The Role of the Actin Cytoskeleton in Asymmetric Cell ...

APPROVED:

Amanda J. Wright, Major Professor Robert Benjamin, Committee Member Stevens Brumbley, Committee Member Art Goven, Chair of the Department of

Biological Sciences Mark Wardell, Dean of the Toulouse Graduate

School

THE ROLE OF THE ACTIN CYTOSKELETON IN ASYMMETRIC CELL DIVISION IN MAIZE

Hassan Hamdan Alhassan

Thesis Prepared for the Degree of

MASTER OF SCIENCE

UNIVERSITY OF NORTH TEXAS

August 2014

Alhassan, Hassan Hamdan. The Role of the Actin Cytoskeleton in Asymmetric Cell Division

in Maize. Master of Science (Biochemistry and Molecular Biology), August 2014, 39 pp., 6

tables, 12 figures, references, 29 titles.

Stomata are specialized plant structures required for gaseous exchange with the outer

environment. During stomata formation, the cytoskeleton plays an important role in controlling

the division of the individual cells leading to the generation of the stomata complex. Two

mutants that affect microfilament and microtubule organization in subsidiary mother cells

include brk1 and dcd1. While only 20% of the subsidiary cells in the brk1 and dcd1 single

mutants are abnormally shaped, it was reported that there is a synergistic effect between the

brk1 and dcd1 mutations in the brk1; dcd1 double mutant since 100% of the subsidiary cells are

abnormal. The focus of this research is to try to understand this synergistic effect by

investigating the actin cytoskeleton and nuclear position in the single and double mutants.

The reported results include the observation that the size of actin patch was largest in

the wild-type subsidiary mother cells (SMCs) and smallest in dcd1 and brk1; dcd1 SMCs and that

brk1 and brk1; dcd1 double mutants had fewer actin patches than wild-type and dcd1 SMCs.

Additionally, we observed that some SMCs that did not have actin patches still underwent

nuclear migration suggesting that nuclear migration may not be solely dependent on actin

patch formation. Finally, during SMC cytokinesis, a large percentage of double mutant (brk1;

dcd1) cells showed an off-track development of the phragmoplast as compared to the single

mutants and the wild-type plant explaining the large number of abnormally shaped subsidiary

cells in the double mutants.

ii

Copyright 2014

By

Hassan Hamdan Alhassan

iii

ACKNOWLEDGMENTS

First of all I would like to acknowledge and thank Dr. Wright for all her support both

mentally and technically. You have truly been an inspiration to me for the hard work and

dedication you taught me. I would also like to extend a special thanks to Dr. Lon for all the help

he gave me working on the confocal microscope. I would never have been able to do the work I

have done without his help and mentorship. I would like also to thank my committee members.

Above all, I would like to thank my wife and daughter for the support and inspiration

that I draw from them. I have done all this work for them. I would like to also thank my parents

for their patience and inspiration. Without their encouragement I would not been able to pull

through all the hours that I have put in in order to complete this work on time.

I would also like to give my special thanks to all my friends and family for all the

encouragement that I got and for the help they provided. One truly can’t go on in this life

without people to relay on, so special thanks to everyone who has crossed my path during my

studies and affected me in a way or another.

iv

TABLE OF CONTENTS

Page

ACKNOWLEDGMENTS ..................................................................................................................... iii LIST OF TABLES ................................................................................................................................. v LIST OF FIGURES .............................................................................................................................. vi CHAPTER 1 INTRODUCTION ............................................................................................................ 1

1.1 Cell Cycle and Emergence of Cytoskeletal Elements .............................................. 2

1.2 Stomata Development in Maize ............................................................................. 3

1.3 Goal of the Project .................................................................................................. 8 CHAPTER 2 MATERIALS AND METHODS ....................................................................................... 10

2.1 Growth and Identification of the Mutants ........................................................... 10

2.2 DNA Extraction for Use in Genotyping ................................................................. 11

2.3 PCR Setup: Genotyping Using dcd1 Primers ......................................................... 12

2.4 Whole Mount Actin Staining in Developing Maize Leaves ................................... 13

2.5 Confocal Microscopy Image Processing and Analysis .......................................... 13 CHAPTER 3 RESULTS ...................................................................................................................... 15

3.1 Identification of brk1; dcd1 (Double) Mutants ..................................................... 15

3.2 Analysis of Nuclear Position and Actin Organization in Subsidiary Mother Cells in Wild-Type, brk1, dcd1 and brk1; dcd1 Mutants ................................................... 15

3.3 Are Actin Patches Required for Nuclear Migration? ............................................ 27

3.4 Phragmoplast Orientation in SMCs ....................................................................... 31 CHAPTER 4 DISCUSSION ................................................................................................................ 33 REFERENCES .................................................................................................................................. 37

v

LIST OF TABLES

Page

Table 3.1. Percentage of subsidiary mother cells with a polarized nucleus in wild type, dcd1, brk1, and brk1; dcd1. SEM (standard error of the mean). n= number of the cells evaluated. .... 17

Table 3.2. Percentage of SMCs (all stages of mitosis) with an actin patch. ................................. 21

Table 3.3. Percentage genotypes showing presence of actin patch during metaphase, anaphase, and divided .................................................................................................................................... 23

Table 3.4. Average size of the actin patch for each genotype in relation to size of adjacent GMC. SEM (standard error of the mean). ............................................................................................... 26

Table 3.5. Percentage of preprophase SMCs with a polarized nucleus and an actin patch. SEM (standard error of the mean). n= number of the cells. ................................................................ 27

Table 3.6. Percentage of prophase SMCs with a polarized nucleus and an actin patch. SEM (standard error of the mean). n= number of the cells. ................................................................ 29

vi

LIST OF FIGURES

Page

Figure 1.1. Cell cycle phases and the timing of cytoskeletal structure formation within plant cells. ................................................................................................................................................ 2

Figure 1.2. Stages of stomata development. .................................................................................. 3

Figure 2.1. Confocal microscope (UNT source). ........................................................................... 14

Figure 3.1. Genotyping of plants using dcd1 markers. ................................................................. 16

Figure 3.2. Average percentage of subsidiary mother cells with a polarized nucleus ................. 18

Figure 3.3. Examples of polarized and unpolarized SMC nuclei ................................................... 19

Figure 3.4. Presence and absence of actin patches in different genotypes. ................................ 21

Figure 3.5. Percentage SMC with an actin patch in wild type, dcd1, brk1 and brk1; dcd1 plants........................................................................................................................................................ 23

Figure 3.6. Percentage of SMCs with an actin patch in wild-type, dcd1, brk1 and brk1; dcd1 plants at various stages of cell division cycle................................................................................ 25

Figure 3.7. Graphical representation of actin patch size in wild type, brk1, dcd1 and brk1; dcd1 mutants in relation to size of GMC. .............................................................................................. 26

Figure 3.8. Percentage of preprophase SMCs, with respect to the size of the adjacent GMC, with polarized nuclei and the percentage of the cells with polarized nuclei that have an actin patch........................................................................................................................................................ 29

Figure 3.9. Percentage of prophase SMCs, with respect to the size of the adjacent GMC, with polarized nuclei and the percentage of the cells with polarized nuclei that have an actin patch........................................................................................................................................................ 31

Figure 3.10. Phragmoplast orientation in wild-type, dcd1, brk1 and brk1; dcd1 SMCs. (A) arrow indicates wild type normal phragmoplast. ................................................................................... 32

1

CHAPTER 1

INTRODUCTION

Plants have stomata and other epidermal structures for protection and interaction with

the environment. Stomata have a special role in a plant's gaseous exchange with its

surroundings. They help in the maintenance of transpiration rates and temperature regulation

in plants. Abnormalities in stomata development can lead to obstruction of plant growth and

development (Galatis et al. 2004). In plants, stomata are formed through asymmetric cell

divisions where the daughter cells generated have different fates and/or sizes (Facette and

Smith. 2012). Other key asymmetric cell divisions critical to plant development include

asymmetric cell divisions during Arabidopsis embryogenesis and asymmetric cell divisions that

establish the layers of the root (Abrash and Bergmann. 2009).

