix was zero-filled to 4096 × 4096 and standard Gaussianweighting functions were applied in both dimensions. The spectra were analysed withiNMR software, version 2.6.4 (www.inmr.net). The oxidation degree (OD) refers to thetheoretical value unless otherwise stated.

4.3.4. DexOx’s Solubility and Solutions Viscosity

The different dexOx and dextran samples were dissolved in PBS (20% w/w). Aliquots of1 mL were distributed in small glass vials, frozen at -20 °C and freeze-dried, in order toobtain a similar freeze-drying cake across every sample. The original dextran processedthis way will be referred as D0. To each sample, 0.85 mL of miliQ water was addedand the dissolution time was recorded at different temperatures (n=3). The reason wasto mimic the reconstitution of a pharmaceutical freeze-dried product. The vials werepreserved under reduced pressure on a glass desiccator supplied with silica gel. Dextranand dexOx solutions, with concentrations ranging from 10 to 30% w/w, were preparedand tested in a Brookfield Programmable D-II+ Viscometer with a S18 spindle, assistedby DVLoader v1.0 software. The chamber temperature was controlled by an externalbath to 25 °C. Low viscosity solutions were measured by a Labolan V1-R viscometerwith a LCP spindle (low viscosity adapter) and controlled temperature to 25 °C.

4.3.5. Size Exclusion Chromatography

Performed in a HPLC system composed by a degasser and a WellChrom Maxi-Star k-1000 pump (Knauer), coupled to a LS detector (evaporative light scattering PL-EMD960) and one column (Polymer Laboratories, aquagel-OH Mixed 8 µm). The whole

58

4.4 Results and Discussion

system was kept at room temperature and the eluent used was KNO3 (0.001 M; pH 3.9)at a flow rate of 0.4 mL/min. Samples and standards were dissolved in the eluent at 4-6mg/mL (Fluka Chemie AG, dextran standards from 12 – 80 kDa).

4.3.6. Dynamic Mechanical Thermal Analysis

The freeze-drying samples obtained above were subjected to dynamical mechanical ther-mal analysis (DMTA) on a Triton Tritec 2000 analyser. About 50 mg of sample wereloaded into metal pockets fabricated from a sheet of stainless steel. The pocket wasclamped directly into de DMA using a single cantilever configuration. Temperaturescans, from -200 °C to +300 °C, with a standard heating rate of 2 °Cmin−1 were per-formed in a multifrequency mode (1 and 10 Hz) in order to identify the temperaturetransition peaks.

4.3.7. Thermogravimetric Analysis

The thermal stability of dextran and dexOx samples was studied in a TA InstrumentsQ500 thermogravimetric analyser (thermobalance sensitivity 0.1 μg). The temperaturecalibration was performed in the range 25-1000 °C by measuring the Curie point of nickelstandard, using open platinum crucibles, a dry nitrogen purge flow of 100 mLmin−1, anda heating rate of 10 °C min−1, the later being the conditions applied throughout thethermoanalytical measurements. At least two runs were performed for each sample(sample weights of ca. 8 mg) in order to check the repeatability of measurements.

4.4. Results and Discussion

4.4.1. DexOx Characterisation

Dextran with a molecular weight of 60 kDa, was oxidised with variable amounts ofsodium periodate in order to obtain different OD. Usually, the aldehyde group is notobserved by FTIR spectroscopy, unless in highly oxidised samples (1730 cm−1), nor inthe NMR spectrum, except during the first minutes of reaction (~9.7 ppm) [14]. It iswidely accepted that the aldehyde groups react with nearby hydroxyl groups, forminghemiacetals or hemialdals [16, 282]. These transitory events could be either intra or

59


inter-residue (Fig. 4.2) and, in certain situations, interfere with the oxidation evolution.The most important aspect arising from this modification is the final oxidation degree.It defines the dexOx’s reactivity on drug conjugation [65] or gelation rate on hydrogelformulations [14, 35]. Concerning the estimation of the oxidation degree, several wayshave been used to approach the problem. On extensive oxidations, acid-base titrationis useful in assessing the released formic acid and the percentage of doubly oxidisedresidues [10]. On mild oxidations, colorimetric titrations, such as the hydroxyalaminehydrochloride [25] or the TNBS assay [22], have been used. However, the calculationsare usually performed assuming that both aldehydes react with the carbazates. On anearlier study [14], our two-dimensional NMR results led us to suggest that just oneof the aldehydes per residue reacts with the carbazates, in agreement with the singlecorrelation observed on the 1H-13C HMQC spectrum. Our new results suggest that,under the studied conditions, only one aldehyde per residue is reacting.

4.4.2. Bidimensional Nuclear Magnetic Resonance

The NMR data was collected in D2O with a measured pD of ~ 4.5, which falls insidethe consensual pH window for hemiacetals formation. Therefore, our bidimensionalNMR analysis will take into account the most likely hemiacetal populations, based onpreviously proposed structures found in the literature. These structures will serve as

Figure 4.2.: (A) Single periodate oxidation outcome after periodate ion attack at C3-C4 and (B) C3-C2 cleavage, followed by possible intra-hemiacetals formation andtBC reaction. (C) Periodate doubly oxidised residue, possible hemiacetals and tBCreactions.

60


Figure 4.3.: (A) COSY (B) HMQC spectra of D25. The peaks assigned with plainnumbers refer to correlations arising from the intact residue. The correlations arisingfrom the different oxidised residues are represented by: a: C3-C4 oxidation; b: C3-C2oxidation; c: C4-C2 double oxidation; and d: α-1,3 branched oxidised residue.

61


a starting ground for the carbazone peak assignment. The C3-C4 cleavage (Fig. 4.2A)was described to be 7.5-fold faster than the C3-C2 cleavage (Fig. 4.2B) [16]. On amild oxidation, the double oxidised structure (Fig. 4.2C) is likely less representative, asmost periodate would be rapidly consumed on single oxidations and such scenario isfavored by the starting pH (~ 5) [283]. Furthermore, it is thought that the hemiacetalformation could hinder further oxidation, even of neighboring residues [16]. Therefore,the structures arising from the C3-C4 oxidation will be treated as more representative,followed by the C3-C2 oxidation and the double oxidation. The titration of dexOx withcarbazates yields a carbazone moiety, evidencing the former aldehydic proton, whichhelps clarifying the bidimensional spectra. The region around 7.3 ppm (proton axis) and145 ppm (carbon axis) on the 1H-13C-HMQC (Fig. 4.3A inset) unveiled two main peakpopulations of carbazone protons. A third carbazone peak exists (7.16 ppm), only seen onthe COSY (correlation spectroscopy) spectrum (Fig. 4.3B) and is apparently correlatedwith the α-1,3 anomeric proton (see left axis dextran’s proton spectrum overlay forthe native peaks). Therefore, it seems to exist two main carbazone peaks, out of fourpossible different carbazones (C2, C4 and two different C3’s), though each of them couldhave different environments influencing the chemical shifts. Analysing the C3-C4 cleavage(Fig. 4.2A), an intra-hemiacetal structure is likely to occur, after a hydroxyl (C2) attack tothe C4 aldehyde, forming a stable six sides ring [284], despite several different possibilitiesdue to the rotativity of the oxidised residue. The aldehyde on C3 could suffer an attackfrom any hydroxyl (HO-C4 from the downstream residue suggested in the structure).We propose this aldehyde to be the more susceptible of attack by tBC, represented bythe most shielded of the protons (Fig. 4.3A 3a; ~ 7.28 ppm) in the 7.3 ppm region.Analysing this peak correlation on the COSY, one can see a correlation with a proton at~ 4.25 ppm (2a), correlating itself with a carbon (Fig. 4.2A) on the same chemical shiftas glucose C2 (~ 71.6 ppm). The same proton (2a) further correlates downfield, witha possible anomeric proton/carbon (1a). Supposing this structure as the most likelyand stable after C3-C4 cleavage, the C4 proton has an anomeric-like environment andpossibly could be associated with a correlation with C5 like those proposed aacording tothe bidimensional spectra (4a and 5a, respectively).

The C3-C2 cleavage yields an aldehyde on C2, which has been proposed to form a stableand conformationally plausible 1,4-dioxepane ring after reaction with the OH on C4 fromthe downstream residue (Fig. 4.2B) [16]. Again, the aldehyde on C3 (3b) would be moreprone to react with tBC. Following the other carbazone proton at ~ 7.35 ppm (Fig. 4.3B;3b), it correlates with a proton at ~ 4.55 ppm (4b), which further correlates with a single

62


proton upfield, falling near the glucose residue proton/carbon 5 (5b). There is a strongcorrelation between an anomeric proton and a proton at ~ 3.65 ppm, which could be anunshielded proton on C2 and also correlates with a carbon in the same chemical shiftas glucose C2. This correlation could likely arise from 1b and 2b, but also 1c and 2c,from the doubly oxidised residue, as the environments are very similar. Regarding thedoubly oxidised residue, the hemiacetal structure depicted in Fig. 4.2 was also suggestedby Ishak and Painter (1978) [16] to be plausible.

Figure 4.4.: NMR spectra acquired at alkaline pH (10.2). (A) 1H-NMR of D25 withclose up (7.8 - 9.2 ppm); (B) D25 mixed with EtC, close up of the region of interest;(C) COSY overlay of D25 (red contour) with D25 mixed with EtC (black contour).The new correlations arising from the carbazone protons are identified.

Therefore, C4 would be more sensitive to a carbazate attack. However, the third majorvisible correlation in the COSY spectrum, at 7.16 ppm, apparently correlates with theanomeric proton (α-1,3), which would be an unlikely chemical shift for a proton onC5. It would be more reasonable if this correlation arose from the carbazate attackat C2 of the doubly oxidised, but a second correlation would have to be present in theHMQC spectrum (Fig. 4.3B). It is possible that the correlations from the doubly oxidised

63


residue, as well as other minor populations, are masked within the major peaks. Thetransient nature of the hemiacetals and the similar environments turn the peak assigningtask a hard mission, which could have several interpretations. Anyhow, the two maincorrelations on the COSY spectrum suggest that not every aldehyde is reacting with acarbazate under these pH conditions.

At alkaline pH (10.2), some new peaks can be seen in the range of 7.5 to 9.5 ppm for theD25 sample (Fig. 4.4A). These peaks were previously attributed to isomeric enol forms.Such structures are under an aldo-enol equilibrium [18]. Many other peak populationsare observed between 4 and 6 ppm, due to the higher resolution (Fig. 4.41A). Though,the addition of EtC, at this pH, did not revert most of the identified new peaks, itpresented more correlations on the zone of interest for the carbazone protons (~7.3ppm; Fig. 4.4 B & C). We have observed before, that dexOx crosslinked with AADhydrogels dissolved quickly at pH 9 [14], suggesting the sensitivity of the hydrazonebond to alkaline pH’s, thus, the likelyhood of a similar behaviour for the carbazone bondalso exists. These new correlations, suggest that, every aldehydic carbon is sensitive toa carbazate attack. Under this pH, the aldo-enolic structures are likely more exposedto attack than under the hemiacetal form, establishing a higher number of equilibriums,concomitantly expressed on the COSY spectrum (Fig. 4.4D). The overlay of both COSYspectra shows the appearance of a high number of new correlations after the additionof EtC (Supplementary Figure 1D, black contour), partially reverting the correlations ofD25 (red contour). These results identify pH as a strong modulator of dexOx reactivity,which might be interesting to contemplate under certain pH sensitive applications.

4.4.3. Macroscopic Consequences of the Oxidation

The extensive and complete dextran oxidation leads to the destruction of the moleculeinto characteristic degradation by-products [10]. Low and mild oxidations also degradedextran, leading to slight molecular weight decrease. The destruction of the glucoseresidue, yielding aldehydes, could also contribute in altering the dexOx behaviour insolution. The periodate oxidation in non-buffered solutions leads to pH decrease, afterformic acid release [14], possibly contributing for acid-hydrolysis [285]. This phenomenoncan be observed in several ways. The reference technique in the characterisation ofpolymers is the size exclusion chromatography (SEC), which separates the differentpopulations in accordance with the hydrodynamic volume, which can be translated tomolecular weight and the polydispersity index (Tab. 4.1). The molecular weight is a

64


Table 4.1.: Macroscopic characteristics of native dextran and the several oxidised sam-ples. OD estimated by 1H-NMR analysis, Mw and PDI calculated by SEC, viscositiesat different concentrations and time necessary until complete dissolution.

Sample Oxidationdegree

Mwc PDId η

e

20%η

f

5%t37ºC

g

IO4a EtCb kDa (mPa.s) (mPa.s)

Dextran - - 60.1 1.47 30.7 2.7 1.0±0.04h

D5 5 3.6 ± 0.1 61.2 1.59 35.9 2.9 1.3±0.08D10 10 8.6 ± 0.2 60.8 1.61 35.1 3.0 1.5±0.05D25 25 22.2 ± 0.7 60.3 2.03 26.8 2.7 3.9±0.65D40 40 33.0 ± 0.8 25.4 3.05 102.8 2.7 26.6±0.44

a Theoretical OD, calculated as the molar ratio of sodium periodate per initial glucose unit in dextran.b Calculated by 1H-NMR after titration with tert-butyl carbazate/ethyl carbazate, taking into accountthe ratio between the integral of the peak at δ 7.3 ppm and the integral of the anomeric proton at δ4.9 ppm. Average and standard deviation of 5 independent integrations.c Weight-average molecular weight estimated by SEC.d Polydispersity index corresponding to Mw/Mn.e Viscosities of dextran and oxidised dextrans at 20% w/w. Taken from the slope of the curves ShearStress = f(Shear Rate) plot. The linear regression was forced to cross the origin as every sample showeda Newtonian behaviour.f Viscosities of dextran and oxidised dextrans at 5 % w/w, at 200 rpm.g Dissolution time taken, at 37 °C, in PBS, without agitation.

key property of polymers, defining certain macroscopic characteristics, such as solubility,viscosity and clearance rates in biological systems [2]. Besides 1H-NMR and SEC, we havegathered results of techniques and empirical evidences, which clearly reflect the molecularweight differences between the several dexOx samples. One direct consequence of thedextran oxidation is the longer dissolution times in aqueous media. This phenomenon is ofutmost importance on an off-the-shelf freeze-dried product. The dissolution time periodsof the several samples under exactly the same conditions (Fig. 4.5A) but at differenttemperatures, show that D5 and D10 have very close dissolution profiles to dextran(D0). However, the D25 and D40 dissolution profiles clearly reflect the OD increase. Theviscosity of a dextran solution is directly related to its concentration and Mw [286, 287].The molecular weight decreasing due to periodate oxidation should theoretically yield aless viscous solution than the original dextran, for the same concentration conditions.At lower concentrations (5%) the viscosity variation is negligible (Tab. 4.1). However,the reactivity of the oxidised dextran, through inter-hemiacetals formation, has greatinfluence on the behaviour of the solutions. We observed that the oxidation degree couldinvert the viscosity trend, depending on the dexOx concentration. Concentrated solutions

65


Figure 4.5.: Dissolution time profiles, at different temperatures (A) and the shear stressvs. shear rate profile at 20% (w/w) concentration and 25 ºC (B) for dextran (O), D5(0), D10 (6), D25 (1) and D40 (3)

favour the inter-chain hemiacetals formation, resembling a molecular weight increasing,hence the higher resistance to flow. Within the same concentration range (20% w/w),only D25 viscosity falls below the dextran viscosity. On the other hand, D40 has anextremely high resistance to flow, reflecting the cross-reactivity (Tab. 4.1 and Fig. 4.5B).We suggest that this effect is due to the interchain hemiacetals formed, inverting whatwould be the natural viscosity trend and demonstrating how both parameters (OD andMw) can interfere with the viscosity of a given dexOx solution.

4.4.4. Thermal Analysis

We have extended the study on the influence of the oxidation extension by analysingthe thermoanalytical curves of the different oxidised species. The DMTA method isfrequently used to evaluate the effects of excipients on polymer’s glass transition tem-perature (T g). In amorphous polymers, a primary relaxation transition may be observedat a characteristic temperature Tg. In this point, the glass-like state (restricted mo-tion of the polymeric chains) changes to a rubber-like state indicating loss in rigidity(i.e. increased relaxation) associated with enhanced polymeric chain mobility. Typically,the glass transition is defined as the temperature(s) at which either a maximum in themechanical damping parameter (tan δ) or loss modulus (G’’) occurs [288]. The pres-ence of moisture can also be assessed by DMTA, visible in the thermoanalytical curvesas characteristic transitions at certain temperatures [289]. In terms of damping, it is

66


possible to identify four main transitions for the pristine dextran, approximately at -80ºC, 105 ºC, 235 ºC and 305 ºC (Fig. 4.6A */**). The peak at -80ºC is a secondaryrelaxation due to absorbed water, which contributes to the formation of a more diffuseand stronger H-bond network than observed in a dry sample [289]. The peak at 105°C refers to the water evaporation from dextran. These thermal events show that evenafter the freeze-drying process some residual water is present. These events have differ-ent profiles on the oxidised samples (not shown), which will not be addressed since thisissue is out of the scope of this work. The next peak at ca. 235 °C corresponds toT g.At this temperature, the storage modulus decreases rapidly and is frequency dependenton the Tan δ (Fig. 4.6A inset). This peak reflectes an α - relaxation from non-frequencydependent events, such as crystalization, melting, curing or thermal degradation [290].The peak at 305 °C reflects an overall degradation stage and will be discussed furtherahead.

It has been reported that the molecular weight of dextrans influences the Tg due tothe decrease of the free volume with the Mw increase [291]. To confirm such influence,the thermoanalytical data of several dextrans (Mw: 580, 60 and 19.5 kDa; tested assupplied) were analysed. In fact, the T g of the tested dextrans samples decrease directlywith the Mw, being the correspondent peak values observed at 237.8, 235.4 and 231.1°C, respectively (Fig. 4.6B). These T g are in agreement with the trend described byIcoz et al [291] for a comparable Mw, despite determined by a different technique. Thedifferent oxidised samples were processed in a similar way to avoid any artifacts thatcould arise from freezing and freeze-drying and there was an effort to minimize samplesmoisture. Interestingly, D0 presented a broader peak and shifted to lower temperature(223.6 °C) when compared with the original dextran (Fig. 4.6B). The presence of thephosphate salts could interfere with the freezing process of dextran, leading to differentdextran chain conformation, which is reflected by the broader T g peak and the shiftto lower temperatures [292]. By freeze-drying a phosphate buffered aqueous dextransolution, it can impair the crystallization process of the salts [293] as well as the dextranderivative itself. Nevertheless, the Mw difference, within the dexOx’s samples, is clearlyvisible on the DMTA curves (Fig. 4.6C and Tab. 4.2) corroborating the SEC and NMRdata. It is known that cross-linking agents can also increase the T g [288]. However,the hemiacetals cross-linking effect, observed on the viscosity studies, apparently is notreflected on the T g, suggesting that the real molecular weight is dominant on the T g

onset.

A first look to the TG curve profiles (Fig. 4.7A) allows to identify a quite dramatic change

67


Figure 4.6.: (A) Full thermogram of native dextran marked with the non-frequency de-pendent transitions (*) and T g identification (inset; **) through frequency dependenttransition; (B) T g of the different molecular weight dextrans; (C) T g of the differentoxidised samples. All samples presented with a frequency of 1 Hz, except for dottedline at a frequency of 10 Hz.

in going from native dextran to its processed (freeze-dried PBS solution) counterpart,D0. Apart from a shift in the onset temperature of the main mass loss stage towardslower temperatures (by 41 °C), a remarkable difference is observed in the residual mass(at 600 °C), which should be ascribed to the salts coming from PBS. The original dextranexhibits a quite familiar behaviour [294, 247, 289, 295], with a first mass loss stage belowca. 120 °C due to the elimination of water, as observed in the DMTA, followed by theoverall degradation stage (depolymerization) along the approximate temperature rangefrom 298 to 328 °C, in good correspondence with the fourth transition, identified bythe DMTA results (Fig. 4.6A). However, the thermal decomposition of oxidised dextransamples should be analysed with reference to thermal decomposition of the samplethat reflects the influence of PBS in dextran, D0. In this case, the differences in thethermoanalytical curves appear to be more subtle.

68


Figure 4.7.: (A) TG and (B) DTG curves of dextran and dexOx samples. (Φ=10°Cmin−1; dry nitrogen at 100 mLmin−1).

Both D0 and oxidised dextran samples exhibit a first mass loss stage, from the ambienttemperature to 150 °C. The correspondent mass loss rate is somewhat variable amongthe samples, but the residual mass at 150 °C is quite comparable (see Tab. 4.2). Thisfirst weight change is caused by the loss of adsorbed water, and, probably, of some waterof crystallization related with the PBS components (phosphates). Above 150 °C, thedifferences in the response of samples under comparison become more apparent. Thecomplexity of the global thermal decomposition, probably involving several kineticallyindependent processes as suggested by the TG data and, mainly, by the differentialthermogravimetric (DTG) curves profiles (Fig. 4.7B), increases with the degree of theoxidation of the samples. A first change in the mass loss rate within the approximatetemperature range 180-220 °C can be observed (Fig. 4.7B inset), being only incipient inthe case of the D5 sample, moderate in the D10 one, and rather evident in the remainingoxidised dextran samples (see also Tab. 4.2 for the onset temperatures). This stage isfollowed by the main decomposition process, whose pattern is also clearly influenced bythe oxidation degree, as revealed by the DTG curve profiles. In terms of characteristicquantities, while the onset temperature of the main decomposition stage obeys to a welldefined pattern, monotonically decreasing with the increase of the oxidation degree from247.5 °C (D5) to 233.0 °C (D40), the undefined trend of the peak temperature at themaximum decomposition rate (Tab. 4.2) reflects differences in decomposition pathways.The residual mass at 600 °C for the most oxidised sample (D40) suggests a pronounceddifferent decomposition course when compared to the remaining oxidised samples.

69


Table 4.2.: Glass transition temperatures obtained from the DMTA curves (see Fig. 4.6)and characteristic quantities (mean and standard deviation) obtained from theTG/DTG curves (see Fig. Fig. 4.7).

Sample Tg

(C°)Ton

a

(C°)Tp

b

(C°)∆mc

(%)Dextran 235.5 298.6±0.4 315.0±0.2 92.8±0.2 8.3±0.4

D0 223.6 257.6±1.4 269.9±1.7 96.3±1.1 29.7±0.2D5 211.5 195.2±1.4 247.5±0.8 267.1±1.6 94.7±0.2 29.7±0.2D10 207.9 198.6±0.6 241.5±0.4 279.2±0.2 93.2±0.3 28.8±0.0D25 200.5 190.8±0.4 234.1±0.3 266.2±0.2 93.1±0.4 30.9±0.3D40 190.7 179.7±0.2 233.0±0.7 274.4±1.8 94.3±0.3 35.4±0.0

a Ton: extrapolated onset temperatures (TG curve).b Tp: peak temperature, corresponding to the maximum decomposition rate (DTG curve).c ∆m: residual mass at the temperatures 150 °C and 600 °C.

4.5. Conclusion

Our bidimensional NMR data suggests that only one aldehyde per residue is respondingto the carbazate under mildly acidic conditions. We propose that the two main peakpopulations (~ 7.3 ppm) arise from carbazates on C3 from single oxidised residues. Thereare more downfield shifted peaks, but not more than 5.5 ppm, which indicate the non-existence of more carbazate proton populations. These peaks should arise from protonsinvolved in hemiacetals. The enol forms appear to be more reactive towards carbazates,though more labile and less stable.

The periodate oxidation of dextran is a harsh reaction which promotes chain degrada-tion, confers high chemical reactivity to a natively neutral molecule and deeply alters itsphysicochemical properties. The increasing OD, impairs water solubility, taking longerperiods of time to solubilise, and interferes with the resulting viscosity, especially at highpolymer concentrations. The solutions viscosity could impair injectability and mixibilityof certain formulations. The degree of oxidation is also reflected on the glass transitiontemperature according to DMTA data. Interestingly, the hemiacetals do not seem toaffect the thermal properties of the freeze-dried samples. The glass transition tempera-tures shift is in direct accordance with the molecular weight decrease, but do not givemuch insight on the structural consequences of the oxidation. On the other hand, theDTG profiles, for the diverse samples, are quite interesting. An increase in the ther-mal decomposition complexity with the increase in the oxidation degree was identified,

70

4.5 Conclusion

evidencing the deleterious effect of periodate oxidation on dextran’s structure. Low ox-idative conditions, up to 10%, do not damage extensively dextran’s structure, howevermilder oxidation conditions, result in extensive disruption of the dextran structure. Theseset of results may rise awareness for the consequences of periodate oxidation on the finalstructural properties of the modified dextran, helping researchers to better guide thedesign of dexOx-based formulations.

71

5. Ocular Injectable FormulationAssessment for OxidisedDextran-based Hydrogels

5.1. Abstract

Initiator-free injectable hydrogels are very interesting for drug and/or cell delivery appli-cations, since they can be administered in a minimally invasive way, without recurring tochemical initiators that could be harmful. In the current work, oxidised dextran cross-linked (dexOx) with adipic acid dihydrazide (AAD) hydrogels were further characterisedand tuned to produce formulations, having in sight an injectable ocular formulation forthe possible treatment of posterior eye diseases. The gelation rate and the hydrogelsdissolution profile were shown to be dependent on the balance between the dextranoxidation degree, and both components concentration. On the in vitro studies, rabbitcorneal endothelial cells were seeded on the hydrogels, to assess cytotoxicity. Hydrogelsprepared with low oxidised dextrans were able to promote cell adhesion and proliferationto confluence in just 24 hours, while higher oxidised samples promoted cell adhesion andproliferation, but without achieving confluence. Cell viability studies were performedusing MTS assays to verify the non-cytotoxicity of hydrogels and their degradation by-products, rendering these formulations attractive for further in vivo studies.

5.2. Introduction

Ocular diseases of the posterior eye segment are the most common cause of visual dis-orders in industrialised countries [296]. These illnesses include, for example, cataracts,diabetic retinopathy, macular degeneration associated with ageing and retinitis pigmen-

73

Chapter 5 Oxidised Dextran-Based Hydrogels

tosa [296, 297]. The visual disorders cause discomfort, anxiety and fear of losing thevision in patients.

Until now, ocular drug market is dominated by drugs, which were conceived to treatillnesses that affect the anterior eye segment, such medicines include: antibiotics, anti-inflammatory agents or anti-glaucoma drugs, usually as eye drop formulations [296, 298].These topical applications, in the form of eye drops, are ineffective in many cases, duemainly to the drainage system of the eye, which leads to poor ocular bioavailability[299]. New drugs have been developed to reach the posterior eye segment, although,most of them are administered through repeated intravitreal injections. This methodis associated with complications such as pain, increased intraocular pressure, retinaldetachment and endophtalmitis (which may lead to blindness). New methods of drugdelivery, more secure, efficient, comfortable and with prolonged activity are needed,to minimise the number of injections. Currently, there are systems of controlled drugdelivery on the market or being tested, such as implants, hydrogels and colloids [296].Hydrogels are hydrophilic polymer networks, which may absorb up to thousands of timestheir dry weight in water. Hydrogels may be chemically stable or they may degrade andeventually disintegrate and dissolve. They are called “reversible” or “physical” gels whenthe networks are held together by molecular entanglements, and/or secondary forcesincluding ionic, H-bonding or hydrophobic forces. Hydrogels are called “permanent” or“chemical” gels when they are covalently cross-linked networks [300]. Recently, VanTomme and collaborators compiled the different strategies used in producing dextran-based hydrogels, demonstrating dextran as a very versatile starting polymer for hydrogelsynthesis [6]. Furthermore, pharmaceuticals and various potential therapeutic agentscan easily be incorporated and its release profile controlled. Recently, human embryonicstem-cell encapsulation was also successfully achieved in bioactive hydrogels of dextran-acrylate [216].

Dextran is biocompatible and can be degraded through the action of dextranases invarious organs in the human body, including liver, spleen, kidney and colon [2].

Dextran oxidation by sodium periodate is an easy and well-known way to functionalisedextran with aldehyde moieties [10]. This chemical functionality has been widely testedto conjugate N-nucleophiles, due to their fast and almost complete reaction [29]. Thisapproach has been tested on the synthesis of pro-drugs [66], as a spacer in enzymeimmobilisation [132] or for growth factor controlled release [103]. On the preparation ofhydrogels, different aminated cross-linkers, like chitosan [104, 105], gelatine [102], 8-arm

74

5.3 Materials and Methods

PEG amine [39] or polyhydrazides [28] have been used to yield chemical initiator-freeformulations.

Recently, we described an injectable formulation composed of oxidised dextran (dexOx)cross-linked with adipic acid dihydrazide (AAD) [14]. The dexOx with 15% oxidationdegree (OD) was cross-linked with AAD, forming a gel within 2–4 minutes, dependingon the AAD concentration used. The obtained hydrogels were characterised by theirmechanical properties (7 – 32 kPa), swelling and degradation (9 to 23 days) behaviourunder physiologic conditions.

In this work, oxidised dextran, with various OD, was studied in order to improve thecontrol of the system properties. The influence of dextran OD and concentration in thesolution viscosity was monitored. We observed that the hydrogel swelling and dissolutioncould also be controlled by the dextran oxidation degree and that the dissolution profilecould be extended for more than 2 months, improving the previous studied formulation.Cell toxicity assays were carried out in 96-well plates with different dexOx’s hydrogels.Cell viability studies were performed using rabbit corneal endothelial cells, which wereseeded on top of the dexOx’s hydrogels. The cell adhesion and growth was visualisedby optical microscopy and dehydrogenase activity of cells was evaluated by reduction ofthe MTS reagent.

5.3. Materials and Methods

5.3.1. Materials

Dextran (from Leuconostoc mesenteroides; Mw 60 kDa, according to Fluka’s specifica-tion), sodium periodate, AAD, tBC, EtC, PBS, dialysis tubes (MWCO ~12 kDa), am-photericin B, L-glutamine, Minimum Essential Medium Eagle, penicillin G, streptomycin,and trypsin were purchased from Sigma (Sintra, Portugal). Foetal bovine serum waspurchased from Biochrom AG (Berlin, Germany). The 3-[4,5-dimethylthiazol-2-yl]-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) and electroncoupling reagent (phenazine methosulphate; PMS) were purchased from Promega. T-flasks and 96 well plates were purchased from Nunc (Denmark).

