The Pathway-Specific Regulator ClaR of Streptomyces clavuligerus Hasa Global Effect on the Expression of Genes for Secondary Metabolismand Differentiation

Yolanda Martínez-Burgo,a Rubén Álvarez-Álvarez,a Antonio Rodríguez-García,a,b Paloma Lirasa

Área de Microbiología, Facultad de Ciencias Biológicas y Ambientales, Universidad de León, León, Spaina; Instituto de Biotecnología de León, INBIOTEC, León, Spainb

Streptomyces clavuligerus claR::aph is a claR-defective mutant, but in addition to its claR defect it also carries fewer copies of theresident linear plasmids pSCL2 and pSCL4 (on the order of 4 � 105-fold lower than the wild-type strain), as shown by qPCR. Todetermine the function of ClaR without potential interference due to plasmid copy number, a new strain, S. clavuligerus �claR::aac, with claR deleted and carrying the wild-type level of plasmids, was constructed. Transcriptomic analyses were performed inS. clavuligerus �claR::aac and S. clavuligerus ATCC 27064 as the control strain. The new �claR mutant did not produce clavu-lanic acid (CA) and showed a partial expression of genes for the early steps of the CA biosynthesis pathway and a very poor ex-pression (1 to 8%) of the genes for the late steps of the CA pathway. Genes for cephamycin C biosynthesis were weakly upregu-lated (1.7-fold at 22.5 h of culture) in the �claR mutant, but genes for holomycin biosynthesis were expressed at levels from 3- to572-fold higher than in the wild-type strain, supporting the observed overproduction of holomycin by S. clavuligerus �claR::aac. Interestingly, three secondary metabolites produced by gene clusters SMCp20, SMCp22, and SMCp24, encoding still-crypticcompounds, had partially or totally downregulated their genes in the mutant, suggesting a regulatory role for ClaR wider thanpreviously reported. In addition, the amfR gene was downregulated, and consequently, the mutant did not produce aerial myce-lium. Expression levels of about 100 genes in the genome were partially up- or downregulated in the �claR mutant, many ofthem related to the upregulation of the sigma factor-encoding rpoE gene.

The claR gene, located in the Streptomyces clavuligerus CA genecluster, encodes a LysR-type regulator (1, 2). LysR-type tran-

scriptional regulators (LTTRs) follow the pattern of the modelregulator controlling lysA expression in Enterobacteriaceae (3).The LTTRs act on metabolic pathways but also in quorum sens-ing, virulence, motility, nitrogen fixation, oxidative stress re-sponses, and other systems (3, 4, 5). These global transcriptionalregulators act mostly as activators but also as repressors and con-trol single genes or operons. The LysR proteins are tetramers, havea helix-turn-helix (HTH) motif close to the N terminus, and bindpalindromic sequences identified as T-N11-A (6). The binding af-finity is usually determined by a ligand coinducer molecule (7).

The presence of LysR-type regulators in antibiotic biosynthesisgene clusters is relatively frequent (8, 9, 10). In undecylprodigiosinand actinorhodin production, the autoregulated StgR LTTR neg-atively controls the expression of the redD and actII-orf4 genesencoding pathway-specific activators (11).

The claR gene of S. clavuligerus is expressed as a monocistronictranscript that encodes a protein of 431 amino acids (Mr, 47,080).ClaR contains HTH motifs in its amino- and carboxyl-terminalregions. The HTH close to the C-terminal end of the protein con-tains, fully conserved, the S352Q, T357, and L363E positions presentin all LysR-type regulators; an additional HTH motif present atthe N-terminal end of ClaR (amino acids 3 to 51) is less conserved(2). Disruption of the claR gene resulted in lack of CA productionand accumulation of the intermediate clavaminic acid (1). Ampli-fication of claR in a multicopy plasmid increased 3-fold clavulanicacid production, whereas cephamycin C production was signifi-cantly reduced (2).

Northern transcriptional analysis using RNA isolated from thewild type and a claR mutant obtained in S. E. Jensen’s laboratoryshowed that the expression of genes encoding the early steps of the

pathway, ceaS2 to cas2, was normal in the mutant (1); these resultsand the accumulation of the intermediate clavaminic acid in theclaR mutant supported a ClaR control on the expression of genesfor the late steps of the clavulanic acid pathway.

Expression of claR itself is subject to control by CcaR, thecephamycin C-clavulanic acid supercluster specific regulator.Northern hybridization (2) or S1 analysis (1) showed undetect-able claR transcription in ccaR-disrupted mutants. Transcrip-tomic studies indicated that the ccaR-disrupted mutant expressedclaR at a level on the order of 16- to 24-fold lower than for thewild-type strain (12). Recombinant CcaR protein purified fromEscherichia coli gave two complexes of gel mobility shift on probescarrying the claR promoter, showing that CcaR had higher speci-ficity for the lower-mobility complex, as detected by competitionstudies (13).

Improving our knowledge of claR function has been hamperedby the difficulty in purifying the recombinant ClaR (rClaR) in an

Received 22 March 2015 Accepted 8 July 2015

Accepted manuscript posted online 17 July 2015

Citation Martínez-Burgo Y, Álvarez-Álvarez R, Rodríguez-García A, Liras P. 2015.The pathway-specific regulator ClaR of Streptomyces clavuligerus has a globaleffect on the expression of genes for secondary metabolism and differentiation.Appl Environ Microbiol 81:6637–6648. doi:10.1128/AEM.00916-15.

Editor: M. A. Elliot

Address correspondence to Paloma Liras, paloma.liras@unileon.es.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.00916-15.

Copyright © 2015, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.00916-15

October 2015 Volume 81 Number 19 aem.asm.org 6637Applied and Environmental Microbiology

on April 2, 2020 by guest

http://aem.asm

.org/D

ownloaded from

active form. Therefore, in this work we focused our attention onthe transcriptomic analysis of the strain S. clavuligerus �claR::aacin comparison to the wild-type strain. The analysis revealed thatClaR has a wider effect than previously thought, affecting S. cla-vuligerus development and additional clusters for secondary me-tabolites.

MATERIALS AND METHODSStrains and culture conditions. The strains used in this work are listed inTable 1. A preculture of these strains was grown in Trypticase soy broth(TSB) for 24 h at 28°C and 220-rpm shaking to an optical density at 600nm (OD600) of 6.5. These seed cultures were used to inoculate (5%, vol/vol) duplicated 500-ml triple-baffled flasks containing 100 ml of SA de-fined medium (14), and the culture were grown for 72 h under the sameconditions. ME medium (15) was used to analyze the aerial myceliumformation and sporulation of the strains. Apramycin (50 �g/ml), hygro-mycin (50 �g/ml), or nalidixic acid (25 �g/ml) was added to the cultureswhen required.