The four major stages of the cell division cycle are G1, S, G2, and M phase (Figure 1.1).

G1 is a growth phase and is often the longest phase of the cell cycle. During S (synthesis) phase

the parental genome is copied via DNA replication. G2 phase is a checkpoint stage that the cell

does not precede through until it is confirmed that the genome was replicated in its entirety

and any DNA damage was repaired. In M (mitosis) phase, the spindle is formed and it separates

the sister chromatids (Taiz et al. 2006). M phase concludes with cytokinesis.

2

1.1 Cell Cycle and Emergence of Cytoskeletal Elements

Figure 1.1. Cell cycle phases and the timing of cytoskeletal structure formation within plant cells. During plant cell cytokinesis, cell wall placement is determined by the position of the

preprophase band (PPB) and the subsequent expansion of phragmoplast (Figures 1.1 and 1.2).

PPBs are cortical rings of parallel microtubules and actin microfilaments that circumscribe the

future plane of division in most somatic cells of the plant (Palevitz 1987, McCundy and Gunning

1990). They form at the end of G2 and exist throughout prophase. The PPB is thought to

modify the mother cell cortex to create a cortical division site that is later recognized by the

phragmoplast, which acts as the cytokinetic apparatus (Ambrose et al. 2008).

As mitosis progresses, the PPB breaks down and the mitotic spindle forms during

prometaphase. After anaphase the spindle is re-arranged to form the phragmoplast array,

which consists of 2 antiparallel groups of microtubules, oriented perpendicular to the cell

division plane (Ivakov et al. 2013). During phragmoplast expansion the phragmoplast grows

centrifugally towards mother cell wall and mediates the linkage of the new cell plate with the

mother cell cortex at the cortical division site. Actin filaments present in the phragmoplast

serve to guide vesicles containing precursors for cell wall material to the growing cell plate

formation site (Raven et al. 2005).

Cell Cycle phase

G1 S G2 M

Nuclear polarization, actin patch

DNA replication

PPBs Spindle & Phragmoplast

3

1.2 Stomata Development in Maize

Early phragmoplast

Late Phragmoplast

Actin patch

SMC

GMC

SMC

SC SC

GG

A

B

C

PPB Spindle

D

Figure 1.2. Stages of stomata development. A) After the GMC signals the adjoining SMC, an actin patch forms in the SMC and migration of SMCs nuclei towards the GMC is initiated. B) The preprophase band (PPB) and spindle form sequentially. C) As the phragmoplast expands, it tracks back to the cortical division site established by the PPB D) Breakdown of actin patch assembly and symmetric division of GMC to complete stomata formation. SC: subsidiary cell. GC: guard cell. SMC: subsidiary mother cell. GMC: guard mother cell.

4

Stomatal complexes in moncots consist of 4 cells; two guard cells that surround the

stomatal pore and two subsidiary cells the flank the guard cells. Development of the stomata is

a complex process associated with several intrinsic and extrinsic factors responsible for the

coordinated and controlled development of these specialized cells (Grannoutsou et al. 2011,

Facette and Smith 2012). Figure 1.2 depicts the development of stomata in maize and the

positioning of critical cytoskeletal elements throughout mitosis. Formation of the accessory

subsidiary cells begins with a signal originating from the guard mother cell (GMC) and perceived

by the subsidiary mother cell (SMC), in part due to the activity of two receptor-like kinases,

PAN1 and PAN2 (Cartwright et al. 2009; Humphries et al. 2011; Zhang et al. 2012;

Sutimantanapi et al. 2014). The first manifestation of the signal in the SMC is the formation of

an actin patch adjacent to the GMC. The formation of the actin patch is correlated with the

polarization and migration of the SMC nucleus towards the GMC. A preprophase band that

encircles the SMC forms adjacent to the GMC forecasting an asymmetric division. The PPB

establishes the cortical division site, a group of proteins that serves as a memory of the position

of the PPB. As the PPB breaks down, the mitotic spindle forms and separates the duplicated

chromosomes. In Fig 2C an early phragmoplast forms and as it expands, it tracks to the cortical

division site. The phragmoplast mediates the deposition of cell wall and membranes forming

the new cell plate that separates the daughter cells in to a smaller subsidiary cell and a much

larger, sister epidermal cell. The phragmoplast coordinates the fusion of the new cell plate with

the cortical division site of the mother cell. The stomatal complex is completed with the

symmetric division of the GMC to form two guard cells that flank the stomatal pore (Figure

1.2D).

5

F-actin patches similar to those observed in SMCs of grasses have also been found in

SMCs of other monocotyledons (Hussey et al. 2002). The cortical actin patches and endoplasmic

actin filaments are reported to have roles in nuclear migration and anchoring of nucleus to the

polarized cell site adjacent to the inducing GMCs (Humpheries et al. 2011). Considering this

information, preprophase organization of microtubule and actin filaments in SMCs in Zea mays

was studied, and it was found that the prophase nucleus is bound to microtubule monopolar

“half spindle” that forms uniting the structure with preprophase band (Panteris et al. 2006).

These observations suggest a critical role of F-actin and microtubules outside the obvious PPB,

spindle, and phragmoplast structures.

Mutant analysis has shed considerable light on understanding how microtubules and

actin filaments are regulated during mitosis and cytokinesis. In particular, several maize

mutants have been identified that disrupts the microfilament and microtubule assembly in

asymmetric cell division of the SMCs (Muller et al. 2009). One group of mutants are the

pangloss mutants. In these mutants, there are defects in actin patch formation and the SMC

nucleus fails to polarize leading to a symmetric division of the SMC. As discussed earlier, the

pangloss genes encode receptors needed to perceive the GMC signal (Cartwright et al. 2009;

Humphries et al. 2011; Zhang et al. 2012; Sutimantanapi et al. 2014).

Another group of maize mutants with defects in subsidiary cell formation are the

discordia mutants (Smith and Gallagher. 1999). The discordia1 (dcd1) and discordia (dcd2)

mutants have abnormally shaped subsidiary cells, which stem from a failure of the

phragmoplast to track to the cortical division site during cytokinesis. In the dcd1 and dcd2

6

mutants, 30% - 50% of SMC divisions are misoriented producing abnormal stomata complexes

(Frank et al. 2002).

While the molecular identity of the dcd2 mutant remains unknown, dcd1 and its

paralogue, alternative discordia1 (add1), are the maize homologs of the Arabidopsis fass

mutant. These genes all encode B'' regulatory subunits of the PP2A phosphatase (Camelleri et

al. 2002, Wright et al. 2009). B'' subunits are responsible for targeting the PP2A phosphatase

activity to a particular target and subcellular localization (Camelleri et al. 2002). Maize plants

deficient in both DCD1 and ADD1 have a severe phenotype characterized by a complete lack of

PPBs while plants lacking just DCD1 have disorganized PPBs in SMCs. This suggests that the SMC

phragmoplast guidance defects seen in the dcd1 mutant stem from a failure to establish the

cortical division site due to abnormal PPBs. The DCD1/ADD1 proteins accumulate at the PPBs

and cortical division site through metaphase stage (Wright et al. 2009).

Another group of mutants that affects SMC divisions in maize are the brick (brk) mutants

(brk1, brk2, and brk3). The brk mutants also have defects in the formation of lobes that are

characteristic of maize leaf epidermal cells (Frank et al. 2002). Of these brk1 is the best studied

and the only one that has been cloned. In expanding brk1 epidermal cells, mutant cells expand

to same length, but fail to establish the polar growth sites from which the lobes arise, thus the

cells have flat sides instead of lobed sides explaining the choice of the name "brick" for the

mutants. There is an absence of F-actin at the lobe site in brk1 mutants as compared to wild

type cells, indicating brk1 is needed for organized F-actin. In addition the epidermal pavement

cells defects, brk1 mutants have 20 – 40 % abnormal subsidiary cells (Gallagher and Smith.

7

2000). It was noted that the brk1 mutants have a decreased numbers of actin patches in

dividing SMCs (Gallagher and Smith. 2000).