75


5.3.2. Dextran Oxidation

An aqueous solution of dextran (1 g; 12.5%, w/v) was oxidised with 2 mL of sodiumperiodate solution with different concentrations (33 – 264 mg/mL) to yield theoreticaloxidations from 5 to 40%, at room temperature. The reaction was stopped after 4hours. The resulting solution was dialysed for 3 days against water, using a dialysis tubewith a MWCO 12-14 kDa, and then lyophilised (Snidjers Scientific type 2040, Tillburg,Holland). The scale-up of the reaction was done using the same procedure albeit using30 g of dextran and a calculated amount of periodate to yield a theoretical oxidation of5, 10, 25 and 40%.

5.3.3. Nuclear Magnetic Resonance and Size ExclusionChromatography

The OD of dexOx is defined as the number of oxidised residues per 100 glucose residues(OD refers to the theoretical value unless otherwise stated) and quantified by using tBC[22, 301]and EtC. The carbazates react with aldehyde groups to form carbazones in thesame way hydrazones are formed in the presence of hydrazides.

1H spectra were acquired on a Varian 600 NMR spectrometer (Palo Alto, CA) using a3 mm broadband NMR probe. 1H NMR spectra were recorded in D2O (20-25 mg in0.2 mL; pD of ca. 5.0) using a 90° pulse and a relaxation delay of 30 s. The watersignal, used as reference line, was set at δ 4.75 ppm and was partially suppressed byirradiation during the relaxation delay. A total of 32 scans were acquired for each 1H NMRspectra. The spectra were analysed with iNMR software, version 2.6.4 (www.inmr.net).Size exclusion chromatography (SEC) was performed in a HPLC system composed of adegasser and a WellChrom Maxi-Star k-1000 pump (Knauer), coupled to a LS detector(evaporative light scattering PL-EMD 960) and one column (PL aquagel-OH Mixed 8µm) from Polymer Laboratories. The whole system was kept at room temperature andthe eluent used was KNO3 (0.001 M; pH 3.9) at a flow rate of 0.4 mL/min. Samplesand standards were dissolved in the eluent at 4-6 mg/mL (Fluka Chemie AG, dextranstandards from 12 – 80 kDa).

76


5.3.4. DexOx’s Solutions Viscosity

Dextran and dexOx’s solutions, with concentrations ranging from 10 to 30% (w/w)in PBS, were prepared and analysed in a Brookfield Programmable D-II+ Viscometerwith a S18 spindle, assisted by DVLoader v1.0 software. The chamber temperature wascontrolled by an external bath to 25 °C, and the chamber was loaded with 8 mL ofsolution.

5.3.5. Hydrogel Preparation and Characterisation

The several oxidised dextrans were dissolved in different concentrations; dexOx 5% (D5)and 10% (D10) solutions were used at 30% (w/w) and dexOx 25% (D25) at 20% (w/w),in aqueous solvent (PBS) at 37 °C until a liquid solution was obtained and then kept at5 to 8 °C, until further use. Then, 250 µL of a given dexOx solution was mixed with 250µL of a given AAD solution on home-made Teflon® moulds and let to cross-link neverless than 2 hours (except for the D5 hydrogels, which were let to cure over night). TheAAD concentrations used are calculated based on a given molar percentage of dextranresidues. The hydrogels nomenclature is as follows: dexOx 5% + AAD 5% - D5A5; andso forth.

5.3.6. Dynamic Swelling Experiments

DexOx hydrogels, after being prepared and weighted (Wi), were immersed in PBS (ca. 5mL) in 6-wells cell culture plates, at 37 °C. At regular time intervals, they were removedfrom the aqueous solution, blotted in filter paper, weighted (Wt) and returned to theoriginal well while PBS was replaced. The swelling index (SI) is defined as:

SI = Wt/Wi (5.1)

where W t is the weight on a given time point and W i represents the initial hydrogelweight.

77


5.3.7. Rheological Analysis

Rheological experiments were carried out using the parallel plate geometry (20 mmdiameter, steel) of a Haake Rheostress RS 1. On the calculation of gelation period,both solutions (190 µL each) were mixed on the bottom plate, and the upper plate waspositioned at a gap of 1 mm (after gap optimisation). This procedure took around 20seconds after which the experiment was started at low frequency (0.5 Hz) and stress (0.1Pa), to avoid interference with the network formation. The gelation rate was followedand the gelation period was considered to be the crossover point between G’ and G’’(G’=G’’).

5.3.8. Cell Source and Growth

Corneal endothelial cells from rabbit were obtained as previously described [302]. Sub-sequently, cells were platted in T-flasks of 25 cm3 with Minimum Essential MediumEagle (MEM) with heat-inactivated foetal bovine serum (FBS, 10% v/v) and growthfactors to do primary culture in agreement with the procedures previously described inthe literature [303]. T-flasks with cells were incubated in a 5% carbon dioxide humidifiedatmosphere at 37 °C. On day 3, the medium was changed and here after every threedays. Six days after cells attained confluence. After confluence was obtained, cells weresub-cultivated using 5 min incubation in 0.18% trypsin (1:250) and 5 mM EDTA. Thefree cells were added to an equal volume of culture medium. Following centrifugation,cells were re-suspended in sufficient culture medium and seed in 96 well plates containingthe biomaterials.

5.3.9. Cell Culture and In Vitro Cytotoxicity Studies

Two cross-linking degrees of AAD for each dexOx were selected and used on cytocom-patibility tests. The oxidised dextran samples and AAD were either dissolved in PBS orin the appropriate cell culture medium, MEM.

Each formulation in the form of hydrogel was introduced (n=6), on wells of 96-wells cellculture plates, never exceeding 60 µL. The plates were irradiated for 30 minutes withUV, before being seeded with cells.

Forth passage endothelial corneal cells were seeded, at a density of 90’000 cells perwell, into a 96-well plate containing the hydrogels. The plate was incubated at 37 °C,

78


under a CO2 (5%) humidified atmosphere. After 1, 3 and 7 days, cell viability wasassessed through MTS assays. A CellTiter 96® AQueous Assay composed of 3-[4,5-dimethylthiazol-2-yl]-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, in-ner salt (MTS) and an electron coupling reagent (phenazine methosulphate; PMS) fromPromega were used. 20 µl of MTS/PMS were added to each sample and incubatedfor 4 h at 37 °C, under a CO2 (5%) atmosphere. The absorbance of the samples wasdetermined at 492 nm using a Biorad Microplate Reader Benchmark.

Wells containing cells in culture medium without biomaterials were used as negativecontrol (K-). Ethanol 96% was added to wells containing both types of cells to havea positive control (K+). The samples were analysed using an Olympus CX41 opticalmicroscope equipped with an Olympus SP-500 UZ digital camera.


5.4.1. DexOx Characterisation

Following previous work [14], we characterised hydrogels made from dexOx with a widerrange of oxidation degrees, cross-linked with different amounts of AAD. Dextran wasoxidised by using sodium periodate at different percentages and characterised by 1H-NMR. The oxidation degree was not estimated by the TNBS assay, due to the goodcorrelation of the NMR titration with the colorimetric assay, as shown in previous work[14]. The tert-butyl carbazate titration, however, causes sample precipitation whenreacted with high oxidation degree samples, not allowing NMR spectra acquisition (D40,Tab. 5.1). We suggest that this effect is caused by the large tert-butyl moiety and wehypothesised that a less bulky molecule, such as ethyl carbazate, would not cause sampleprecipitation. In fact, both spectra are similar except for the ethyl protons peak whichis sharper and slightly shifted up-field in comparison to the tert-butyl peak (spectranot shown). The real oxidation degree was calculated by taking into account the ratiobetween the integral of the peak at δ 7.3 ppm (arising from the carbazone group formedeither with tBC or EtC) and the integral of the anomeric proton at δ 4.9 ppm. Theoxidation degrees obtained with EtC were slightly higher (Tab. 5.1) than that obtainedwith tBC titration, which may suggest some difficulty of tBC to react further due to itsbulkier moiety.

The dexOx number-average molecular weight (Mn), estimated by a SEC analysis, showed

79


Table 5.1.: Oxidation Degree of several oxidised dextrans calculated by 1H-NMR anal-ysis after titration with different carbazates and molecular weight evolution.

Sample Oxidation degree Mnc PDIdNaIO4

a tBCb EtCb

Dextran - - - 40.9 1.47D5 5 2.5 ± 0.3 3.6 ± 0.1 40.8 1.59D10 10 7.4 ± 0.9 8.6 ± 0.2 37.9 1.61D25 25 18.9 ± 0.4 22.2 ± 0.7 29.7 2.03D40 40 -e 33.0 ± 0.8 8.3 3.05

a - Theoretical OD, calculated as the molar ratio of sodium periodate per initial glucoseunit in dextran.b - Calculated by 1H-NMR after titration with tert-butyl carbazate/ethyl carbazate,taking into account the ratio between the integral of the peak at δ 7.3 ppm and theintegral of the anomeric proton at δ 4.9 ppm. Average and standard deviation of 5independent integrations.c - Number-average molecular weight estimated by SECd - Polydispersity index corresponding to Mw/Mne - Precipitation occurred

a clear decrease with increasing oxidation degree, but also an increasing polidispersityindex (PDI), reflecting the higher range of dexOx molecular weights (Tab. 5.1).

5.4.2. DexOx Solutions Viscosity

On the design of injectable hydrogel formulations, details, like viscosity characterisation,become increasingly important, in order to choose the best syringe geometries and/orneedle gauges. Generally, the hydrogel characteristics can be tailored by the feed con-centration [104], degree of polymer modification and in other cases, chemical initiatorsconcentration [304]. This particular system involves the mixing of two equal-volumesolutions, each of which, with its own reactive species, oxidised dextran residues and thedihydrazide. Thus, the formulations design has to take into account the feed concentra-tion halving, of both solutions, after mixing.

Every dexOx sample, at any of the concentrations tested, showed a linear shear stressincrease regarding the different shear rates, hence, a Newtonian behaviour. For everyconcentration tested, across the different OD’s, the obtained viscosities for each dexOxseries show a natural trend directly related with the concentration, as can be observedon Fig. 5.2A for dextran and D40. The OD influence on viscosity seems to have a

80


Figure 5.1.: The reactive aldehyde groups formed upon periodate oxidation are proneto establish inter (A) or intra (B) hemiacetals, when reacting with hydroxyl groupsfrom nearby residues. The addition of AAD (C) promotes the reversible cross-linkingwith the formation of hydrazones.

higher effect, when the polymer concentration is high, but as the polymer solution is lessconcentrated, the viscosity tends to decrease and eventually be lower than the referencesolution (original dextran).

Within the same concentration range, only the D25 viscosity falls below the dextranviscosity, but on the other hand, D40 has an extremely high viscosity reflecting theinfluence of the high reactivity, due to the high OD (Fig. 5.2B).

We suggest that this effect is due to the molecular weight decrease with oxidation,which, below a certain concentration, counter-balances the cross-linking via hemiacetals(Fig. 5.1A), decreasing the solution viscosity (Fig. 5.2A), which could possibly be fur-ther enhanced by a dexOx chain coil due to the intra hemiacetal formation (Fig. 5.1B),demonstrating how both parameters (OD and Mw) can interfere on the viscosity of agiven dexOx solution.

81


Figure 5.2.: Shear stress versus Shear rate. (A) – Dextran with concentrations (w/w)of: 0 - 30%, O - 20%, 1 - 15% and 6 - 10%; and D40 with concentrations (w/w)of: - 20%, a - 15% and f- 10%. (B) All solutions at 20% (w/w) O - dextran,0- D5, 6 - D10, 1 - D25 and 3 - D40

5.4.3. Hydrogels Characterisation

The hydrogels preparation took into consideration three factors: the dexOx concentra-tion/oxidation degree and the AAD concentration. The first two are closely related dueto the viscosity issues that were discussed above. Therefore, the concentration used wasas high as the viscosity would allow it. Solutions of D5 and D10 with 30% concentrationallow a good homogenisation, despite the high viscosity, but for D25, we had to use a20% concentration. The D40 macro-monomer was not studied in deep detail as the oth-ers, due to its high reactivity for the concentration range wanted. The D40 with a 20%concentration yields a very viscous solution that reacts promptly with AAD, impairing agood homogenisation. Lower concentrations produce nicer hydrogels, however with lessattractive and more unpredictable swelling profiles. Yet, the D40 gelation rate data ispresented (15% feed concentration), to strengthen the issue on the balance between ODand AAD feed concentration effect on the gelation rate, discussed below.

The balance between the available cross-linking points (oxidation degree) and the amountof cross-linker used (AAD feed concentration) clearly affects the gelation rate, as shownon Tab. 5.2, however, not always on the same direction. The gelation periods of D25and D40 hydrogels decrease with the AAD increase, while for the D5 and D10 hydrogels,

82


the gelation periods increase directly with the AAD concentration. When low OD’s arepresent, the excess AAD increases the number of non-valid cross-links, caused by thereaction of a single hydrazide, leaving a dangling end [305], and retarding the hydrogelformation. The polymer feed concentration also affects the gelation periods, as can beobserved with the D40 hydrogels, which should be faster than the D25, for the sameAAD feed concentrations.

Table 5.2.: Gelation periods estimated for each dexOx with different AADconcentrations.

dexOx Feed Conc. Gelation period (min)a

% (w/w) 5% AAD 10% AAD 20% AADD5 30 66.7±1.4 77.8 ± 5.2 -bD10 30 14.9 ± 1.7 16.8 ± 0.5 18.8 ± 1.3D25 20 2.8 ± 0.3 1.6 ± 0.9 1.3 ± 0.2D40 15 3.7 ± 0.4 2.6 ± 0.1 2.3 ± 0.1

a The gelation period was considered when G′ = G′′ ; values are means ± SD (n=4).b Hydrogel not formed.

The dexOx/AAD hydrogels were prepared in Teflon moulds and let to cure for at leasttwo hours, except for the D5 hydrogels, which were left overnight, due to the slow curingrate. Equal volumes of dexOx and AAD solutions were added and mixed vigourouslywith the pipette tip, to achieve a good homogenisation of both solutions.

The hydrazide groups in AAD react with the aldehyde groups in oxidised dextransforming hydrazone bonds, which are hydrolysable, retrieving the same chemical groups(Fig. 5.1C), therefore, making these hydrogels soluble in different time frames. Theswelling index (Equation 5.1) of the different sets of hydrogels showed how the disso-lution profiles could be controlled, not only by the AAD amount but as well by thedextran OD. By increasing the OD, we can significantly increase the dissolution time ofthe hydrogels. This oxidation increase, allows that more AAD can be used as a cross-linking agent, reflecting on more lasting hydrogels. By balancing these two variables itis possible to control the dissolution profile of the hydrogels.

As shown, low oxidation degrees do not allow long dissolution times. However, it isperfectly possible to control the dissolution profile with the AAD concentration, withina range of 5 days (Inset in Fig. 5.3). Rising up the oxidation, hydrogels more resistantto dissolution are obtained. The D25 hydrogels have very interesting profiles (Fig. 5.3).

83


The dissolution time could be extended up to 70 days. Furthermore, one can observean interesting plateau, with 20% AAD, resembling a saddle, approximately from the 2nd

until the 50th day of immersion on phosphate buffer. Within this period the hydrogelsmaintained their size and shape without abrupt swelling variations. This profile seems tobe interesting for the proposed application, as it will not swell above the injected volumeand takes few weeks to dissolve. Just before the hydrogel collapses and dissolve, a maxi-mum swelling peak is observed. We hypothesise this peak to be a fracture point, reachedwhen the osmotic force equals the polymeric matrix force, which weakens through time,due to the AAD diffusion out of the hydrogel.

Figure 5.3.: Swelling index profile of dexOx+AAD hydrogels. D25 with feed concentra-tion of 20% and D10 and D5 with feed concentration of 30%. Main plot: �- D25A5;O- D25A10; 1- D25A20; Inset: � - D10A5; O -D10A10; 1- D10A20; ` - D5A5; - D5A10.

The water content of the vitreous humour is around 98%, mainly composed of collagen,hyaluronic acid [306] and hyalocytes of Balazs, which take care of removing cellular debrisand reprocessing the hyaluronic acid [307]. Since the dexOx hydrogels are soluble in waterand electrolyte solutions we think that the vitreous humour will naturally contribute tothe dissolution of the hydrogel and help the hydrogel elimination. The by productsof the designed hydrogel are its same initial components. oxidised dextran and AAD.Both by-products should be excreted, to the aqueous humour, by the anterior route.This elimination is probably faster than through the blood-retina barrier to the systemiccirculation [296], despite that dextrans, up to 150 kDa, are diffusible through the sclera[308].

84


5.4.4. Assessment of Cytotoxic Potential

The characteristics of these formulations render them suitable as a drug carrier to theposterior part of the eye, due to its injectable character, the controlled gelation rate or thedissolution profile shown. Formulations composed partially by dexOx have been testedfor their biocompatibility. Recently, Bhatia and co-workers [39], seeded 3T3 fibroblastcells on top of oxidised dextran (20% – 50% OD) cross-linked with 8-arm PEG amineand showed that their formulation, was non-toxic and could lead to cell confluence after24 hours of growth. This suggests, that the cross-linked oxidised dextran can promotebetter cell adhesion than dextran itself [109], despite showing some toxicity when present,alone, in cell culture with mesothelial cells [38].

In the present work, endothelial cells from rabbit cornea were chosen based on the needto assess the oxidised dextran AAD cross-linked hydrogels cytotoxicity for the proposedapplication.

To assess the cytotoxicity of these materials, several combinations of hydrogels involvingthe different dexOx’s and AAD concentrations, were prepared. The 96-well cell cultureplates were covered with 60 µL of hydrogels or just controls and the cells were seededon top, after an over-night curing period. The materials used were not only dissolved inPBS but also on the appropriate cell culture media. Occasionally, the initial dexOx feedconcentration had to be slightly decreased, due to the high viscosity, probably due tomedium proteins, that cross-link with the oxidised dextran through the existing aminegroups.

After cell seeding on top of the hydrogels, each well was visualised in optical microscope,to observe whether there was any cell adhesion and/or proliferation. Cells grew in thepresence of all hydrogels tested, although cell growth, in the presence of D25 hydrogels,did not achieve confluence during the period of study (Fig. 5.4).

Dextran is neutrally charged and we expect dexOx to keep the neutrality, as the periodateoxidation reaction does not yield any charged chemical groups. However, the cross-linking of dexOx with AAD (pKa 2.5) yields hydrazone bonds which were reported tohave a pKa in the order of 3 to [309]. Hence, due to the nature of the cross-linkingbond, we suggest that the hydrogels zeta potential shifts negatively, allowing cell growthand proliferation.

It is well known that the surface chemistry of hydrogels can affect cell adhesion, prolif-eration and other phenomena. Chen et al [310] work showed how the polymer nature

85


Figure 5.4.: Endothelial cells isolated from rabbit cornea seeded in dexOx + AADhydrogels, dissolved in MEM or PBS, after 72 h. (A) D5A5, PBS; (B) D5A5, MEM;(C) D10A10, PBS; (D) D10A10, MEM; (E) D25A10, PBS; (F) D25A10, MEM; (G)negative control; (H) positive control. Original magnification 100X.

and cross-linker concentration can dictate the surface charge density of the gels andstrongly influence the cell behaviour. They have identified a threshold on the surfacezeta potential (- 20 mV), below which cell adhere and proliferate.

Schneider and collaborators also reported that charge density of the hydrogel can regulatecell attachment either directly in the absence of extra-cellular matrix components, orindirectly through the association of extra-cellular matrix proteins found within the serumassociated with charges of the hydrogel surface [311].

The MTS assay is a quick effective method for testing mitochondrial impairment andcorrelates quite well with cell proliferation. In recent years, it has been frequently used asa preliminary screen for the evaluation of in vitro cytotoxicity of polymeric components.

The MTS assays were performed at 1, 3 and 7 days after cells being seeded on top of thehydrogels. Cellular activity did not seem to be affected by the medium used to preparethe hydrogels (MEM or PBS). The results (Fig. 5.5) emphasise that every formulationpromoted dehydrogenase activity. In the first 24 hours, all hydrogels promoted higherenzyme activity than the negative control. By the 3rd day, the activity doubled for most

86

5.5 Conclusions

Figure 5.5.: Cellular activities measured by the MTS assay after 1 day (open bars), 3days (grey bars) and 7 days (black bars). Endothelial cells from rabbit cornea, seededonto dexOx+AAD hydrogels. The materials were either dissolved in PBS or MEM.K+: Positive control; K-: Negative control. All error bars represent one standarddeviation from six experiments.

hydrogels, with a few exceptions, and by the 7th day, the activity maintained the samelevels. These results demonstrate the tested formulations as non-cytotoxic.

5.5. Conclusions

On the estimation of the dextran oxidation degree, we have identified ethyl carbazate asa better and more accurate titrant, than tert-butyl carbazate, especially for the higheroxidised samples. The bulkier tBC moiety causes sample precipitation and it also seemsto impair good access to the oxidised residues lowering the measured oxidation degree.

The viscosity studies revealed how the dextran oxidation degree can limit the concentra-tion used. However, for diluted dexOx solutions, the lower molecular weight, counter-balances the oxidation effect, decreasing the viscosity.

The characterised hydrogels have a dual cross-linking control method, which lies onthe dextran OD and the amount of AAD used. The OD allows a given percentage ofresidues to serve as reactive points to molecules such as AAD. The amount of AAD usedis crucial in defining the gelation period, mechanical properties and dissolution profile of

87


the hydrogels. It should be within the same range of the amount of oxidised residuespresent in dextran, to avoid forming dangling ends, and not valid mechanical cross-links.

On the cytotoxicity assay, the different dextran oxidation degrees tested were successfulin promoting cell adhesion and growth. However, with the increasing oxidation, the cellstook longer to proliferate in the hydrogels. Oddly, the metabolic activity, measured bythe MTS assay, showed very high levels of activity for the higher oxidised hydrogels, notcorresponding to the cellular proliferation observed.

The proposed and studied system aims at providing a sustainable drug delivery deviceto the posterior part of the eye, which requires a single injection, but does not requirefurther surgery on the removal of the device. The designed formulation is expected todissolve and be eliminated naturally by the organism.

88

6. Dextran-Based Microgels

6.1. Abstract

The use of micro or nano drug carriers in biomedical applications is an extremely at-tractive approach, in order to circumvent the commonly associated issues with drugdelivery. This chapter reports the use of an all-aqueous methodology to prepare degrad-able dextran-based microgels of variable sizes by the cross-linking of oxidised dextranwith adipic acid dihydrazide. The size and polydispersity of microgels is deeply affectedby the concentration of adipic acid dihydrazide as assessed by scanning electron mi-croscopy. The light scattering analysis revealed monodispersed populations with sizesabove 100 μm and slightly dependent of the dextran’s oxidation degree. The continuousphase has a strong influence on the polydispersity of the microgels.

6.2. Introduction

Microgels, in the same way as hydrogels, are networks prepared from hydrophilic poly-meric materials, which are cross-linked in several different ways, to avoid dissolution ofthe polymeric chains into solution [100]. Microgels offer an interesting platform as thebasis of a drug delivery system due to their high water content and good biocompatibility.These systems nature allow polymer-based drug conjugation or simply drug entrapmentinto the network, which couples perfectly with the tuneable microsphere size, surfacearea/volume ratio and release time-profile [312].

The polysaccharide nature, dictates the processing techniques that can be used in or-der to achieve a target final application. However, these natural-origin polymers arequite versatile, and their structure can be modified and tuned with extra functionalities[313], broadening the range of processing techniques able to manipulate the polymers.Oxidised-dextran (dexOx) is easily obtained after periodate oxidation and yields a shorter

89

Chapter 6 Dextran-Based Microgels

dextran chain with aldehyde functionalities [14], which are extremely reactive towardsN-nucleophiles [29]. The most common application has been in drug conjugation, whichcan be called 1D processing, where small molecules [66, 7] but as well proteins [47] havebeen studied for improved drug delivery. A 2D processing has also been approached, bestexemplified by the coating of aminated surfaces [109, 111, 112] and finally, the 3D pro-cessing, in structures such as hydrogels, where a dexOx solution can be cross-linked withseveral different substrates [14, 35, 30, 104]. Apart from hydrogels, dexOx has not beeninvolved in many different 3D micro-processing. Some of the few existing studies inte-grate oxidised modified dextrans. Methyl polyethylene glycol (MPEG) modified dextran,for example, that after oxidation, cross-linked with human albumin in a water/acetonemixture to yield nanospheres, with narrow size distribution and under 200 nm diame-ter [107]. Oxidised sulfopropyl dextran microspheres for the delivery of mitomycin Cwere also successfully achieved [73, 74]. Another study, used oxidised dextran modifiedwith cholic acid, hydrophobic core, to promote self-aggregation in nanomicelles [71].However, simple dexOx has only been used as a cross-linker, in the case of gelatine, toprepare microspheres as carriers of pingyangmycin [70] and polyamidine TAPP-Br [106],interestingly, both studies obtained mean diameter sizes shy of 100 µm.

Figure 6.1.: Oxidised dextran and adipic acid dihydrazide reversible cross-linkingreaction

The formulation of oxidised dextran cross-linked with AAD has the potential of beinginjectable, and it has the capacity to form a hydrogel within a few minutes withoutrequiring the use of a chemical initiator (Fig. 6.1) [14]. The hydrogel eventually dissolves,in variable periods of time, depending on the dextran oxidation degree; the AAD feedconcentration or environment conditions, such as pH. Therefore, we intended to adaptthe components of this hydrogel formulation, and broaden the range of techniques,able to process this system. An all-water emulsion technique was preferred over otheremulsion techniques, specially the organic/aqueous emulsions, where protein aggregationcan occur at the aqueous/organic interface [314, 315]. This is an important aspect if a

90


protein drug, should be carried by such system. This water/water approach has only beenused with formulations involving cross-linking by radical polymerisation [316]. We chosethe method described by Hennink’s group, where an all-aqueous system is used, takingadvantage of the polymer-polymer immiscibility due to a thermodynamic constraint. Ina ternary system consisting of two water-soluble polymers and water, liquid–liquid phaseseparation can occur. From a thermodynamic point of view, phase separation in thesesystems occurs when the change in Gibbs free energy is positive [317, 318, 319]. To thebest of our knowledge, we will approach this emulsion technique, with a self-gelling andinitiator-free system, for the first time.


6.3.1. Materials

Polyethylene glycol (PEG; 20 kDa) was obtained from Merck – Schuchardt. PEG (6kDa) (Fluka), Polyvinyl Alcohol (PVA; 13 to 23 kDa), Dextran (from Leuconostocmesenteroids; Mw 60 kDa, according to Fluka’s specification), sodium periodate, adipicacid dihydrazide (AAD), ethyl carbazate (EtC), phosphate buffered saline (PBS), Tween60, dialysis tubes with a MWCO ~12 kDa were purchased from Sigma – Aldrich (Sintra,Portugal). All the reagents were used as received.

6.3.2. Preparation of Microspheres

Dextran with several oxidation degrees were prepared and characterised as describedelsewhere [35]. The dexOx samples used, have oxidation degrees of 8.6 ± 0.2 (D10),22.2 ± 0.7 (D25) and 33.0 ± 0.8 (D40) as calculated by 1H-NMR using EtC as titrant.Typically, a 25% (w/v) PEG or PVA solution was used as the continuous phase (CP), withAAD in the concentration range of 0.01 to 10 µg/mL. The dexOx solution (20% w/v)was used as the discontinuous phase (DP), either with or without Tween 60 (2% dexOxweight). On a first formulation screening, a capped reaction tube was filled with 10 mLof the CP and 250 µL of the DP were added. The system was vortexed at maximumspeed allowed for 60 seconds. The system was let to rest for 10 -15 minutes and thencentrifuged at 5000 rpm for 5 minutes. The supernatant was discarded and the pelletwas washed with PBS three times before being freeze-dried. The upscale was performed

91


with a 100 mL round-bottom vial with 3 entries. The stirring was provided by a home-made inox stirrer, and a Heidolph rotor (model RZR1). The CP and DP compositionsrespected the same concentrations and weight ratios as on the initial screen, describedabove. The microgels were collected on the same way as described before.

6.3.3. Scanning Electron Microscopy and Particle Sizing Analysis

Freeze-dried microparticles, were mounted into an aluminium stud and gold coated byplasma vapour deposition and were recorded by a field emission scanning electron mi-croscope (JEOL model JSM-5310), at 15.0 – 20.0 kV. Particle size distribution wasperformed with a COULTER LS 130 (Coulter Electronics) standard bench.


The mixing reaction of dexOx and AAD solutions is characterised as being fast, depend-ing on the feed concentration of the reactive species [35]. Therefore, the productionof microgels had to take this aspect into account on the expectation that it would notperturb significantly the phase separation. We observed that when AAD was formulatedwithin the discontinuous phase (DP), a better phase separation occurred. After establish-ing the best system configuration we screened the AAD concentration, oxidised dextranOD and the surfactant presence. Based on the work of Hennink’s group [317, 318, 319]we prepared a continuous phase (CP) composed of 6 kDa PEG dissolved in PBS to25% w/w. The DP was composed with dexOx dissolved in PBS (20% w/w) plus AAD.After adding the DP, a turbid solution was formed, suggesting the phasing out of themicrogels. With AAD above this concentration range, aggregates could be seen withthe naked eye, indicating the formation of macrogels. Within the concentration rangechosen, a homogenous turbidity was always observed. The SEM visualisation (Fig. 6.2)of the freeze-dried microgels elucidated the extreme importance of AAD on the microgelssize. Not only the microgels sizes decreased directly with the AAD concentration, butthe homogeneity in sizes also improved.

Because microgels tend to aggregate and form networks, we evaluated the effect ofthe addition of Tween 60 during their preparation. Previous studies have reported thatthe addition of a surfactant could avoid this phenomena [248]. According to Fig. 6.2,Tween 60 had little effect in the stabilisation of microparticles. These results suggest

92


Figure 6.2.: Freeze-dried microparticles morphology with varying concentrations ofAAD in PEG continuos phase, in the presence or not of Tween 60, as the surfac-tant. Bar corresponds to 10 µm.

that the aggregation of the microparticles might be due to the cross-linking of individualmicroparticles promoted by the adipic acid dihidrazide.