Strain construction. S. clavuligerus �claR::aac was obtained from S.clavuligerus ATCC 27064 using a SuperCos1 cosmid carrying the wholeclavulanic acid gene cluster, oligonucleotides claR-F and claR-R (TCTTTACTGGACGCGGTGGGACACTGCGGAGACCTCATGATTCC GGGGATCCGTCGACC and CCCGCCCGGTCCGGTCCGGACCCGGTCGCGGCCCGCTCATGTAGGCTGGAGCTGCTTC, where nucleotides inbold correspond to the claR sequence) and the ReDirect Method. In theapramycin-resistant exconjugants, the claR deletion was reconfirmed byPCR, using oligonucleotides cyp-F and Am-R (ACATCGGGACCATCTCCTC and TCAGCCAATCGACTGGCGAGCGGCATCGCATTCTTCGCAT), and by sequencing of the amplicon.

To complement S. clavuligerus �claR::aac, the claR gene with its ownpromoter (1,516 bp) was amplified by PCR using oligonucleotidesclaR_cF (GGGCGCGTTCCGCTTCCCG) and claR_cR (CCGCTCAGCCGGACATCCG). The amplified DNA fragment was sequenced andsubcloned into the EcoRV site of the integrative vector pMS83, leadingto pMS83-claR. The complemented mutant S. clavuligerus �claR::aac(pMS83-claR) was obtained by conjugation and selected by apramycinand hygromycin resistance. The presence of claR in this strain was recon-firmed by PCR and sequencing of the amplicon. S. clavuligerus �claR::aac(pMS83) was used as the complementation control strain.

Antibiotic assays. Clavulanic acid and cephamycin C were quantifiedas indicated by Pérez-Redondo et al. (2). Holomycin was determined bybioassay against Micrococcus luteus ATCC 9341 as described by de la Fu-ente et al. (16). Clavaminic acid was detected as described by Paradkar etal. (1).

Nucleic acids isolation. DNA was isolated as described by Pospiechand Neumann (17). For RNA isolation, samples from the Streptomycescultures were stabilized with 2 volumes of RNA Protect Bacteria Reagent(Qiagen) for 5 min, and 150 �l lysozyme (30 mg/ml) in Tris-EDTA (TE)buffer was added to the stabilized mycelium pellet of 1 ml of culturesamples. After 10 min, 600 �l buffer RLT (Qiagen) with �-mercaptoeth-anol was added to the samples, mixed by vortex, transferred to LysingMatrix B (MP Biomedicals) microtubes, and processed in a FastPrep in-strument (MP Biomedicals) with the following program: 30 s, 6.5 m/s; 1min at 0°C; 30 s, 6.5 m/s; 1 min at 0°C. One volume of phenol-chloro-form-isoamyl alcohol was added to the extracts, and the aqueous phasewas applied to RNeasy minikit columns (Qiagen) according to the man-ufacturer’s instructions. RNA preparations were incubated with DNase I(Qiagen) to eliminate DNA contamination. When used in reverse transcrip-tion-quantitative PCR (RT-qPCR) analysis, the RNA preparations were fur-ther treated with DNase I (Ambion) to eliminate all DNA contamination. TheRNA was quantified spectrophotometrically in a NanoDrop ND-1000 UV-vis (Thermo Scientific), and its integrity was determined using a Bioanalyzer2100 and the RNA 6000 Nano LabChip kit (Agilent Technologies). OnlyRNAs with RNA integrity values above 7.0 were used.

PCR. PCRs were performed as described by Kieser et al. (18) with aT-gradient thermocycler (Biometra). The PCR mixture contained, in a20-�l volume, 40 ng DNA template, 0.2 mM each deoxynucleosidetriphosphate (dNTP), 0.75 mM MgCl2, 5% dimethyl sulfoxide (DMSO),and 0.1 units of GoTaq DNA Polymerase (Promega). The amplificationwas carried out with an initial 3-min, 95°C denaturing step. The cyclescomprised a denaturing step of 30 s at 95°C, annealing for 30 s at 68°C, andextension for 3.5 min at 72°C. Successive cycles were carried out, de-creasing the annealing temperature by 1°C/cycle between 68°C and58°C. The amplification was completed with a final extension of 5 minat 72°C. The EcoRI-HindIII 1,382-bp fragment from pIJ774 was used toobtain the deletion cassette (19). Quantification and purity analysis ofPCR products were performed using a NanoDrop ND-1000 UV-vis(Thermo Scientific), and the fidelity of the amplification was confirmedby sequencing.

qPCR. Detection and quantification of plasmids pSCL2 and pSCL4were carried out using 20 ng DNA by qPCR as described by Lee et al. (20).To detect and quantify pSCL2, the parApSCL2 gene was used, and the brp,parBpSCL4, and traA genes were used to detect and quantify pSCL4. Thechromosomal genes adpA and hrdB were used as controls. The oligonu-cleotides used in this experiment were previously described by Álvarez-Álvarez et al. (21).

RT-qPCR. Gene expression analysis and quantification were per-formed by RT-qPCR as described by López-García et al. (22) using the

TABLE 1 Strains used in this work

Strain Origin Characteristics

S. clavuligerus ATCC 27064 ATCC Wild-type strain. Produces cephamycin C and clavulanic acid. Does notproduce holomycin. Carries standard copy no. of plasmids pSCL2and pSCL4.

S. clavuligerus �claR::aac This work Clavulanic acid nonproducer, holomycin producer, apramycin-resistant strain. Standard copy no. of pSCL2 and pSCL4.

S. clavuligerus claR::aph Fuente et al., 2002 (16) Clavulanic acid nonproducer, holomycin producer strain. Low copy no.of pSCL2 and pSCL4. Obtained by transformation of protoplasts.Renamed S. clavuligerus claR::aph pSCLlow

S. clavuligerus oppA2::aph pSCLlow Lorenzana et al., 2004 (32);Álvarez-Álvarez et al.,2014 (21)

Clavulanic acid nonproducer, holomycin producer strain. Kanamycinresistant. Low copy no. of pSCL2 and pSCL4. No sporulating strain.Used in qPCR as low plasmid copy no. control strain.

S. clavuligerus�claR::aac(pMS83-claR)

This work Clavulanic acid producer, holomycin nonproducer, apramycin- andhygromycin-resistant strain. Standard copy no. of pSCL2 and pSCL4.Sporulating strain.

S. clavuligerus �claR::aac(pMS83) This work Clavulanic acid nonproducer, holomycin producer, apramycin- andhygromycin-resistant strain. Standard copy no. of pSCL2 and pSCL4.

Martínez-Burgo et al.

6638 aem.asm.org October 2015 Volume 81 Number 19Applied and Environmental Microbiology

on April 2, 2020 by guest

http://aem.asm

.org/D

ownloaded from

2���Ct method (where CT is threshold cycle) (23, 24) and the constitutivehousekeeping gene hrdB gene as internal control (25). cDNAs were syn-thesized as described by López-García et al. (22). Negative controls werealways carried out to confirm the absence of contaminating DNA.