These observations suggest that BRK1 promotes multiple actin dependent cell

polarization events in the developing leaf epidermis (Frank et al. 2003). A study revealed that

brk1, brk2, and brk3 act in common pathway by using a combination of double mutants and a

comparison of subsidiary cell development between the single and double mutants (Frank et al.

2003). The molecular identity of brk1 reveals it is highly conserved in animals and plants

suggesting conserved roles. The APR2/3 (Actin Related Protein) complex is responsible for

regulation of actin cytoskeleton. ARP2/3 nucleates new actin filaments thus indirectly

promoting cell morphogenesis. Efficient nucleation of actin requires activator genes such as

SCAR/WAVE and HSPC300. Maize BRK1 is the homolog of HSPC300 (Djakovic et al. 2006).

Double mutant analysis with other members of the ARP2/3 regulatory complex revealed that

BRK1 plays an essential role in ARP2/3 function and that they act in a common pathway

(Djakovic et al. 2006).

Based on the observation that SMCs in brk1 mutants occasionally lack PPBs (Gallagher

and Smith. 2000) and that the addition of drugs that inhibit actin polymerization enhances the

dcd1 phenotype (Gallagher and Smith. 1999), the dcd1; brk1 double mutant was created. While

the dcd1 single mutant has on average, 26% abnormal subsidiary cells and the brk1 mutant has

on average, 18% abnormal subsidiary cells, the dcd1; brk1 double mutant had 98% abnormal

subsidiary cells (Malhotra. 2014). This suggests that the brk1 and dcd1 mutations are synergistic

as opposed to additive. The microtubule cytoskeleton in dividing SMCs was compared between

wild-type, brk1, dcd1, and brk1; dcd1 plants in an effort to understand the dramatic increase in

8

the number of abnormally shaped subsidiary cells in the double mutant. Malhotra (2014) found

that nuclear migration was equivalent in all genotypes when considering SMCs next to

immature GMCs (Immature GMCs have with a width less than 6um and are less likely to have

signaled to the adjacent SMCs, while mature GMC have a width greater than 6 um and are

more likely to have signaled to the adjacent SMCs.) However in SMCs next to mature GMCs,

nuclear polarization was less likely to have occurred the brk1 and brk1; dcd1 mutants. When

examining PPB orientation and organization, PPBs were normally organized and orientated in

91% of wild-type SMCs, 37% of dcd1 SMCs, 64% of brk1 SMCs, and 7% of brk1; dcd1 double

mutants. Spindles were normally orientated in 100% of wild-type SMCs, 65% of dcd1 SMCs,

47% of brk1 SMCs, and 0% of brk1; dcd1 double mutants. Finally phragmoplasts were normally

oriented in 100% of wild-type SMCs, 65% of dcd1 SMCs, 75% of brk1 SMCs, and 18% brk1; dcd1

double mutants. In all cases, the double mutant had an increased level of defects relative to

the individual single mutants (Malhotra. 2014). Because brk1 directly affects the actin

cytoskeleton, it is important to examine the organization of the actin cytoskeleton in all 4

genotypes in addition to the microtubule cytoskeleton to gain a complete understanding of the

nature of the subsidiary mother cell division defects.

1.3 Goal of the Project

The cell wall of the plant cell is an important structure necessary for the maintenance

and establishment of plant cell shape and to withstand the external forces exerted on the plant

body through maintenance of turgor pressure inside the cell. An inability to alter cellular

position after cytokinesis is one consequence of having a cell wall; hence correct orientation of

9

the division plane is critical for the organization and development of different plant structures,

tissues, and organs. Research in this direction has focused on identifying different proteins

needed for division plane orientation and the localization of these proteins within cells. In the

research presented here, focus is centered on two cytoskeletal elements, actin filaments and

microtubules and their related roles in division plane orientation during asymmetric cell

divisions. This research uses stomata formation in Zea mays leaves, which are essential for

gaseous exchange with the environment through the stomata pore. This small opening is

surrounded by guard cells that govern its opening and closure via changes in internal

environment within these cell's protoplasm. In monocots, including maize, guard cells are

flanked by subsidiary cells that act to assist and protect the guard cells during gaseous

exchange as the process involves contraction and swelling of sensitive guard cells. Research in

this arena will provide us with more details on the organization of these different cytoskeletal

elements during formation of this specialized epidermal leaf structure. This research will enable

us to understand the regulation of microtubules and actin filament orientation during mitosis.

The outcome of this research will answer questions about how the timely placement of actin

and microtubule elements contributes to the division of stomatal complex cells. This could be

of great help in the refinement of experimental techniques in maize, a crop plant.

10

CHAPTER 2

MATERIALS AND METHODS

2.1 Growth and Identification of the Mutants

Around 60 seeds from the ears segregating the brk1-O, dcd1-O, and brk1-O; dcd1-O

double mutants were planted in rounded pots with 15 inches of Metro-mix 900 soil in the

EESAT greenhouse at University of North Texas. In each pot approximately one tablespoon of

Osmocote fertilizer was sprinkled onto the top soil layer in each pot. Seeds were spaced in soil

in four rows with the uppermost row containing two seeds, the middle rows containing four

seeds, and the bottom row containing two seeds with even spacing. Each seed was pressed 2

cm deep into the soil and pots were well-watered immediately after planting two times. Each

pot was monitored for water content and drenched every 5 days initially and later every two

days. Seeds germinated in 3-4 days. When the seedlings had 3-5 leaves, plants were numbered

and one leaf from each plant was detached for analysis. Detached leaf blades were then

analyzed for the presence and/or absence of phenotypes associated with the brk1, dcd1 or

brk1: dcd1 mutations by screening Loctite Cynoacrylate glue impressions of the leaf surface for

epidermal cell and subsidiary cell shape defects. To make the glue impressions, the three

stripes of glue were spread on a microscope glass slide and the detached leaf blade was pressed

against the glue surface on the slide. To make an even impression, the slide was turned upside

down and a light weight was applied by putting an empty glass bottle on each slide. After 3

minutes, the leaf was gently removed from the slide leaving an impression of the leaf surface.

The slides were then observed under a light microscope at 5X and 10 X objective powers to

study shape of the cells. For each set of experiments, 60 seeds were planted, glue impression

11

analysis was carried out and the plants were classified as wild type, dcd1, brk1 and brk1; dcd1.

Roughly 4 plants from each group were selected and grown until at least the 8th leaf was visible.

The phenotypic observations were partially confirmed by doing the genotyping analysis as

described in the next section.

2.2 DNA Extraction for Use in Genotyping

Genomic DNA was extracted from plants identified as wild type, dcd1, brk1 and brk1;

dcd1. For extraction of DNA, extraction buffer was prepared by combining 20 ml 0.5 M EDTA, 5

ml 4M NaCl, 20 ml 1M Tris, and 155 ml ultra-pure ddH2O. Prior to use, 0.7 µl of BME (Beta-

mercaptoethanol) was added per 1 ml of extraction buffer. Fresh leaf tips were ground in 500 µl

of extraction buffer in 1.5 ml eppendorf tube with a pestle until the tissue was completely

disrupted. 35 µl 20% SDS was added to each tube and inverted to mix, then the DNA extraction

was incubated at 65˚C for 10 minutes. 130 µl 5M Potassium acetate was added, the tube was

incubated on ice for 5 minutes, then centrifuged at 13000 rpm for 10 minutes. After

centrifugation, the clear supernatant was transferred to a clean Eppendorf tube. To this tube

was added an equal amount of ice-cold isopropanol and 1/10 volume of 3M sodium acetate.

Tubes were incubated for overnight at -20˚C. To form pellets of precipitated DNA, the tubes

were centrifuged at 13000 rpm for 10 minutes. The supernatant was discarded and pellet was

washed with 1 ml 70% ethanol by centrifuging the tube at 13000 rpm for 5 minutes. All traces

of ethanol were removed by evaporation and the DNA pellet was re-suspended in 50-100 µl of

RNAse solution (10 ng/µl) and kept overnight at 4˚C to ensure the DNA had gone into solution.