Next we evaluated the influence of oxidation degree of dextran as well as the compositionof the two-aqueous system in the size of the microgels. The oxidation degree of dextranappeared to have a slight influence on the particles sizes. There was a slight shift tolarger average sizes with the lowest oxidised dextran (D10), which could be due to theless cross-linking points available (Fig. 6.3A). On the other hand, the highest oxidised

93


Figure 6.3.: Differential volume percentage for microgels synthesized with different ox-idised dextrans in CP with PEG 6 kDa (a); and D40 microgels synthesized in differentCP (b). Every CP presented 0.01 µg/mL of AAD

sample (D40) originated other populations with lower diameter sizes. Analysing thecontinuous phase, apart from PEG 6 kDa, we also tested a higher Mw PEG (20 kDa),but also a different synthetic polymer, PVA with ~10 kDa. The results suggest that theMw increase of PEG, directly affected the microparticles polydispersity. PVA, however,promoted a less polydispersed sample (Fig. 6.3B).

The sizes obtained by light scattering were considerably higher than the apparent sizesobserved by SEM. We need to take into consideration that a few aspects might haveinfluenced this difference. The SEM observed samples were in a freeze-dried state com-pared to the ones measured by LS, which were re-suspended in water and subjected tosonication. This phenomenon might be ascribed to the physical state of the nanoparticleswhen characterised by the two techniques: dry state for SEM and hydrated state for lightscattering analyses. Similar differences have been described elsewhere for peptide-coatedself-assembled nanoparticles of poly(ß-amino ester) and DNA [252]. These microgels,should behave similarly with the previously characterised hydrogels therefore, some ini-tial burst swelling is expected. The higher ratio surface/volume of the microgels shouldpromote a faster uptake of water, which leads to the much higher particle sizes when insolution.

6.5. Conclusion

The results obtained, in this work, suggest that it is possible to obtain microgels based onoxidised dextran cross-linked with AAD, using this all-water emulsion system. Comparedto other systems, we were able to avoid the use of chemical initiators, which reduce the

94

6.5 Conclusion

amount of toxic components. We observed, that the cross-linker concentration, AAD,present on the continuous phase, is responsible for the particles size and homogeneity.As the concentration decreases, so does the particle size. Higher AAD concentrationsshould lead, not only to larger particles but also to higher microgels aggregation. Theoxidation degree, also seems to affect the polydispersity of the microgels, but to a lowerextension. The microgels, should behave similarly with the studied hydrogels, havingdissolution time profiles, dependent on the oxidation degree [35]. The type of polymerused on the continuous phase appears to have a relevant role. Both the polymer natureand the molecular weight were shown to affect the microgels polydispersity. Otherexcipients (e.g. surfactants) should be screened, to improve the microgels stability uponcryopreservation or freeze-drying.

Further studies to evaluate the dissolution profile of this system and the efficiency ascarrier for small molecules with amine moieties or proteins should be performed.

95

7. Dual Pro-angiogenic TherapyBased on Hybrid HydrogelNetworks

7.1. Abstract

We present a hybrid hydrogel, where a VEGF-loaded matrix was combined with anendothelial cells-loaded fibrin matrix. Oxidised dextran was used as the basis for thematrix-bearing VEGF. Oxidised dextran conjugates to VEGF, through covalent iminebonds. The oxidation degree effect on VEGF’s three-dimensional structure was evalu-ated by circular dichroism and the bioactivity was assessed by the stimulation effect onsome VEGF receptor 2-mediated metabolic pathways. The VEGF release profile from ox-idised dextran hydrogels was followed by radioactivity and ELISA. The dexOx hydrogelswere entrapped in fibrin matrices loaded with endothelial cells and an influence on geneexpression and 3D cell organisation was observed which is dependent on the oxidationdegree. We envision that these constructs might be beneficial for the induction of arapid pro-angiogenic response in ischemic tissues, as well as matrixes to drive the in situdifferentiation of vascular progenitor cells.

7.2. Introduction

Ischemic diseases such as myocardial infarction, chronic wounds and stroke, are thecause of high morbidity and have an important social impact on the western society.Two major angiogenic therapies are under study to treat patients suffering from thesediseases. One is based on the delivery of growth factors, such as, VEGF, placenta growthfactor (PlGF) or FGF among others [135] and the second one takes advantage of cells,

97

Chapter 7 Pro-angiogenic Hybrid Hydrogels

such as EPCs [167]. In the first group, VEGF has been extensively examined in thepromotion of tissue vascularisation. Unfortunately, the bolus delivery of VEGF in phaseII human clinical trials failed to demonstrate significant benefits in the approved endpoints [148]. The fast plasma clearance (19.1 ± 5.7 mL/min/kg) and short half-life(33.7 ± 13 min) of VEGF [164] are likely in the origin of the poor therapeutic efficacyobserved [147, 320, 148, 135]. To overcome this issue, several polymeric matrices havebeen developed for the efficient delivery of VEGF [170]. The strategies range fromsimple VEGF diffusion out of the gel [173], to delayed release due to VEGF affinity-based interactions with the matrix [188] or due to covalent binding [137]. Overall,the spatio-temporal presentation of VEGF is essential for a proper therapeutic actuation[321]. Despite these advances, alternative therapeutic solutions are needed to potentiatethe effect of VEGF in ischemic tissues and rapidly form blood vessels.

The transplantation of vascular cells could be a potential platform for the quick formationof blood vessels after an ischemic insult. Indeed, several studies have demonstratedthat the transplantation of EPCs or vascular cells, derived from umbilical cord bloodstem cells, can increase significantly the vascularisation of ischemic tissues. This wasdemonstrated in animal models of hindlimb ischemia [169, 206, 139, 207], myocardialischemia [208, 209, 210] and diabetic chronic wounds [138]. Unfortunately, the survival ofthese cells is relatively low in the first days of post-transplantation due to a combinationof different factors, including oxidative stress or inflammation. A three-dimensionalscaffold able to support the attachment of vascular cells and simultaneously deliverVEGF could be beneficial for the development of more potent and rapid pro-angiogenictherapies. The combination of both platforms in a single matrix should meet severaldesign criteria. First, it should support the attachment of vascular cells and allow theirmigration and organisation. Second, it should allow the delivery of VEGF at appropriaterates and concentrations. Although recent studies have reported the incorporation ofpro-survival factors with vascular cells in the same matrix [322], it is difficult to decouplethe growth factor delivery component from the cell-matrix component.

Herein, we developed a new approach to integrate in the same three-dimensional hydrogelscaffold a growth factor delivery system and a substrate able to support cell attachmentand remodelation. Both components can be tailored separately to match different needs.VEGF was covalently conjugated to oxidised dextran and the immobilisation efficiency,VEGF three-dimensional structure and bioactivity were characterised. We show that theoxidation degree of dextran has a tremendous impact on the presentation of VEGF to itsnatural cellular receptors, as evaluated by the effect on intracellular signaling molecules

98


like Ca2+, ERK and Akt. We further show that the crosslinking of these conjugateswith adipic acid dihydrazide yield gels having variable VEGF release kinetics, dependingon the OD of dexOx. The incorporation of these VEGF-releasing systems within fibrinhydrogels containing endothelial cells, showed a pro-survival effect dependent of the ODof the dexOx hydrogels, as observed by contrast phase microscopy and qRT-PCR.


7.3.1. Materials

Adipic acid dihydrazide, EtC, dextran (from Leuconostoc mesenteroides; Mw 60 kDa, ac-cording to Fluka’s specification), NaBH3CN (Fluka), dialysis tubes (MWCO of 12 kDa),human fibrinogen, human thrombin, phosphate-buffered saline (PBS), Tris-buffered saline(TBS), Histopaque-1077 Hybri Max, rhodamine B isothiocyanate (TRITC), serum freemedium 199 and Pluronics F127 and oligonucletides used as primers in qPCR were pur-chased from Sigma. Endothelial growth medium (EGM-2) and human umbilical veinendothelial cells (HUVEC) were purchased from Lonza. Slide-a-lyzer (10 kDa) was ac-quired from Thermo Scientific. N-Succinimidyl-[2,3-3H] Propionate (3HNSP; 1 mCi/mLwith specific activity of 80 mCi/mmol) was purchased from Scopus Research. scintilla-tion liquid Ultima Gold XR purchased from Perkin-Elmer. DuoSet ELISA kit from R&DSystems. Fura-2AM was purchased from Molecular Probes. Phosphoprotein assay kitwas purchased from Biorad. Taqman Reverse transcription reagents and Power SYBRGreen PCR Master Mix were from Applied Biosystems. The RNeasy Mini Kit was pur-chased from Qiagen. CaCl2 was acquired from Merck. DiI-Ac-LDLwere purchased fromBiomedical Technologies. The mini-MACS immunomagnetic separation system was pur-chased from Miltenyi Biotec. Fetal bovine serum, Trizol reagent, Fibrinogen - AlexaFluor 488 conjugate and the LIVE/DEAD kit were purchased from Invitrogen.VEGF wasa kind gift of Genentech, Inc, South San Francisco, CA. All materials were used asreceived.

7.3.2. Dextran Oxidation and Characterisation

An aqueous solution of dextran (1 g; 12.5%, w/v) was oxidised with 2 mL of sodiumperiodate solution with different concentrations (33 – 165 mg/mL) to yield theoretical

99


oxidations from 5 to 25%, at room temperature. The reaction was stopped after 4 hours.The resulting solution was dialysed for 3 days against water, using a dialysis tube with aMWCO 12 kDa, and then lyophilised (Snidjers Scientific type 2040, Tillburg, Holland).The scale-up of the reaction was done using the same procedure albeit using 30 g ofdextran and a calculated amount of periodate to yield a theoretical oxidation of 5, 10and 25%, referred as D5, D10 and D25, respectively.

The real oxidation degree (OD) was quantified by 1H NMR (Varian 600 NMR spectrom-eter, Palo Alto, CA) using EtC as a titrant and taking into account the ratio betweenthe integral of the peak at δ 7.3 ppm and the integral of the anomeric proton at δ 4.9ppm. The spectra were analysed with iNMR software, version 2.3.3 (www.inmr.net).

7.3.3. VEGF Labelling

The N-Succinimidyl-[2,3-3H] Propionate (3HNSP) solution was transferred to a glassvial with a rubber stopper and the airspace was flushed with N2, to allow evaporationof the ethyl acetate. A PBS-dialysed solution of VEGF with 2.54 mg/mL was movedto the 3HNSP vial and stirred magnetically, at room temperature, for 4 hours. Thesolution was transferred to a slide-a-lyzer cassette (10 kDa) and dialysed against PBS.The resulting absorbance at 276 nm (εvegf = 0.37) revealed a 2.13 mg/mL VEGF-3Hsolution. The estimated radioactivity is 1.33 ± 0.07 mCi/mmol of VEGF. The sampleswere mixed with scintillation liquid and the scintillation counts were read on a Perkin-Elmer Tri-Carb 2900T Liquid Scintillation Analyser.

7.3.4. Characterisation of VEGF Conjugates by GelElectrophoresis

The SDS-PAGE was performed on a 12.5% polyacrylamide gel and 0.75 mm thick.Approximately 5 - 10 μg of protein was loaded into each well, after denaturing for5 minutes at 95 °C. The samples were run at 200 V and later revealed with ComassieBlue. The loaded samples consisted of VEGF or mixtures between VEGF and the severaldextrans at 100-fold weight excess of dextran or the different dexOx’s. In onne case D25-VEGF sample was reduced with an VEGF equimolar amount of NaBH3CN.

100


7.3.5. Characterisation of VEGF Conjugates by CircularDichroism

Far-UV circular dichroism (CD) spectra were collected using a Olis DSM 20 spectropo-larimeter equipped with a Peltier temperature controller. Protein samples (~0.6 mg/mL)were analysed at 37 °C in a quartz cuvette with a 0.2 mm path-length. Spectra werecollected at resolution of 1 nm with 4 seconds of integration time with a bandwidth of0.6 mm. To monitor changes in the secondary structure of VEGF bound with dexOx,CD spectra were obtained for VEGF in the presence of a 100-fold weight excess of dex-tran or the different dexOx’s. Spectra for VEGF bound with dextrans were backgroundcorrected with respect to the same dextran in buffer.

7.3.6. Evaluation of VEGF Conjugates Bioactivity

HUVECs (passage 7) or endothelial cells (derived from CD34+ umbilical cord blood cells[138]) were cultured in EGM-2 medium at 37 °C and 5% CO2 until sub-confluence wasachieved. The cells were tripsinized and plated into an opaque 96-wells plate (Costar)with an initial seeding of 30,000 cells per well. After reaching sub-confluence, theywere kept in starvation for 20h in M199. The medium was discarded and the wellswere loaded with Fura-2 calcium fluorescent indicator by incubation with 5 μM of themembrane permeable acetoxymethyl (AM) derivative FURA-2/AM (1 mM in DMSO,Molecular Probes, Invitrogen) and 0.06% (w/v) Pluronic F-127 (Sigma), using basalmedium (M199, Sigma) as a vehicle (35 μl/well, not supplemented with serum norantibiotics), for 1 hour at 37 °C in 5% CO2 and 90% humidity. Cells were washed twicewith sodium salt solution (140 mM NaCl, 5 mM KCl, 1 mM MgCl2, 10 mM glucose,10 mM HEPES Na+pH 7.4) and once again before testing each condition. The readingwas performed at 25 °C (Spectramax Gemini EM, Molecular Devices, with SoftMax ProSoftware), by measuring emission at 510 nm using two alternating excitation wavelengths(340 and 380 nm). Cells were stimulated with 2 μL of VEGF, D25-VEGF and D25-VEGF(cyanoborohydride reduced) solutions to yield a 100 ng/mL final concentration of VEGFand 1000-fold more of D25, when present (n=4). Activation of Akt and extracellularsignal-regulated kinase (ERK) in HUVECs (80% confluency, in 6 well plates) was inducedby starving the cells for 20 h in serum-free M199 medium (with Earle’s Salts and L-glutamine; Sigma-Aldrich) [157] and then treating them for 10 minutes, by replacing themedium by fresh M199 containing VEGF or VEGF conjugates. Following treatment, the

101


plates were immersed on ice and the medium discarded. Then the proteins were isolatedfrom the cells (total protein concentration of 220-300 μg/mL) using the Bio-Plex CellLysis kit (Bio-Rad) and the levels of Akt and ERK phosphorylation were determinedusing a Bio-Plex kit (Bio-Rad), according to manufacturer’s recommendations.

7.3.7. Release of VEGF from DexOx Hydrogels

The D25 was dissolved in aqueous solvent (PBS) to obtain a 20% (w/w) and stored at4 °C if not used immediately. The hydrogels were produced by mixing thoroughly 100 µLof D25 and 100 µL of AAD, with different concentrations. The AAD concentration usedwas calculated based on a given molar percentage of dextran residues. The hydrogelswere let to cure for never less than 2 hours and the swelling was performed in 24-wellscell culture plates immersed in 1 mL of PBS at 37 °C. At regular time intervals, thehydrogels were removed from the aqueous solution, blotted in filter paper, weighted (Wt)and returned to the original well while the buffer was replaced.

For the in vitro studies, VEGF or VEGF-3H were added to the D25 solution or the AAD10% solution, to obtain a 0.2 mg/mL final concentration, delivering 20 µg of VEGF,per hydrogel. The VEGF release study was performed in the same conditions as theswelling study. At regular time intervals, the immersion media was collected and savedand replaced by new media. The released VEGF was quantified either by ELISA orscintillation.

7.3.8. Hybrid Hydrogels of DexOx and Fibrin

DexOx hydrogels were prepared on top of the plungers of 1 mL sterile syringes with cuttips and were let to cure for 2 hours. They were later washed with PBS (three times)and let in contact with fibrinogen solution for 30 minutes. The hydrogels were latercovered with mixed fibrin gel precursor solution to yield a hydrogel. The 10 μL dexOxhydrogels were prepared with D5, D10 (30% w/w)chapter 5 and D25 (20% w/w) with10% crosslinking degree of AAD. When required, VEGF was added to the feed solution ofdexOx or AAD, at 20 μg/mL, before the preparation of the hydrogels. Endothelial cells(induced from CD34+ UCB isolated cells, as described elsewhere [138]) were delivered inthe fibrin hydrogels as previously described [138]. Fibrin gels were formed by crosslinkingof fibrinogen in the presence of thrombin. The 50 μL fibrin gels contained 10 mg/mLfibrinogen (in TBS, pH 7.4), 2 U/mL thrombin and 2.5 mM CaCl2. CD34+-derived

102


ECs (0.35 × 105) were centrifuged, ressuspended in the fibrin gel precursor solutionand transferred to the syringes containing the dexOx hydrogels. Polymerisation wasinitiated at 37 ºC and allowed to proceed over 30 minutes. After polymerisation, thecell constructs were removed from the syringes and placed in 96-well plates containingculture medium identical to EGM-2 but without VEGF (unless otherwise stated), for upto 6 days. After 6 days, the live cells were counted and enough hydrogels were savedand stored at –80 °C for posterior analysis.

DexOx (D25) modified with TRITC and fibrinogen conjugated with Alexa fluor 288 wereused to prepare fluorescent hydrogels. To 100 μL of D25 (20% w/w) was add 1 μLof 10 mg/mL of TRITC in DMSO and the final solution was diluted 100-fold in D25(20% w/w) solution, before crosslinking with AAD (20%). The Alexa fluor conjugatedfibrinogen was resuspended to 20 mg/mL in TBS buffer (pH 7.4) and diluted 1000-foldwith a plain fibrinogen solution (20 mg/mL). The hybrid hydrogels were prepared betweenglass slides for visualisation under the fluorescence microscope. A Zeiss Axiovert 200Mfluorescence inverted microscope with 1.25x and 5x objectives was used. Endothelialcells stained with Hoechst were encapsulated in the fibrin hydrogel.

7.3.9. Viability of Encapsulated Endothelial Cells

Cell viability was determined using a LIVE/DEAD kit. The gels containing the encap-sulated cells were washed in PBS, immersed in a working solution of 2 μg/mL calceinAM and 4 μg/mL ethidium homodimer-1 in PBS for 30 minutes at 37 ºC and visualisedunder a Zeiss Axiovert 200M fluorescence inverted microscope. The statistical signifi-cance was determined by using one-way ANOVA followed by Dunnett’s post hoc test forcomparison with control, with P < 0.05 considered to represent statistical significance.

7.3.10. Quantitative Real time Reverse-TranscriptionPolymerase Chain Reaction

Cell constructs were collected at day 6 and stored at – 80 °C until further use. Cellconstructs were disrupted in Trizol reagent in 2 mL tubes containing a 5 mm diame-ter stainless steel bead (Qiagen), in a TissueLyser II aparatus (Qiagen) for 2 min, at30 Hz. Total RNA was isolated by using the RNeasy Mini Kit, according to manufac-turer’s instructions. cDNA was synthesized from 1 μg total RNA using Taqman Reverse

103


transcription reagents. Quantitative PCR (qRT-PCR) was performed using Power SYBRGreen PCR Master Mix and the detection was carried out in a 7500 Fast Real-Time PCRSystem (Applied Biosystems). Quantification of target genes was performed relativelyto the reference gene (GAPDH): relative expression= 2[−(Ctsample−CtGADP H)] [323]. Themean minimal cycle threshold values (Ct) were calculated from four to six independentreactions. The primer sequences can be found on Tab. 7.1.

Table 7.1.: Primer sequences used for rtPCR.

Target Gene Primer SequenceHuman GAPDH Forward: AGCCACATCGCTCAGACACC

Reverse: GTACTCAGCGCCAGCATCGHuman VEGF Forward: AGAAGGAGGAGGGCAGAATC

Reverse: ACACAGGATGGCTTGAAGATGHuman Flk-1 Forward: CTGGCATGGTCTTCTGTGAAGCA

Reverse: AATACCAGTGGATGTGATGGCGGHuman MMP2 Forward: CCCAGAAAAGATTGACGC

Reverse: CGACAGCATCCAGGTTATHuman MCP-1 Forward: CCCCAGTCACCTGCTGTTAT

Reverse: TGGAATCCTGAACCCACTTC

7.3.11. Statistical Analysis

For the cell viability and the qRT-PCR analysis a paired t test was used. Results wereconsidered significant when P ≤ 0.05. GraphPad Prism 4.0 (San Diego, CA) was used.


7.4.1. VEGF Conjugation to DexOx

The periodate ion attacks vicinal diols in dextran, between carbons C3 - C4 or C3 - C2,breaking the C - C bond and yielding aldehyde groups. The oxidation degree of dexOxwas determined by 1H-NMR after titration with ethyl carbazate (chapter 5). The dexOxsamples, D5, D10 and D25, used in this study, have an OD of 3.6 ± 0.1, 8.6 ± 0.2 and17.8 ± 1.2, respectively. The dexOx derivatives were then conjugated with VEGF to havea final mass ratio of 100-fold. The conjugation of VEGF to dexOx is mediated by iminebonds (Schiff base) [48]. The reversible imine bond can then be reduced to an amine,

104


an irreversible and stable bond, by sodium cyanoborohydride. The presence of VEGFin both dexOx-VEGF conjugates (non-reduced and reduced forms) was characterised bySDS-PAGE (Fig. 7.1A). In this case, the presence of unconjugated VEGF contributesfor a band with an electrophoretic mobility at approximately 40 kDa (lane 1), whileconjugated VEGF contributes for bands with an electrophoretic mobility above 40 kDa(lanes 2-4), likely depending in the degree of VEGF immobilisation into each polymerchain. Solutions of non-oxidised dextran with VEGF (lane 5) and VEGF reduced withNaCNBH3 (lane 6) were used as controls to demonstrate that the presence of dextranor the reducing activity of NaCNBH3 does not affect the electrophoretic mobility ofunconjugated VEGF, respectively.

Figure 7.1.: Conjugation of oxidised dextran to VEGF followed by SDS-PAGE (A). vegf(1); D5-vegf (2); D10-vegf (3); D25-vegf (4); dextran + vegf (5); reduced vegf (6);reduced D25-vegf (7); D25 (8); (B) Schematic representation of dextran oxidationand subsequent immobilization of VEGF.

According to Fig. 7.1A the conjugation of VEGF to dexOx without reduction with sodiumcyanoborohydride is directly proportional to the OD in dexOx (lanes 2 - 4). The imageanalysis (ImageJ) revealed an amount of free protein of 32.6 %, 15.5 % and ~ 0 % for theD5, D10 and D25 conjugates, respectively. The presence of free VEGF in D5 and D10conjugates might be due to two different reasons. First, dexOx with low oxidation degreemight be unable to immobilise chemically all the VEGF added initially to the polymeric

105


solution. Second, because dexOx with low oxidation degree immobilises VEGF by a lownumber of attachment points, the biomolecule might be released overtime due to theinstability of imine bonds. The absence of free VEGF in D25 might be due to the slowdissociation of VEGF from dexOx due to multi-point attachment. In line with our results,the conjugation of VEGF into dexOx with high OD (D25) and subsequent reduction withsodium cyanoborohydride yields a conjugate with complete immobilisation of VEGF (lane7).

7.4.2. Structure Stabilisation of VEGF

We investigated the three-dimensional (3D) structure of VEGF chemically immobilisedinto dexOx by circular dichroism (CD). Previous studies have shown that in most casesthe chemical immobilisation of proteins into dexOx does not affect its native structureand activity [48] even at wide temperature ranges [84]. The CD spectra of either reducedor non-reduced D25-VEGF conjugates showed comparable 3D structural organisation asunconjugated VEGF (Fig. 7.2A). There was a decrease in the intensity of the 204 nmpeak, either for the reduced VEGF or reduced D25-VEGF conjugate. As cyanoborohy-dride does not reduce disulphide bridges (lane 7, Fig. 7.1A) [324], a drastic secondarystructure change is not expected. This might be due to differences in protein concen-tration. Any potential interference in the 3D VEGF structure was expected to promoteshifts in the absorption band of the spectrum. However, the denaturation of VEGF bytemperature, did not affect the overal spectrum, except after reaching 90 ºC, where apeak shift occurred to approximately 200 nm. With the temperature increase, proteinprecipitation was observed, which was reflected on a decrease in intensity (Fig. 7.2B).Other denaturation conditions failed to be observed by CD, due to the high amount ofnecessary salts, which interfere in the absorption spectrum.

Next, we estimated the secondary structure of VEGF chemically immobilised into dexOxby fitting the CD data with CONTIN software. The secondary structure percentageswere estimated taking in account the number of residues assigned to each structure (α-helix and β-strand) reported in previous studies. One study characterised the fragmentcorresponding to the KDR-binding domain (95 residues; 2VPF from Protein Data Bank)[325] and other characterised the heparin-binding domain (55 residues; 2VGH from Pro-tein Data Bank) [326] fragment of VEGF). All the other residues were considered to berandom coil for a total of 165 residues (Tab. 7.2).

According to Tab. 7.2, an increase of 7% on the α-helixes and a decrease of 6% on the

106


β-sheets content were observed on D25-VEGF conjugate as compared to the originalVEGF.

Figure 7.2.: (A) Circular Dichroism spectra of VEGF; D25-VEGF; reduced D2-VEGF;reduced VEGF at 25 °C. (B) Circular Dichroism spectra of VEGF at increasing tem-peratures. * Spectrum at 25 °C after decreasing temperature from 90 °C.

However, this result might be affected by the high absorbance observed on the infraredwindow of the spectrum, likely interfering with our fit curve. Interestingly, the reductionof D25-VEGF by cyanoborohydride reverted this shift up to normal percentual values.This could be due to an increase in rigidity of the conjugate, possibly promoted by the

Table 7.2.: Estimation of rhVEGF secondary structure percentage from circulardichroism.

Entry α-helix(%)

β-sheet(%)

Unordered(%)

SDE Ref.

VEGF1 11-12 37-41 48-51 - PDB; [325, 326]

VEGF 14 39 47 ≤ 0.01 -VEGF reduced 15 36 48 ≤ 0.01 -D25 + VEGF 21 33 46 ≤ 0.01 -

D25 + VEGF reduced 14 37 49 ≤ 0.01 -

1 - Based on crystallography and NMR studies [325, 326]; 2VPF and 2VGH files from the Protein DataBank. Both estimations considered 165 residues

increasing number of links within the conjugate [33], maintaining the original conforma-

107


tion. On the other hand, the reversible character of the imine bonds in the non-reducedD25-VEGF conjugate might promote some changes in the 3D VEGF structure, explain-ing the higher deviations observed for this sample. Overall, the 3D structure of VEGFis substantially not affected by the chemical conjugation to dexOx.

7.4.3. Intracellular Ca2+ Uptake in Endothelial Cells

To assess the bioactivity of VEGF conjugated to dexOx we evaluated its ability to inducean increase in intracellular Ca2+ [327] mediated by the activation of VEGF receptor 2[142, 328]. Initially, we tested the ability of VEGF conjugates to induce an increase ofintracellular Ca2+ in HUVECs. Previous results have shown that free VEGF activates thetransient increase in cytosolic calcium in HUVECs through VEGFR2 [329]. This calciumis released initially from intracellular Ca2+ stores and only after is due to extracellularcalcium influx [329].

Figure 7.3.: Intracellular Ca2+ uptake as determined by Fura-2-loaded HUVECs. (A)VEGF dose-dependent Ca2+ uptake (blue dots; VEGF concentration in ng/mL). (B)Changes in the concentration of intracellular Ca2+ in the presence of the differentdexOx-VEGF conjugates (green dots; VEGF at 100 ng/mL). Histamine (100 μM)and BSA (1%, w/v) were used to set the limits (100% and 0%, respectively) andnormalized the experimental data of Ca2+ uptake (n = 4 – 8).

In this work, HUVECs were cultured in serum-free medium for 20 hours to reduce theinfluence of VEGF present in the serum and loaded with a fluorescent dye to monitorthe intracellular concentration of Ca2+. As a first step, cells were activated by different

108


concentrations of free VEGF to determine a dose response profile (Fig. 7.3A). Histamineand BSA were used to set the range of Ca2+ uptake. The administration of VEGFinduces an increase in Ca2+ uptake (first 5 minutes), followed by a plateau phase whereCa2+ remains constant for the remaining of the experiment. In line with previous studies[327], the levels of cytosolic Ca2+ increased in direct correlation with an increase ofVEGF concentration. The VEGF concentration decrease also promoted a rate decreaseon Ca2+ uptake.

Figure 7.4.: Intracellular Ca2+ uptake as determined by Fura-2-loaded endothelial cellsderived from cord blood stem cells. (A) VEGF dose-dependent Ca2+ uptake (bluedots; VEGF concentration in ng/mL). (B) Intracellular levels of Ca2+ mediated byVEGF conjugates (D25-VEGF, D10-VEGF and D5-VEGF). (C) Intracellular levelsof Ca2+ mediated by VEGF cyanoborohydride-reduced conjugates (D25-VEGF, D10-VEGF and D5-VEGF). The concentration of VEGF conjugate assessed in these assayscorresponds to a concentration of 100 ng/mL of VEGF (n = 4 – 8).