Microarray design. (i) Prediction of noncoding RNAs. S. clavuligerusgenome sequence and annotation (5,710 chromosomal coding sequences[CDS], 1,581 pSCL4 CDS, 18 rRNA, and 66 tRNA) were downloadedfrom StrepDB (http://strepdb.streptomyces.org.uk/). To identify non-coding RNA (ncRNA) in the genome sequence, two procedures wereused. First, 27 sequences of small RNA (sRNA) of the closely related spe-cies Streptomyces avermitilis were used to identify homologous sequencesin the genome of S. clavuligerus by means of BLAST searches. These se-quences were obtained from the StrepDB database (ssrA, srp, and rnpBgenes) and from the fRNAdb database of predicted ncRNA (26). In thisway, 20 sequences were identified (systematic names, SCLAV_mr001 toSCLAV_mr020). Second, the procedure and nocoRNAc program of Her-big and Nieselt (27) were used to predict 164 ncRNAs in the chromosome(systematic names with prefix “SCLAV_nr”) and 30 ncRNAs in the pSCL4plasmid (SCLAV_pnr). Thus, a total of 7,589 loci were the starting targetset for the probe design.

Microarray probes (45- to 60-mer) were designed with the onlinetool eArray (Agilent) for gene expression probes (1 to 3 probes perlocus) and with the chipD program (28) for tiling probes. The eArrayprocedure was the “Tm matching methodology” used with the option“best probe methodology” (DSCV01 probes) or “best distribution”(DSCV02 probes, an option used to obtain 3 probes per gene only forthose genes larger than 1,500 nucleotides [nt]); in both cases, 85°C wasthe “preferred probe Tm.” The chipD procedure was used to cover 13genome regions for a deeper analysis, including the known or putativebiosynthesis clusters for secondary metabolites. The tiling design(DSCV05, 5,559 probes) included the following parameters: Na con-centration, 1.134; target Tm, 97; Tm model, 3; and interval size, 30.Finally, a total of 14,867 probes were selected, covering 98.85% of thetargeted locus. Microarrays were manufactured by Agilent Technolo-gies (Santa Clara, CA, USA) in the format 8 � 15K.

(ii) Microarray labeling and hybridization. RNA was extracted fromthe culture samples at 22.5, 46.5, and 60 h. The analysis was performed fortwo biological replicates for each condition (two strains and three growthtimes). Labeling of RNA preparations with Cy3-dCTP, labeling ofgenomic DNA as the reference sample with Cy5-dCTP, and the purifica-tion procedures were carried out as indicated previously (21), except that2.5 pmol was the amount of Cy5-gDNA added to 50 �l of the hybridiza-tion solution. The hybridization conditions, washing, scanning with Agi-lent Scanner G2565BA, and the quantification of the images were carriedout as previously described (29).

Transcriptome analysis. Microarray fluorescence data were normal-ized and analyzed with the Bioconductor package limma (30).

First, net fluorescence intensities were calculated as mean fore-ground minus background median; when this subtraction was lowerthan the background standard deviation, the latter value was used asthe surrogate.

Second, the binary logs of Cy3/Cy5 net intensities were normalized(Mg value) with cycling loess and global median using spot weights (as-signing weights of 1 for CDS probes and of 1E�6 for the rest of the probes),so the only values taken into account in the normalization were thosefrom the chromosome coding genes, while the pSCL4 probes were prac-tically discarded. The Mg value is proportional to the abundance of thetranscript for a particular gene (31).

Third, the spot values corresponding to the same probe sequence wereaveraged, and then the probe values of the same locus were averaged.Tiling probe data were discarded for this analysis.

The Mg transcription values of the six experimental conditions werecompared using three contrasts, mutant versus wild type, correspondingto the three studied growth times. For each gene, P values and Mc valueswere calculated (three sets of values, one for each comparison). Mc values

are the binary log of the differential transcription between the mutant andthe wild-type strain.

The Benjamini-Hochberg (BH) false-discovery rate correction was ap-plied to the P values. For each comparison, a result was considered statisticallysignificant if the BH-corrected P value was �0.05. A positive Mc value indi-cates upregulation, and a negative Mc value indicates downregulation.

Microarray data accession number. The microarray data used in thiswork have been deposited in the National Center for Biotechnology In-formation-Gene Expression Omnibus database under accession numberGSE66683.

RESULTSThe mycelium of the old mutant S. clavuligerus claR::aph car-ries a low number of copies of plasmids pSCL4 and pSCL2. TheS. clavuligerus oppA2::aph strain used previously in our laboratory(16, 32) was shown by qPCR amplification and transcriptomicanalysis to carry in the mycelium 25,000-fold fewer copies of plas-mid pSCL2 and 10,000-fold fewer copies of plasmid pSCL4 thanthe wild-type strain (21). The lack of sporulation of S. clavuligerusoppA2::aph, previously believed to be due to the oppA2 mutation(32), was shown to be dependent on the lack of pSCL4 (21). Todiscriminate whether the effects described for the mutations in theclavulanic acid gene cluster are real or due to the absence of plas-mids in the mutant strains, the levels of plasmids pSCL2 andpSCL4 were quantified in our collection of mutant strains andcompared to those of the wild-type strain. The parA gene in pSCL2and 11 genes located in pSCL4 (SCLAV_p0032, p0126, p0353,p0528, p0713, p0828, p1090, p1250, p1328, p1452, and p1539)were quantified by qPCR. Levels of the linear plasmids similar tothose of the wild-type strain were found in strains S. clavuligerusccaR::aph, S. clavuligerus cyp::tsr, S. clavuligerus orf13::apr, S. cla-vuligerus orf14::aph, S. clavuligerus oppA1::acc, S. clavuligerus relA::neo, and S. clavuligerus �adpA (22, 32, 33, 34, 35, 36). However,the old S. clavuligerus claR::aph strain, obtained by transformationof protoplasts to disrupt the claR gene (16), was found to give avery low qPCR DNA amplification of genes located in eitherpSCL2 or pSCL4 (Fig. 1A), suggesting that this mutant has a lownumber of copies of both plasmids. A transcriptomic study per-formed as described by Álvarez-Álvarez et al. (12) confirmed thatgenes located in the pSCL2 and pSCL4 plasmids gave a very poortranscription signal in S. clavuligerus claR::aph (data not shown).Therefore, the old S. clavuligerus claR::aph strain has now beenrenamed S. clavuligerus claR::aph pSCLlow. To distinguish the phe-notypes due to the absence of the ClaR regulator from the effectsdue to the lack of linear plasmids, we constructed a new mutantwith claR deleted, which carried a normal number of copies ofpSCL2 and pSCL4. The new strain, named S. clavuligerus �claR::aac, was constructed by the ReDirect method using S. clavuligerusATCC 27064 as the parental strain (Table 1), and its correct num-ber of copies of plasmids was confirmed by qPCR (Fig. 1A). Theold S. clavuligerus claR::aph pSCLlow mutant did not produce cla-vulanic acid but produced larger amounts of cephamycin C and ofholomycin than the wild-type strain (16). When tested by bioas-say, the new S. clavuligerus �claR::aac broth cultures did not con-tain clavulanic acid at any time during the fermentation. Theseculture broths contained about 40% more cephamycin C thanthose of the parental strain S. clavuligerus ATCC 27064 at 72 h offermentation and produced significant amounts of holomycin(Fig. 1B). Since the same pattern of antibiotic production wasfound in both claR-null strains, we conclude that these effects weredue to the lack of ClaR.