12

Finally the tube containing the DNA solution was incubated at 37˚C for 30 minutes to allow the

RNAse to degrade the RNA. The DNA was then stored at -20˚C for future use.

2.3 PCR Setup: Genotyping Using dcd1 Primers

DNA extracted from the mutants was used for genotyping for the presence of the dcd1-

O mutation. The dCAPfor (GTGGTGACCTGGAGAATATCG) and dCAPrev2

(ATTAACAATAATTCCAGCTGGGATA) primers were used for amplification. Each reaction

contained 2 µl 2.5 mM dNTPs, 2 µl 10X Thermal Pol buffer (New England Biolabs), 1 µl DMSO,

0.1 µl Taq Polymerase (New England Biolobs), 1.25 µl 100 ng/µl dCAP for/rev2 primers, 12.65 µl

ddH₂O, and 1 µl of DNA. PCR amplification conditions included an initial DNA denaturation step

at 94˚C for 2 minutes. The following steps were repeated 35 times: 94˚C for 1 minute, 56˚C for

1 minute, and elongation at 68˚ C for 1 minute 30 seconds. The reaction concluded with

extension at 68˚C for 10 minutes and a hold at 10˚C. The PCR products were digested and run

on 12% polyacrylamide gels. For each digest, 0.4 µl EcoRV HF (New England Biolabs), 2 µl of NEB

buffer #4, and 7.6 µl of ddH2O were combined with 10 µl of PCR product and the reactions

were incubated for 2-3 hours at 37˚C. Meanwhile, a 12% acrylamide gel was prepared by using

6 ml acrylamide (dilution 29:1) , 3 ml 5X TBE buffer, 100 µl 10% APS (freshly prepared) and 10 µl

TEMED. 4 µl of loading dye was added to each restriction digest product and a total of 24 µl of

sample was loaded into each well and analyzed using 1 Kb plus ladder (Life Technologies). The

products were electrophoresed on the gel for 2-3 hours at 100 Volts in 1XTAE. The DNA

fragments were visualized by staining the gel in 1:10000 dilution of Syber Safe (Life

13

Technologies) for 30-45 minutes. The gel was observed and photographed under blue light

using a Cannon Photoshop digital camera.

2.4 Whole Mount Actin Staining in Developing Maize Leaves

Actin was visualized with phalloidin-AlexaFluor 488 (Life Technologies) and DNA was

visualized with propidium iodide. The staining procedure was performed on plants with adult

leaves visible (leaf 8 or older) and the plants were sacrificed for the procedure. Immature leaf

blades (the basal 3 cm of each developing leaf) were cut into 1 cm strips and fixed in 2ml 2X

PME, 40 µl 30 mM MBS, 40 µl DMSO, and 1.88 ml water for 30 minutes. 2X PME was prepared

by dissolving 15.11 g PIPES, 1.9 g EGTA and 0.49 g MgSO4 in 500 ml ddH2O and adjusting the pH

to 6.8. Next the leaves were incubated in 1 ml 16% formaldehyde, 2ml 2X PME, 40 µl 10%

Triton-X, and 960 µl water for 1 hour. After fixing, the leaf strips were washed in 1X PME with

0.5% Triton-X. The leaves were extracted in a solution of 5% DMSO and 1% Triton-X for 10

minutes. The phalloidin was prepared by evaporating off the storage methanol then

resuspending it in the same amount of 1X PME. Prepared phalloidin was diluted 1:10 in 1X PME

and leaf strips were incubated in this solution for 1 hour at 37˚C. After incubation, the leaf

strips were washed in 1x PME with 0.5% Triton-X for 10 minutes. To visualize DNA, the leaf

stripes were incubated for 10 minutes in 10 µg/ml propodium iodide then washed with 1X PME

with 0.5% Triton-X.

2.5 Confocal Microscopy Image Processing and Analysis

Confocal microscopy was carried out under the supervision of Dr. Lon Turnbull at the

14

UNT microscopy facility. The machine used was a Zeiss LSM710. The argon 488 nm laser was

used to excite the phalloidin 488 and propidium iodide. Z stacks of dividing subsidiary cells were

captured and analyzed using the Zeiss Zen computer software platform. Image processing was

accomplished using Image J software.

Figure 2.1. Confocal microscope (UNT source).

15

CHAPTER 3

RESULTS

3.1 Identification of brk1; dcd1 (Double) Mutants

Maize ears segregating the brk1 and dcd1 alleles were generated by crossing brk1-O and

dcd1-O homozygotes and then selfing the resulting F1 heterozygotes. brk1 encodes a protein

required for ARP2/3 to function and aids in the organization of the actin cytoskeleton. dcd1 is

responsible for normal PPB formation and organization of the interphase microtubule

cytoskeleton. The individual and double mutants were examined via a combination of

phenotypic and genotypic approaches. Glue impressions of the epidermal leaf surface of each

plant were observed by light microscopy. Wild-type plants showed normal epidermal cell lobes

and normal subsidiary cells. dcd1 mutants had normal epidermal cell lobes, but the subsidiary

cells were abnormally shaped. brk1 and brk1; dcd1 double mutants had both abnormal

epidermal cell lobes and abnormally shaped subsidiary cells. After the phenotypic

observations, each plant was genotyped for the presence/absence of the dcd1-O allele. The

genotyping results distinguished between the brk1 single mutants and the brk1; dcd1 double

mutants and confirmed the identity of the dcd1 and wild-type plants (Figure 3.1).

3.2 Analysis of Nuclear Position and Actin Organization in Subsidiary Mother Cells in Wild-Type, brk1, dcd1 and brk1; dcd1 Mutants

The cause of abnormal subsidiary cell development in brk1; dcd1 mutant was studied by

observing the organization of actin microfilaments in SMCs (subsidiary mother cells) undergoing

cell division. Phallodian-488, a molecule fused to Alexflour 488 that binds actin filaments, was

used to visualize the actin microfilaments, and a nucleic acid stain, propodium iodide, was used

16

to observe the nuclear position of dividing SMCs as well as to assess the progress of the cell

through the cell cycle. Cells in the subsidiary mother cell division zone cells were observed and

the state of the cell cycle, position of the nucleus, presence/absence of actin patch, size of actin

patch, and size of the adjacent guard mother cell (GMC) were noted. Data was collected for

SMCs adjacent to GMCs having a width less than 6 µm and a width greater than 6 µm size.

Guard mother cells send a signal that results in the polarization of the nucleus in adjacent

SMCs. Current evidence suggests that mature GMCs (width > 6 µm) are more likely to be

competent to signal the adjoining SMCs that immature GMCs (width < 6 µm; Humphries et al

2009). For each genotype, dividing cells in 4 plants were evaluated and the standard error of

mean (SEM) was calculated for the average of each measurement across the 4 plants.

Figure 3.1. Genotyping of plants using dcd1 markers. The red areas on the gel are marked with genotype of the plants. DNA from wild type, brk1, dcd1 and brk1; dcd1 was amplified using

1 KB ladder

230bp

200bp

dcd

1 WT Het

17

specific primers and digested with Eco RV HF. The 1 kb ladder was used to size the products of the restriction digest on the acrylamide gel. The 230 bp and 200 bp bands corresponds to the wild-type and dcd1 alleles. The het box on the gel indicates a heterozygote since the wild-type and dcd1 mutant bands are both present.

3.2.1 Nuclear Migration

The first step in the asymmetric cell division of a SMC is the polarization of its nucleus

towards the adjacent GMC. The migration of the nucleus occurs when an extrinsic signal is

received from the adjacent GMC (Stebbins and Shah, 1960). Table 3.1 and Figure 3.2 show the

percentage of polarized SMC nuclei in relation to the width of the guard mother cells (GMCs)

for SMCs in preprophase and prophase for each genotype. Examples of polarized and

unpolarized nuclei are shown in Figure 3.3. A polarized nucleus is defined as a SMC nucleus

touching the SMC cell wall directly opposed to the nearby GMC; all other positions were

considered non-polarized. The results suggest equivalent levels of nuclear migration across all

genotypes.