109


Next, we evaluated the inductive effect of different dexOx-VEGF conjugates in the intra-cellular concentration of Ca2+ (Fig. 7.3B). For that purpose, HUVECs were stimulatedwith VEGF conjugates having a concentration of 100 ng/mL VEGF . Interestingly, D25-VEGF induces an initial increase of intracellular Ca2+ corresponding to the effect of 25ng/mL of free VEGF, reaching a plateau after 7-8 minutes with a similar intracellularCa2+ concentration, as observed for 100 ng/mL of free VEGF. Our results indicate thatalthough D25-VEGF loses approximately 75% of the initial induction effect (taking intoaccount that D25-VEGF has 100 ng/mL of VEGF), the later response is similar to 100ng/mL VEGF. The D5- and D10-VEGF conjugates have similar Ca2+activation profiles.Both conjugates induce an initial increase of intracellular Ca2+ corresponding to theeffect of free VEGF between 50 and 100 ng/mL, reaching the plateau after 7-8 minuteswith an intracellular concentration of Ca2+ that is slightly lower than the one observedfor 100 ng/mL of free VEGF. The differences found in the initial intracellular Ca2+ pro-files between unconjugated and conjugated VEGF might due to the accessibility of VEGFto interact with its receptors. It is likely that only part of the immobilised VEGF in allthree conjugates will activate VEGF receptor due to conformational barriers; however,the conjugates could maintain their activation for long time without the complex ligand-receptor being internalised and eliminated by the cell. The same effect was observedwith CD34+-derived endothelial cells. The dexOx conjugation to VEGF, reduced theCa2+ activation profile and this reduction was dependent on the OD (Fig. 7.4B). Thereduction on calcium uptake was not so drastic, as observed earlier for the HUVECs,which might be due to the differences between both kinds of cells and the density ofVEGF receptors at the cell surface ([138]). Again, the higher the OD, the more iminesare formed between the dexOx and VEGF, which is more extensive in the case of D25.The reduction of the conjugate, to non-hydrolisable amine bonds, with cyanoborohy-dride, further reduced this calcium uptake. This effect is more expressive with D25,strongly inhibiting the bioactivity of VEGF (Fig. 7.4B&C). The Ca2+ uptake reductionwas less pronunciated with D10 (Fig. 7.4B&C) and D5 (Fig. 7.4B&C), suggesting thehigher conjugate lability on these two last conditions.

7.4.4. Phosphorylation of Akt and ERK in Endothelial Cells

To further confirm the activation of endothelial cells by D25-VEGF, the activation ofAkt [157] and ERK [330, 331] (downstream effectors of VEGF signaling pathway), wereevaluated by protein analysis. In this case, HUVECs were starved for 20 hours in serum-

110


free M199 medium and then treated for up to 20 minutes with M199 medium containingVEGF or D25-VEGF conjugate. The levels of phosphorylated and total Akt and ERKproteins were determined using a Bio-Plex kit. A VEGF concentration of 100 ng/mLwas used in all experimental groups. VEGF increased Akt phosphorylation as early as5 minutes and produced a maximal effect at 15 minutes (Fig. 7.5A), declining there-after. The same samples were evaluated for the activation of ERK1/2 signaling pathway(Fig. 7.5B). The activation of ERK1/2, a mediator in the mitogen-activated protein ki-nase (MAPK) cascade, may promote cell proliferation [331] or cell survival when cellsare cultured under stress conditions [330]. ERK1/2 signaling was highly activated whenHUVECs were exposed to VEGF.

Figure 7.5.: Phosphorylation pathways. (A) Akt and Erk expression (phospho/totalprotein ratio) throughout 20 minutes, after stimulation by VEGF (100 ng/mL) and 20hours of starvation. Upper dashed lines represente the positive control: EGM-2; andlower dashed lines represent the negative controls: M199. (B) Erk phosphorylationratio by soluble VEGF, D25-VEGF and D25-VEGF (reduced) at 10 minutes afterstimulus, after 20 hours of starvation. All conditons presented VEGF at 100 ng/mL.

Free VEGF increased ERK1/2 phosphorylation as early as 5 minutes (first time point)followed by a decrease on the effect up to 20 minutes. A similar profile has been reportedelsewhere for the activation of ERK by free VEGF [331]. As the ERK pathway was themost responsive under the studied conditions, the effect of non-reduced or reducedD25-VEGF conjugate was assessed. Importantly, cells exposed to unconjugated VEGFfor 10 min have higher activation than non-reduced or reduced D25-VEGF conjugate(Fig. 7.5C). This is in line with the previous intracellular Ca2+ results. This is likely due

111


to the fact that VEGF conjugated to DexOx has decreased access to the VEGF receptordue to the physical restrictions exerted by the dextran polymer.

7.4.5. VEGF Controlled Release from Hydrogels

Next, we evaluated the release of VEGF from hydrogels prepared by the cross-linking ofdexOx-VEGF with AAD. Considering that the terminal half-life of VEGF, after a 4-hourintravenous steady infusion, is around 30 minutes [164], the dexOx-VEGF-AAD hydrogelsmay be a valuable sustained delivery system of VEGF. Several formulations have beenreported in the last years, for the sustained release of VEGF, based on the physicalimmobilisation of VEGF such as heparin-based hydrogels [188], dextran sulphate-basednanoparticles [203] and on the chemical immobilisation of VEGF to networks formedby collagen, PLGA and PEG [175, 176, 137, 195]. In this work, VEGF was chemicallyconjugated to dexOx (100-fold weight excess of dexOx to VEGF) and the remainingaldehyde groups reacted with AAD to form a gel. The gel was formed within minutes[14] depending on the feed concentration of dexOx and/or AAD. Several gel formulationswere prepared based in D25-VEGF, different concentrations of AAD (10% and 20%),and different methodologies (addition of VEGF to the D25 or the AAD solution).

Hydrogels with or without VEGF have similar dissolution profiles. Hydrogels with lowcross-linking density (5% AAD) are dissolved completely before the fourth day and werenot further studied. Hydrogels with medium cross-linking density (10%) and containingVEGF have similar dissolution times as hydrogels without VEGF, however presenting ahigher swelling profile (Fig. 7.6A). Hydrogels with high cross-linking density (20%) didnot dissolve up to over 30 days (Fig. 7.6A).

To determine the release of VEGF from hydrogels we used two methodologies: (i)quantification by ELISA and (ii) quantification by tritium (3H-VEGF). We evaluated therelease of VEGF in hydrogels having D25 and different cross-linking densities (10 and20% AAD) and hydrogels where (i) VEGF was first conjugated with dexOx and thencross-linked with AAD or where (ii) VEGF was added first to AAD and then cross-linked with dexOx. The formulation where VEGF is conjugated to dexOx before gelpreparation promotes higher levels of conjugation than when VEGF is conjugated duringthe preparation of the gel.

ELISA results showed that only a tiny amount (< 4%) of VEGF is released from thegels (Fig. 7.6B). This is likely due to the fact that most of the VEGF released from

112


Figure 7.6.: (A) Swelling of D25 hydrogels crosslinked with 10% AAD, with (#) andwithout (6) VEGF, and D25 hydrogels crosslinked with 20% AAD with VEGF (A).(B, C, D) Release of VEGF, as quantified by ELISA (B, D) or scintillation (C), fromD25 hydrogels crosslinked with 10% AAD, in which VEGF was added in the dexOxsolution (#) or in the AAD ( ) solution, from D25 hydrogels crosslinked with 20%AAD (A), from D10 hydrogels crosslinked with 10% AAD (�), and from D5 hydrogelscrosslinked with 10% AAD (3). Results are average ± SD, n=3.

the gel is still conjugated to dexOx. The presence of dextran attached to VEGF willprevent its interaction with the antibody that recognises VEGF. In line with all this,when VEGF is released from gels where the biomolecule was incorporated in the networkduring its formation (mixed with AAD), therefore less conjugated to the network, thecontent of VEGF released is higher (up to 3.5% of the total VEGF incorporated in thenetwork) than in the other experimental groups. When VEGF is firstly conjugated withdexOx and then used for gel preparation, only 0.1% of the total VEGF is released over30 days (Fig. 7.6B). In a subsequent step, radio-labeled VEGF (3H-VEGF) was used forthe release studies (Fig. 7.6C). In contrast to the ELISA results, a significant release

113


of VEGF was observed for all the experimental groups, showing that most of VEGF isconjugated with DexOx. The release of VEGF in gels with medium cross-linking density(10% AAD) peaks at day 5 corresponding to the total dissolution of the gel. The releaseof VEGF in gels with high cross-linking density (20%) is low (< 2%) for the first 20days and increases abruptly afterwards. Next, we evaluated VEGF release from D5 orD10-based hydrogels. In contrast to D25-VEGF hydrogels, D10 and D5-based hydrogelsrelease high concentration of VEGF as assessed by ELISA (Fig. 7.6D). The D5 hydrogelsdegrade in less than 2 days and release approximately 30% of the initial VEGF over thattime while D10-based hydrogels degrade in 4 days and release approximately 7% of theinitial VEGF over the same time.

The amount of VEGF identified by ELISA, may not account for the total real releaseddrug, but it qualifies as the active VEGF, as it was identified by anti-VEGF antibodies.The slow release of the VEGF, plus the protecting effect of the binded dexOx, couldhelp establish a gradient within an optimal concentration range (0 - 10 ng/mL) [321],which could promote endothelial sprouting and a directional growth towards the hydrogel.The fact that dexOx remains conjugated to VEGF, after the release from the hydrogel,means that there is an extended protection which can prolong significantly the life-timeof VEGF.

7.4.6. Endothelial Cells Encapsulation in Hybrid HydrogelsContaining VEGF

The hybrid construct was formed by two components: (i) a hydrogel of dexOx-VEGFcrosslinked with AAD and (ii) a fibrin hydrogel embedding the dexOx-VEGF hydrogel(Fig. 7.7A&B). The dexOx hydrogels containing VEGF (10 μL volume) were preparedinitially on a syringe plunger, after which a mixed aqueous solution of fibrinogen andthrombin (50 μL in total) was placed on top of the dexOx hydrogel (Fig. 7.7A&B).Umbilical cord blood-derived endothelial cells, previously characterised by Pedroso et al.[138], were immersed in the fibrin gel precursor solution. These cells have a typicalcobblestone morphology, express high levels of EC markers, including CD31, Von Wille-brand factor (vWF), CD34 and Flk-1/KDR over time [138]. After the curing of thefibrin gel, the hybrid constructs were placed in EGM-2 media and incubated at 37 °C.The constructs were monitored for six days by contrast microscopy and the cell viabilitywas quantified by a live-dead assay at the 6th day(Fig. 7.7C).

114


Figure 7.7.: Hybrid hydrogels visualisation in a fluorescence microscope. (A) Image ofthe whole hybrid hydrogel. DexOx hydrogel in red (TRITC) and fibrin hydrogel ingreen (Alexa 488). Scale bar 2 mm. (B) Image of the hybrid hydrogel dexOx/fibrininterface with cells stained with Hoechst (blue). Scale bar 200 μm. (C) Cellularviability assessed by live/dead assay (P<0.05).

Figure 7.8.: Contrast phase images from endothelial cells encapsulated in the fibrinsection of the hybrid hydrogels. All scale bars are 100 μm.

D5 hydrogels located within fibrin gels were completely degraded before the 6th day,while no macroscopic degradation was observed for the remaining hydrogels (D10 andD25). The survival of the ECs was high (> 80%) for all the experimental groupstested (Fig. 7.7). With the exception of gels containing D25, cell survival was higherfor constructs with VEGF than without VEGF (P<0.05). These results demonstratethe cell pro-survival effect of VEGF. In addition, images obtained by light microscopyindicate that the release of VEGF within the hybrid gel induce a cord-like organisation

115


of the endothelial cells (Fig. 7.8). This effect was observed for constructs containing D5and D10 hydrogels, but not D25 hydrogels. In addition, no visible network formationwas observed in constructs containing D5 and D10 hydrogels without VEGF, suggestingthat the formation of cord-like structures was mediated by VEGF.

Figure 7.9.: Genetic profiling of endothelial cells after six days.

The effect of VEGF in the encapsulated endothelial cells was evaluated by qRT-PCRanalysis. We analysed the expression of VEGF and Flk-1 (VEGFR2), but also the ma-trix metallo-proteinase 2 (involved in the remodeling of ECM and cell migration andwhich has been shown to be stimulated by VEGF in vitro [332]) and MCP-1, an endoge-nous cytokine with chemotactic properties towards SMCs [333] and up-regulated whenendothelial cells are exposed to certain conditions [334]. Gene expression in cells encap-sulated in constructs with VEGF was normalized by the corresponding gene expressionin cells encapsulated in fibrin hydrogels without VEGF. Interestingly, the expression ofmatrix metallo-proteinase 2 (MMP-2) was higher for gels that have the ability to releasefaster VEGF (D5 and D10). The constructs with D25-VEGF have no statistical signif-icant upregulation of MMP-2 gene at day 6, as compared to the control. In addition,constructs that release faster VEGF induced a downregulation in the expression of theVEGF gene. Constructs with D25-VEGF hydrogels, that have no significant release ofVEGF over 6 days, have cells with an upregulation of VEGF and Flk-1 gene. Under theseconditions, the cells need to secrete VEGF and to express VEGF receptor for survival.These constructs have cells that express high levels of MCP-1, a chemotactic protein,specific for SMCs, which would benefit the survival of the ECs, by the segregation ofEC-specific cytokines and growth factors [335].

116

7.5 Conclusion

7.5. Conclusion

We report a novel pro-angiogenic therapy based on a construct able to release VEGF atvariable rates and support the attachment and organisation of endothelial cells derivedfrom umbilical cord stem cells. These constructs allow tailoring the properties of thegrowth factor release system separately from the matrix encapsulating the cells. Weshow that the degree of oxidation in dexOx is very important to control the release ofVEGF. DexOx with high degree of oxidation (D25) tend to form multi-point attachmentwith VEGF retarding its delivery. By circular dichroism we demonstrate that the 3Dstructure of VEGF is substantially not affected by the chemical conjugation to dexOx.We also show that the VEGF conjugates induce an increase of intracellular Ca2+ inendothelial cells and the induction profile is dependent on the degree of oxidation ofthe VEGF conjugate. We confirmed these results also by evaluating the phosphorylationof Akt and ERK proteins. Our results also indicate that dexOx-VEGF hydrogels canrelease between 1 to 45% of the total initial protein. Yet, most of the protein is releasedas a conjugate, accompanying hydrogel dissolution. We show that when dexOx-VEGFhydrogels are incorporated in a fibrin gel containing endothelial cells, the released VEGF(mainly for the low cross-linked hydrogels) can modulate gene expression and three-dimensional cell organisation. We envision that these constructs might be beneficial forthe induction a rapid pro-angiogenic response in ischemic tissues, as well as matrixes todrive the in situ differentiation of vascular progenitor cells.

117

8. Controlling the neuronaldifferentiation of stem cells by theintracellular delivery of retinoicacid-loaded nanoparticles

8.1. Abstract

The manipulation of endogenous stem cell populations from the subventricular zone(SVZ), creates an opportunity to induce neurogenesis and influence brain regenera-tive capacities in the adult brain. Herein, we demonstrate the ability of polyelectrolytenanoparticles to induce neurogenesis exclusively after being internalized by SVZ stemcells. The nanoparticles are not cytotoxic for concentrations equal or below to 10μg/mL. The internalisation process is rapid and nanoparticles escape endosomal fate infew hours. Retinoic acid-loaded nanoparticles increase the number of neuronal nuclearprotein (NeuN)-positive neurons and functional neurons responding to depolarisationwith KCl and expressing NMDA receptor subunit type 1 (NR1). These nanoparticlesoffer an opportunity for in vivo delivery of proneurogenic factors and neurodegenerativediseases treatment.

8.2. Introduction

Several biomolecules have the capacity to differentiate stem cells progeny towards de-sired lineage-specific precursors [336, 337, 213]. However, the administration of someof these bioactive factors presents a significant challenge because of their poor watersolubility, short half-life, and potentially undesired side effects. One example is retinoic

119

Chapter 8 Retinoic Acid-Loaded Nanoparticles

acid (RA) which interacts with members of the hormone receptor super-family, includingthe RA receptor (RAR) and the retinoid X receptor (RXR), located in the cell nuclei[262]. These receptors heterodimerise and bind to a DNA sequence called retinoic acid-response element (RARE), activating gene transcription involved in cell proliferation,differentiation and apoptosis. Many factors regulate neurogenesis and several studieshave demonstrated that RA is able to induce the differentiation of progenitor cells intoneuronal cells [262, 338, 339], suggesting that this molecule is a good candidate forenhancing postinjury neurogenesis. However, RA is rapidly metabolized by cells and haslow solubility in aqueous solutions [264]. In addition, the use of this biomolecule in anin vivo setting for the differentiation of resident stem/progenitor cells remains elusive.

Nanoparticles can be an excellent platform to ensure intracellular transport and controlledrelease of RA [266, 267, 340]. Several nanoparticle formulations have been developedfor the release of this molecule [266, 267, 340]. However, until now none of the reportedformulations was designed to deliver RA within cells, and particularly for the differ-entiation of stem/progenitor cells. Nanoparticles can be internalised via endocytosis,macropinocytosis or phagocytosis, but these processes confine the compounds to closedvesicles (endosomes or phagosomes), where the pH is progressively lowered to 5.5-6.5[271, 274]. Polycations, such as polyethylenimine, that absorb protons in response tothe acidification of endosomes (i.e. cationic polymers with a pK around or slightly belowphysiological pH) can disrupt these vesicles via the “proton sponge” effect that promotesthe swelling of the endosome in situ [56, 341]. Once the polymeric nanoparticles reachthe cytosol, the bioactive molecule may be released by desorption, diffusion through thenanoparticle or nanoparticle erosion.

Herein, we present a novel strategy to differentiate the progeny of stem cells into neu-rons using nanoparticles able to intracellularly release RA. We demonstrate that theinternalisation of the RA-loaded nanoparticles has a minimal effect on cell viability andproliferation but a large impact on differentiation. Importantly, nanoparticle-conditionedmedium is unable to promote the differentiation of stem/progenitor cells indicating thatneuronal differentiation is only mediated by internalisation of the nanoparticles.


Disclaimer: From sec. 8.3.9 onward, the work respecting the biological characterisationof the developed nanoparticulate system, was performed by Tiago Santos under the

120


guidance of João Malva and Liliana Bernardino with assistance by Fabienne Agasse andLuisa Cortes.

8.3.1. Materials

All-trans retinoic acid, polyethylenimine (PEI, average Mw ~25 kDa by LS, average Mn~10 kDa by GPC, branched), zinc sulphate heptahydrate (ZnSO4), ninhydrin reagentsolution, Azure-A, fluorescein isothiocyanate (FITC) and tungstic acid were purchasedfrom Sigma-Aldrich. Dextran sulphate (DS, Mw=500 kDa) was purchased from Fluka.Dimethyl sulfoxide (DMSO) and Ethanol (EtOH) were acquired from Merck. All reagentswere used without further purification.

8.3.2. Fluorescent Labeling of PEI

PEI (10 g) was dissolved in 90 mL of borate buffer (pH 8.5) and a 10-fold molar excessof FITC, dissolved in 2 mL of DMF, was added dropwise and stirred for 1 hour. Thesolution was transferred to a dialysis membrane with 6 - 8 kDa cut-off and dialyzedagainst milliQ water. The dialysed solution was freeze-dried for 2 to 3 days, protectedfrom light.

8.3.3. Preparation of Nanoparticles

Nanoparticles with a weight ratio of DS to PEI of 1 were prepared by adding dropwise 0.6mL of RA (2% w/v, in DMSO)) into 12 mL of PEI (1% w/v, in pH 8.0 borate buffer).The formation of complexes between RA-PEI occurred immediately and was allowed toproceed for 30 min with intense magnetic stirring. Then, 12 mL of DS solution (1% w/v)was added dropwise and stirred for another 5 min. Finally, 1.2 mL of ZnSO4 aqueoussolution (1 M) was added and stirred for 30 min. Nanoparticles were centrifuged 3 timesin 5% mannitol solution at 14,000 g for 20 minutes. Supernatants from each step werecollected to determine PEI and DS amounts in nanoparticles. Resulting nanoparticleswere frozen and lyophilised for 4 days to obtain a dry powder. Lyophilised nanoparticleswere stored at 4°C. Similar protocol was adopted for the preparation of nanoparticleswith a weight ratio of PEI to DS of 5 and 0.2, by changing the concentration of thepolymers accordingly. Blank nanoparticles were prepared using the same procedure inthe absence of RA.

121


8.3.4. Characterisation of the Nanoparticles

The morphology of the nanoparticles was evaluated by transmission electron microscopy(Hitachi SU-70, with a STEM detector at 30 kV) following negative staining with tungsticacid solution (1%, w/v; pH 7.5). Initially, an aliquot of lyophilised NPs (5 mg) wasresuspended in PBS (1 mL), centrifuged for 5 minutes at 14,000 g, ressuspended inPBS, centrifuged again, and finally ressuspended in PBS (0.5 mg/mL). Five microlitersof both sample and tungstic acid solution (1%, w/v; pH 7.5) were placed on a 300mesh copper grid with a carbon-coated formvar membrane and dried overnight beforeexamination by TEM.

Particle size was determined using light scattering via Zeta PALS Zeta Potential Analyzerand ZetaPlus Particle Sizing Software, v. 2.27 (Brookhaven Instruments Corporation).Nanoparticles suspended in water and sonicated for short times (< 10 min) were used.Typically, all sizing measurements were performed at 25 °C, and all data were recordedat 90°, with an equilibration time of 5 min and individual run times of 60 s (5 runsper measurement). The average diameters described in this work are number-weightedaverage diameters. The zeta potential of nanoparticles was determined in a 1 mM KClpH 6 solution, at 25 °C. All data were recorded with at least 6 runs with a relativeresidual value (measure of data fit quality) of 0.03.

8.3.5. Determination of Weight Ratio of Cationic to AnionicPolymer in Nanoparticles

Anionic-to-cationic polymer (DS:PEI) mass ratios in nanoparticles can be determinedby subtracting the known amount of PEI and DS in the supernatant of completelycentrifuged particles from the initial amount present [244]. The amount of PEI was de-termined using ninhydrin. Twenty microliters of supernatant from a centrifuged nanopar-ticle suspension were mixed with 380 mL of an acetic acid solution (0.05% w/v). Onemilliliter of ninhydrin reagent solution was then added. The mixture was placed into aboiling water bath for 10 min and then cooled to room temperature. Three millilitersof 95 % ethanol were added and mixed. The amount of PEI was then determined spec-trophotometrically at 575 nm using a calibration curve from 10 to 30 mg/ml of PEI. Theamount of unreacted DS in the supernatant was detected spectrophotometrically at 630nm using an azure A dye binding method in which 400 mL of supernatant from a cen-trifuged nanoparticle suspension were mixed with 1.0 mL of azure A (10 mg/mL). Again

122


a calibration curve of 1.0 to 3.5 mg/mL of DS was used to determine the concentrationof unknown samples.

8.3.6. Loading Efficiency of RA in Nanoparticles

In order to determine the amount of RA in loaded nanoparticles, a given amount ofnanoparticle powder was dissolved in 1 mL of DMSO:HCl (9:1) solution and the ab-sorption for RA at 350 nm was measured. The RA concentration was obtained from acalibration curve from 0.47-0.0023 mg/mL of RA in DMSO:HCl (9:1) solution. Loadingefficiency was calculated using the following equation:

Loading Efficiency = Amount of RA in the nanoparticles

Initial amount of RA× 100

8.3.7. RA Release from Nanoparticles

Nanoparticles (2.5 mg) were placed in PBS (0.5 mL) and incubated under mild agitation,at 37 °C. At specific intervals of time, the nanoparticle suspension was centrifuged (at20,000 rpm for 20 min) and 0.4 mL of the release medium removed and replaced by a newone. The reserved supernatant was stored at 5 °C until the RA content in release sampleswas assessed by spectrophotometry at 350 nm. Concentrations of RA were determinedby comparison to a standard curve. All analyses were conducted in triplicate.

8.3.8. In vitro Degradation of Polymeric Nanoparticles

Nanoparticles with or without RA were suspended at ~10 mg/mL in 10 mM PBS (pH7.4) or 0.2 M citrate buffer pH 5 or 6 and incubated at 37 °C, under mild agitation.In one experimental set, the incubation lasted 7 days, after which, the nanoparticlesuspension was centrifuged (20,000 g for 15 min) and the pellets lyophilised for finalmass. On the second experimental set, the incubation lasted for 21 days and at dailyintervals, the nanoparticles suspension was centrifuged (20,000 g for 15 min) and 0.4mL of the release medium removed and replaced by a new one, for RA quantificationand particles size measurements. At the final day, the resulting nanoparticle suspensionswere lyophilised for 3 days to obtain a dry powder for mass determination.

123


8.3.9. SVZ Cell Cultures and Experimental Treatments.

All experiments were performed in accordance with NIH and European (86/609/EEC)guidelines for the care and use of laboratory animals. SVZ cells were prepared from1-3 day-old C57BL/6 donor mice as described by [342]. Briefly, mice were killed bydecapitation and the brains were removed and placed in calcium- and magnesium-freeHBSS solution (Gibco, Rockville, MD, USA), under sterile conditions. Fragments of SVZwere dissected out of 450 μm-thick coronal brain sections using a McIlwain tissue chopperand then SVZ was digested in 0.025% trypsin (Gibco) and 0.265 mM EDTA (Gibco) (10min, 37 °C), following mechanical dissociation with a P1000 pipette. The cell suspensionwas diluted in serum-free medium (SFM) composed of Dulbecco’s modified eagle medium[(DMEM)/F12 + GlutaMAXTM-I)] supplemented with 100 U⁄ml penicillin, 100 μg⁄mlstreptomycin, 1% B27 supplement, 10 ng⁄ml epidermal growth factor (EGF) and 10ng⁄ml basic fibroblast growth factor (FGF)-2 (all from Gibco). Single cells were thenplated on uncoated Petri dishes at a density of 3000 cells⁄cm2 and were allowed todevelop in an incubator with 5% CO2 and 95% atmospheric air at 37 °C. Six-day-oldneurospheres were adhered for 48 hours onto 24 well plate poly-D-lysine-coated glasscoverslips for all experiments except western blots, which were left adherent onto poly-D-lysine-coated 6 well plates, all in SFM devoid of growth factors. Then, the neurosphereswere allowed to develop for 2 or 7 days at 37 °C in the presence a broad range of RA-releasing NP concentrations. Cell death assays were done after 2 days of incubation.At the end of the 7 day treatment, Single Cell Calcium Imaging (SCCI) experiments,western blots and immunocytochemistry were performed. (Fig. 8.5).

To determine whether the proneurogenic effect of RA was due to its release in the cellmedium or the nanoparticles internalized, RA+-NPs were dissolved in SFM devoid ofgrow factors and incubated for 7 days at 37 °C. Thereafter, the resulting cell mediumcontaining the RA+-NPs was centrifuged (14,000 rpm, 15 min), nanoparticles werediscarded and the supernatant was recovered and used for conditioned medium (CM) onSVZ cells for 7 days, followed by NeuN immunocytochemistry.

8.3.10. Single Cell Calcium Imaging

To functionally characterise neuronal differentiation in SVZ cells, variations of intracellu-lar calcium concentration ([Ca2+]i) following stimulation with 50mM KCl and 100µM his-tamine (Sigma-Aldrich) were analysed. KCl depolarisation causes the increase of [Ca2+]i

124


in neurons, whereas stimulation with histamine increases [Ca2+]i in stem/progenitor cells[343]. SVZ cultures were loaded for 40 minutes at 37 °C with 5µM Fura-2 AM (Molecu-lar Probes), 0.1% fatty acid-free bovine serum albumin (BSA), and 0.02% pluronic acidF-127, in Krebs buffer (132 mM NaCl, 1 mM KCl, 1 mM MgCl2, 2.5 mM CaCl2, 10mM glucose, 10 mM HEPES, pH 7.4). After a 10 minutes post-loading period at roomtemperature (RT), the coverslip was mounted on RC-20 chamber in a PH3 platform(Warner Instruments) on the stage of an inverted Axiovert 200 fluorescence microscope(Carl Zeiss). Cells (approximately 100 cells per field) were continuously perfused withKrebs and stimulated by applying 100 µM histamine or high-potassium Krebs solution(containing 50 mM KCl, isosmotic substitution with NaCl) by the mean of a fast pres-surized (95% air, 5% CO2 atmosphere) system (AutoMate Scientific Inc.). [Ca2+]i wasevaluated by quantifying the ratio of the fluorescence emitted at 510 nm following alter-nate excitation (750 milliseconds) at 340 and 380 nm, using a Lambda DG4 apparatus(Sutter Instrument) and a 510 nm band-pass filter (Carl Zeiss) before fluorescence acqui-sition with a 40x objective and a CoolSNAP digital camera (Roper Scientific). Acquiredvalues were processed using the MetaFluor software (Universal Imaging Corporation).Histamine/KCl values for Fura-2 ratio were calculated to determine the extent of neu-ronal maturation in cultures. The percentage of cells displaying a neuronal-like profilewas calculated on the basis of the histamine (Hist)/KCl ratio.

8.3.11. Internalisation Studies

In order to visualise the cellular uptake of RA+-NP by SVZ cells we performed a liveimaging experiment on a confocal microscope (LSM 510 Meta, Carl Zeiss). 50 µg/mLRA+-NPs were administrated to SVZ neurosphere seeded on glass bottom petri dishs(35 mm, IBIDI, Germany) and incubated at 37 °C for 60 min. For imaging, cells werethen placed into a special stage (Heating Insert P Lab-Tek and Incubator S, Pecon) at37 °C, 5% CO2 on a confocal laser scanning microscopy (LSM 510 META, Carl Zeiss).This system maintained normal cell culture and allowed multiple regions of interest tobe imaged regularly throughout the duration of the experiment. internalisation of NPwas followed over a 4 hours period (4 frames −1), by detection of FITC bound to theNPs using a 488 nm argon laser (45 mW) for excitation and a 510-550 nm band-pass emission filter, and a 63x objective (Plan-ApoChromat, N.A. 1.4). Differentialinterference contrast (DIC) images were simultaneously acquired in order to visualisealterations on cell morphology during the experiment. Finally, Hoechst 33342 (2 μg/ml)

125


(Invitrogen) was added in order to visualise nuclei morphology. Images were acquiredusing a 405 nm Diode laser (30 mW) and a band-pass emission filter (420-450 nm).