The ClaR Regulator of S. clavuligerus

October 2015 Volume 81 Number 19 aem.asm.org 6639Applied and Environmental Microbiology

on April 2, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Transcriptomic analysis of S. clavuligerus �claR::aac incomparison to the parental S. clavuligerus ATCC 27064. Thedifferential transcriptomic analysis between the S. clavuligerus�claR::aac mutant and the wild-type parental strain were per-formed on 22.5-, 46.5-, and 60-h SA-grown culture samples. Thetranscriptomic results were filtered for the three sampling times,applying the criteria of Mc �1.0 or Mc ��2.0 and a BH-correctedP value of �0.05, to restrict the data to only those genes that werestrongly affected by the lack of ClaR. By these criteria, 103 geneswere clearly downregulated and 64 genes were upregulated in the�claR mutant.

Differential transcription of the clavulanic acid (CA) and cla-vam gene clusters. The effect produced by the lack of ClaR on theCA biosynthesis gene expression is shown in Fig. 2. Genes for theearly steps of the pathway were relatively well expressed (39 to56% in relation to the wild-type strain). All the genes for the latesteps of CA biosynthesis (gcas, orf16, oppA2, orf14, orf13, orf12,cyp-fd) had very low expression levels, between 1% (orf16) and 8%(car), in relation to those of the control strain. The fluorescencevalue for the claR probe, a gene that is not present in the mutant,indicated a background level of 1.3% in relation to the wild-type-

strain-derived value. Therefore, we might conclude that the lategenes for CA biosynthesis, as well as the two oligopeptide per-mease-encoding genes oppA1 and oppA2 (32) with differentialtranscription of 3.1% and 1.2%, respectively, are, for all practicalpurposes, not expressed in the �claR mutant (Fig. 2A). Only car, agene divergent from claR, which encodes the enzyme for the laststep of the pathway, is partially expressed (8%). All the cephamy-cin C-clavulanic acid supercluster genes putatively involved in�-lactam antibiotic resistance (pbpA, pbp2, pcbR) were upregu-lated in the �claR mutant. This finding is important and correlateswith the increased production of cephamycin C. An expressionincrease is observed at 22.5 h of culture for all the cephamycin Cbiosynthesis genes in the S. clavuligerus �claR::aac strain, explain-ing the increase of cephamycin production observed in the mu-tant; however, all the biosynthesis genes’ expression decreasesthereafter.

Interestingly, the clavam gene cluster (SCLAV_2921 to 2935),which is located far from the CA cluster (37), showed no signifi-cant differences in the expression of most genes. Only cvm5 andcvm7 were slightly upregulated (2.0-fold and 2.4-fold, respec-tively) and cvm3 was downregulated (2.4-fold) in the mutant, at

0

4000

8000

12000

16000

0 20 40 60 80

Cephamycin C

Rel

ativ

e am

ount

of D

NA

Gene amplified

brp

parB

traA adpA

1

10-2

10-4

10-6

pSCL2 pSCL4 Chromosome

parA

A

Clavulanic Acid

00

20

200

400

600

800

40 60 80

TIME (h)

Holomycin

0 20

100

200

040 60 80

Ant

ibio

tic(

g/m

g D

NA

)

B

μ

FIG 1 Plasmid copy number and antibiotic production by S. clavuligerus �claR::aac. (A) Relative amount of DNA measured by qPCR of the genes indicatedabove. DNA samples were obtained from S. clavuligerus claR::aph pSCLlow (black columns), S. clavuligerus �claR::aac (gray columns), and S. clavuligerusoppA2::aph pSCLlow (white columns). The relative amounts of DNA shown for the three mutant strains were determined by comparison to the amounts obtainedwith wild-type S. clavuligerus. (B) Production of clavulanic acid (left panel), holomycin (central panel), and cephamycin C (right panel) by S. clavuligerus ATCC27064 (white circles), S. clavuligerus �claR::aac (black circles), S. clavuligerus �claR::aac(pMS83) (black squares), and S. clavuligerus �claR::aac(pMS83-claR)(white squares).

Martínez-Burgo et al.

6640 aem.asm.org October 2015 Volume 81 Number 19Applied and Environmental Microbiology

on April 2, 2020 by guest

http://aem.asm

.org/D

ownloaded from

46.5 h of culture. In the clavam paralogous gene cluster(SCLAV_p1069 to p1082), located in the pSCL4 megaplasmid, thebls1, pah1, cvm6P, and orfB genes were upregulated (2.2- to 5.8-fold) (data not shown). The cluster SMCp25 (SCLAV_p1508 toSCLAV_p1510) (38) showed a downregulation of 21-fold on av-erage. This cluster contains a clavaminate synthase-like oxygenase(18-fold downregulated) and a putative carbamoyltransferase.

Differential transcription of the cephamycin C and holomy-cin gene clusters. All the genes in the cephamycin C gene clusterwere moderately upregulated at 22.5 h of culture in the �claRmutant, with an average fold change of 1.7 at this sampling time,but their expression decreased at 46.5 and 60 h of culture (Fig. 2B).The hlm genes, encoding enzymes for holomycin biosynthesis(Fig. 2C), showed diverse expression changes. The expression in-creases were small for hlmK, hlmL, and hlmM genes (14-foldchange average at 22.5 h). The other hlm genes had a large expres-sion increase at 22.5 h, on the order of 250.7-fold change average.These high expression differences decreased at later samplingtimes. Only two genes, hlmI and hlmH, showed a high and main-tained upregulation at all sampling times with maximum differ-ences in relation to the wild-type strain at 46.5 h and 60 h. ThehlmI gene encodes the thioredoxin-like dithiol oxidase formingthe disulfide bond that cyclizes the second ring in holomycin (39).The hlmH gene encodes an MSF-type transporter, and its role inholomycin production is still unknown (40).

The differences in the cephamycin C biosynthesis gene expres-sion did not meet the criteria initially applied to the data (Mc �1.0

or Mc ��2.0 and BH-corrected P value of �0.05); however, thedifferences observed correlated well with the different cephamy-cin C production levels by S. clavuligerus �claR::aac and the wild-type strain (Fig. 1B).