Table 3.1. Percentage of subsidiary mother cells with a polarized nucleus in wild type, dcd1, brk1, and brk1; dcd1. SEM (standard error of the mean). n= number of the cells evaluated.

Plant number and GMC Width

(µm)

% of wild-type SMC nuclei Polarized

% of dcd1 SMC nuclei Polarized

% of brk1 SMC nuclei polarized

% of brk1; dcd1 SMC nuclei Polarized

Plant 1 GMC < 6 µm 25.74 (n=43) 50 (n=33) 50 (n=15) 26.47 (n=27)

Plant 2 GMC < 6 µm 52.02 (n=77) 30.76 (n=4) 46.15 (n=6) 29.26 (n=12)

Plant 3 GMC < 6 µm 9.09 (n=2) 84.61 (n=33) 18.18 (n=2) 30 (n=9)

Plant 4 GMC < 6 µm 43.24 (n=48) 45.83 (n=11) 51.19 (n=43) 56.3 (n=32)

Mean 32.5 52.8 41.4 35.5 SEM 8.254 9.855 6.762 6.038

Plant 1 31.57 (n=203) 47.66 (n=92) 44.357 (n=114) 33.164 (n=131)

18

GMC ˃ 6 µm Plant 2

GMC ˃6 µm 78.57 (n=99) 67.53 (n=52) 68.62 (n=70) 31.37 (n=16)

Plant 3 GMC ˃ 6 µm 25 (n=44) 83.7 (n=113) 46.57 (n=34) 50.87 (n=29)

Plant 4 GMC ˃ 6 µm 63.56 (n=82) 40.93 (n=61) 52.7 (n=39) 55.1 (n=153)

Mean 49.7 60.0 53.1 42.6

SEM 1.11 8.4 4.7 5.2

Figure 3.2. Average percentage of subsidiary mother cells with a polarized nucleus. A) Average percentage of SMC nuclei polarized in relation to the size of the adjacent GMCs with a width less than 6 µm. B) Average percentage of SMC nuclei polarized in relation to the size of the

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

wild type dcd1 brk1 brk1; dcd1

Average percentage of polarized SMC nuclei associated with a GMC < 6 µm

A

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

wild type dcd1 brk1 brk1; dcd1

Average percentage of polarized SMC nuclei associated with a GMC > 6 µm

B

19

adjacent GMC with a width greater than 6 µm. Error bars represent the SEM (standard error of the mean).

Figure 3.3. Examples of polarized and unpolarized SMC nuclei. Actin patch (green) and DNA (red) shown in (A) wild type, (B) dcd1, (C) brk1 and (D) brk1; dcd1 (double mutant) SMCs. Arrows indicate polarized nuclei, diamond sign indicates GMCs, and the star indicates an un-polarized nucleus in a SMC.

Our data shows that the SMC nuclei polarized even in case of immature guard mother

cell (with a width less than 6 µm. In the case of mature GMCs nearly 50-60 % nuclei polarized

across all genotypes indicating strong extrinsic factor driving the migration of nuclei towards

B

C D

A

20

adjacent GMC. Figure 3.3 shows the images of polarized and unpolarized nuclei in wild-type,

dcd1, brk1 and brk1; dcd1 plants.

3.2.2 Actin Patch Formation in SMCs

The arrangement and organization of the actin patch is thought to influence nuclear

migration and aid in the anchoring of the spindle to help with the separation of genetic material

into daughter cells during cell division. Since the phragmoplast arises from the remnants of the

spindle, the position of the spindle also may contribute to the initial position of the

phragmoplast. Because of this and the known role of brk1 in organizing the actin cytoskeleton,

it is important to observe the presence/absence of the actin patch as well as the size of the

actin patch during asymmetric division of SMCs in each of the genotypes. Table 3.2 and Figure

3.5 show the percentage of cells in all stages of mitosis for each genotype with an actin patch,

while Figure 3.4 shows images of representative actin patches. There are a high percentage of

actin patches present in wild-type and dcd1 SMCs adjacent to mature and immature GMCs as

compared to SMCs in brk1 and brk1; dcd1 mutants. The difference is much more dramatic in

the SMCs adjacent to mature GMCs (width > 6 µm).

This analysis was continued by looking at the absence or presence of actin patch in

SMCs adjacent to mature GMCs (width greater than 6 µm) only during metaphase, anaphase

and after cytokinesis was complete. It is thought that the actin patch may contribute to

maintenance of the spindle position during anaphase and metaphase. This data is shown in

Table 3.3 and Figure 3.6 and it keeps with the trend observed before with wild type and dcd1

SMCs having the greatest percentage of cells with actin patches and brk1 and brk1; dcd1 SMCs

21

having significantly less. After cytokinesis, divided SMCs showed fewer actin patches indicating

a re-distribution of actin microfilaments or digestion of actin microfilament assembly into its

monomer form.

Figure 3.4. Presence and absence of actin patches in different genotypes. DNA is in red and actin is in green. A) wild type, B) dcd1, C) brk1 and D) brk1; dcd1 double mutant. Arrows point to actin patches, star indicates polarized nucleus and the diamond represents the GMC.

Table 3.2. Percentage of SMCs (all stages of mitosis) with an actin patch.


(µm) wild type dcd1 brk1 brk1; dcd1

Plant 1 GMC<6 (µm) 65.86 (n=110) 18.18 (n=12) 3.33 (n=1) 9.8 (n=1)

C

A B

D

22

Plant 2 GMC<6 (µm) 73.64 (n=109) 53.84 (n=7) 7.69 (n=1) 7.14 (n=1)

Plant 3 GMC<6 (µm) 22.72 (n=5) 51.12 (n=20) 7.1 (n=2)

Plant 4 GMC<6 (µm) 52.25 (n=58) 25 (n=6) 39.28 (n=33) 18.36 (n=9)

Mean 53.6 37.0 12.6 10.6 SEM 9.706006 7.830819 7.8228717 2.30596

Plant 1 GMC ˃6 (µm) 84.75 (n=545) 40.41 (n=78) 19.06 (n=49) 0.278 (n=1)

Plant 2 GMC ˃6 (µm) 72.22 (n=91) 81.81 (n=63) 15.68 (n=16) 3.92 (n=2)

Plant 3 GMC ˃6 (µm) 53.4 (n=94) 82.08 (n=110) 5.55 (n=4) 39.28 (n=22)

Plant 4 GMC ˃6 (µm) 72.86 (n=94) 57.71 (n=86) 51.35 (n=38) 40 (n=98)

Mean 70.8

65.5

22.9

20.9

SEM 4.488 7.017 9.706 7.526

0

10

20

30

40

50

60

70

wt dcd1 brk1 brk1; dcd1

Average percentage SMC with an actin patch that associated with a GMC < 6 µm

% SMC with an actin patch

A

23

Figure 3.5. Percentage SMC with an actin patch in wild type, dcd1, brk1 and brk1; dcd1 plants. A) Percentage SMCs with an actin patch adjacent to a GMC < 6 µm in width. B) Percentage SMCs with an actin patch adjacent to a GMC > 6 µm in width. Error bars represent SEM (standard error of the mean).