8.3.12. Western Blots

SVZ cells, previously incubated with RA+-NPs for 7 days in differentiation conditions,were washed with 0.15 M phosphate-buffered saline (PBS) and incubated in a lysisbuffer [0.15 M NaCl , 0.05 M Tris-Base, 5 mM EGTA, 1% Triton X-100, 0.5% DOC,0.1% SDS, 10 mM DTT containing a cocktail of proteinase inhibitors (Roche)]. To-tal protein concentration from the lysates was determined by BCA assay and sampleswere treated with SDS-PAGE buffer [6x concentrated: 350 mM Tris, 10% (w/v) SDS,30% (v/v) glycerol, 0.6 M DTT, 0.06% (w/v) bromophenol blue], boiled for 5 min at95 °C, and stored at -20 °C until use for western blotting. Then, proteins (40 µg oftotal protein) were resolved in 15% SDS polyacrilamide gels and then transferred toPVDF membranes with 0.45 µm pore size in the following conditions: 300 mA, 90 minat 4 °C in a solution containing 10 mM CAPS and 20% methanol, pH 11) (protocoladapted from Pinheiro et al. (2005) [344]). Membranes were blocked in Tris-buffersaline containing 5% low-fat milk and 0.1% Tween 20 (Sigma) for one hour, at RT, andthen incubated overnight at 4 °C with the primary antibody rabbit monoclonal anti-NR1(1:100) (CHEMICON International Inc., Billerica, MA, USA) diluted in 1% TBS-Tweenand 0.5% low fat milk. After rinsing three times with TBS-T 0.5% low-fat milk, mem-branes were incubated for 1 h, at RT, with an alkaline phosphatase-linked secondaryantibody anti-rabbit IgG 1:20,000 in 1% TBS-T and 0.5% low-fat milk (GE Healthcare,Buckinghamshire, UK). For endogenous control immnunolabelling, primary antibody so-lution consisted of mouse monoclonal anti-GAPDH (1:10,000) (Millipore, MA, USA).Protein immunoreactive bands were visualised in a Versa-Doc Imaging System (Model3000, BioRad Laboratories, CA, USA), following incubation of the membrane with ECFreagent (GE Healthcare, Buckinghamshire, UK) for 5 min. Densitometric analysis wereperformed by using the ImageQuant software.

8.3.13. Immunocytochemistry

Cells were fixed with 4% paraformaldehyde (PFA). After washing three times with PBS,unspecific binding was prevented by incubating cells in a 3% BSA and 0.3% Triton X-100 solution for 30 min, at RT. Cells were kept overnight at 4 °C in a primary antibody

126


solution, then washed with PBS the following day, and incubated for 1 h, at RT, withthe corresponding secondary antibody. Antibodies were used as listed: mouse mono-clonal anti-Tuj1 (Covance, Princeton, NJ, USA) (1:100), mouse monoclonal anti-NeuN(Millipore) (1:100), rabbit polyclonal anti-GFAP (1:100) (Cell Signaling Tech., Beverly,MA, USA) prepared in 0.1% Triton X-100, 0.3% BSA solution; Alexa Fluor 594 goatanti-mouse; Alexa Fluor 488 goat anti-rabbit (both at 1:200 in PBS, from Invitrogen).For nuclear labelling, cell preparations were stained with Hoechst 33342 (2 μg/ml) (In-vitrogen) in PBS 5 min, at RT, and mounted in Dakocytomation fluorescent medium(Dakocytomation Inc., Carpinteria, CA, USA). Fluorescent images were acquired usinga confocal microscope (LSM 510 Meta, Carl Zeiss).

In order to visualise the NPs internalisation, cells were incubated overnight with theRA-releasing NPs (10 µg/mL) and then fixed in methanol-acetone 1:1 for 20 min at -20°C. After fixation, non-specific binding sites were blocked with 6% BSA (Sigma) in PBSfor 1 h. Cells were subsequently incubated with the primary antibody mouse monoclonalanti-FITC (1:100, Sigma) in PBS containing 0.3% BSA (Sigma). Thereafter, coverslipswere rinsed in PBS and incubated for 1 h, at RT, with the secondary goat anti-mouseAlexa 594 (1:200, Invitrogen). After rinsing with PBS, cell preparations were incubatedwith Hoechst 33342 (2 µg/ml, Invitrogen) in PBS for 5 min at RT. Finally, the prepa-rations were mounted using Dako Fluorescent Mounting Medium (Dakocytomation).Fluorescent images were acquired using a confocal microscope (LSM 510 Meta, CarlZeiss).

8.3.14. TUNEL Assay

SVZ cultures were fixed with 4% PFA for 30 min, at RT, rinsed in PBS and permeabilisedin 0.25% Triton X-100 (Sigma) for 30 min at RT. Thereafter, coverslips were incubatedfor 20 min in 3% H2O2 and reacted for terminal transferase (0.25 U⁄µL) biotinylateddUTP (6 µM) nick-end labelling of fragmented DNA in TdT buffer (pH 7.5) (all fromRoche, Basel, Switzerland) for 1 h 30 min at 37 °C in a humidified chamber. Theenzymatic reaction was stopped by 15 min incubation in 300 mM NaCl and 30 mMsodium citrate (both from Sigma) buffer. Following an additional rinse in PBS, cultureswere incubated for 30 min at RT with the avidin-biotin-peroxidase complex (1:100;Vector Laboratories Inc., Burlingame, CA, USA). Peroxidase activity was revealed by theDAB chromogen (0.025%; Sigma) intensified with 0.08% NiCl2 in 30 mM Tris-HCl (pH7.6) buffer containing 0.003% H2O2. The cell preparations were then dehydrated in an

127


ethanol gradient (70%, 2 min; 80%, 2 min; 90%, 2 min; 95%, 2 min; 100%, 2 min),cleared in xylene (3 min) and mounted using DEPEX mounting medium (Fluka ChemieAG, Buchs, Switzerland). Photomicrographs of TUNEL labelling were recorded using adigital camera (Axiocam HRC, Carl Zeiss) adapted to an Axioskop 2 Plus fluorescentmicroscope (Carl Zeiss).

8.3.15. Propidium Iodide Incorporation

Propidium iodide (PI; 3 µg/mL, Sigma) was added 40 min before the end of the 48h of incubation with RA+-NPs. Thereafter, cells were fixed with 4% PAF for 30 min,rinsed in PBS and stained with Hoechst 33342 (2 μg/ml; Invitrogen) in PBS, for 5 min,at RT, and mounted in Dakocytomation fluorescent medium (Dakocytomation Inc.).Photomicrographs of PI-uptake labelling were recorded using a digital camera (AxiocamHRC, Carl Zeiss) adapted to an Axioskop 2 Plus fluorescent microscope (Carl Zeiss).

8.3.16. Statistical Analysis

Data are expressed as means ± standard error of mean (SEM). Statistical significancewas determined by using Student’s t-test or one-way ANOVA followed by Dunnett’spost hoc test for comparison with control or Neuman-Keuls for multiple comparisontest, with P<0.05 considered to represent statistical significance. All measurementswere performed in the monolayer of cells surrounding the seeded SVZ neurospheres. ForSCCI experiments, the percentage of neuronal responding cells (Hist/KCl ratio<0.8)was calculated on the basis of one microscopic field per coverslip, containing about 100cells (40× magnification). Percentages of NeuN-, TUNEL-, or PI-positive cells werecalculated from cell counts in five independent microscopic fields in each coverslip witha 40× objective (approximately 200 cells per field). Because no significant differenceswere found between experiments from different SVZ cell cultures, the corresponding datawere pooled.


Nanoparticles were prepared by complex coacervation, i.e., through the electrostatic in-teraction of polyethylenimine (PEI, polycation) and dextran sulphate (DS, polyanion)

128


(Fig. 8.1A). Initially, complexes of RA with PEI were formed by the electrostatic interac-tions of the carboxyl groups of RA with the amine groups of PEI. According to previousstudies the maximum loading is obtained for a ratio of amino groups to carboxylic acidgroups of about 2:1 [266]. In this work we used a ratio between 4:1 (for the NP formu-lation DS:PEI with weight ratio of 5.0) and 17:1 (for the NP formulation DS:PEI withweight ratio of 0.2), only considering the primary amines present in PEI. The electro-static interaction between RA and PEI is confirmed by a shift in the RA peak at 350 nmto near 300 nm, as confirmed by spectrophotometry (Fig. 8.2).

Figure 8.1.: Physico-chemical properties of the nanoparticles. A) Chemical structuresof retinoic acid (RA), polyethylenimine (PEI) and dextran sulphate (DS). B) Typicalprofile obtained by DLS for the formulation RA+-NPs (0.2). Results are expressedas number-weight average diameter. C) Transmission electron microscopy (TEM)images of RA+-NPs. Scale bar: 200 nm. D) Mass loss on nanoparticles suspended inbuffered solutions at pH 5.0, 6.0 and 7.4 for 7 days, at 37 °C. Nanoparticles with orwithout RA were used in these degradation studies. Results are shown as mean ± SD,n=6. ** and *** denotes statistical significance P<0.01 and P<0.001, respectively.

These complexes formed nanoparticles with 100 to 250 nm in diameter, although theytend to dissociate relatively easy. To stabilize the nanoparticle formulation DS and zincsulfate were added in successive steps [244]. The electrostatic interaction of DS with PEIpreviously has been confirmed by Fourier Transform Infrared (FTIR) analysis in PEI/DS

129


nanoparticles [244] and this physical crosslink may contribute for the stabilization ofthe NPs. Then, DS and zinc sulphate were added in successive steps to stabilise theformulation [244]. Nanoparticles without zinc sulphate tend to aggregate and form largeparticles. Mannitol was added to the NP suspension during centrifugation steps andlyophilisation to prevent their aggregation.

8.4.1. High-Loading Capacity and Positive-Net ChargeNanoparticles

Three different weight ratios of DS relatively to PEI were selected for our initial screening:5.0 (large excess of DS), 1.0 (similar weight of both polymers), and 0.2 (large excessof PEI). In each formulation we determined particle size, zeta potential and RA loadingefficiency. A Brookhaven ZetaPALS analyser was used to evaluate NP zeta potentialand size distribution (deionized water). The number-weighting profile of all formulationstested was usually unimodal (>99%) (Fig. 8.1B). The formulation DS:PEI weight ratio of5 yielded nanoparticles with an average diameter between 40 and 120 nm, and a negativenet charge, while the formulation DS:PEI weight ratio of 1 yielded large aggregates ofnanoparticles (diameter > 500 nm), with a positive net charge (Tab. 8.1). This isin line with other results previously reported, indicating that an excess of one of theNP components is needed to act as a colloidal protective agent and preventing thecoalescence of the NPs [244]. Nanoparticles prepared from the formulation DS:PEIweight ratio of 0.2 had an average diameter between 80 and 90 nm; however, presentinga significantly higher RA loading efficiency (48 versus 2%) and positive net charge (15versus 2 mV) than the other formulations tested. The high loading efficiency is explainedby the high content of PEI able to interact with RA. Based on the loading capacity andnet charge results, nanoparticles obtained from the formulation 0.2 were selected forsubsequent experiments. The morphology of these nanoparticles was then characterisedby transmission electron microscopy (TEM). TEM micrographs (Fig. 8.1C) show a similarrange of sizes as observed by DLS.

The dissolution profile of nanoparticles is affected by pH. The dissolution of the nanopar-ticles (~10 mg/mL) was evaluated at pH 7.4, 6.0 and 5.0, under agitation, at 37 °C.This pH range is typically found at the cytoplasm and intracellular organelles [274].After 7 days, the suspensions were centrifuged, lyophilised and finally weighed. Interest-ingly, the disassembly of RA-containing nanoparticles (RA+-NPs) was lower than blanknanoparticles (RA−-NPs) (Fig. 8.1D).

130


Table 8.1.: Physico-chemical characteristics of DS/PEI nanoparticles either with orwithout RA.

Form

ulation

Ratio

a

w/w

Charge

ratio

b

ηc%

ζdmV

Emulsio

nenm

RVf

NPg

nmRV

fLE

h%

RApaylo

adi

µg/m

gDS

/PEI

57.1

1-34.7±

3.0

43.4

0.074

740.311

--

DS/P

EI+RA

57.4

6.2

-42.6±

8.1

115

0.283

670.557

2.2±

1.2

18.6

±9.2

DS/P

EI1

1.4

n.a.

n.a.

541j

0.510i

n.a.

n.a.

--

DS/P

EI+RA

11.5

7.3

+1.9±

0.5

711j

0.228i

n.a.

n.a.

0.4±

0.2

2.5±

1.5

DS/P

EI0.2

0.3

22.5

+14.9

±2.8

910.044

610.078

--

DS/P

EI+RA

0.2

0.4

34.12

+15.6

±1.4

800.074

224

0.503

48.3

±15.9

86.1

±28.4

a–Th

ereal

ratio

fort

he0.2and0.2R

Aform

ulations

wase

stim

ated

tobe

0.585and0.599,

respectiv

ely.

b–Ch

arge

ratio

.(-/+).

c–Yield

(with

outm

annitol)

d-Z

etapo

tential

e–Pe

akdiam

eter

aftert

heem

ulsio

nf-R

elativ

evaria

nce

g–Na

noparticle

ssize

afterfreeze-dryin

gandresuspendedin

aqueou

sbuff

erh–Lo

adingeffi

ciency

i–Am

ount

ofRA

perm

asso

fnanop

artic

le(w

ithou

tmannitol)

j-F

ormationof

aggregates;v

alues

afterr

emovingtheform

edagglom

erates.

This might reflect differences in the cross-linking of both preparations. RA might act asa cross-linker agent, where the carboxyl group interacts electrostatically with the amine

131


groups of PEI, and the aromatic group interacts hydrophobically with the aromatic groupof another RA molecule. RA+-NPs showed a mass loss of 15.4 ± 5.9%, 42 ± 3.8% and54.5 ± 6.3%, at pHs 7.4, 5.0 and 6.0, respectively, over 7 days (Fig. 8.1D). Our resultsindicate that acidic pH enhanced the degradation of the nanoparticles likely due to theprotonation of PEI amine groups (in excess relatively to the sulphate groups in DS) andthe concomitant repulsion between positive charges [345].

Figure 8.2.: Diameter and release profile of RA+-NPs. Diameter variation (A) andrelease profile (B) of RA+-NPs suspended in buffered solutions at pH 5.0, 6.0 and 7.4over 21 days, at 37 °C.

The release of RA from nanoparticles is dependent on the external pH. Polyelectrolytecomplexes change their three-dimensional conformation according to the pH, affectingthe release of RA. To evaluate this effect, nanoparticles were incubated at pH 7.4, 6.0or pH 5.0, at 37 °C, under agitation. At determined times the nanoparticle suspensionswere centrifuged and the supernatant evaluated by spectrophotometry at 350 nm. Thenanoparticles diameter was also evaluated at each time point (Fig. 8.2A). At pH 7.4, theinitial diameter (~100 nm) is roughly maintained over 15 days, decreasing afterwards toapproximately 60 nm. At pH 6.0 and 5.0, higher aggregation was observed for all thetime points; however the population with diameters between 100 and 1000 nm (number-weighting average) accounted for most (> 95%) of the nanoparticles in suspension(Fig. 8.2A).

Taking into account that RA solubility is approximately 63 ng per mL at physiological

132


pH [264], most of RA released at pH 7.4 is complexed with PEI (Fig. 8.2B). Indeed, thecomplexation of RA to PEI is confirmed by a shift in the RA peak at 350 nm, whichis not affected by the subsequent addition of DS (Fig. 8.3). Interestingly, the release of

Figure 8.3.: UV spectral scan of RA, RA conjugated to PEI, RA conjugated to PEI andafter addition of DS, and RA conjugated to PEI and after addition of DS and zincsulphate, according to the methodology described in the Materials and Methods sec-tion, the suspension centrifuged and the pellet resuspended in PBS and characterisedby spectrophotometry. RA was dissolved in DMSO and diluted in PBS.

RA at pH 5.0 or 6.0 is much lower than pH 7.4, over the same period of time. Thiscan be due to the crystallisation of the RA and the aggregation of the nanoparticles atacidic pHs which decreases RA diffusion from the nanoparticles [268, 346]. We cannoteliminate the possibility that RA is released by the nanoparticles at higher percentagesthan the values assessed, and the low values observed by us is because RA precipitatesat acidic pHs circumventing its real quantification.

8.4.2. Nanoparticles Internalisation in SVZ Cells

RA+-NPs could potentially be used to induce neurogenesis and influence the brain re-generative capacities. In adult mammalian brain, neurogenesis persists in restrictedneurogenic niches. These resources play a central role in the generation and integrationof new neurons into pre-existing neural circuitry and are crucial for the maintenance ofbrain integrity and plasticity [347, 348, 349]. The SVZ is the main neurogenic niche ofthe adult rodent brain [347, 348, 349] and contains a population of neural stem cells thatcan give rise to neurons, astrocytes, and oligodendrocytes. Therefore, SVZ cells have ahuge potential for stem cell-based brain repair strategies. Previous studies have shown

133


that nanoparticles (typically below 100 nm) formed by PEI (polycation) complexed withDNA (polyanion) can be internalised by adult mammalian brain cells [350, 351, 352].However, in spite of the importance of SVZ neural stem cells for brain physiology andrepair, there is no consistent information concerning nanoparticle uptake and intracellulardrug release in SVZ cells.

To evaluate the kinetics of nanoparticle uptake by SVZ cells, they were exposed tofluorescein isothiocyanate (FITC)-conjugated nanoparticles and their uptake assessed byconfocal live cell imaging and immunocytochemistry. One hour after cell treatment,nanoparticles accumulate rapidly in cell cytoplasm (data not shown). This accumulation

Figure 8.4.: Cellular nanoparticle uptake. A) Confocal live imaging of SVZ cells afterexposure for 5 h to FITC-labeled RA+-NPs (50 µg/mL). Hoechst-33342 staining (blue)was used to visualise cell nuclei. Crop images show both transmission and FITC chan-nel or FITC channel alone. B) Confocal microscopy photomicrographs of untreatedor FITC-labeled RA+-NPs-treated (10 μg/mL) SVZ cells for 18 h, imunostained withanti-FITC antibody and Hoechst-33342. Scale bars are 10 μm.

becomes even more expressive at 5 h (Fig. 8.4A). This is in line with other studies,showing that PEI-based nanoparticles can escape rapidly endosomal fate due to theirbuffering capacity leading to osmotic swelling and rupture of endosomes [341]. At 18 hafter cell treatment, the FITC-conjugated nanoparticles are distributed overall the cellcytoplasm (Fig. 8.4B).

134


To determine the cytotoxicity of these nanoparticles, SVZ neurospheres were exposedto RA+-NPs or RA−-NPs for 2 days and cell death, presumably involving apoptosis ornecrosis, was then evaluated by terminal deoxynucleotidyl transferase-mediated dUTPnick end labeling (TUNEL) and propidium iodide (PI) staining, respectively (Fig. 8.5).No significant effect on cell apoptosis was observed for all the experimental groups testedwith nanoparticle concentrations up to 100 μg/mL (Fig. 8.6A).

Figure 8.5.: Scheme of the experimental protocols used for studying the effects of RA+-NPs on SVZ cell cultures. Dashed line: exposure with RA+-NPs.

In contrast, cell necrosis increases significantly for nanoparticle concentrations of 100μg/mL (~4-fold) (77.3 ± 9.1%; n=4 coverslips; 2938 cells counted; P<0.0001), rel-atively to the control (17.8 ± 1.3%; n=9 coverslips; 8618 cells counted) (Fig. 8.6B).The toxic effects of 100 μg/mL RA+-NPs was not due to RA since the void formulationRA−-NPs was equally toxic at the same concentration (Fig. 8.6B). Based on these results,RA+-NPs are not cytotoxic for concentrations equal or below to 10 μg/mL. Moreover,at these concentrations, the internalisation of the nanoparticles did not affect signifi-cantly the morphology of the cells. Untreated cells or cells treated with RA+-NPs (1μg/mL) for 7 days were characterised by immunocytochemistry against neuron-specificclass III beta-tubulin (Tuj1) and glial fibrillary acidic protein (GFAP). RA+-NPs-treatedcells present a healthy morphology undistinguishable from untreated cells (Fig. 8.6C).

To investigate the effect of RA+-NPs on cell proliferation, SVZ neurospheres were ex-posed to a wide range of nanoparticle concentrations (0.001 to 10 µg/mL) for 2 daysand then exposed to bromodeoxyuridine (BrdU) in the last 4 h of the treatment. BrdU isa synthetic nucleoside that can be incorporated into newly synthesised DNA substitutingfor thymidine during cell replication. SVZ cells either when grown under proliferative (inserum free medium with growth factors as free floating neurospheres) or differentiation(after adherence on poly-D-lysine and in absence of growth factors) conditions exposed

135


Figure 8.6.: Cell viability after RA+/−-NPs uptake. A) Percentage of TUNEL-positivecells in control cultures and in cultures exposed to RA+-NPs for 2 days. Data areexpressed as mean ± SEM (n=4-8 coverslips). B) Percentage of PI-positive cells incontrol cultures and in cultures exposed to RA+-NPs or RA−-NPs for 2 days. Data areexpressed as mean ± SEM (n=4-9 coverslips). ***P<0.001 using Dunnet’s MultipleComparison Test. C) Representative confocal microscopy photomicrographs showinga typical morphology of Tuj1-positive neurons (red), GFAP-positive glia (green) andHoechst-33342 staining (blue nuclei) in SVZ cells maintained for 7 days in the absence(control) or in the presence of RA+-NPs (1 μg/mL). Scale bars are 10 μm.

to RA+-NPs had similar proliferation rates as control cells not exposed to nanoparticles(Fig. 8.7).

Figure 8.7.: Proliferation of SVZ cells cultured in (A) differentiation (after adherenceon poly-D-lysine and in absence of growth factors) or (B) proliferative (in serum freemedium with growth factors as free floating neurospheres) conditions.

136


8.4.3. RA+NPs Promote Neuro-Differentiation

SVZ cell cultures are mixed cultures of immature cells, neurons, astrocytes, oligodendro-cytes, neuronal and glial progenitors in different stages of differentiation [353, 354, 355].In untreated SVZ cultures we detected about 5 to 15% of new neurons (detected bySCCI and NeuN immunocytochemistry; Fig. 8.8), which is in accordance with the per-centage of neurons obtained from standard methods of isolating neural stem cells invitro [355, 343]. To evaluate the effect of RA+-NPs on neuronal differentiation of SVZcells, the cells were cultured in differentiation conditions for 7 days in media containingthe nanoparticles and then immunolabeled for NeuN, a neuronal-specific nuclear pro-tein present on mature neurons [356, 357, 358] (Fig. 8.5). In the presence of RA+-NPsat concentrations of 0.1 μg/mL (19.6 ± 2.3%; n=5 coverslips; 3460 cells counted;P<0.001) and 1 μg/mL (19.2 ± 2.2%; n=7 coverslips; 4954 cells counted; P<0.001),a significant increase in the percentage of NeuN-positive cells was observed relatively tothe untreated cells (11.8 ± 0.6%; n=13 coverslips; 7306 cells counted) (Fig. 8.8A). Theproneurogenic effect mediated by RA+-NPs was absent in cell cultures treated with voidnanoparticles (RA−-NPs), suggesting that this effect was due to the RA and not dueto the nanoparticle formulation per se (Fig. 8.8B). Importantly, the neuronal differentia-tion effect was absent for high concentrations (> 1 μg/mL) of nanoparticles indicatingthat an optimal concentration window of RA exists to drive the neuronal commitmentof SVZ cells. Most in vitro studies, using embryonic stem cells and neural stem cellcultures isolated from the SVZ and hippocampus, suggest that RA exposure stimulatesneurogenesis and neuronal maturation [339, 359, 360, 361, 362, 363]. However, therange of RA concentrations used in these studies ranged from 0.1 to 1 µM. These con-centrations are 100 to 1000 fold higher than the payload of RA from nanoparticles thatinduces neurogenesis in our studies. Considering the RA payload per mg of NPs, wefound that concentrations of RA payload below 4 nM RA (corresponding to 0.1 µg/mLnanoparticles) and above 40 nM RA (corresponding to 1 µg/mL nanoparticles) did notpromote neuronal differentiation (Fig. 8.8C). This is consistent with the effect of RA inanimal studies [364, 365]. The acute administration of RA (0.15 mg/kg) helped to re-verse an age-related deficit in long-term potentiation amplitude and improved the abilityof the mice to perform relational learning tasks [364]. In contrast, the long-term sys-temic administration (1 mg/kg, for 42 days) of RA in mice leaded to a decrease in bothproliferation and neuronal production in the hippocampus, which were accompanied bya significant reduction in the ability to perform a learning task [365]. In this case, one

137


of the RA effects was to suppress SVZ neurogenesis [365].

Figure 8.8.: RA+-NPs have a proneurogenic effect. A) Representative fluorescencephotomicrographs of NeuN immunostaining (red) in control cultures and cultures ex-posed to RA+-NPs (0.1 µg/mL) for 7 days. Hoechst 33342 was used for nuclearstaining (blue). B) Percentage of NeuN-immunostained neurons in SVZ cultures af-ter being exposed for 7 days to RA+-NPs, RA−-NPs, or conditioned medium (CM)obtained from the resultant supernatant of the centrifugation of nanoparticles sus-pensions previously left in culture for 7 days. Data are expressed as mean ± SEM(n=5-15 coverslips). ***P<0.001 using unpaired Student’s t-test for comparison withSVZ control cultures. C) Percentage of NeuN-immunostained neurons in SVZ cul-tures after being exposed for 7 days to RA+-NPs or free-RA (solubilised in DMSOand added to the culture medium at different concentrations). Data are expressed asmean ± SEM (n=5-15 coverslips).

Because the differentiation process could be either due to RA release in the mediumor within the cell, nanoparticles were left in SFM cell medium devoid of growth factorsfor 7 days, at 37 °C, then centrifuged and the resultant supernatant was collected, andused to treat SVZ neurospheres (7 days treatment protocol). Interestingly, no significant

138


proneurogenic effect was observed when the nanoparticle conditioned medium (CM) wasadded to SVZ cells (Fig. 8.8B). This shows that the differentiation of SVZ cells was onlymediated by the internalisation of the RA+-NPs and concomitant intracellular releaseof RA. We speculate that the spatial gradient of RA within the cell is likely the causeof this biological response; however future studies are needed to address completely thisissue.

We also found that free RA solubilised in medium applying the same treatment protocolas for the NP, has only achieved a proneurogenic effect with a concentration of 10 µM(1000 fold higher concentration than RA released from nanoparticles) (148.6±22.9% per-centage relative to control; n=6 coverslips from 3 independent cell cultures) (Fig. 8.8C).As for RA+-NPs, the neuronal differentiation effect was absent for higher concentrationsof free RA (50 µM) (81.3 ± 17.8% percentage relative to control; n=6 coverslips from3 independent cell cultures). Therefore, RA signaling really depends on an optimal con-centration window to drive the neuronal commitment. Importantly, results also stressthat neuronal differentiation induced by RA+-NPs requires lower RA concentrations ascompared with free RA. Therefore, our formulation is advantageous as comparing to thedirect incubation with RA.

To assess functional neuronal differentiation, we measured intracellular calcium ([Ca2+]i)variations in single SVZ cells, following KCl depolarization and histamine stimulation[343] (Fig. 8.5). KCl depolarization leads to the massive entry of Ca2+ through voltage-dependent calcium channels in differentiated neurons and is used as a functional markerof neuronal differentiation [366]. Histamine stimulation increases [Ca2+]i in SVZ im-mature cells but not in neurons or in glial cells [343]. Therefore, mature neurons havelow Hist/KCl ratios (below 0.8) [343]. To evaluate [Ca2+]i variations, SVZ cells wereloaded with the Fura-2AM calcium probe, perfused continuously for 15 min with Krebssolution, and subsequently stimulated for 2 min with 50 mM KCl followed by 2 minstimulation with 100 mM histamine (Fig. 8.9A). In control cultures, most of the cellsshowed a predominant immature-like profile, characterised by an increase in [Ca2+]i inresponse to histamine but a negligible response to KCl depolarisation. In contrast, SVZcells treated with RA+-NPs at concentration of 0.1 µg/mL displayed an increase in the[Ca2+]i in response to KCl but not to histamine stimulation, indicating their neuronal-likestate (Ctrl: 4.8 ± 1.9%, 9 coverslips, 838 cells; 0.1 µg/mL: 28.2 ± 5.2%, 8 coverslips,1117 cells; P<0.001) (Fig. 8.9A). Moreover, these cells were characterised for the ex-pression of NMDA subunit type 1 (NR1) by western blot analysis. Functional NMDAreceptors form the molecular basis of synaptic plasticity and depend on the presence of

139


Figure 8.9.: RA+-NPs induce differentiation of SVZ cells into functionally neurons.A) Representative SCCI response profiles of 20 cells in a control culture and in aculture treated with RA+-NPs (0.1 µg/mL). Graph shows percentages of neuronal-likeresponding cells (Hist/KCl below 0.8) in SVZ control cultures and in cultures exposedto RA+-NPs (0.01 or 0.1 µg/mL) for 7 days. Data are expressed as mean ± SEM(n=6-9 coverslips). ***P<0.001 using Dunnet’s Multiple Comparison Test. B) Graphdepicts the percentages relative to control of NR1 protein expression normalized toGAPDH in cultures exposed to RA+-NPs (0.1 µg/mL) for 7 days. Below the graph, arepresentative western blot for 120 kDa NR1 and 37 kDa GAPDH expression is shown.The data is expressed as percentage of control ± SEM (n=5). *P<0.05 using pairedStudent’s t-test for comparison with SVZ control cultures. Scale bars are 10 μm.

the channel-forming NR1 subunit [367]. In line with the previous results, SVZ culturesthat presented a neuronal-like profile (treated with 0.1 µg/mL of RA+-NPs) also showa higher expression of NR1 (~150% comparing with control cultures) (Fig. 8.9B).

8.5. Conclusion

We report a novel method to modulate the differentiation of SVZ cells into neuronsinvolving the use of RA+-NPs. We show that our NP formulation is very effective inloading RA (86 ± 28 μg of RA per mg of NP), a small molecule with low aqueoussolubility, and to release RA at concentrations higher than its solubility limit (> 63

140

8.5 Conclusion

ng/mL, at physiological pH 7) due to its complexation with PEI. We further showthat the RA+-NPs have approximately 200 nm in diameter, positive net charge, anddisassemble preferentially at acidic pHs. These RA+-NPs can be taken up rapidly bySVZ cells (first 5 h) under the tested conditions and localise in the overall cell cytoplasmafter 18 h. The NPs are not cytotoxic and do not interfere with cell morphology andproliferation for concentrations below 100 μg/mL. Importantly, our results show thatthe intracellular internalisation of RA+-NPs contribute for neurogenesis and thereforehighlighting the importance of drug spatial positioning and concentration in terms ofstem cell differentiation. We anticipate that these nanoparticles might be delivered intothe brain via the nasal cavity, as recently demonstrated for the delivery of cells [368].Thus, nanoparticle-mediated delivery of neurogenic-inductive factors (proteins, DNA,siRNA, mRNA) [369] might provide a new opportunity for the treatment of variousneurodegenerative disorders.