Other putative secondary metabolites gene clusters affectedby the lack of ClaR. Three clusters (SMCp20, SMCp22, andSMCp24) putatively involved in secondary metabolite formation(38) and located in plasmid pSCL4 were specially affected by thelack of ClaR. The block of genes SCLAV_p1334 to SCLAV_p1337(cluster SMCp20) was strongly downregulated. These genes en-code proteins with a UPF0089 domain, an acyl-coenzyme A (acyl-CoA) synthetase, a caffeoyl O-methyltransferase, and a histidineammonia-lyase, respectively. The remaining genes in the cluster,encoding nonribosomal peptide synthetases (SCLAV_ p1339,SCLAV_p1340, SCLAV_p1341) were not affected (Fig. 3, toppanel). The SMCp20 cluster appears to be involved in the biosyn-thesis of a nonribosomal peptide containing a caffeic acid-derivedmoiety. All the genes of cluster SMCp22 were downregulated, es-

10.0

100.0

1000.0

1.0

0.1

0.01

2.0

1.0

0.5

1.0

B

A

CpcbA

B

pcbR

ceaS2

bls2

pah2

cas2

oat2

oppA

1claR

car

cyp

fd orf12

orf13

orf14

oppA

2

orf16

gcaS

pbpA

pbp2

hlmA

hlmB

hlmC

hlmD

hlmE

hlmF

hlmG

hlmH

hlmI

hlmK

hlmL

hlmM

pcbC

lat

blp

orf10

ccaR

cmcH

cefF

cmcJ

cmcI

cefD

cefE

pcd

cmcT

pbp

bla

Chan

ge of

Expr

essio

n (Fo

ld)

FIG 2 Effects of the lack of ClaR on transcription of clavulanic acid, cepha-mycin C, and holomycin biosynthesis genes. Transcriptomic results of genesfor clavulanic acid biosynthesis (A), cephamycin C biosynthesis (B), and ho-lomycin biosynthesis (C) in S. clavuligerus �claR::aac compared to S. clavulig-erus ATCC 27064. The columns represent the average of the fold change ofexpression at 22.5 h (black columns), 46.5 h (gray columns), and 60 h (whitecolumns). The corresponding gene is indicated at the bottom of the columns.The values are compared to those of the control strain, S. clavuligerus ATCC27064, taken as 1.

_p13

34

_p13

35

_p13

36

_p13

37

_p13

38

_p13

39

_p13

40

_p13

41

_p14

07

_p14

09

_p14

08

_p14

11

_p14

12

_p14

13

_p14

14

_p14

15

_p14

10

Cluster SMCp20

Cluster SMCp22

1.0

1.0

0.1

0.10

0.001

0.010

0.01

Chan

ge of

Expr

essio

n (Fo

ld)

_p14

71

_p14

72

_p14

73

_p14

74

_p14

75

_p14

76

_p14

77

_p14

78

_p14

79

_p14

80

_p14

81

_p14

82

_p14

83

Cluster SMCp24

1.0

0.1

0.01FIG 3 Effects of the lack of ClaR on the SMCp20, SMCp22, and SMCp24 genecluster transcription. Transcriptomic results of genes of the SMCp20 cluster(top), the SMCp22 cluster (middle), and the SMCp24 cluster (bottom) in S.clavuligerus �claR::aac compared to S. clavuligerus ATCC 27064. The columnsrepresent the average of the fold change of expression at 22.5 h (black col-umns), 46.5 h (gray columns), and 60 h (white columns). The correspondinggene is indicated at the top of the columns. The values are compared to thoseof the control strain, S. clavuligerus ATCC 27064, taken as 1.

The ClaR Regulator of S. clavuligerus

October 2015 Volume 81 Number 19 aem.asm.org 6641Applied and Environmental Microbiology

on April 2, 2020 by guest

http://aem.asm

.org/D

ownloaded from

pecially SCLAV_p1407, encoding a pentalenene synthase (140-fold down-expressed), SCLAV_p1410, encoding a protein with aDUF397 domain, and SCLAV_p1415, encoding a hydrolase (Fig.3, middle panel); the cluster genes showed an average of 5-folddownregulation in the mutant strain. Also, all the genes in clusterSMCp24 were downregulated in the �claR mutant (average, 4.75-fold decrease), but specially affected were (i) SCLAV_p1474 andSCLAV_p1475, encoding a putative indigoidine synthase and atransporter, and (ii) SCLAV_p1478, SCLAV_p1482, andSCLAV_p1483 for two DUF-domain-containing proteins and ahypothetical protein, respectively (Fig. 3, bottom panel). Theproducts of clusters SMCp20, SMCp22, and SMCp24 have not yetbeen characterized.

Other genes affected in the �claR mutant. (i) Regulatorygenes. Twelve regulatory genes were up- or downregulated in the�claR mutant (Fig. 4). Six genes were upregulated, with an averageincrease of 4.2-fold. A high change (6-fold increase) was observedin SCLAV_4082, a gene annotated as rpoE, which encodes theRNA polymerase sigma factor RpoE. The orthologous gene of S.coelicolor is sigR, encoding the SigR regulator, which, coordinatedwith the anti-sigma factor RsaR, controls the cellular redox ho-meostasis and a regulon of 160 genes (41). Strongly affected wasalso staR (SCLAV_p1122), encoding the staurosporine biosynthe-sis transcriptional activator (42). This gene showed a 7.7-fold in-crease in the mutant; surprisingly, the staurosporine biosynthesisgenes were not affected, with the exception of SCLAV_p1123, en-

coding a methyltransferase, which was upregulated at all samplingtimes, with a maximum change of 70-fold at 46.5 h.

Six regulatory genes were downregulated by the lack of ClaR,with an average change of 24.6-fold. The most affected downregu-lated gene was SCLAV_4956, encoding the response transcrip-tional regulator AmfR, with a 61-fold change. This gene is or-thologous to S. coelicolor ramR and S. griseus amfR (43, 44); thelatter is known to control the operon amfTSBA, which is strictlyrequired for aerial mycelium formation. This low expression ofamfR supports the observation that S. clavuligerus �claR::aac isunable to form aerial mycelium (Fig. 4B) (see Discussion). The S.clavuligerus chromosomal genes SCLAV_4787 and SCLAV_4788are orthologous to the Streptomyces lividans two-component sys-tem (TCS)-encoding genes cutS and cutR, and their expressionwas not affected in the �claR mutant. However, a putativeparalogous TCS-encoding cutS-cutR (SCLAV_p1438 andSCLAV_p1439) was downregulated in the �claR mutant (14.5-fold average decrease).