Table 3.3. Percentage genotypes showing presence of actin patch during metaphase, anaphase, and divided

Percentage of SMCs in metaphase with an actin patch Plant

number and GMC Width

(µm)

wild-type

% of SMCs with an

actin patch

dcd1 % of SMCs with an actin

patch

brk1 % of SMCs with an

actin patch

brk1; dcd1

% of SMCs with an

actin patch

plant 1 GMC ˃6

n=43 76 n=27 55 n=50 8 n=94 1

plant 2 GMC ˃6

n=1 100 n=9 66 n=27 81 n=7

plant 3 GMC ˃6

n=2 100 n=27 81 n=8 12 n=3 33

plant 4 GMC ˃6

n=9 66 n=30 36 n=37 32 n=68 35

Mean 85.5 59.5 33.25 17.25

SEM 7.462406

8.20442

14.51454

8.384323

Percentage of SMCs in anaphase with an actin patch


(µm)

wild-type

% of SMCs with an

actin patch


patch


actin patch

brk1; dcd1

% of SMCs with an

actin patch

plant 1 GMC ˃6 µm

n=65 90.7 n=26 26.9 n=48 22.9 n=29

0

10

20

30

40

50

60

70

80


Average percentage SMC with an actin patch that associated with a GMC > 6 µm

% SMC with an actin patch

B

24

plant 2 GMC ˃6 µm

n=2 100 n=12 75 n=20 20 n=2

plant 3 GMC ˃6 µm

n=2 100 n=37 81 n=16 12.5 n=15 40

plant 4 GMC ˃6 µm

n=2 100 n=18 44.4 n=28 60.7

Mean 97.67 56.8 13.85 25.17

SEM 2.013509

11.08109

4.425565

13.1086

Percentage of divided SMCs with an actin patch


(µm)

wild-type

% of SMCs with an

actin patch


patch


actin patch

brk1; dcd1

% of SMCs with an

actin patch

plant 1 GMC ˃6 µm

n=107 94.3 n=4 25 n=5 n=11

plant 2 GMC ˃6 µm

n=1 100 n=2 n=2

plant 3 GMC ˃6 µm

n=14 85.7 n=7 42.8 n=11 61

plant 4 GMC ˃6 µm

n=4 75 n=3 100 n=4 25

Mean 63.75 66.95 21.5

SEM 18.71786 16.82192

12.4925

0

20

40

60

80

100


Percentage of SMCs in metaphase with an actin patch withGMC ˃ 6µm

% of SMCs with an actin patch

A

25

Figure 3.6. Percentage of SMCs with an actin patch in wild-type, dcd1, brk1 and brk1; dcd1 plants at various stages of cell division cycle. A) Metaphase, B) Anaphase, C) Divided nuclei of daughter cells. Error bars represents SEM (standard error of the mean).

3.2.3 Actin Patch Size

The size of the actin patch in dividing SMCs in relation to the width of adjacent guard

mother cell was analyzed. It was observed that, in SMCs adjacent to GMC of size < 6 µm actin

patch size was largest in wild-type SMCs and then in the brk1 SMCs and was the smallest in the

dcd1 and dcd1; brk1 SMCs. In SMCs with adjacent GMC size > 6 µm (mature) the largest actin

patches were found in wild type and then in brk1 SMCs with the smallest identified the dcd1

and double mutants, as indicated in Table 3.4 and Figure 3.7. The actin patch approximately

020406080

100120


Percentage of SMCs in anaphase with an actin patch withGMC ˃ 6µm


B

0

20

40

60

80

100

wt dcd1 brk1; dcd1

Percentage of SMCs in dividing with an actin patch withGMC ˃ 6µm


C

26

doubled in size for all genotypes when comparing actin patch size in SMCs next to mature and

immature GMCs.

Table 3.4. Average size of the actin patch for each genotype in relation to size of adjacent GMC. SEM (standard error of the mean).

Figure 3.7. Graphical representation of actin patch size in wild type, brk1, dcd1 and brk1; dcd1 mutants in relation to size of GMC. Error bars represent the SEM (standard error of the mean).

0

0.5

1

1.5

2

2.5

3

3.5


Size of actin patchGMC < 6 µm

size of actin patch

0

1

2

3

4

5

6

7

wt dcd1 brk1 brk1;dcd1

Size of actin patch GMC > 6 µm

size of actin patch

Average size of actin patch Plant number

and GMC Width (µm)

wild type Size actin patch

(µm)

dcd1 Size actin patch

(µm)

brk1 Size actin patch

(µm)

brk1; dcd1 Size actin patch

(µm) plant 1 GMC < 6 µm 3.392 0.78 0.151 plant 2 GMC < 6 µm 3.4 0.085 2.61 0.38 plant 3 GMC < 6 µm 1.2 0.18 2.99 plant 4 GMC < 6 µm 2.9 0.75 1.33 2.61

Mean 2.723 0.253 1.927 0.785 SEM 0.451162 0.169547 0.451973 0.640371

plant 1 GMC ˃ 6 µm 5.58 0.018 2.69 1.165 plant 2 GMC ˃ 6 µm 5.002 0.10 5.52 0.90 plant 3 GMC ˃ 6 µm 8.18 2.75 5.10 0.399 plant 4 GMC ˃ 6 µm 5.09 2.76 3.85 4.21

Mean 5.963 1.407 4.29 1.66 SEM 0.649395 0.674158 0.554673 0.746448

27

3.3 Are Actin Patches Required for Nuclear Migration?

Since nuclei in some SMCs failed to migrate and actin patches failed to form in some

SMCs, it was examined to see if there was a direct correlation between the failure to undergo

nuclear migration and a failure to form an actin patch. For this analysis, preprophase (Table 3.5

and Figure 3.8) and prophase (Table 3.6 and Figure 3.9) SMCs adjacent to mature GMCs were

considered. For each genotype, the first column shows the percentage of cells that have

polarized nuclei and the second column shows the percentage of those polarized cells that have

an actin patch. It is clear that many cells are capable of polarizing without the assistance of an

actin patch. This data also suggests that actin patches do not form as a result of nuclear

polarization.

Table 3.5. Percentage of preprophase SMCs with a polarized nucleus and an actin patch. SEM (standard error of the mean). n= number of the cells.

Percentage of preprophase SMCs with a polarized nucleus and an actin patch Plant numb

er and

GMC Widt

h (µm)

wild type

% polarized SMC

% polarized SMC with actin patch

dcd1 % polarized SMC


brk1 % polarized SMC


brk1; dcd1

% polarized SMC


plant 1 GMC<6 µm

n= 116 25 68.9 n=59 44 18.6 n=17 47 n=82 29.2

plant 2 GMC<6 µm

n= 129 54.2 71.3 n=4 75 75 n=11 45.4 9.09 n=36 22.2 2.7

plant 3 GMC<6 µm

n=19 10.5 26.31 n=11 90.9 72.7 n=9 11.1 22.2 n=24 25

plant 4 GMC<6 µm

n=66 40.9 54.5 n=7 42.8 n=32 59.3 9.3 n=24 66.6 29.16

Mean 32.6

5 55.25 63.17 41.57 40.7 10.14 35.75 7.96

SEM 8.22 8.951 10.28 16.47 8.957 3.953 8.992 6.143

28

196 296 144 408 888 409 323 242 plant 1 GMC

˃6 µm

n=314

33.12 81.2 n=13

2 43.9 59 n=119 35.29 22.68 n=20

2 33.16

plant 2 GMC

˃6 µm

n=103 75.7 66 n=21 52.3 85.7 n=47 55.3 10.6 n=40 25

plant 3 GMC

˃6 µm

n=117 21.3 45.2 n=43 93 79 n=38 31.57 2.6 n=27 33.3 48.1

plant 4 GMC

˃6 µm n=72 65.2 68 n=45 28.8 46.6 n=6 83.3 16.6 n=12

6 62.6 37.3

Mean 48.8 65.1 54.5 67.57 51.36 13.12 38.5 21.35

SEM

11.1654

6

6.444183 11.88

471 7.796343 10.26

394 3.712519 7.152

861 10.84438

0

10

20

30

40

50

60

70

80


Percentage of preprophase SMCs with a polarized nucleus and an actin patch with GMC < 6 µm

% polarized SMC % polarized SMC with actin patch

A

29

Figure 3.8. Percentage of preprophase SMCs, with respect to the size of the adjacent GMC, with polarized nuclei and the percentage of the cells with polarized nuclei that have an actin patch. A) percentage of preprophase SMCS adjacent to a GMC with a width < 6 µm. B) percentage of preprophase SMCS adjacent to a GMC with a width > 6 µm. Error bars indicates SEM (standard error of the mean).

Table 3.6. Percentage of prophase SMCs with a polarized nucleus and an actin patch. SEM (standard error of the mean). n= number of the cells.