141

Part III.

Final Remarks

9. General Conclusions

Though oxidised dextran has been tested in many research studies, entered clinical tri-als and is even being comercially used in biomedical applications1, the oxidation degreecharacterisation and the arising structural consequences have not been a priority in manystudies. The assumption that all the aldehydes are fully reactive is common throughoutthe literature. However, our bidimensional NMR data suggests that only one aldehydeper residue is responding to N-nucleophiles, under certain pH conditions. Based on pro-posed oxidised residues structures, available on the literature, our interpretation suggeststhat the two main peak populations, observed on the bidimensional spectra, arise fromcarbazones on C3, likely, from single oxidised residues. All the other populations mightbe disguised under these peaks or they may be arrested as hemiacetals, under the studiedpH conditions. Anyhow, it seems that the totality of the aldehydes are not reacting,which could impair the correct determination of the OD. However, at more alkaline pH’s,where the carbazone/hydrazone bonds are more labile, all sorts of aldehyde populationsseem to be reactive.

This issue could pose some problems on the prediction of the dexOx behaviour. Thedextran periodate oxidation is a harsh reaction which promotes chain degradation butconfers high chemical reactivity to a natively neutral molecule, deeply altering its physico-chemical properties. We have shown how the water solubility is compromised and how theOD interferes with the resulting viscosity, especially at high concentrations. The solutionsviscosity could impair injectability and miscibility of certain formulations, affecting apossible clinical application, due to issues on manipulation.

The characterised hydrogels have a dual cross-linking control method, relying on thedextran OD and the amount of AAD used. The OD allows a given percentage of residuesto serve as reactive points to cross-linkers such as AAD. The amount of AAD used iscrucial in defining the gelation period, mechanical properties and dissolution profile ofthe hydrogels. It should be within the same range of the amount of oxidised residues1www.royerbiomedical.com

145

Chapter 9 General Conclusions

present in dextran, to avoid forming dangling ends and not valid mechanical cross-links.The inclusion of a bioactive factor within such matrix is usually complete and can be fedeither on the dexOx solution or the AAD solution, allowing the modulation of the burstrelease profile.

Oxidised dextran, by itself, is an excellent carrier of aminated entities, from smallmolecules to proteins, extending the small drugs bioavailability and confering proteins in-creased environmental stability. The conjugation of dexOx to vascular endothelial growthfactor yielded a strong conjugate where the OD had a major influence in capturing VEGFas observed by SDS-PAGE. The entanglement of VEGF by dexOx preserves its quater-nary structure, impairing it, however, to react in full extension with specific antibodies orcellular receptors, likely due to a steric constraint. The conjugation to dexOx reduces theVEGF consumption, but it seems to prolong its activity as observed on the profile of theCa2+ uptake assay. The reversibility of this conjugate may be modulated by controllingthe OD, and the reduction of the conjugate, by cyanoborohydride, further inhibits thebioactivity of VEGF.

Within the hydrogel context, formulating VEGF with dexOx, allows the conjugate tomature, before the hydrogel preparation, which will reflect strongly in the release profile,when compared to VEGF formulated together with AAD. The amounts released withinthe first 24 hours range from less than 1% to around 45% of the total initial protein,for VEGF formulated with dexOx and AAD, respectively. Most of the VEGF is releasedconjugated to dexOx, taking in account the low amount identified by ELISA. Still thishydrogel formulation allows for the smooth control of the burst release profile.

DexOx has been described before to have some cytotoxicity, not so evident when it iscross-linked. Indeed, endothelial corneal cells showed an interesting acceptance uponbeing seeded on top of these hydrogels, adhering and proliferating well, likely due to thearrest of medium proteins. This is a good indication for the use of the hydrogel as acoating for some biomedical devices. Some work was performed on a wound dressingcontext, using VEGF-loaded dexOx hydrogels. The initial indications were that suchapplication could benefit wound closure rate, however, such study was not concluded.

Instead, we proposed a new approach, composed of a dexOx and fibrin hybrid hydrogel.The controlled and sustained release of VEGF, from the fibrin-entrapped dexOx hydrogel,was successful in promoting endothelial cells organisation, that were encapsulated on thefibrin hydrogels. This hybrid system allows the manipulation of cells and growth factors inseparate environments, though maintaining the communication and consequent interplay

146

General Conclusions

through close contact of both systems. We envision that these constructs might bebeneficial for the induction of a rapid pro-angiogenic response in ischemic tissues, aswell as matrixes to drive the in situ differentiation of vascular progenitor cells.

The last section of this thesis exploited the use of nanoparticles as intracellular drugcarriers for a small hydrophobic drug. We show that our NP formulation is very effectivein loading retinoic acid, a small molecule with low aqueous solubility, and to release RA atconcentrations higher than its solubility limit due to its complexation with PEI. The RA-loaded NP have approximately 200 nm in diameter, positive net charge, and disassemblepreferentially at acidic pHs. These RA+-NPs can be taken up rapidly by SVZ cells,localise in the overall cell cytoplasm, not showing cytotoxicity and not interfering with thecells morphology and proliferation for concentrations below 100 μg/mL. Importantly, ourresults show that the intracellular internalisation of RA+-NPs contribute for neurogenesisbetter than pre-released RA.

The same formulation has been described as a VEGF carrier [203], though with differentpolyelectrolyte mass ratios. The use of nanoparticles allows to reach other cellular fron-tiers. Some unacomplished projects, involved the integration of such nanoparticles withthe dexOx hydrogels (Fig. 1.4), which could improve the performance of the developedformulation and open new research opportunities.

Future Work

The studied hydrogel formulation has tremendous potential as a drug carrier in severalbiomedical settings. However, the delivery of proteins has to be carefully weighted, astheir bioactivity could be seriously impaired. We believe that some other strategies thatwere not fully explored, might yield interesting outcomes. DexOx would be an interestingplatform for a nanoparticle cross-linked matrix.

Several questions related with the VEGF actuation arose, throughout the study. Does thedexOx binded VEGF promotes similar VEGF-R2 phosphorylation patterns as describedfor other systems? We were not able to answer completely how the actuation of VEGFis performed in the presence of dexOx.

The developed hybrid system is still immature, but has great potential. It could be usedwith great advantage in in vitro settings, for the promotion of stem cells differentiation,through the controlled presentation of specific factors. It could also be studied theapplication in vivo for the delivery of therapeutic molecules and cells at the same time.

147

Chapter 9 General Conclusions

Further studies are required to assess the real efficacy of such system in vivo. Woundhealing could be a potential unmet medical need suitable for such VEGF delivery system.This system could also be useful in guiding differentiation of endothelial precursor cellsinto mature endothelial cells and have direct application in cardiovascular and otherpro-angiogenic therapies.

Regarding the RA nanoparticulate delivery system, it would be interesting to assessits potential, after delivery through the nasal cavity, in addressing neurodegenerativedisorders.

148

Bibliography

[1] Bixler GH, Hines GE, McGhee RM, Shurter RA. Dextran. Industrial and Engi-neering Chemistry. 1953;45(4):692–705.

[2] Mehvar R. Dextrans for targeted and sustained delivery of therapeutic and imagingagents. Journal of Controlled Release. 2000;69(1):1–25.

[3] Sidebotham RL. Dextrans. Advances in Carbohydrate Chemistry and Biochemistry.1974;30:371–444.

[4] Heinze T, Liebert T, Heublein B, Hornig S. Functional polymers based on dextran.Advances in Polymer Science. 2006;205:199–291.

[5] Pasut G, Veronese FM. Polymer-drug conjugation, recent achievements and gen-eral strategies. Progress in Polymer Science. 2007;32(8-9):933–961.

[6] Tomme SRV, Hennink WE. Biodegradable dextran hydrogels for protein deliveryapplications. Expert Review of Medical Devices. 2007;4(2):147–164.

[7] Sokolsky-Papkov M, Domb AJ, Golenser J. Impact of aldehyde content on ampho-tericin B-dextran imine conjugate toxicity. Biomacromolecules. 2006;7(5):1529–1535.

[8] Joensuu TK, Nilsson S, Holmberg AR, Márquez M, Tenhunen M, Saarto T, et al.Phase I trial on sms-D70 somatostatin analogue in advanced prostate and renalcell cancer. Annals Of The New York Academy Of Sciences. 2004;1028:361–374.

[9] Malaprade L. Action des polyalcools sur l’acide periodique: Application analytique.Bulletin de la Société Chimique de France. 1928;43(4):683.

[10] Jeanes A, Wilham CA. Periodate Oxidation of Dextran. Journal of the AmericanChemical Society. 1950;72(6):2655–2657.

[11] Sloan J, Alexander B, Lohmar R, Wolff I, Rist C. Determination of dextran struc-ture by periodate oxidation techniques. Journal of the American Chemical Society.1954;76(17):4429–4434.

149

Bibliography

[12] Rankin J, Jeanes A. Evaluation of the periodate oxidation method for structuralanalysis of dextrans. Journal of the American Chemical Society. 1954;76(17):4435–4441.

[13] Dimler R, Wolff I, Sloan J, Rist C. Interpretation of periodate oxidation data ondegraded dextran. Journal of the American Chemical Society. 1955;77(24):6568–6573.

[14] Maia J, Ferreira LS, Carvalho R, Ramos M, Gil MH. Synthesis and charac-terization of new injectable and degradable dextran-based hydrogels. Polymer.2005;46(23):9604–9614.

[15] Tiziani S, Sussich F, Cesaro A. The kinetics of periodate oxidation of carbohydrates2. Polymeric substrates. Carbohydrate Research. 2003;338(10):1083–1095.

[16] Ishak MF, Painter T. Kinetic evidence for hemiacetal formation during oxidationof dextran in aqueous periodate. Carbohydrate Research. 1978;64:189–197.

[17] Drobchenko S, IsaevaIvanova L, Kleiner A, Lomakin A, Kolker A, Noskin V. An in-vestigation of the structure of periodate-oxidised dextran. Carbohydrate Research.1993;241:189–199.

[18] Drobchenko S, IsaevaIvanova L, Kleiner A, Eneyskaya E. Aldo-enol transition inperiodate-oxidized dextrans. Carbohydrate Research. 1996;280(1):171–176.

[19] Yu R, Bishop C. Novel oxidations of methyl glycopyranosides by periodic acid indimethyl sulfoxide. Canadian Journal of Chemistry. 1967;45(19):2195–2203.

[20] Bondarev G, Drobchenko S, Isaeva-Ivanova L. 1H NMR spectra of tautomericstructures of dialdehydedextran. Polymer Science. 1994;36(7):915–918.

[21] Neishlos AL, Novikova EV, Passet BV, Moskvin AV. IR and NMR Study ofthe Structure of Dextran Polyaldehyde. Russian Journal of Applied Chemistry.2004;77(1):128–130.

[22] Bouhadir K, Hausman D, Mooney DJ. Synthesis of cross-linked poly (aldehydeguluronate) hydrogels. Polymer. 1999;40:3575–3584.

[23] Sumner J, Graham V. Dinitrosalicylic acid: A reagent for the estimation of sugarin normal and diabetic urine. Journal of Biological Chemistry. 1921;47(1):5–9.

[24] Lenders JP, Crichton RR. Thermal stabilization of amylolytic enzymes by co-valent coupling to soluble polysaccharides. Biotechnology and Bioengineering.1984;26(11):1343–1351.

150

Bibliography

[25] Zhao H, Heindel ND. Determination of degree of substitution of formyl groups inpolyaldehyde dextran by the hydroxylamine hydrochloride method. PharmaceuticalResearch. 1991;8(3):400–402.

[26] Schiff H. Eine neue Reihe organischer Diamine;. Annalen der Chemie und Phar-macie. 1866;140(1):92–137.

[27] Matsunaga K, Hara K, Imamura T, Fujioka T, Takata J, Karube Y. Technetiumlabeling of dextran incorporating cysteamine as a ligand. Nuclear Medicine andBiology. 2005;32(3):279–285.

[28] Heindel ND, Zhao HR, Leiby J, VanDongen JM, Lacey CJ, Lima DA, et al. Hy-drazide pharmaceuticals as conjugates to polyaldehyde dextran: syntheses, char-acterization, and stability. Bioconjugate Chemistry. 1990;1(1):77–82.

[29] Suvorova O, Iozep A, Passet B. Reactivity of polysaccharide aldehydes towardN-nucleophiles. Russian Journal of Applied Chemistry. 2001;74(6):1016–1020.

[30] Schacht E, Nobels M, Vansteenkiste S, Demeester D, Franssen O, Lemahieu A.Some aspects of the crosslinking of gelatin by dextran dialdehydes. Polymer Gelsand Networks. 1993;1(4):213–224.

[31] Bonneaux F, Dellacherie E. Fixation of various aldehydic dextrans onto hu-man hemoglobin - study of conjugate stability. Journal of Protein Chemistry.1995;14(1):1–5.

[32] Borch RF, la Mark D Bernstein, Durst HD. The Cyanohydridoborate Anionas a Selective Reducing Agent. Journal of the American Chemical Society.1971;93(12):2897–2904.

[33] Germain P, Slagmolen T, Crichton RR. Relation between stabilization and rigid-ification of the three-dimensional structure of an enzyme. Biotechnology andBioengineering. 1988;33(5):563–569.

[34] Cabacungan JC, Ahmed AI, Feeney RE. Amine boranes as alternative re-ducing agents for reductive alkylation of proteins. Analytical Biochemistry.1982;124(2):272–278.

[35] Maia J, Ribeiro MP, Ventura C, Carvalho RA, Correia IJ, Gil MH. Ocular injectableformulation assessment for oxidized dextran-based hydrogels. Acta Biomaterialia.2009;5(6):1948–1955.

151

Bibliography

[36] Ahmad S, Tester RF, Corbett A, Karkalas J. Dextran and 5-aminosalicylic acid(5-ASA) conjugates: synthesis, characterisation and enzymic hydrolysis. Carbo-hydrate Research. 2006;341(16):2694–2701.

[37] Draye JP, Delaey B, de Voorde AV, Bulcke AVD, Reu BD, Schacht E. In vitro andin vivo biocompatibility of dextran dialdehyde cross-linked gelatin hydrogel films.Biomaterials. 1998;19(18):1677–1687.

[38] Ito T, Yeo Y, Highley CB, Bellas E, Kohane DS. Dextran-based in situcross-linked injectable hydrogels to prevent peritoneal adhesions. Biomaterials.2007;28(23):3418–3426.

[39] Bhatia S, Arthur S, Chenault H, Kodokian G. Interactions of polysaccharide-based tissue adhesives with clinically relevant fibroblast and macrophage cell lines.Biotechnology Letters. 2007;29:1645–1649.

[40] Harris J, Martin N, Modi M. Pegylation: A Novel Process for Modifying Pharma-cokinetics. Clinical Pharmocokinetics. 2001;40(7):539–551.

[41] Levi-Schaffer F, Bernstein A, Meshorer A, Arnon R. Reduced toxicity of daunoru-bicin by conjugation to dextran. Cancer Treatment Reports. 1982;66(1):107–114.

[42] Bapat N, Boroujerdi M. Effect of Colloidal Carriers on the Disposition and TissueUptake of Doxorubicin: I. Conjugation with Oxidized Dextran Particles. DrugDevelopment and Industrial Pharmacy. 1993;19(20):2651–2665.

[43] Betancor L, Lopez-Gallego F, Hidalgo A, Alonso-Morales N, Fuentes M,Fernandez-Lafuente R, et al. Prevention of interfacial inactivation of enzymesby coating the enzyme surface with dextran-aldehyde. Journal of Biotechnology.2004;110(2):201–207.

[44] Betancor L, Hidalgo A, Fernández-Lorente G, Mateo C, Fernández-Lafuente R,Guisan JM. Preparation of a stable biocatalyst of bovine liver catalase us-ing immobilization and postimmobilization techniques. Biotechnology Progress.2003;19(3):763–767.

[45] Balcão VM, Mateo C, Fernández-Lafuente R, Malcata FX, Guisán JM. Structuraland functional stabilization of L-asparaginase via multisubunit immobilization ontohighly activated supports. Biotechnology Progress. 2001;17(3):537–542.

[46] Behe M, Du J, Becker W, Behr T, Angerstein C, Márquez M, et al. Biodistribution,blood half-life, and receptor binding of a somatostatin-dextran conjugate. MedicalOncology. 2001;18(1):59–64.

152

Bibliography

[47] Wulbrand U, Feldman M, Pfestroff A, Fehman HC, Du J, Hiltunen J, et al. Anovel somatostatin conjugate with a high affinity to all five somatostatin receptorsubtypes. Cancer. 2002;94:1293–1297.

[48] Battersby J, Clark R, Hancock W, Puchulu-Campanella E, Haggarty N, Poll D,et al. Sustained release of recombinant human growth hormone from dextran viahydrolysis of an imine bond. Journal of Controlled Release. 1996;42(2):143–156.

[49] Hurwitz E, Maron R, Bernstein A, Wilchek M, Sela M, Arnon R. The effect invivo of chemotherapeutic drug–antibody conjugates in two murine experimentaltumor systems. International Journal of Cancer. 1978;21(6):747–755.

[50] Tsukada Y, Bischof WK, Hibi N, Hirai H, Hurwitz E, Sela M. Effect of a con-jugate of daunomycin and antibodies to rat alpha-fetoprotein on the growth ofalpha-fetoprotein-producing tumor cells. Proceedings of the National Academy ofSciences. 1982;79(2):621–625.

[51] Tsukada Y, Hurwitz E, Kashi R, Sela M, Hibi N, Hara A, et al. Effect of aconjugate of daunomycin and purified polyclonal or monoclonal antibodies to ratalpha-fetoprotein on the growth of alpha-fetoprotein-producing tumor cells. AnnalsOf The New York Academy Of Sciences. 1983;417:262–269.

[52] Tsukada Y, Hurwitz E, Kashi R, Sela M, Hibi N, Hara A, et al. Chemotherapyby intravenous administration of conjugates of daunomycin with monoclonal andconventional anti-rat alpha-fetoprotein antibodies. Proceedings of the NationalAcademy of Sciences. 1982;79(24):7896–7899.

[53] Check E. A tragic setback. Nature. 2002;420(6912):116–118.

[54] Wong SY, Pelet JM, Putnam D. Polymer systems for gene delivery-past, present,and future. Progress in Polymer Science. 2007;32(8-9):799–837.

[55] Vicennati P, Giuliano A, Ortaggi G, Masotti A. Polyethylenimine in medicinalchemistry. Current Medicinal Chemistry. 2008;15(27):2826–2839.

[56] Boussif O, Lezoualc’h F, Zanta MA, Mergny MD, Scherman D, Demeneix B,et al. A versatile vector for gene and oligonucleotide transfer into cells in cultureand in vivo: polyethylenimine. Proceedings of the National Academy of Sciences.1995;92(16):7297–7301.

[57] Azzam T, Eliyahu H, Shapira L, Linial M, Barenholz Y, Domb AJ. Polysaccharide-oligoamine based conjugates for gene delivery. Journal of Medicinal Chemistry.2002;45(9):1817–1824.

153

Bibliography

[58] Azzam T, Raskin A, Makovitzki A, Brem H, Vierling P, Lineal M, et al. Cationicpolysaccharides for gene delivery. Macromolecules. 2002;35(27):9947–9953.

[59] Azzam T, Eliyahu H, Makovitzki A, Domb A. Dextran-spermine conjugate: Anefficient vector for gene delivery. Macromolecular Symposia. 2003;195:247–261.

[60] Eliyahu H, Joseph A, Azzam T, Barenholz Y, Domb AJ. Dextran-spermine-basedpolyplexes–evaluation of transgene expression and of local and systemic toxicity inmice. Biomaterials. 2006;27(8):1636–1645.

[61] Hosseinkhani H, Azzam T, Kobayashi H, Hiraoka Y, Shimokawa H, Domb AJ, et al.Combination of 3D tissue engineered scaffold and non-viral gene carrier enhance invitro DNA expression of mesenchymal stem cells. Biomaterials. 2006;27(23):4269–4278.

[62] Yudovin-Farber I, Azzam T, Metzer E, Taraboulos A, Domb AJ. Cationic polysac-charides as antiprion agents. Journal of Medicinal Chemistry. 2005;48(5):1414–1420.

[63] Tu J, Zhong S, Li P. Studies on acyclovir-dextran conjugate: Synthesis andpharmacokinetics. Drug Development and Industrial Pharmacy. 2004;30(9):959–965.

[64] Schacht E, Ruys L, Vermeersch J, Remon J, Duncan R. Use of Polysaccharidesas Drug Carriers, Dextran and Inulin Derivatives of Procainamide. Annals Of TheNew York Academy Of Sciences. 1985;446:199–212.

[65] Hudson SP, Langer R, Fink GR, Kohane DS. Injectable in situ cross-linking hy-drogels for local antifungal therapy. Biomaterials. 2009;31(6):1444–1452.

[66] Domb A, Linden G, Polacheck I, Benita S. Nystatin-dextran conjugates: Synthe-sis and characterization. Journal of Polymer Science: Part A: Polymer Science.1996;34:1229–1236.

[67] Marquez M, Nilsson S, Lennartsson L, Liu Z, Tammela T, Raitanen M, et al.Charge-dependent targeting: Results in six tumor cell lines. Anticancer Research.2004;24(3A):1347–1351.

[68] Mitra S, Gaur U, Ghosh PC, Maitra AN. Tumour targeted delivery of encapsulateddextran-doxorubicin conjugate using chitosan nanoparticles as carrier. Journal ofControlled Release. 2001;74(1-3):317–323.

154

Bibliography

[69] Agarwal A, Gupta U, Asthana A, Jain NK. Dextran conjugated dendritic nanocon-structs as potential vectors for anti-cancer agent. Biomaterials. 2009;30(21):3588–3596.

[70] Wu H, Zhang Z, Wu D, Zhao H, Yu K, Hou Z. Preparation and drug releasecharacteristics of Pingyangmycin-loaded dextran cross-linked gelatin microspheresfor embolization therapy. Journal of Biomedical Materials Research Part B: AppliedBiomaterials. 2006;78(1):56–62.

[71] Yuan X, Li H, Zhu X, Woo H. Self-aggregated nanoparticles composed ofperiodate-oxidized dextran and cholic acid: preparation, stabilization and in-vitrodrug release. Journal of Chemical Technology and Biotechnology. 2006;81(5):746–754.

[72] Ramirez H, Valdivia A, Cao R, Fragoso A, et al. Preparation of beta-Cyclodextrin-Dextran Polymers and their Use as Supramolecular Carrier Systems for Naproxen.Polymer Bulletin. 2007;59:597–605.

[73] Cheung RY, Ying Y, Rauth AM, Marcon N, Wu XY. Biodegradable dextran-based microspheres for delivery of anticancer drug mitomycin C. Biomaterials.2005;26(26):5375–5385.

[74] Cheung RY, Rauth AM, Ronaldson PT, Bendayan R, Wu XY. In vitro toxic-ity to breast cancer cells of microsphere-delivered mitomycin C and its combina-tion with doxorubicin. European Journal of Pharmaceutics and Biopharmaceutics.2006;62(3):321–331.

[75] Gumargalieva K, Shipunova O, Zaikov G, Jubanov B, Moshkevitch S. Biodegrada-tion of polymer compounds based on cross-linked dextrans. Polymer Degradationand Stability. 1996;51(1):57–65.

[76] Yoshitani N, Takasaki S. Microscale synthesis of dextran-based multivalent N-linked oligosaccharide probes. Analytical Biochemistry. 2000;277(1):127–134.

[77] Sibikina OV, Novikova EV, Iozep AA, Iozep LI, Tikhomirova NG, KozhevnikovaLS. Reaction between dextran polyaldehyde and iron(III). Russian Journal ofApplied Chemistry. 2007;80(2):341–343.

[78] Du J, Marquez M, Hiltunen J, Nilsson S, Holmberg AR. Radiolabeling of dextranwith rhenium-188. Applied Radiation and Isotopes. 2000;53(3):443–448.

[79] Devakumar J, Mookambeswaran V. A novel affinity-based controlled release sys-

155

Bibliography

tem involving derivatives of dextran with enhanced osmotic activity. BioconjugateChemistry. 2007;18(2):477–483.

[80] Meurling L, Marquez M, Nilsson S, Holmberg AR. Polymer-conjugated guani-dine is a potentially useful anti-tumor agent. International Journal of Oncology.2009;35(2):281–285.

[81] Betancor L, Fuentes M, Dellamora-Ortiz G, Lopez-Gallego F, Hidalgo A, Alonso-Morales N, et al. Dextran aldehyde coating of glucose oxidase immobilized onmagnetic nanoparticles prevents its inactivation by gas bubbles. Journal of Molec-ular Catalysis B: Enzymatic. 2005;32(3):97–101.

[82] Fuentes M, Segura R, Abian O, Betancor L, Hidalgo A, Mateo C, et al. Deter-mination of protein-protein interactions through aldehyde-dextran intermolecularcross-linking. Proteomics. 2004;4(9):2602–2607.

[83] Lenders JP, Germain P, Crichton RR. Immobilization of a soluble chemicallythermostabilized enzyme. Biotechnology and Bioengineering. 1984;27(5):572–578.

[84] Siddiqui KS, Cavicchioli R. Improved thermal stability and activity in the cold-adapted lipase B from Candida antarctica following chemical modification withoxidized polysaccharides. Extremophiles. 2005;9(6):471–476.

[85] Tam SC, Blumenstein J, Wong JT. Soluble dextran-hemoglobin complex as apotential blood substitute. Proceedings of the National Academy of Sciences.1976;73(6):2128–31.

[86] Klett D, Grandgeorge M, Dellacherie E. Fixation of aldehydic dextrans onto humandeoxyhemoglobin. Biopolymers. 1992;32(5):517–522.

[87] Bonneaux F, Dellacherie E, Labrude P, Vigneron C. Hemoglobin-dialdehyde dex-tran conjugates: Improvement of their oxygen-binding properties with anionicgroups. Journal of Protein Chemistry. 1996;15(5):461–465.

[88] Dellacherie E, Bonneaux F, Labrude P, Vigneron C. Modification of humanhemoglobin by covalent association with soluble dextran. Biochimica et BiophysicaActa. 1983;749(1):106–114.

[89] Zambaux MF, Bonneaux F, Dellacherie E. Covalent fixation of soluble derivatizeddextrans to model proteins in low-concentration medium: application to factor IXand protein C. Journal of Protein Chemistry. 1998;17(3):279–84.

156

Bibliography

[90] Fagnani R, Hagan MS, Bartholomew R. Reduction of immunogenicity by covalentmodification of murine and rabbit immunoglobulins with oxidized dextrans of lowmolecular weight. Cancer Research. 1990;50(12):3638–45.

[91] Fagnani R, Halpern S, Hagan M. Altered pharmacokinetic and tumoor-localizationproperties of Fab fragments of a murine monoclonal anti-CEA antibody by covalentmodification with low-molecular weight dextran. Nuclear Medicine Communica-tions. 1995;16(5):362–369.

[92] Dillman RO, Shawler DL, Johnson DE, Meyer DL, Koziol JA, Frincke JM. Pre-clinical trials with combinations and conjugates of T101 monoclonal antibody anddoxorubicin. Cancer Research. 1986;46(10):4886–91.

[93] Hurwitz E, Kashi R, Arnon R, Wilchek M, Sela M. The covalent linking of two nu-cleotide analogues to antibodies. Journal of Medicinal Chemistry. 1985;28(1):137–40.

[94] Pimm MV, Jones JA, Price MR, Middle JG, Embleton MJ, Baldwin RW. TumourLocalization of Monoclonal Antibody Against a Rat Mammary Carcinoma andSuppression of Tumour Growth with Adriamycin-antibody Conjugates. CancerImmunology and Immunotherapy. 1982;12(2):125–134.

[95] Bue P, Márquez M, Malmström PU, Westlin JE, Nilsson S, Holmberg AR. The po-tential of radiolabeled EGF-dextran conjugates in the treatment of urinary bladdercarcinoma. Cancer. 1997;80(12 Sup):2385–2389.

[96] Márquez M, Westlin JE, Nilsson S, Holmberg AR. 99mTc-dextran-antibody con-jugates. Labelling procedures. Acta Oncologica. 1996;35(4):489–92.

[97] Dobrev I, Karamancheva I. Solvatochromic Determination of Second-order Po-larizabilities of Chromophore-functionalized Dextran and Amylose Derivatives.Supramolecular Chemistry. 2002;14(6):491–495.

[98] Jukes J, van der Aa H, Hiemstra C, van Veen T, Dijkstra P, Zhong Z, et al.A newly developed chemically crosslinked Dex-PEG hydrogel for cartilage tissueengineering. Tissue Engineering Part A. 2010;16(2):564–573.

[99] Brondsted H, Hovgaard L, Simonsen L. Dextran hydrogels for colon-specific drugdelivery. II. Synthesis and characterization. European Journal of Pharmaceuticsand Biopharmaceutics. 1996;42(1):85–89.

[100] Hennink WE, van Nostrum CF. Novel crosslinking methods to design hydrogels.Advanced Drug Delivery Reviews. 2002;54(1):13–36.

157

Bibliography

[101] Tomme SRV, Storm G, Hennink WE. In situ gelling hydrogels for pharmaceuticaland biomedical applications. International Journal of Pharmaceutics. 2008;355(1-2):1–18.

[102] Schacht E, Bogdanov B, den Bulcke AV, DeRooze N. Hydrogels prepared bycrosslinking of gelatin with dextran dialdehyde. Reactive and Functional Polymers.1997;33(2-3):109–116.

[103] Draye JP, Delaey B, de Voorde AV, Bulcke AVD, Bogdanov B, Schacht E. In vitrorelease characteristics of bioactive molecules from dextran dialdehyde cross-linkedgelatin hydrogel films. Biomaterials. 1998;19(1-3):99–107.