(ii) Genes with various functions. In addition to the genesalready mentioned, 48 genes encoding miscellaneous proteinswere upregulated and 69 genes were downregulated in the �claRmutant (Table 2). The proteins encoded by these genes exert dif-ferent functions in the cell. The more affected genes were the ATP-dependent Clp protease-encoding gene (SCLAV_0526) and thestaurosporin-related methyltransferase (SCLAV_p1123), whichwas upregulated 70-fold. Upregulated changes between 10- and

FIG 4 Different transcription of genes encoding regulators. (A) Regulatory genes up- or downregulated in S. clavuligerus �claR::aac. Note that the shaded datacorrespond to downregulated genes. (B) Plates of ME medium at 7 days (left plate) and 12 days (right plate) of culture. S. clavuligerus ATCC 27064 (WT) is grownat the left side of the plates. S. clavuligerus �claR::aac is grown at the right side of each plate. Note in the 12-day culture the formation of aerial mycelium on theS. clavuligerus �claR::aac lawn when grown in the proximity of the wild-type strain.(C) Aerial mycelium and sporulation by S. clavuligerus ATCC 27064 (1), S.clavuligerus �claR::aac (2), S. clavuligerus �claR::aac(pMS83) (3), and S. clavuligerus �claR::aac(pMS83-claR) (4).

Martínez-Burgo et al.

6642 aem.asm.org October 2015 Volume 81 Number 19Applied and Environmental Microbiology

on April 2, 2020 by guest

http://aem.asm

.org/D

ownloaded from

TABLE 2 Genes encoding nonregulatory proteins that are upregulated or downregulated in S. clavuligerus �claR::aac in relation to S. clavuligerusATCC 27064

Gene Product

Mc BH-corrected P value Fold changea

22.5 h 46.5 h 60 h 22.5 h 46.5 h 60 h 22.5 h 46.5 h 60 h

UpregulatedSCLAV_0156 Hypothetical protein 1.60 2.87 2.71 4.52E�02 2.64E�04 3.90E�04 3.03 7.32 6.56SCLAV_0254 Putative acetyltransferase 4.07 1.51 2.18 8.61E�06 4.56E�02 3.56E�03 16.80 2.86 4.55SCLAV_0526 ATP-dependent Clp protease 1.63 4.45 3.02 2.50E�02 �1E�06 5.64E�05 3.10 21.99 8.15SCLAV_1182 Hypothetical protein 1.69 2.03 1.61 1.03E�05 �1E�06 1.63E�05 3.24 4.11 3.05SCLAV_1184 ATP grasp superfamily enzyme 2.99 3.58 1.34 �1E�06 �1E�06 6.86E�04 7.98 12.02 2.54SCLAV_1186 Putative dephospho-CoA kinase 1.17 2.12 1.16 1.01E�02 1.58E�05 4.88E�03 2.25 4.37 2.24SCLAV_1187 Hypothetical protein 1.57 1.74 1.43 5.77E�04 5.80E�05 3.92E�04 2.97 3.35 2.70SCLAV_1453 Alkaline d-peptidase 1.70 1.60 1.56 7.69E�03 1.21E�02 6.99E�03 3.27 3.04 2.95SCLAV_1808 DsbA oxidoreductase 2.17 2.38 1.48 �1E�06 �1E�06 5.70E�06 4.51 5.21 2.80SCLAV_1991 N-Acetylglucosamine catabolism protein 1.01 1.22 1.45 2.60E�03 2.69E�04 3.83E�05 2.02 2.33 2.74SCLAV_2412 GTP cyclohydrolase I 1.03 1.69 1.93 1.29E�03 2.99E�06 �1E�06 2.04 3.24 3.82SCLAV_2900 GCN5-related N-acetyltransferase 1.38 1.74 1.27 2.36E�05 �1E�06 4.66E�05 2.60 3.35 2.42SCLAV_2956 Hypothetical protein 1.51 1.79 1.36 6.38E�03 8.38E�04 6.51E�03 2.85 3.48 2.57SCLAV_3213 Glycosyltransferase 2.78 2.71 1.10 �1E�06 �1E�06 3.98E�05 6.89 6.57 2.15SCLAV_3214 DUF2596 domain-containing protein 1.53 1.40 1.41 3.75E�05 8.39E�05 6.56E�05 2.89 2.64 2.68SCLAV_3281 Putative permease of the MFS superfamily 2.73 2.81 1.50 �1E�06 �1E�06 2.05E�04 6.65 7.04 2.83SCLAV_3946 Fumarate hydratase 2.35 3.61 2.04 �1E�06 �1E�06 �1E�06 5.13 12.29 4.13SCLAV_4021 Hypothetical protein 2.15 1.95 1.61 2.45E�06 7.86E�06 6.93E�05 4.46 3.88 3.07SCLAV_4151 Hypothetical protein 1.29 3.08 1.31 7.78E�04 �1E�06 3.80E�04 2.45 8.50 2.48SCLAV_4287 NAD-dependent epimerase/dehydratase 1.07 1.46 1.31 3.56E�02 2.30E�03 4.35E�03 2.10 2.76 2.49SCLAV_4768 3=-OH-methylcephem-O-