Percentage of prophase SMCs with a polarized nucleus and an actin patch

Plant number and GMC

Width (µm)

wild type

% polarized SMC


dcd1 % polarized SMC


brk1 % polarized SMC


brk1; dcd1

% polarized SMC


plant 1 GMC<6

µm

n=28

35.7 53.5 n=1 100 100 n=8 50 12.5 n=3

plant 2 GMC<6

µm

n=15

40 86.6 n=7 14.28 57.14

plant 3 GMC<6

µm

n=1 n=13

100 69.2

plant 4 GMC<6

µm

n=29

44.82

44.8 n=7 28.5 85.7 n=31 54.8 70.9 n=3 100

Mean 30.1 46.2 58.19 78.01 26.2 20.85 25

0

10

20

30

40

50

60

70

80


Percentage of preprophase SMCs with a polarized nucleus and an actin patch with GMC > 6 µm


30

SEM

8.846097

15.45527

19.81262

8.123535

13.12745

14.67176

21.65064

plant 1 GMC ˃6

µm

n=115

53.9 84.3 n=4 50 n=35 42.8 20 n=23 52.1

plant 2 GMC ˃6

µm

n=20

90 100 n=34

70.5 85.29 n=6 25 50

plant 3 GMC ˃6

µm

n=41

39 60.9 n=20

70 100

plant 4 GMC ˃6

µm

n=41

65.8 82.9 n=51

52.9 80.3 n=30 46.6 83.3 n=15 60 60

Mean 62.1 82 60.85 66.39 28.6 38.3 28 15

SEM

9.330486

6.961086

4.728702

19.50635

9.207877

15.73942

14.08192

12.99038

0102030405060708090

100


Percentage of prophase SMCs with a polarized nucleus and an actin patch with GMC < 6 µm


A

31

Figure 3.9. Percentage of prophase SMCs, with respect to the size of the adjacent GMC, with polarized nuclei and the percentage of the cells with polarized nuclei that have an actin patch. A) percentage of prophase SMCS adjacent to a GMC with a width < 6 µm. B) percentage of prophase SMCS adjacent to a GMC with a width > 6 µm. Error bars indicates SEM (standard error of the mean).

3.4 Phragmoplast Orientation in SMCs

The orientation of phragmoplast in all four genotypes was also observed, though the

percentage of SMCs with abnormally positioned phragmoplasts was not calculated. In wild type

plants, during cytokinesis, it has been observed that phragmoplast develops from remnants of

spindle assembly and grows towards the cortical division site, which was established by the pre-

prophase band during prophase. Figure 3.10 shows variation in the positioning of

phragmoplasts in dividing SMCs in wild-type, dcd1, brk1 and brk1; dcd1. In case of the

asymmetric cell division under study, wild-type SMCs develop a normal phragmoplast at the

site of the cortical division site (CDS). In case of mutant’s phragmoplasts, they expand away

from CDS and many times are located in the corner of a cell as opposed to adjacent to the GMC.

0

20

40

60

80

100


Percentage of prophaseSMCs with a polarized nucleus and an actin patch with

GMC > 6 µm


B

32

This type of phragmoplast development leads to the abnormal shape of the subsidiary cell since

phragmoplast positioning is essential for correct cell plate positioning between daughter cells.

Figure 3.10. Phragmoplast orientation in wild-type, dcd1, brk1 and brk1; dcd1 SMCs. (A) arrow indicates wild type normal phragmoplast. (B) Misoriented phragmoplast in brk1 mutant (away from plane of cortical division site. (C) Normal phragmoplast in dcd1 mutant. (D) brk1; dcd1 double mutant phragmoplast is tilted and off track.

A B

D C

SMC

33

CHAPTER 4

DISCUSSION

The subsidiary mother cell (SMC) division during stomatal complex formation is an

asymmetric cell division that produces a large epidermal cell and a smaller, sister subsidiary

cell. Mutants such as brk1 and dcd1 have a high number of abnormally shaped subsidiary cells.

brk1 mutants have defects in actin polymerization while dcd1 mutants have defects in

microtubule organization, specifically the formation of an organized PPB. The abnormal shape

of the subsidiary cells in brk1 mutants has been attributed to a failure of the SMC nucleus to

polarize in preprophase. Results from our study and previous studies indicate an absence of

actin patches in brk1 mutants. The dcd1 mutants have abnormal subsidiary cells due to

disorganized PPBs (Wright et al. 2009). Here, we examine the synergistic effect of the brk1 and

dcd1 mutations in the double mutant as opposed to the expected additive effect.

Experiments were conducted to determine the cause of the abnormal shape of the

subsidiary cells in the double mutant, brk1; dcd1. Actin staining was carried out to observe the

actin patches in dividing SMCs in each genotype. The study included a microscopic visualization

of the actin patch and the degree of SMC nuclear polarization at each stage of the cell cycle.

Propodium iodide was used to stain the DNA in nucleus and fluorescent phalloidin was used to

visualize actin microfilaments.

The process of SMC division starts with nuclear migration towards adjacent guard

mother cell. The results indicate that all wild type, brk1, dcd1 and brk1; dcd1 SMCs had similar

levels of nuclear migration when the polarizing GMC was immature and mature. This result is

in contrast to previously published results, which suggested defects in nuclear migration in the

34

brk1 mutant (Gallagher and Smith. 2000). This issue needs to be revisited with additional data

collection and analysis. One issue may be sampling error where a large number of very

immature GMCs were evaluated in one study and a large number of very mature GMCs were

evaluated in another study. There may have also been differences in what constituted a fully

migrated nucleus in each study.

The organization of an actin patch is a key characteristic in the asymmetric SMC division.

In dividing SMCs, the percentage of SMCs containing an actin patch was highest in wild type

and dcd1 mutants with the brk1 and brk1; dcd1 double mutants showing the least percentage

of SMCs with an actin patch. The difference between the two groups was greatest in SMCs

adjacent to mature GMCs. This behavior could be explained by concept of maturity and

reliability of signals coming from the mature GMCs. When actin patches were considered only

during metaphase and anaphase, the percentage of dcd1 SMCs with actin patches declined

relative to wild type. It is interesting to note that the double mutant phenotype is not

significantly worse than the brk1 single mutant an any stage of the cell cycle suggesting that

loss of DCD1 activity does not affect whether or not an actin patch forms inside a particular cell.

The size of actin patch is also essential factor in consideration of normal stomata

formation through proper SMC division. The size of actin patch in dividing SMCs in relation to

the width of adjacent guard mother cell was analyzed. It was observed that, in SMCs adjacent

to GMCs with a width < 6 µm, actin patch size was largest in WT and then brk1 and the smallest

in dcd1 and dcd1; brk1 double mutants. In SMCs adjacent to a GMC with a size > 6 µm (mature),

again the largest actin patches were found in wild type and then in the brk1 with the smallest in

the dcd1 and double mutants.

35

The observation that the size of actin patch was largest in wild type and the smallest in

the dcd1 mutant was quite surprising since dcd1 had not previously been implicated in any

actin-based processes. In SMCs, the PPB surrounds the area of the cortex where the actin

patch is formed. This data indicates that there may be a feedback mechanism between the PPB

and the actin patch that controls size actin patch size. Future investigations into this idea would

involve dual labeling of actin and microtubules in dividing SMCS in dcd1 mutants to see if there

is a correlation between disorganized PPB and actin patch size.

The percentage of SMCs with a polarized nucleus that had an actin patch during

preprophase and prophase was also evaluated to see if there was any correlation between

nuclear migration and actin patch formation. It is clear from the data that cells lacking an actin

patch are still capable of polarization suggesting that the actin patch is not required for nuclear

migration. This can also be interpreted as nuclear migration does not cause actin patch

formation.

Finally during SMC cytokinesis, the phragmoplast plays an important role in guiding the

cell plate between separated chromatids to the cortical division site. Similar to Malhortra

(2014) large numbers of brk1; dcd1 phragmoplasts were expanding off track predicting an

abnormally shaped subsidiary cell.

Overall, the work reported here and in Malhorta (2014) sought to clarify the cause of

the synergistic effect on SMC divisions created by combining the brk1 and dcd1 mutations.