[104] Weng L, Chen X, Chen W. Rheological characterization of in situ crosslinkable hy-drogels formulated from oxidized dextran and N-carboxyethyl chitosan. Biomacro-molecules. 2007;8(4):1109–1115.

[105] Weng L, Romanov A, Rooney J, Chen W. Non-cytotoxic, in situ gelable hydro-gels composed of N-carboxyethyl chitosan and oxidized dextran. Biomaterials.2008;29(29):3905–3913.

[106] Cortesi R, Esposito E, Osti M, Menegatti E, Squarzoni G, Spencer D, et al. Dextrancross-linked gelatin microspheres as a drug delivery system. European Journal ofPharmaceutics and Biopharmaceutics. 1999;47(2):153–160.

[107] Lin W, Coombes AG, Garnett MC, Davies MC, Schacht E, Davis SS, et al.Preparation of sterically stabilized human serum albumin nanospheres us-ing a novel Dextranox-MPEG crosslinking agent. Pharmaceutical Research.1994;11(11):1588–1592.

[108] Martwiset S, Koh AE, Chen W. Nonfouling characteristics of dextran-containingsurfaces. Langmuir. 2006;22(19):8192–8196.

[109] Massia SP, Stark J, Letbetter DS. Surface-immobilized dextran limits cell adhesionand spreading. Biomaterials. 2000;21(22):2253–2261.

[110] Miksa D, Irish ER, Chen D, Composto R, Eckmann DM. Dextran functionalizedsurfaces via reductive amination: morphology, wetting, and adhesion. Biomacro-molecules. 2006;7(2):557–564.

[111] Massia SP, Stark J. Immobilized RGD peptides on surface-grafted dextran pro-mote biospecific cell attachment. Journal of Biomedical Materials Research.2001;56(3):390–399.

158

Bibliography

[112] Massia SP, Holecko MM, Ehteshami GR. In vitro assessment of bioactive coat-ings for neural implant applications. Journal of Macromolecular Science, Part A.2003;68(1):177–186.

[113] Klaver CL, Caplan MR. Bioactive surface for neural electrodes: decreasing astro-cyte proliferation via transforming growth factor-beta1. Journal of MacromolecularScience, Part A. 2007;81(4):1011–1016.

[114] Mahdavi A, Ferreira LS, Sundback C, Nichol JW, Chan EP, Carter DJD, et al. Abiodegradable and biocompatible gecko-inspired tissue adhesive. Proceedings ofthe National Academy of Sciences. 2008;105(7):2307–2312.

[115] Bogdanov B, Schacht E, Bulcke AVD. Thermal and rheological propertiesof gelatin-dextran hydrogels. Journal of Thermal Analysis and Calorimetry.1997;49(2):847–856.

[116] Mo X, Iwata H, Matsuda S, Ikada Y. Soft tissue adhesive composed of modifiedgelatin and polysaccharides. Journal of Biomaterial Sciences - Polymer Edition.2000;11(4):341–51.

[117] Liu Y, Chan-Park MB. Hydrogel based on interpenetrating polymer networks ofdextran and gelatin for vascular tissue engineering. Biomaterials. 2009;30(2):196–207.

[118] Ehrenfreund-Kleinman T, Domb A, Golenser J. Polysaccharide scaffolds preparedby crosslinking of polysaccharides with chitosan or proteins for cell growth. Journalof Bioactive and Compatible Polymers. 2003;18(5):323–338.

[119] Liu G, Shi Z, Kuriger T, Hanton L, Simpson J, Moratti S, et al. Synthesis andCharacterization of Chitosan/Dextran-Based Hydrogels for Surgical Use. Macro-molecular Symposia. 2009;279:151–157.

[120] Hoffmann B, Volkmer E, Kokott A, Augat P, Ohnmacht M, Sedlmayr N, et al.Characterisation of a new bioadhesive system based on polysaccharides with thepotential to be used as bone glue. Journal of Materials Science - Materials inMedicine. 2009;20(10):2001–2009.

[121] Artzi N, Shazly T, Baker AB, Bon A, Edelman ER. Aldehyde-Amine Chemistry En-ables Modulated Biosealants with Tissue-Specific Adhesion. Advanced Materials.2009;21(32-33):3399–3403.

[122] Artzi N, Shazly T, Crespo C, Ramos AB, Chenault HK, Edelman ER. Characteriza-

159

Bibliography

tion of Star Adhesive Sealants Based On PEG/Dextran Hydrogels. MacromolecularBioscience. 2009;9(8):754–765.

[123] Shazly TM, Artzi N, Boehning F, Edelman ER. Viscoelastic adhesive mechanicsof aldehyde-mediated soft tissue sealants. Biomaterials. 2008;29(35):4584–4591.

[124] Bhatia SK, Arthur SD, Chenault HK, Figuly GD, Kodokian GK. Polysaccharide-based tissue adhesives for sealing corneal incisions. Current Eye Research.2007;32(12):1045–1050.

[125] Peng H, Shek P. Development of in situ-forming hydrogels for hemorrhage control.Journal of Materials Science - Materials in Medicine. 2009;20(8):1753–1762.

[126] Stair JL, Watkinson M, Krause S. Sensor materials for the detection of proteases.Biosensors and Bioelectronics. 2009;24(7):2113–2118.

[127] Cheung RY, Rauth AM, Wu XY. In vivo efficacy and toxicity of intratumorallydelivered mitomycin C and its combination with doxorubicin using microsphereformulations. Anticancer Drugs. 2005;16(4):423–433.

[128] Hong X, Guo W, Yuang H, Li J, Liu Y, Ma L, et al. Periodate oxidation ofnanoscaled magnetic dextran composites. Journal of Magnetism and MagneticMaterials. 2004;269(1):95–100.

[129] Reiner HGRH. HIO-4-oxidized soluble polysaccharides as polyfunctional links forcovalent binding of enzymes, 1. Preparation of polysaccharides and matrices fortheir binding. Die Makromolekulare Chemie. 1981;182(6):1641–1648.

[130] Dai L, StJohn H, Bi J, Zientek P, Chatelier R, Griesser H. Biomedical coatings bythe covalent immobilization of polysaccharides onto gas-plasma-activated polymersurfaces. Surface and Interface Analysis. 2000;29(1):46–55.

[131] Avseenko NV, TYa M, Ataullakhanov FI, Morozov VN. Immobilization of proteinsin immunochemical microarrays fabricated by electrospray deposition. AnalyticalChemistry. 2001;73(24):6047–6052.

[132] Penzol G, Armisen P, Fernandez-Lafuente R, Rodes L, Guisan J. Use of dex-trans as long and hydrophilic spacer arms to improve the performance of immo-bilized proteins acting on macromolecules. Biotechnology and Bioengineering.1998;60:518–523.

[133] Moser I, Dworsky P, Pittner F. Degradation of bacterial cell walls by immobilizedlysozyme. Applied Biochemistry and Biotechnology. 1988;19(3):243–249.

160

Bibliography

[134] Fuentes M, Mateo C, Fernandez-Lafuente R, Guisan J. Aldehyde-dextran-proteinconjugates to immobilize amino-haptens: avoiding cross-reactions in the immun-odetection. Enzyme and Microbial Technology. 2005;36(4):510–513.

[135] Phelps EA, Garcia AJ. Update on therapeutic vascularization strategies. Regen-erative Medicine. 2009;4(1):65–80.

[136] Jay SM, Shepherd BR, Andrejecsk JW, Kyriakides TR, Pober JS, Saltzman WM.Dual delivery of VEGF and MCP-1 to support endothelial cell transplantation fortherapeutic vascularization. Biomaterials. 2010;31(11):3054–62.

[137] Phelps EA, Landázuri N, Thulé PM, Taylor WR, García AJ. Bioartificial matricesfor therapeutic vascularization. Proceedings of the National Academy of Sciences.2010;107(8):3323–8.

[138] Pedroso DCS, Tellechea A, Moura L, Fidalgo-Carvalho I, Duarte J, Carvalho E,et al. Improved survival, vascular differentiation and wound healing potential ofstem cells co-cultured with endothelial cells. Accepted for publication in PLoSOne. 2010;.

[139] Silva EA, Kim ES, Kong HJ, Mooney DJ. Material-based deployment enhancesefficacy of endothelial progenitor cells. Proceedings of the National Academy ofSciences. 2008;105(38):14347–14352.

[140] Carmeliet P. Angiogenesis in health and disease. Nature Medicine. 2003;9(6):653–660.

[141] Folkman J, Merler E, Abernathy C, Williams G. Isolation of a tumor factor respon-sible for angiogenesis. Journal of Experimental Medicine. 1971;133(2):275–288.

[142] Ferrara N, Gerber HP, LeCouter J. The biology of VEGF and its receptors. NatureMedicine. 2003;9(6):669–76.

[143] Senger DR, Galli SJ, Dvorak AM, Perruzzi CA, Harvey VS, Dvorak HF. Tumorcells secrete a vascular permeability factor that promotes accumulation of ascitesfluid. Science. 1983;219(4587):983–985.

[144] Leung DW, Cachianes G, Kuang WJ, Goeddel DV, Ferrara N. Vascular endothelialgrowth factor is a secreted angiogenic mitogen. Science. 1989;246(4935):1306–1309.

[145] Ferrara N. VEGF and the quest for tumour angiogenesis factors. Nature ReviewsCancer. 2002;2(10):795–803.

161

Bibliography

[146] Ferrara N, Hillan KJ, Gerber HP, Novotny W. Discovery and development ofbevacizumab, an anti-VEGF antibody for treating cancer. Nature Reviews DrugDiscovery. 2004;3(5):391–400.

[147] Hanft JR, Pollak RA, Barbul A, van Gils C, Kwon PS, Gray SM, et al. Phase Itrial on the safety of topical rhVEGF on chronic neuropathic diabetic foot ulcers.Journal of Wound Care. 2008;17(1):30–37.

[148] Henry TD, Annex BH, McKendall GR, Azrin MA, Lopez JJ, Giordano FJ, et al.The VIVA trial: Vascular endothelial growth factor in Ischemia for Vascular An-giogenesis. Circulation. 2003;107(10):1359–1365.

[149] Murukesh N, Dive C, Jayson GC. Biomarkers of angiogenesis and their role in thedevelopment of VEGF inhibitors. British Journal of Cancer. 2010;102(1):8–18.

[150] Ferrara N. Vascular Endothelial Growth Factor: Basic Science and ClinicalProgress. Endocrine Reviews. 2004;25(4):581–611.

[151] Tischer E, Mitchell R, Hartman T, Silva M, Gospodarowicz D, Fiddes JC, et al.The human gene for vascular endothelial growth factor. Multiple protein formsare encoded through alternative exon splicing. Journal of Biological Chemistry.1991;266(18):11947–11954.

[152] Houck KA, Ferrara N, Winer J, Cachianes G, Li B, Leung DW. The vascu-lar endothelial growth factor family: identification of a fourth molecular speciesand characterization of alternative splicing of RNA. Molecular Endocrinology.1991;5(12):1806–1814.

[153] Park JE, Keller GA, Ferrara N. The vascular endothelial growth factor (VEGF)isoforms: differential deposition into the subepithelial extracellular matrix andbioactivity of extracellular matrix-bound VEGF. Molecular Biology of the Cell.1993;4(12):1317–26.

[154] Houck KA, Leung DW, Rowland AM, Winer J, Ferrara N. Dual regulation ofvascular endothelial growth factor bioavailability by genetic and proteolytic mech-anisms. Journal of Biological Chemistry. 1992;267(36):26031–26037.

[155] Ferrara N. Binding to the extracellular matrix and proteolytic processing: twokey mechanisms regulating vascular endothelial growth factor action. MolecularBiology of the Cell. 2010;21(5):687–90.

[156] Park JE, Chen HH, Winer J, Houck KA, Ferrara N. Placenta growth factor.Potentiation of vascular endothelial growth factor bioactivity, in vitro and in vivo,

162

Bibliography

and high affinity binding to Flt-1 but not to Flk-1/KDR. Journal of BiologicalChemistry. 1994;269(41):25646–54.

[157] Gerber H, McMurtrey A, Kowalski J, Yan M, Keyt B, Dixit V, et al. Vascu-lar endothelial growth factor regulates endothelial cell survival through the phos-phatidylinositol 3 ’-kinase Akt signal transduction pathway - Requirement for Flk-1/KDR activation. Journal of Biological Chemistry. 1998;273(46):30336–30343.

[158] Waltenberger J, Claesson-Welsh L, Siegbahn A, Shibuya M, Heldin CH. Differentsignal transduction properties of KDR and Flt1, two receptors for vascular en-dothelial growth factor. Journal of Biological Chemistry. 1994;269(43):26988–95.

[159] Takahashi T, Ueno H, Shibuya M. VEGF activates protein kinase C-dependent,but Ras-independent Raf-MEK-MAP kinase pathway for DNA synthesis in primaryendothelial cells. Oncogene. 1999;18(13):2221–30.

[160] Carmeliet P, Tessier-Lavigne M. Common mechanisms of nerve and blood vesselwiring. Nature. 2005;436(7048):193–200.

[161] Lee S, Chen TT, Barber CL, Jordan MC, Murdock J, Desai S, et al. AutocrineVEGF signaling is required for vascular homeostasis. Cell. 2007;130(4):691–703.

[162] Kilic E, Kilic U, Wang Y, Bassetti CL, Marti HH, Hermann DM. Thephosphatidylinositol-3 kinase/Akt pathway mediates VEGF’s neuroprotective ac-tivity and induces blood brain barrier permeability after focal cerebral ischemia.FASEB Journal. 2006;20(8):1185–7.

[163] Chen TT, Luque A, Lee S, Anderson SM, Segura T, Iruela-Arispe ML. Anchorageof VEGF to the extracellular matrix conveys differential signaling responses toendothelial cells. Journal of Biological Chemistry. 2010;188(4):595–609.

[164] Eppler SM, Combs DL, Henry TD, Lopez JJ, Ellis SG, Yi JH, et al. A target-mediated model to describe the pharmacokinetics and hemodynamic effects ofrecombinant human vascular endothelial growth factor in humans. Clinical Phar-macology Therapeutics. 2002;72(1):20–32.

[165] Carmeliet P. Mechanisms of angiogenesis and arteriogenesis. Nature Medicine.2000;6(4):389–395.

[166] Richardson TP, Peters MC, Ennett AB, Mooney DJ. Polymeric system for dualgrowth factor delivery. Nature Biotechnology. 2001;19(11):1029–34.

[167] Asahara T, Kawamoto A. Endothelial progenitor cells for postnatal vasculogenesis.American Journal of Physiology, Cell Physiology. 2004;287(3):C572–C579.

163

Bibliography

[168] Asahara T, Takahashi T, Masuda H, Kalka C, Chen D, Iwaguro H, et al. VEGFcontributes to postnatal neovascularization by mobilizing bone marrow-derivedendothelial progenitor cells. EMBO Journal. 1999;18(14):3964–3972.

[169] Kalka C, Masuda H, Takahashi T, Kalka-Moll WM, Silver M, Kearney M,et al. Transplantation of ex vivo expanded endothelial progenitor cells for ther-apeutic neovascularization. Proceedings of the National Academy of Sciences.2000;97(7):3422–7.

[170] Fischbach C, Mooney DJ. Polymeric systems for bioinspired delivery of angiogenicmolecules. Advances in Polymer Science. 2006;203:191–221.

[171] Caspi O, Lesman A, Basevitch Y, Gepstein A, Arbel G, Habib IHM, et al. Tis-sue engineering of vascularized cardiac muscle from human embryonic stem cells.Circulation Research. 2007;100(2):263–272.

[172] Morritt AN, Bortolotto SK, Dilley RJ, Han X, Kompa AR, McCombe D, et al.Cardiac tissue engineering in an in vivo vascularized chamber. Circulation.2007;115(3):353–60.

[173] Ji JA, Liu J, Shire SJ, Kamerzell TJ, Hong S, Billeci K, et al. Characteristics ofrhVEGF Release from Topical Hydrogel Formulations. Pharmaceutical Research.2010;27(4):644–54.

[174] Sun G, Shen YI, Ho CC, Kusuma S, Gerecht S. Functional groups affect phys-ical and biological properties of dextran-based hydrogels. Journal of BiomedicalMaterials Research: Part A. 2009;93(3):1080–90.

[175] Sharon JL, Puleo DA. Immobilization of glycoproteins, such as VEGF, onbiodegradable substrates. Acta Biomaterialia. 2008;4(4):1016–23.

[176] Shen YH, Shoichet MS, Radisic M. Vascular endothelial growth factor immobilizedin collagen scaffold promotes penetration and proliferation of endothelial cells. ActaBiomaterialia. 2008;4(3):477–89.

[177] la Riva BD, Nowak C, Sánchez E, Hernández A, Schulz-Siegmund M, Pec MK,et al. VEGF-controlled release within a bone defect from alginate/chitosan/PLA-H scaffolds. European Journal of Pharmaceutics and Biopharmaceutics.2009;73(1):50–8.

[178] Lode A, Wolf-Brandstetter C, Reinstorf A, Bernhardt A, König U, Pompe W,et al. Calcium phosphate bone cements, functionalized with VEGF: release ki-

164

Bibliography

netics and biological activity. Journal of Biomedical Materials Research: Part A.2007;81(2):474–83.

[179] Lode A, Reinstorf A, Bernhardt A, Wolf-Brandstetter C, König U, Gelinsky M.Heparin modification of calcium phosphate bone cements for VEGF functionaliza-tion. Journal of Biomedical Materials Research: Part A. 2008;86(3):749–59.

[180] Peattie RA, Rieke ER, Hewett EM, Fisher RJ, Shu XZ, Prestwich GD. Dualgrowth factor-induced angiogenesis in vivo using hyaluronan hydrogel implants.Biomaterials. 2006;27(9):1868–75.

[181] Pike DB, Cai S, Pomraning KR, Firpo MA, Fisher RJ, Shu XZ, et al. Heparin-regulated release of growth factors in vitro and angiogenic response in vivoto implanted hyaluronan hydrogels containing VEGF and bFGF. Biomaterials.2006;27(30):5242–51.

[182] Hosack L, Firpo M, Scott J, Prestwich G, Peattie R. Microvascular maturity elicitedin tissue treated with cytokine-loaded hyaluronan-based hydrogels. Biomaterials.2008;29(15):2336–47.

[183] Roca C, Adams RH. Regulation of vascular morphogenesis by Notch signaling.Genes and Development. 2007;21(20):2511–24.

[184] Cao L, Arany P, Wang Y, Mooney DJ. Promoting angiogenesis via manipulation ofVEGF responsiveness with notch signaling. Biomaterials. 2009;30(25):4085–4093.

[185] Ehrbar M, Zeisberger SM, Raeber GP, Hubbell J, Schnell C, Zisch AH. The roleof actively released fibrin-conjugated VEGF for VEGF receptor 2 gene activationand the enhancement of angiogenesis. Biomaterials. 2008;29(11):1720–9.

[186] Ehrbar M, Metters AT, Zammaretti P, Hubbell J, Zisch AH. Endothelial cellproliferation and progenitor maturation by fibrin-bound VEGF variants with dif-ferential susceptibilities to local cellular activity. Journal of Controlled Release.2005;101(1-3):93–109.

[187] Ehrbar M, Djonov VG, Schnell C, Tschanz SA, Martiny-Baron G, Schenk U, et al.Cell-demanded liberation of VEGF121 from fibrin implants induces local and con-trolled blood vessel growth. Circulation Research. 2004;94(8):1124–32.

[188] Yamaguchi N, Zhang L, Chae BS, Palla CS, Furst EM, Kiick KL. Growth factormediated assembly of cell receptor-responsive hydrogels. Journal of the AmericanChemical Society. 2007;129(11):3040–1.

165

Bibliography

[189] Leslie-Barbick JE, Moon JJ, West JL. Covalently-Immobilized Vascular Endothe-lial Growth Factor Promotes Endothelial Cell Tubulogenesis in Poly(ethylene gly-col) Diacrylate Hydrogels. Journal of Biomaterial Sciences - Polymer Edition.2009;20(12):1763–1779.

[190] Chiang CK, Chowdhury MF, Iyer RK, Stanford WL, Radisic M. Engineering sur-faces for site-specific vascular differentiation of mouse embryonic stem cells. ActaBiomaterialia. 2010;6(6):1904–1916.

[191] Chiu L, Radisic M. Scaffolds with covalently immobilized VEGF and Angiopoietin-1 for vascularization of engineered tissues. Biomaterials. 2010;31(2):226–241.

[192] Koch S, Yao C, Grieb G, Prével P, Noah EM, Steffens GCM. Enhancing angiogen-esis in collagen matrices by covalent incorporation of VEGF. Journal of MaterialsScience - Materials in Medicine. 2006;17(8):735–41.

[193] Yao C, Roderfeld M, Rath T, Roeb E, Bernhagen J, Steffens G. The impact ofproteinase-induced matrix degradation on the release of VEGF from heparinizedcollagen matrices. Biomaterials. 2006;27(8):1608–16.

[194] Kanczler JM, Ginty PJ, Barry JJA, Clarke NMP, Howdle SM, Shakesheff KM, et al.The effect of mesenchymal populations and vascular endothelial growth factordelivered from biodegradable polymer scaffolds on bone formation. Biomaterials.2008;29(12):1892–900.

[195] Silva EA, Mooney DJ. Spatiotemporal control of vascular endothelial growth factordelivery from injectable hydrogels enhances angiogenesis. Journal of Thrombosisand Haemostasis. 2007;5(3):590–598.

[196] Silva EA, Mooney DJ. Effects of VEGF temporal and spatial presentation onangiogenesis. Biomaterials. 2010;31(6):1235–1241.

[197] Freeman I, Cohen S. The influence of the sequential delivery of angiogenicfactors from affinity-binding alginate scaffolds on vascularization. Biomaterials.2009;30(11):2122–31.

[198] Jay SM, Saltzman WM. Controlled delivery of VEGF via modulation of alginatemicroparticle ionic crosslinking. Journal of Controlled Release. 2009;134(1):26–34.

[199] Ennett AB, Kaigler D, Mooney DJ. Temporally regulated delivery of VEGF in vitroand in vivo. Journal of Biomedical Materials Research: Part A. 2006;79(1):176–184.

166

Bibliography

[200] Lee J, Lee K. Local and Sustained Vascular Endothelial Growth Factor De-livery for Angiogenesis Using an Injectable System. Pharmaceutical Research.2009;26(7):1739–1744.

[201] Chung YI, Kim SK, Lee YK, Park SJ, Cho KO, Yuk SH, et al. Efficient revas-cularization by VEGF administration via heparin-functionalized nanoparticle-fibrincomplex. Journal of Controlled Release. 2010;143(3):282–9.

[202] Vallbacka JJ, Sefton MV. Vascularization and Improved In Vivo Survival ofVEGF-Secreting Cells Microencapsulated in HEMA-MMA. Tissue Engineering.2007;13(9):2259–69.

[203] Huang M, Vitharana SN, Peek LJ, Coop T, Berkland C. Polyelectrolyte complexesstabilize and controllably release vascular endothelial growth factor. Biomacro-molecules. 2007;8(5):1607–1614.

[204] Rocha F, Sundback C, Krebs N, Leach J, Mooney DJ, Ashley S, et al. Theeffect of sustained delivery of vascular endothelial growth factor on angiogenesisin tissue-engineered intestine. Biomaterials. 2008;29(19):2884–2890.

[205] Schmidt D, Breymann C, Weber A, Guenter CI, Neuenschwander S, Zund G, et al.Umbilical cord blood derived endothelial progenitor cells for tissue engineering ofvascular grafts. Annals of Thoracic Surgery. 2004;78(6):2094–2098.

[206] Kupatt C, Horstkotte J, Vlastos G, Pfosser A, Lebherz C, Semisch M, et al.Embryonic endothelial progenitor cells expressing a broad range of proangiogenicand remodeling factors enhance vascularization and tissue recovery in acute andchronic ischemia. FASEB Journal. 2005;19(9):1576–1578.

[207] Ziebart T, Yoon CH, Trepels T, Wietelmann A, Braun T, Kiessling F, et al.Sustained Persistence of Transplanted Proangiogenic Cells Contributes to Neo-vascularization and Cardiac Function After Ischemia. Circulation Research.2008;103(11):1327–1334.

[208] Kawamoto A, Asahara T, Losordo DW. Transplantation of endothelial progen-itor cells for therapeutic neovascularization. Cardiovascular Radiation Medicine.2002;3(3-4):221–225.

[209] Taguchi A, Soma T, Tanaka H, Kanda T, Nishimura H, Yoshikawa H, et al.Administration of CD34+ cells after stroke enhances neurogenesis via angiogenesisin a mouse model. Journal of Clinical Investigation. 2004;114(3):330–338.

167

Bibliography

[210] Kocher AA, Schuster MD, Szabolcs MJ, Takuma S, Burkhoff D, Wang J, et al.Neovascularization of ischemic myocardium by human bone-marrow-derived an-gioblasts prevents cardiomyocyte apoptosis, reduces remodeling and improves car-diac function. Nature Medicine. 2001;7(4):430–436.

[211] Ferreira LS, Gerecht S, Shieh HF, Watson N, Rupnick MA, Dallabrida SM, et al.Vascular progenitor cells isolated from human embryonic stem cells give rise toendothelial and smooth muscle like cells and form vascular networks in vivo. Cir-culation Research. 2007;101(3):286–94.

[212] Hoffman LM, Carpenter MK. Characterization and culture of human embryonicstem cells. Nature Biotechnology. 2005;23(6):699–708.

[213] Ferreira LS, Squier T, Park H, Choe H, Kohane DS, Langer R. Human embryoidbodies containing nano- and microparticulate delivery vehicles. Advanced Materi-als. 2008;20(12):2285–2292.

[214] Gerecht S, Burdick JA, Ferreira LS, Townsend SA, Langer R, Vunjak-NovakovicG. Hyaluronic acid hydrogel for controlled self-renewal and differentiation of hu-man embryonic stem cells. Proceedings of the National Academy of Sciences.2007;104(27):11298–303.

[215] Rahman N, Purpura KA, Wylie RG, Zandstra PW, Shoichet MS. The use ofvascular endothelial growth factor functionalized agarose to guide pluripotent stemcell aggregates toward blood progenitor cells. Biomaterials. 2010;31(32):8262–8270.

[216] Ferreira LS, Gerecht S, Fuller J, Shieh HF, Vunjak-Novakovic G, Langer R. Bioac-tive hydrogel scaffolds for controllable vascular differentiation of human embryonicstem cells. Biomaterials. 2007;28(17):2706–17.

[217] Murday JS, Siegel RW, Stein J, Wright JF. Translational nanomedicine: sta-tus assessment and opportunities. Nanomedicine: Nanotechnology, Biology, andMedicine. 2009;5(3):251–73.

[218] Lin W, Coombes AG, Davies MC, Davis SS, Illum L. Preparation of sub-100 nmhuman serum albumin nanospheres using a pH-coacervation method. Journal ofDrug Targeting. 1993;1(3):237–43.

[219] Gao X, Cui Y, Levenson RM, Chung LWK, Nie S. In vivo cancer targeting and imag-ing with semiconductor quantum dots. Nature Biotechnology. 2004;22(8):969–76.

168

Bibliography

[220] Gao J, Zhang W, Huang P, Zhang B, Zhang X, Xu B. Intracellular spatial controlof fluorescent magnetic nanoparticles. Journal of the American Chemical Society.2008;130(12):3710–3711.

[221] Byrne MT, Gun’ko YK. Recent Advances in Research on Carbon Nanotube-Polymer Composites. Advanced Materials. 2010;22(15):1672–1688.

[222] Kim TG, Park TG. Surface functionalized electrospun biodegradable nanofibers forimmobilization of bioactive molecules. Biotechnology Progress. 2006;22(4):1108–13.

[223] Gao J, Xu B. Applications of nanomaterials inside cells. Nano Today.2009;4(1):37–51.

[224] Fahmy T, Fong P, Goyal A, Saltzman W. Targeted for drug delivery. MaterialsToday. 2005;8(8, Supplement 1):18–26.

[225] Zhang S, Uludağ H. Nanoparticulate systems for growth factor delivery. Pharma-ceutical Research. 2009;26(7):1561–80.

[226] Quintanar-Guerrero D, Allémann E, Fessi H, Doelker E. Preparation techniquesand mechanisms of formation of biodegradable nanoparticles from preformed poly-mers. Drug Development and Industrial Pharmacy. 1998;24(12):1113–28.

[227] Ye S, Wang C, Liu X, Tong Z. Multilayer nanocapsules of polysaccharide chi-tosan and alginate through layer-by-layer assembly directly on PS nanoparticlesfor release. Journal of Biomaterials Science - Polymer Ed. 2005;16(7):909–23.

[228] Thienen TV, Lucas B, Flesch F, van Nostrum C, Demeester J, Smedt SD. Onthe synthesis and characterization of biodegradable dextran nanogels with tunabledegradation properties. Macromolecules. 2005;38(20):8503–8511.

[229] Lemarchand C, Gref R, Passirani C, Garcion E, Petri B, Müller R, et al. Influence ofpolysaccharide coating on the interactions of nanoparticles with biological systems.Biomaterials. 2006;27(1):108–18.

[230] Aggarwal P, Hall J, McLeland C, Dobrovolskaia M, McNeil S. Nanoparticle interac-tion with plasma proteins as it relates to particle biodistribution, biocompatibilityand therapeutic efficacy. Advanced Drug Delivery Reviews. 2009;61(6):428–437.

[231] Walczyk D, Bombelli FB, Monopoli MP, Lynch I, Dawson KA. What the cell "sees"in bionanoscience. Journal of the American Chemical Society. 2010;132(16):5761–8.

169

Bibliography

[232] Hu Y, Litwin T, Nagaraja AR, Kwong B, Katz J, Watson N, et al. Cytosolic deliveryof membrane-impermeable molecules in dendritic cells using pH-Responsive core-shell nanoparticles. Nano Letters. 2007;7(10):3056–3064.

[233] Elbert DL, Hubbell J. Conjugate addition reactions combined with free-radicalcross-linking for the design of materials for tissue engineering. Biomacromolecules.2001;2(2):430–41.