carbamoyltransferase1.12 2.50 1.34 3.81E�02 1.49E�05 5.53E�03 2.17 5.69 2.54

SCLAV_4869 Oxidoreductase 1.12 2.57 1.13 6.63E�05 �1E�06 4.42E�05 2.19 5.96 2.20SCLAV_4922 Ribosome-associated GTPase 1.19 2.52 1.28 5.71E�04 �1E�06 1.71E�04 2.30 5.77 2.43SCLAV_5145 Potassium-transporting ATPase subunit B 1.94 2.21 1.97 �1E�06 �1E�06 �1E�06 3.85 4.64 3.94SCLAV_5146 Potassium-transporting ATPase C chain 2.98 2.68 2.58 �1E�06 �1E�06 �1E�06 7.93 6.43 5.99SCLAV_5150 TrkABC domain-containing protein 1.18 1.08 1.39 2.89E�05 6.59E�05 3.11E�06 2.27 2.11 2.63SCLAV_5161 Hypothetical protein 1.85 1.16 1.03 1.49E�05 1.72E�03 3.79E�03 3.62 2.25 2.04SCLAV_5162 NocE-like protein 1.36 1.26 2.33 1.98E�02 1.91E�02 9.08E�05 2.58 2.40 5.03SCLAV_5163 Hypothetical protein 1.18 1.77 1.20 8.26E�05 �1E�06 4.86E�05 2.27 3.43 2.30SCLAV_5198 Copper oxidase 1.35 2.91 3.80 1.28E�04 �1E�06 �1E�06 2.56 7.52 14.00SCLAV_5199 Putative hydroxylase 1.15 2.86 3.77 6.01E�04 �1E�06 �1E�06 2.22 7.30 13.66SCLAV_5222 Hypothetical protein 1.79 2.14 1.16 8.85E�05 8.10E�06 3.47E�03 3.47 4.42 2.24SCLAV_5248 Zn-dependent hydrolase 1.44 1.55 1.08 2.63E�04 8.20E�05 2.30E�03 2.72 2.94 2.11SCLAV_5256 Putative ABC transporter permease 1.33 1.43 1.05 5.92E�03 1.91E�03 1.54E�02 2.52 2.70 2.07SCLAV_5350 Acyltransferase 3 1.03 1.80 1.27 1.34E�05 �1E�06 �1E�06 2.05 3.49 2.41SCLAV_5511 Hypothetical protein 1.23 1.62 1.37 2.69E�02 2.12E�03 6.19E�03 2.35 3.08 2.60SCLAV_5534 Selenocysteine lyase 1.26 1.22 2.62 3.76E�02 2.70E�02 1.39E�05 2.40 2.34 6.16SCLAV_5547 YD repeat protein 1.02 1.66 1.19 1.01E�02 5.78E�05 1.31E�03 2.03 3.17 2.29SCLAV_5583 Putative oxidoreductase 1.44 1.97 1.19 1.95E�02 9.78E�04 2.95E�02 2.73 3.93 2.29SCLAV_5617 Putative dehydrogenase 1.12 1.40 1.28 1.28E�02 1.26E�03 2.54E�03 2.18 2.64 2.43SCLAV_5688 Hypothetical protein 1.58 1.43 1.14 4.15E�05 1.10E�04 8.55E�04 3.01 2.69 2.21SCLAV_5714 Cysteine desulfurase 1.40 1.51 1.22 2.01E�02 7.02E�03 2.25E�02 2.65 2.85 2.34SCLAV_p0020 Hypothetical protein 1.37 1.33 1.25 1.89E�02 1.31E�02 1.60E�02 2.59 2.52 2.38SCLAV_p0560 Multimeric flavodoxin WrbA 3.40 2.97 1.37 �1E�06 �1E�06 1.61E�03 10.63 7.85 2.59SCLAV_p0693 Luciferase domain-containing protein 1.85 1.63 1.61 9.22E�04 1.95E�03 1.76E�03 3.62 3.11 3.06SCLAV_p0703 Carbonic anhydrase 1.28 1.17 1.77 2.86E�02 2.89E�02 1.18E�03 2.44 2.26 3.43SCLAV_p0842 NADPH-dependent FMN reductase 3.15 3.14 1.18 �1E�06 �1E�06 9.18E�03 8.91 8.85 2.28SCLAV_p1123 Putative methyltransferase 4.57 6.13 6.06 �1E�06 �1E�06 �1E�06 23.83 70.03 66.95

DownregulatedSCLAV_3892 DUF946 domain-containing protein �2.09 �4.38 �2.63 1.23E�03 �1E�06 6.82E�05 4.26 20.8 6.19SCLAV_4953 AmfT: putative AmfS-modifying enzyme �5.99 �6.68 �4.86 �1E�06 �1E�06 �1E�06 63.6 103 29.1SCLAV_4954 AmfB, membrane translocator �1.98 �2.56 �1.68 2.10E�03 9.78E�05 4.03E�03 3.95 5.93 3.22SCLAV_4955 AmfA, membrane translocator �2.45 �2.85 �1.15 3.01E�05 3.68E�06 1.74E�02 5.47 7.21 2.23SCLAV_4957 Hypothetical protein �3.72 �4.68 �4.31 �1E�06 �1E�06 �1E�06 13.3 25.8 19.9SCLAV_4968 CbbY/CbbZ/GpH/YieH family hydrolase �5.40 �6.38 �5.60 �1E�06 �1E�06 �1E�06 42.4 83.8 48.6SCLAV_4971 ATPase with various cellular activities �6.24 �6.26 �5.55 �1E�06 �1E�06 �1E�06 76.0 77.0 47.0SCLAV_4973 Hypothetical protein �3.15 �3.14 �2.11 �1E�06 �1E�06 �1E�06 8.89 8.82 4.34SCLAV_p1192 Peptidoglycan-binding LysM �2.00 �3.67 �2.97 4.11E�03 3.56E�06 4.60E�05 4.00 12.8 7.85SCLAV_p1196 Secreted protein �2.45 �4.70 �3.51 9.78E�04 �1E�06 1.21E�05 5.50 26.1 11.5

(Continued on following page)

The ClaR Regulator of S. clavuligerus

October 2015 Volume 81 Number 19 aem.asm.org 6643Applied and Environmental Microbiology

on April 2, 2020 by guest

http://aem.asm

.org/D

ownloaded from

TABLE 2 (Continued)