Careful analysis of the microtubule and actin cytoskeletons at all stages of the cell cycle

identified PPB, spindle, and phragmoplast orientation as characteristics that are likely to be

worse in the double mutant when compared to either of the single mutants. PPBs in the

36

double mutant were more likely to be transverse than in either of the single mutants, the

spindle was more to be tilted, and the phragmoplast was more likely to be off track. These

results suggest that multiple processes function redundantly to ensure correct phragmoplast

positioning and thus normal cell shape. Loss of control over the microtubule and actin

cytoskeletons caused by the dcd1 and brk1 mutations impact the functionally redundant

mechanisms at the same time leading to abnormal phragmoplast orientation. For example, loss

of brk affects polarization of the SMC so a transverse instead of an asymmetric PPB forms.

However, the PPB is disorganized because the dcd1 mutation so the phragmoplast cannot track

back to the cortical division site and you end up with an abnormally shaped subsidiary cell. Or

in another case, the GMC signal is interpreted despite the brk1 mutation and the PPB forms in

the correct spot. However, it is disorganized so the cortical division site is insufficient. Also no

actin patch forms so the spindle is not anchored and it tilts out of position. Now phragmoplast

expansion begins in the wrong place and with the deficient cortical division site, the

phragmoplast cannot recover and cytokinesis produces an abnormally shaped cell.

Future experiments include a time course study of actin patch development with the

help of live cell actin markers in maize. Additionally triple labeling of microtubules, actin

filaments, and DNA in dividing SMCs may clarify some of the questions raised and provide

additional support for the explanation of the synergistic phenotype. It would also be useful to

examine double brk2; dcd1 mutants to see if they have the same synergistic affect. BRK2 is also

needed for ARP2/3 complex functioning and the results of this experiment would help us

distinguish if the observed synergy is brk1 specific or general to the actin cytoskeleton.

37

REFERENCES

Abrash, E. B. and Bergmann D. (2009). Asymmetric Cell Divisions: A View from Plant Development. Developmental Cell, 16, 783-796

Ambrose, J.C. and Cyr, R. (2008). Mitotic spindle organization by the preprophase band. Mol. Plant, 1, 950-960

Cartwright, H. N., Humphries, J.A., Smith, L. G. (2009) A Receptor-Like Protein That Promotes Polarization of an Asymmetric Cell Division in Maize. Science, 5914, 649-651

Cleary, A.L., Gunning, B.E.S., Wasteneys, G.O., Hepler, P.K. (1992) Microtubule and F–actin dynamics at the division site in living Tradescantia stamen hair cells. J. Cell Sci. 103, 977–988

Djakovic, S., Dyachok, J., Burke, M., Frank, M.J., Smith, L.G. (2006) BRICK1/HSPC300 functions with SCAR and the ARP2/3 complex to regulate epidermal cell shape in Arabidopsis. Development 133(6): 1091-100

Facette M. R. and Smith L. G. (2012). Division polarity in developing stomata. Current opinion in plant biology. 15 (6): 585-592

Frank, M.J., Cartwright, H.N. and Smith, L.G. (2003). Three Brick genes have distinct functions in a common pathway promoting polarized cell division and cell morphogenesis in the maize leaf epidermis. Development 130(4) 753-62

Frank, M.J. and Smith, L.G. (2002). A small, novel protein highly conserved in plants and animals promotes the polarized growth and division of maize leaf epidermal cells. Current Biology 12(10) 849-53

Galatis, B. and Apostolakos, P. (2004) The role of the cytoskeleton in the morphogenesis and function of stomatal complexes. New Phytol 161, 613-639

Gallagher K. and Smith L.G. (1999). Discordia mutations specifically misorient asymmetric cell divisions during development of the maize leaf epidermis. Development 126, 4623-4633

Gallagher, K. and Smith, L. G. (2000). Roles for polarity and nuclear determinants in specifying daughter cell fates after an asymmetric division in the maize leaf. Curr. Biol. 10, 1229-1232

Giannoutsou, E., Apostolakos, P. and Galatis, B. (2011) Actin filament-organized local cortical endoplasmic reticulum aggregations in developing stomatal complexes of grasses. Protoplasma 248,373-390

Hepler, P. K., Vidali, L. and Cheung, A. Y. (2001). Polarized cell growth in higher plants. Annu. Rev. Cell Dev. Biol. 17, 159-187

38

Humphries, J.A., Vejlupkova, Z., Luo, A., Meeley, R.B., Sylvester, A.W., Fowler, J.E., and Smith, L.G. (2011). ROP GTPases act with the receptor-like protein PAN1 to polarize asymmetric cell division in maize. Plant Cell 23: 2273–2284

Hussey, P.J., Hawkins, T.J., Igarashi, H., Kaloriti, D. and Smertenko, A. (2002) The plant cytoskeleton: recent advances in the study of the plant microtubule-associated proteins MAP–65, MAP–190 and the Xenopus MAP215-like protein, MOR1. Plant Mol. Biol. 50, 915–924

Ivakov A. and Persson S. (2013) Plant cell shape: modulators and measurements. Front plant science 4:439

Kirik, A., Ehrhardt, D., and Kirik, V. (2012). TONNEAU2/FASS regulates the geometry of microtubule nucleation and cortical array organization in interphase Arabidopsis cells. Plant Cell 24, 1158-1170

McCurdy, D. W. and Gunning, B. E. S. (1990) Reorganization of cortical actin microfilaments and microtubules at preprophase and mitosis in wheat root-tip cells: a double label immunofluorescence study. Cell Motil. Cytoskel. 15, 76-87

Muller, S., Wright, A., Smith, L. G. (2009). Division plane control in plants: new players in the band. Trends Cell Biology, 19, 180-188

Palevitz, B.A. (1987) Actin in the preprophase band of Allium cepa. J. Cell Biol. 104, 1515–1519

Panteris, E., Apostolakos, P., and Galatis, B. (2006). Cytoskeletal asymmetry in Zea mays subsidiary cell mother cells: a monopolar prophase microtubule half-spindle anchors the nucleus to its polar position. Cell Motil Cytoskeleton 63, 696-709

Raven P.H., Evert R.F., Eichhorn S.E. (2005): Biology of Plants, 7th Edition, W.H. Freeman and Company Publishers, New York, ISBN 0-7167-1007-2

Rhyu, M. S. and Knoblich, J. A. (1995) Spindle orientation and asymmetric cell fate. Cell 82, 523-526

Scheres, B., Benfey, P.N. (1999) Asymmetric cell division in plants. Annu Rev Plant Physiol Plant Molec Biol 50:505-537

Stebbins, G., and Shah, S. (1960) Developmental studies of cell differentiation in the epidermis of monocotyledones. II. Cytological features of stomatal development in the Gramineae. Dev. Biol. 2: 477–500

Sutimantanapi D, Pater D, Smith LG. (2014). Divergent roles for maize PAN1 and PAN2 receptor-like proteins in cytokinesis and cell morphogenesis. Plant phys 164 (4): 1905 - 1917

Taiz, E. Zeiger (2006): Plant Physiology, 4th Edition, Sinauer Associates, Inc., Publishers, Sunderland, MA, ISBN 0-87893-856-7

39

Wright, A.J., Gallagher, K. and Smith, L.G. (2009) discordia1 and alternative discordia1 function redundantly at the Cortical Division Site to promote preprophase band formation and orient division planes in maize. The Plant Cell vol. 21 234-247

Zhang, X., Facette M., Humphries, J., Shen, Z., Park, Y., Sutimantanapi, D, Sylvester, A.W., Briggs, S.P., and Smith, L.G. (2012) Identification of PAN2 by Quantitative Proteomics as a Leucine-Rich Repeat–Receptor-Like Kinase Acting Upstream of PAN1 to Polarize Cell Division in Maize .The Plant Cell, 24, 4577–4589

The Role of the Actin Cytoskeleton in Asymmetric Cell ...

Documents

Transcript of The Role of the Actin Cytoskeleton in Asymmetric Cell ...