[234] Weng L, Pan H, Chen W. Self-crosslinkable hydrogels composed of partially oxi-dized hyaluronan and gelatin: in vitro and in vivo responses. Journal of BiomedicalMaterials Research: Part A. 2008;85(2):352–65.

[235] Kolb HC, Finn MG, Sharpless KB. Click Chemistry: Diverse Chemical Functionfrom a Few Good Reactions. Angewandte Chemie Int Edit. 2001;40(11):2004–2021.

[236] Malkoch M, Vestberg R, Gupta N, Mespouille L, Dubois P, Mason AF, et al.Synthesis of well-defined hydrogel networks using Click chemistry. Chemical Com-munication. 2006;(26):2774–2776.

[237] Slager J, Domb AJ. Stereocomplexes based on poly(lactic acid) and insulin: for-mulation and release studies. Biomaterials. 2002;23(22):4389–4396.

[238] Tiyaboonchai W, Woiszwillo J, Middaugh CR. Formulation and characterization ofDNA-polyethylenimine-dextran sulfate nanoparticles. European Journal of Phar-maceutical Sciences. 2003;19(4):191–202.

[239] Khutoryanskaya O, Williams A, Khutoryanskiy V. pH-Mediated Interactionsbetween Poly (acrylic acid) and Methylcellulose in the Formation of Ultra-thin Multilayered Hydrogels and Spherical Nanoparticles. Macromolecules.2007;40(21):7707–7713.

[240] Thomas JA. Locking self-assembly: strategies and outcomes. Chemical SocietyReviews. 2007;36(6):856–68.

[241] Grenha A, Gomes ME, Rodrigues M, Santo VE, Mano JF, Neves NM, et al. Devel-opment of new chitosan/carrageenan nanoparticles for drug delivery applications.Journal of Biomedical Materials Research: Part A. 2010;92(4):1265–72.

[242] Boddohi S, Moore N, Johnson P, Kipper M. Polysaccharide-Based PolyelectrolyteComplex Nanoparticles from Chitosan, Heparin, and Hyaluronan. Biomacro-molecules. 2009;10(6):1402–1409.

170

Bibliography

[243] Tiyaboonchai W, Woiszwillo J, Sims RC, Middaugh CR. Insulin containingpolyethylenimine-dextran sulfate nanoparticles. International Journal of Pharma-ceutics. 2003;255(1-2):139–51.

[244] Tiyaboonchai W, Woiszwillo J, Middaugh C. Formulation and characteriza-tion of amphotericin B-polyethylenimine-dextran sulfate nanoparticles. Journalof Phamaceutical Sciences. 2001;90(7):902–914.

[245] Akiyoshi K, Kobayashi S, Shichibe S, Mix D, Baudys M, Kim SW, et al. Self-assembled hydrogel nanoparticle of cholesterol-bearing pullulan as a carrier ofprotein drugs: complexation and stabilization of insulin. Journal of ControlledRelease. 1998;54(3):313–320.

[246] Choi KY, Min KH, Na JH, Choi K, Kim K, Park JH, et al. Self-assembled hyaluronicacid nanoparticles as a potential drug carrier for cancer therapy: synthesis, char-acterization, and in vivo biodistribution. Journal of Materials Science. 2009;.

[247] Tang M, Dou H, Sun K. One-step synthesis of dextran-based stable nanoparticlesassisted by self-assembly. Polymer. 2006;47(2):728–734.

[248] Jhaveri SB, Carter KR. Triggered decomposition of polymeric nanoparticles.Macromolecules. 2007;40(22):7874–7877.

[249] Huang X, Zhuang J, Chen D, Liu H, Tang F, Yan X, et al. General Strategyfor Designing Functionalized Magnetic Microspheres for Different Bioapplications.Langmuir. 2009;25(19):11657–11663.

[250] Leobandung W, Ichikawa H, Fukumori Y, Peppas N. Preparation of stable insulin-loaded nanospheres of poly(ethylene glycol) macromers and N-isopropyl acry-lamide. Journal of Controlled Release. 2002;80(1-3):357–363.

[251] Steinhauser I, Spänkuch B, Strebhardt K, Langer K. Trastuzumab-modifiednanoparticles: optimisation of preparation and uptake in cancer cells. Bioma-terials. 2006;27(28):4975–83.

[252] Green JJ, Chiu E, Leshchiner ES, Shi J, Langer R, Anderson DG. Electrostaticligand coatings of nanoparticles enable ligand-specific gene delivery to humanprimary cells. Nano Letters. 2007;7(4):874–9.

[253] Rothenfluh DA, Bermudez H, O’Neil CP, Hubbell J. Biofunctional polymernanoparticles for intra-articular targeting and retention in cartilage. Nature Mate-rials. 2008;7(3):248–54.

171

Bibliography

[254] Hoffman AS. The origins and evolution of "controlled" drug delivery systems.Journal of Controlled Release. 2008;132(3):153–163.

[255] Dinbergs ID, Brown L, Edelman ER. Cellular response to transforminggrowth factor-beta1 and basic fibroblast growth factor depends on release ki-netics and extracellular matrix interactions. Journal of Biological Chemistry.1996;271(47):29822–9.

[256] Bowen-Pope DF, Malpass TW, Foster DM, Ross R. Platelet-derived growth factorin vivo: levels, activity, and rate of clearance. Blood. 1984;64(2):458–69.

[257] Cleland J, Duenas ET, Park A, Daugherty AL, Kahn J, Kowalski J, et al. De-velopment of poly-(D,L-lactide-coglycolide) microsphere formulations containingrecombinant human vascular endothelial growth factor to promote local angiogen-esis. Journal of Controlled Release. 2001;72(1-3):13–24.

[258] King TW, Patrick CW. Development and in vitro characterization ofvascular endothelial growth factor (VEGF)-loaded poly(DL-lactic-co-glycolicacid)/poly(ethylene glycol) microspheres using a solid encapsulation/single emul-sion/solvent extraction technique. Journal of Biomedical Materials Research.2000;51(3):383–90.

[259] Gu F, Amsden B, Neufeld R. Sustained delivery of vascular endothelial growthfactor with alginate beads. Journal of Controlled Release. 2004;96(3):463–72.

[260] Chung YI, Tae G, Yuk SH. A facile method to prepare heparin-functionalized nanoparticles for controlled release of growth factors. Biomaterials.2006;27(12):2621–6.

[261] Oh KS, Han SK, Lee HS, Koo HM, Kim RS, Lee KE, et al. Core/Shell nanoparticleswith lecithin lipid cores for protein delivery. Biomacromolecules. 2006;7(8):2362–7.

[262] Duester G. Retinoic acid synthesis and signaling during early organogenesis. Cell.2008;134(6):921–31.

[263] Clarke N, Germain P, Altucci L, Gronemeyer H. Retinoids: potential in cancerprevention and therapy. Expert Reviews in Molecular Medicine. 2004;6(25):1–23.

[264] Szuts EZ, Harosi FI. Solubility of retinoids in water. Archives of Biochemistry andBiophysics. 1991;287(2):297–304.

[265] Thunemann A, Beyermann J, von Ferber C, Lowen H. Immobilization ofretinoic acid by polyamino acids: Lamellar-structured nanoparticles. Langmuir.2000;16(2):850–857.

172

Bibliography

[266] Thunemann A, Beyermann J. Polyethylenimine complexes with retinoic acid:Structure, release profiles, and nanoparticles. Macromolecules. 2000;33(18):6878–6885.

[267] Thunemann A, Beyermann J, Kukula H. Poly(ethylene oxide)-b-poly(L-lysine)complexes with retinoic acid. Macromolecules. 2000;33(16):5906–5911.

[268] Kim D, Choi C, Jeong Y, Jang M, Nah J, Kang S, et al. All-trans retinoic acid-associated low molecular weight water-soluble chitosan nanoparticles based on ioncomplex. Macromolecular Research. 2006;14(1):66–72.

[269] Park JS, Koh YS, Bang JY, Jeong YI, Lee JJ. Antitumor effect of all-trans retinoicacid-encapsulated nanoparticles of methoxy poly(ethylene glycol)-conjugated chi-tosan against CT-26 colon carcinoma in vitro. Journal of Phamaceutical Sciences.2008;97(9):4011–9.

[270] Kim DG, Jeong YI, Nah JW. All-trans retinoic acid release from polyion-complexmicelles of methoxy poly(ethylene glycol) grafted chitosan. Journal Applied Poly-mer Science. 2007;105(6):3246–3254.

[271] Vasir JK, Labhasetwar V. Biodegradable nanoparticles for cytosolic delivery oftherapeutics. Advanced Drug Delivery Reviews. 2007;59(8):718–728.

[272] Ferreira LS. Nanoparticles as tools to study and control stem cells. Journal ofCellular Biochemistry. 2009;108(4):746–52.

[273] Bale SS, Kwon SJ, Shah DA, Banerjee A, Dordick JS, Kane RS. Nanoparticle-mediated cytoplasmic delivery of proteins to target cellular machinery. ACS nano.2010;4(3):1493–1500.

[274] Breunig M, Bauer S, Goepferich A. Polymers and nanoparticles: intelligent toolsfor intracellular targeting? European Journal of Pharmaceutics and Biopharma-ceutics. 2008;68(1):112–128.

[275] Wan ACA, Ying JY. Nanomaterials for in situ cell delivery and tissue regeneration.Advanced Drug Delivery Reviews. 2010;62(7-8):731–740.

[276] Hu Z, Lu X, Gao J, Wang C. Polymer gel nanoparticle networks. AdvancedMaterials. 2000;12(16):1173–1176.

[277] Wu Y, Zhou Z, Fan Q, Chen L, Zhu M. Facile in-situ fabrication of novel organicnanoparticle hydrogels with excellent mechanical properties. Journal of MaterialsScience. 2009;19:7340–7346.

173

Bibliography

[278] Wang C, Flynn N, Langer R. Controlled structure and properties of thermorespon-sive nanoparticle-hydrogel composites. Advanced Materials. 2004;16(13):1074–1079.

[279] Bencherif SA, Washburn NR, Matyjaszewski K. Synthesis by AGET ATRP ofdegradable nanogel precursors for in situ formation of nanostructured hyaluronicacid hydrogel. Biomacromolecules. 2009;10(9):2499–2507.

[280] Yang Z, Ding J. A thermosensitive and biodegradable physical gel with chemicallycrosslinked nanogels as the building block. Macromolecular Rapid Communica-tions. 2008;29(9):751–756.

[281] Klajn R, Bishop KJM, Grzybowski BA. Light-controlled self-assembly of reversibleand irreversible nanoparticle suprastructures. Proceedings of the National Academyof Sciences. 2007;104(25):10305–9.

[282] Guthrie R. The" dialdehydes" from the periodate oxidation of carbohydrates.Advances in Carbohydrate Chemistry. 1961;16:105–158.

[283] Novikova E, Tishchenko E, Iozep A, Passet B. Influence of Synthesis and IsolationConditions on Properties of Dextran Polyaldehyde. Russian Journal of AppliedChemistry. 2002;75(6):985–988.

[284] Aalmo KM, Grasdalen H, Painter T, Krane J. Characterization by 1H- and 13C-NMR spectroscopy of the products from oxidation of methyl alfa-and beta-D-galactopyranoside with periodic acid in dimethyl sulfoxide. Carbohydrate Research.1981;91(1):1–11.

[285] Basedow A, Ebert K, Ederer H. Kinetic Studies on the Acid Hydrolysis of Dextran.Macromolecules. 1978;11(4):774–781.

[286] Ioan C, Aberle T, Burchard W. Structure properties of dextran. 2. Dilute solution.Macromolecules. 2000;33(15):5730–5739.

[287] Xu X, Li H, Zhang Z, Qi X. Hydrodynamic properties of aqueous dextran solutions.Journal of Applied Polymer Science. 2009;111(3):1523–1529.

[288] Jones D. Dynamic mechanical analysis of polymeric systems of pharmaceutical andbiomedical significance. International Journal of Pharmaceutics. 1999;179(2):167–178.

[289] Scandola M, Ceccorulli G, Pizzoli M. Molecular motions of polysaccharides inthe solid state: dextran, pullulan and amylose. International Journal of BiologicalMacromolecules. 1991;13(4):254–260.

174

Bibliography

[290] Coelho JFJ, Carreira M, Goncalves PMOF, Popov AV, Gil MH. Processability andcharacterization of poly(vinyl chloride)-b-poly(n-butyl acrylate)-b-poly(vinyl chlo-ride) prepared by living radical polymerization of vinyl chloride. Comparison witha flexible commercial resin formulation prepared with PVC and dioctyl phthalate.Journal of Vinyl and Additive Technology. 2006;12(4):156–165.

[291] Icoz D, Moraru C, Kokini J. Polymer-polymer interactions in dextran systemsusing thermal analysis. Carbohydrate Polymers. 2005;62(2):120–129.

[292] Izutsu K, Heller M, Randolph T, Carpenter J. Effect of salts and sug-ars on phase separation of polyvinylpyrrolidone-dextran solutions induced byfreeze-concentration. Journal of the Chemical Society, Faraday Transactions.1998;94(3):411–417.

[293] Randolph T. Phase separation of excipients during lyophilization: Effects on pro-tein stability. Journal of Pharmaceutical Sciences. 1997;86(11):1198–1203.

[294] Katsikas L, Jeremic K, Jovanovic S, Velickovic J, Popovic I. The thermal degrada-tion kinetics of dextran and pullulan. Journal of Thermal Analysis and Calorimetry.1993;40(2):511–517.

[295] Hussain MA, Shahwar D, Tahir MN, Sher M, Hassan MN, Afzal Z. An efficientacetylation of dextran using in situ activated acetic anhydride with iodine. Journalof the Serbian Society of Chemistry. 2010;75(2):165–173.

[296] Amo EMD, Urtti A. Current and future ophthalmic drug delivery systems. A shiftto the posterior segment. Drug Discovery Today. 2008;13(3-4):135–43.

[297] Schachar RA, Chen W, Woo BK, Pierscionek BK, Zhang X, Ma L. Diffusion ofnanoparticles into the capsule and cortex of a crystalline lens. Nanotechnology.2008;19(2):025102.

[298] Urtti A. Challenges and obstacles of ocular pharmacokinetics and drug delivery.Advanced Drug Delivery Reviews. 2006;58(11):1131–5.

[299] Bourlais CL, Acar L, Zia H, Sado PA, Needham T, Leverge R. Ophthalmicdrug delivery systems–recent advances. Progress in Retinal and Eye Research.1998;17(1):33–58.

[300] Hoffman AS. Hydrogels for biomedical applications. Advanced Drug DeliveryReviews. 2002;54(1):3–12.

175

Bibliography

[301] Jia X, Burdick J, Kobler J, Clifton R, Rosowski J, Zeitels S, et al. Synthesis andcharacterization of in situ cross-linkable hyaluronic acid-based hydrogels with po-tential application for vocal fold regeneration. Macromolecules. 2004;37(9):3239–3248.

[302] Natu MV, Sardinha JP, Correia IJ, Gil MH. Controlled release gelatin hydrogelsand lyophilisates with potential application as ocular inserts. Biomedical Materials.2007;2(4):241–249.

[303] MacCallum DK, Lillie JH, Scaletta LJ, Occhino JC, Frederick WG, LedbetterSR. Bovine corneal endothelium in vitro. Elaboration and organization and of abasement membrane. Experimental Cell Research. 1982;139(1):1–13.

[304] Vervoort L, Vinckier I, Moldenaers P, den Mooter GV, Augustijns P, Kinget R.Inulin hydrogels as carriers for colonic drug targeting. Rheological characterizationof the hydrogel formation and the hydrogel network. Journal of PhamaceuticalSciences. 1999;88(2):209–14.

[305] Lee K, Bouhadir K, Mooney DJ. Degradation behavior of covalently cross-linkedpoly(aldehyde guluronate) hydrogels. Macromolecules. 2000;33(1):97–101.

[306] Chirile T, Hong Y. Handbook of Biomaterials Properties. Black J, Hastings GW,editors. London: Chapman and Hall; 1998. The vitreous humor.

[307] Grabner G, Boltz G, Forster O. Macrophage-like properties of human hyalocytes.Investigative Ophthalmology and Visual Science. 1980;19(4):333–340.

[308] Ambati J, Canakis CS, Miller J, Gragoudas E, Edwards A, Weissgold D, et al.Diffusion of high molecular weight compounds through sclera. InvestigativeOphthalmology and Visual Science. Investigative Ophthalmology and VisualScience;41(5):1181–1185.

[309] Rando R, Orr G, Bangerter F. Throshold effects on the concanavalin-A-mediated agglutination of modified erythrocytes. Journal of Biological Chemistry.1979;254(17):8318–8323.

[310] Chen YM, Shiraishi N, Satokawa H, Kakugo A, Narita T, Gong JP, et al. Culti-vation of endothelial cells on adhesive protein-free synthetic polymer gels. Bioma-terials. 2005;26(22):4588–4596.

[311] Schneider GB, English A, Abraham M, Zaharias R, Stanford C, Keller J. The effectof hydrogel charge density on cell attachment. Biomaterials. 2004;25(15):3023–8.

176

Bibliography

[312] Oh JK, Drumright R, Siegwart DJ, Matyjaszewski K. The development of mi-crogels/nanogels for drug delivery applications. Progress in Polymer Science.2008;33(4):448–477.

[313] Langenhan J, Thorson J. Recent carbohydrate-based chemoselective ligation ap-plications. Current Organic Synthesis. 2005;2(1):59–81.

[314] van de Weert M, Hoechstetter J, Hennink WE, Crommelin DJ. The effect of awater/organic solvent interface on the structural stability of lysozyme. Journal ofControlled Release. 2000;68(3):351–9.

[315] Sah H. Protein behavior at the water/methylene chloride interface. Journal ofPhamaceutical Sciences. 1999;88(12):1320–1325.

[316] Zhang X, Chu C. A responsive poly(N-isopropylacrylamide)/poly(ethylene glycol)diacrylate hydrogel microsphere. Colloid and Polymer Science. 2004;282(12):1415–1420.

[317] Franssen O, Hennink WE. A novel preparation method for polymeric microparti-cles without the use of organic solvents. International Journal of Pharmaceutics.1998;168:1–7.

[318] Stenekes RJ, Franssen O, van Bommel EM, Crommelin DJ, Hennink WE. Thepreparation of dextran microspheres in an all-aqueous system: effect of theformulation parameters on particle characteristics. Pharmaceutical Research.1998;15(4):557–61.

[319] Stenekes RJ, Franssen O, van Bommel EM, Crommelin DJ, Hennink WE. Theuse of aqueous PEG/dextran phase separation for the preparation of dextran mi-crospheres. International Journal of Pharmaceutics. 1999;183(1):29–32.

[320] Henry TD, Rocha-Singh K, Isner JM, Kereiakes DJ, Giordano FJ, Simons M,et al. Intracoronary administration of recombinant human vascular endothelialgrowth factor to patients with coronary artery disease. American Heart Journal.2001;142(5):872–80.

[321] Chen RR, Silva EA, Yuen WW, Brock AA, Fischbach C, Lin AS, et al. Inte-grated approach to designing growth factor delivery systems. FASEB Journal.2007;21(14):3896–3903.

[322] Kraehenbuehl TP, Ferreira LS, Zammaretti P, Hubbell J, Langer R. Cell-responsivehydrogel for encapsulation of vascular cells. Biomaterials. 2009;30(26):4318–4324.

177

Bibliography

[323] Livak K, Schmittgen T. Analysis of relative gene expression data using real-timequantitative PCR and the 2(deltaCt) method. Methods. 2001;25(4):402–408.

[324] Jentoft N, Dearborn DG. Labeling of proteins by reductive methylation usingsodium cyanoborohydride. Journal of Biological Chemistry. 1979;254(11):4359–65.

[325] Muller YA, Christinger HW, Keyt BA, de Vos AM. The crystal structure of vascularendothelial growth factor (VEGF) refined to 1.93 A resolution: multiple copyflexibility and receptor binding. Structure. 1997;5(10):1325–38.

[326] Fairbrother WJ, Champe MA, Christinger HW, Keyt BA, Starovasnik MA. Solutionstructure of the heparin-binding domain of vascular endothelial growth factor.Structure. 1998;6(5):637–48.

[327] Brock TA, Dvorak HF, Senger DR. Tumor-secreted vascular permeability factorincreases cytosolic Ca2+ and von Willebrand factor release in human endothelialcells. American Journal of Pathology. 1991;138(1):213–221.

[328] Bates D, Harper S. Regulation of vascular permeability by vascular endothelialgrowth factors. Vascular Pharmacology. 2002;39(4-5):225–237.

[329] Dawson NS, Zawieja DC, Wu MH, Granger HJ. Signaling pathways mediatingVEGF165-induced calcium transients and membrane depolarization in human en-dothelial cells. FASEB Journal. 2006;20(7):991–3.

[330] Gupta K, Kshirsagar S, Li W, Gui L, Ramakrishnan S, Gupta P, et al. VEGFprevents apoptosis of human microvascular endothelial cells via opposing ef-fects on MAPK/ERK and SAPK/JNK signaling. Experimental Cell Research.1999;247(2):495–504.

[331] Pedram A, Razandi M, Levin ER. Extracellular signal-regulated protein kinase/Junkinase cross-talk underlies vascular endothelial cell growth factor-induced endothe-lial cell proliferation. Journal of Biological Chemistry. 1998;273(41):26722–8.

[332] Burbridge MF, Cogé F, Galizzi JP, Boutin JA, West DC, Tucker GC. The roleof the matrix metalloproteinases during in vitro vessel formation. Angiogenesis.2002;5(3):215–226.

[333] Selzman CH, Miller SA, Zimmerman MA, Gamboni-Robertson F, Harken AH,Banerjee A. Monocyte chemotactic protein-1 directly induces human vascularsmooth muscle proliferation. American Journal of Physiology, Heart and Circula-tory Physiology. 2002;283(4):1455–1461.

178

Bibliography

[334] Rollins B, Yoshimura T, Leonard E, Pober J. Cytokine-activated human endothelialcells synthesize and secrete a monocyte chemoattractant, MCP-1/JE. AmericanJournal of Pathology. 1990;136(6):1229–1233.

[335] Heydarkhan-Hagvall S, Helenius G, Johansson BR, Li JY, Mattsson E, Risberg B.Co-culture of endothelial cells and smooth muscle cells affects gene expression ofangiogenic factors. Journal of Cellular Biochemistry. 2003;89(6):1250–1259.

[336] Ferreira LS, Karp JM, Nobre L, Langer R. New opportunities: The use of Nan-otechnologies to manipulate and track stem cells. Cell Stem Cell. 2008;3(2):136–146.

[337] Hwang NS, Varghese S, Elisseeff J. Controlled differentiation of stem cells. Ad-vanced Drug Delivery Reviews. 2008;60(2):199–214.

[338] Sachlos E, Auguste DT. Embryoid body morphology influences diffusive transportof inductive biochemicals: a strategy for stem cell differentiation. Biomaterials.2008;29(34):4471–80.

[339] Kim M, Habiba A, Doherty JM, Mills JC, Mercer RW, Huettner JE. Regulationof mouse embryonic stem cell neural differentiation by retinoic acid. DevelopmentBiology. 2009;328(2):456–71.

[340] Castro GA, Oréfice RL, Vilela JMC, Andrade MS, Ferreira LAM. Developmentof a new solid lipid nanoparticle formulation containing retinoic acid for topicaltreatment of acne. Journal of Microencapsulation. 2007;24(5):395–407.

[341] Akinc A, Thomas M, Klibanov AM, Langer R. Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis. Journal of GeneMedicine. 2005;7(5):657–663.

[342] Agasse F, Roger M, Coronas V. Neurogenic and intact or apoptotic non-neurogenicareas of adult brain release diffusible molecules that differentially modulate the de-velopment of subventricular zone cell cultures. European Journal of Neurosciences.2004;19(6):1459–1468.

[343] Agasse F, Bernardino L, Silva B, Ferreira R, Grade S, Malva JO. Response tohistamine allows the functional identification of neuronal progenitors, neurons,astrocytes, and immature cells in subventricular zone cell cultures. RejuvenationResearch. 2008;11(1):187–200.

[344] Pinheiro PS, Rodrigues RJ, Rebola N, Xapelli S, Oliveira CR, Malva JO. Presy-

179

Bibliography

naptic kainate receptors are localized close to release sites in rat hippocampalsynapses. Neurochemistry International. 2005;47(5):309–16.

[345] Kramer M, Stumbe J, Turk H, Krause S, Komp A, Delineau L, et al. pH-responsivemolecular nanocarriers based on dendritic core-shell architectures. AngewandteChemie Int Edit. 2002;41(22):4252–4256.

[346] Choi Y, Kim SY, Kim SH, Lee KS, Kim C, Byun Y. Long-term delivery of all-trans-retinoic acid using biodegradable PLLA/PEG-PLLA blended microspheres.International Journal of Pharmaceutics. 2001;215(1-2):67–81.

[347] Lois C, Alvarez-Buylla A. Proliferating subventricular zone cells in the adult mam-malian forebrain can differentiate into neurons and glia. Proceedings of the Na-tional Academy of Sciences. 1993;90(5):2074–7.

[348] Zhao C, Deng W, Gage FH. Mechanisms and functional implications of adultneurogenesis. Cell. 2008;132(4):645–60.

[349] Lledo PM, Alonso M, Grubb MS. Adult neurogenesis and functional plasticity inneuronal circuits. Nature Reviews Neurosciences. 2006;7(3):179–93.

[350] Abdallah B, Hassan A, Benoist C, Goula D, Behr JP, Demeneix BA. A pow-erful nonviral vector for in vivo gene transfer into the adult mammalian brain:polyethylenimine. Human Gene Therapy. 1996;7(16):1947–1954.

[351] Goula D, Remy JS, Erbacher P, Wasowicz M, Levi G, Abdallah B, et al. Size,diffusibility and transfection performance of linear PEI/DNA complexes in themouse central nervous system. Gene Therapy. 1998;5(5):712–7.

[352] Lemkine GF, Mantero S, Migné C, Raji A, Goula D, Normandie P, et al. Preferen-tial transfection of adult mouse neural stem cells and their immediate progeny invivo with polyethylenimine. Molecular and Cellular Neuroscience. 2002;19(2):165–74.

[353] Reynolds BA, Weiss S. Generation of neurons and astrocytes from isolated cells ofthe adult mammalian central nervous system. Science. 1992;255(5052):1707–10.

[354] Levison SW, Goldman JE. Multipotential and lineage restricted precursors coexistin the mammalian perinatal subventricular zone. Journal of Neuroscience Research.1997;48(2):83–94.

[355] Gage FH. Mammalian neural stem cells. Science. 2000;287(5457):1433–8.

180

Bibliography

[356] Goetz AK, Scheffler B, Chen HX, Wang S, Suslov O, Xiang H, et al. Temporallyrestricted substrate interactions direct fate and specification of neural precursorsderived from embryonic stem cells. Proceedings of the National Academy of Sci-ences. 2006;103(29):11063–8.

[357] Agasse F, Bernardino L, Kristiansen H, Christiansen SH, Ferreira R, Silva B, et al.Neuropeptide Y promotes neurogenesis in murine subventricular zone. Stem Cells.2008;26(6):1636–1645.

[358] Kim KK, Adelstein RS, Kawamoto S. Identification of neuronal nuclei (NeuN)as Fox-3, a new member of the Fox-1 gene family of splicing factors. Journal ofBiological Chemistry. 2009;284(45):31052–61.

[359] Wohl CA, Weiss S. Retinoic acid enhances neuronal proliferation and astroglialdifferentiation in cultures of CNS stem cell-derived precursors. Journal of Neuro-biology. 1998;37(2):281–90.

[360] Takahashi J, Palmer TD, Gage FH. Retinoic acid and neurotrophins collaborateto regulate neurogenesis in adult-derived neural stem cell cultures. Journal ofNeurobiology. 1999;38(1):65–81.

[361] Wang TW, Zhang H, Parent JM. Retinoic acid regulates postnatal neuroge-nesis in the murine subventricular zone-olfactory bulb pathway. Development.2005;132(12):2721–32.

[362] Maden M. Retinoic acid in the development, regeneration and maintenance of thenervous system. Nature Reviews Neurosciences. 2007;8(10):755–65.

[363] Lu J, Tan L, Li P, Gao H, Fang B, Ye S, et al. All-trans retinoic acid promotesneural lineage entry by pluripotent embryonic stem cells via multiple pathways.BMC Cell Biology. 2009;10:57.

[364] Etchamendy N, Enderlin V, Marighetto A, Vouimba RM, Pallet V, Jaffard R,et al. Alleviation of a selective age-related relational memory deficit in mice bypharmacologically induced normalization of brain retinoid signaling. Journal ofNeurosciences. 2001;21(16):6423–9.

[365] Crandall J, Sakai Y, Zhang J, Koul O, Mineur Y, Crusio WE, et al. 13-cis-retinoicacid suppresses hippocampal cell division and hippocampal-dependent learning inmice. Proceedings of the National Academy of Sciences. 2004;101(14):5111–6.

[366] Pla AF, Maric D, Brazer SC, Giacobini P, Liu X, Chang YH, et al. Canonical tran-sient receptor potential 1 plays a role in basic fibroblast growth factor (bFGF)/FGF

181

Bibliography

receptor-1-induced Ca2+ entry and embryonic rat neural stem cell proliferation.Journal of Neurosciences. 2005;25(10):2687–2701.

[367] Platel JC, Dave KA, Gordon V, Lacar B, Rubio ME, Bordey A. NMDA receptorsactivated by subventricular zone astrocytic glutamate are critical for neuroblastsurvival prior to entering a synaptic network. Neuron. 2010;65(6):859–872.

[368] Danielyan L, Schäfer R, von Ameln-Mayerhofer A, Buadze M, Geisler J, KlopferT, et al. Intranasal delivery of cells to the brain. European Journal of Cell Biology.2009;88(6):315–324.

[369] Roy I, Stachowiak MK, Bergey EJ. Nonviral gene transfection nanoparticles: func-tion and applications in the brain. Nanomedicine: Nanotechnology, Biology, andMedicine. 2008;4(2):89–97.

182

Thesis April 2011 Lyx

Documents

Transcript of Thesis April 2011 Lyx