Gene Product

Mc BH-corrected P value Fold changea

22.5 h 46.5 h 60 h 22.5 h 46.5 h 60 h 22.5 h 46.5 h 60 h

SCLAV_p1197 Phage tail protein �2.42 �3.93 �3.21 4.78E�03 2.06E�05 1.74E�04 5.37 15.2 9.31SCLAV_p1198 Tail sheath protein �2.77 �5.20 �3.75 2.12E�03 1.03E�06 5.69E�05 6.86 36.8 13.5SCLAV_p1200 Hydrolytic protein �2.85 �5.19 �3.71 1.07E�03 �1E�06 3.98E�05 7.22 36.5 13.2SCLAV_p1328 SAM-dependent O-methyltransferase �2.80 �2.63 �3.42 �1E�06 �1E�06 �1E�06 6.99 6.20 10.7SCLAV_p1329 Peptidases S1 and S6; chymotrypsin/Hap �5.41 �6.13 �6.47 �1E�06 �1E�06 �1E�06 42.5 70.0 89.2SCLAV_p1330 Oxidoreductase UcpA �4.85 �5.25 �5.29 �1E�06 �1E�06 �1E�06 29.0 38.1 39.1SCLAV_p1342 Hypothetical protein �3.89 �4.46 �3.91 �1E�06 �1E�06 �1E�06 14.9 22.1 15.0SCLAV_p1352 Flavin reductase domain protein �2.50 �2.40 �2.99 �1E�06 �1E�06 �1E�06 5.69 5.28 7.97SCLAV_p1355 Hypothetical protein �6.24 �5.70 �5.27 �1E�06 �1E�06 �1E�06 75.7 52.3 38.6SCLAV_p1370 Acyl-CoA dehydrogenase �5.00 �4.97 �3.79 1.18E�06 1.19E�06 3.47E�05 32.1 31.5 13.9SCLAV_p1378 Dyp-type peroxidase family protein �3.42 �3.36 �2.09 �1E�06 �1E�06 2.93E�05 10.7 10.3 4.27SCLAV_p1379 Plastocyanin �6.14 �6.33 �4.73 �1E�06 �1E�06 �1E�06 71.0 80.6 26.6SCLAV_p1381 CnaB domain-containing protein �7.44 �7.81 �7.59 �1E�06 �1E�06 �1E�06 174.0 225.0 193.0SCLAV_p1382 Putative peptidase inhibitor �3.03 �3.95 �3.83 �1E�06 �1E�06 �1E�06 8.18 15.5 14.3SCLAV_p1383 YVTN family beta-propeller repeat protein �4.90 �5.06 �3.48 �1E�06 �1E�06 7.61E�06 29.9 33.5 11.2SCLAV_p1388 Putative secreted metalloprotease �5.43 �5.92 �6.17 �1E�06 �1E�06 �1E�06 43.2 61.0 72.2SCLAV_p1389 Putative secreted protein �5.88 �6.60 �7.19 �1E�06 �1E�06 �1E�06 59.2 97.3 147SCLAV_p1402 Actinohivin �2.33 �2.91 �3.45 2.95E�03 2.11E�04 3.02E�05 5.04 7.53 10.9SCLAV_p1403 DNA-binding protein �5.48 �5.25 �4.43 �1E�06 �1E�06 �1E�06 44.9 38.3 21.6SCLAV_p1404 Multicopper oxidase, type 2 �2.56 �2.82 �2.55 �1E�06 �1E�06 �1E�06 5.93 7.10 5.87SCLAV_p1417 Hypothetical protein �3.94 �4.30 �5.75 �1E�06 �1E�06 �1E�06 15.4 19.8 53.9SCLAV_p1420 Short-chain dehydrogenase/reductase SDR �3.40 �3.34 �3.59 �1E�06 �1E�06 �1E�06 10.6 10.2 12.1SCLAV_p1421 Hypothetical protein �3.29 �3.68 �4.52 �1E�06 �1E�06 �1E�06 9.8 12.8 23.0SCLAV_p1424 Hypothetical protein �2.03 �2.36 �2.23 5.62E�04 8.00E�05 1.29E�04 4.10 5.13 4.71SCLAV_p1425 Hypothetical protein �6.05 �6.15 �5.91 �1E�06 �1E�06 �1E�06 66.5 71.5 60.5SCLAV_p1428 Prenyltransferase/squalene oxidase �4.07 �4.16 �3.34 �1E�06 �1E�06 2.85E�06 16.9 18.0 10.2SCLAV_p1431 Putative surface layer protein �6.92 �8.23 �7.18 �1E�06 �1E�06 �1E�06 121 302 146SCLAV_p1434 Hypothetical protein �5.19 �5.27 �4.83 �1E�06 �1E�06 �1E�06 36.6 38.8 28.6SCLAV_p1442 Hypothetical protein �2.94 �4.27 �4.42 5.55E�05 �1E�06 �1E�06 7.70 19.4 21.5SCLAV_p1443 Integrin alpha-2 domain-containing protein �5.89 �6.30 �4.17 �1E�06 �1E�06 �1E�06 59.6 79.0 18.1SCLAV_p1445 Calcium binding protein �4.72 �5.43 �3.07 �1E�06 �1E�06 5.30E�06 26.5 43.4 8.42SCLAV_p1448 Methyltransferase family protein �5.26 �4.40 �2.11 �1E�06 �1E�06 4.97E�06 38.4 21.2 4.33SCLAV_p1449 Hypothetical protein �5.86 �6.38 �5.81 �1E�06 �1E�06 �1E�06 58.1 83.3 56.4SCLAV_p1451 Cytochrome P450 �4.12 �4.91 �5.35 �1E�06 �1E�06 �1E�06 17.4 30.1 41.0SCLAV_p1453 Trypsin �4.07 �5.48 �4.76 1.43E�05 �1E�06 1.78E�06 16.8 44.8 27.3SCLAV_p1455 Hypothetical protein �3.66 �3.41 �3.50 �1E�06 �1E�06 �1E�06 12.7 10.7 11.3SCLAV_p1459 Mg2� transporter C �3.50 �3.60 �6.28 2.70E�04 1.04E�04 �1E�06 11.4 12.2 78.2SCLAV_p1469 Lipoprotein �6.34 �5.34 �3.96 �1E�06 �1E�06 �1E�06 81.4 40.8 15.6SCLAV_p1484 Oxidoreductase �2.53 �3.01 �2.25 5.14E�05 5.02E�06 1.36E�04 5.81 8.06 4.78SCLAV_p1485 ATP-dependent RNA helicase �4.07 �4.12 �4.31 �1E�06 �1E�06 �1E�06 16.9 17.5 19.9SCLAV_p1491 Hypothetical protein �2.33 �2.22 �2.81 1.38E�05 2.15E�05 1.19E�06 5.06 4.67 7.05SCLAV_p1497 Inhibitor I36 domain-containing protein �3.28 �3.28 �3.01 �1E�06 �1E�06 �1E�06 9.8 9.7 8.06SCLAV_p1506 WD40 domain-containing protein �3.50 �4.20 �3.22 �1E�06 �1E�06 1.08E�06 11.4 18.4 9.37SCLAV_p1511 Putative integron gene cassette protein �4.39 �4.91 �5.31 �1E�06 �1E�06 �1E�06 21.0 30.1 39.9SCLAV_p1515 NAD-dependent epimerase/dehydratase �5.50 �5.45 �5.24 �1E�06 �1E�06 �1E�06 45.5 44.0 37.9SCLAV_p1526 Hypothetical protein �4.56 �4.06 �3.67 �1E�06 �1E�06 �1E�06 23.6 16.7 12.8SCLAV_p1527 Secreted protein �3.50 �3.20 �3.34 �1E�06 �1E�06 �1E�06 11.4 9.21 10.1SCLAV_p1528 DUF574 domain-containing protein �3.87 �4.07 �4.73 �1E�06 �1E�06 �1E�06 14.7 16.8 26.7SCLAV_p1539 Folylpolyglutamate synthetase �2.24 �4.19 �4.55 1.17E�03 �1E�06 �1E�06 4.72 18.3 23.5SCLAV_p1556 Adenosylcobinamide amidohydrolase (putative) �5.29 �4.92 �3.04 �1E�06 �1E�06 2.80E�05 39.2 30.4 8.23SCLAV_p1558 Beta-xylosidase �2.97 �3.97 �4.40 5.36E�04 1.42E�05 4.10E�06 7.85 15.7 21.2SCLAV_p1566 Phenolic acid decarboxylase �4.82 �4.69 �4.40 �1E�06 �1E�06 �1E�06 28.3 25.8 21.3SCLAV_p1580 Short-chain dehydrogenase/reductase SDR �3.28 �2.92 �2.18 4.44E�06 1.70E�05 3.57E�04 9.7 7.57 4.55SCLAV_p1582 Putative DNA-binding protein �2.40 �2.21 �2.46 1.18E�06 3.21E�06 �1E�06 5.28 4.65 5.53SCLAV_p1585 Hypothetical protein �2.11 �2.28 �2.06 4.78E�04 1.10E�04 2.81E�04 4.33 4.88 4.17SCLAV_p1586 Oxidoreductase �3.24 �3.51 �4.06 �1E�06 �1E�06 �1E�06 9.5 11.4 16.8SCLAV_p1588 Reductase �2.79 �2.99 �2.81 1.24E�05 4.30E�06 9.27E�06 6.94 7.99 7.06SCLAV_pnr026 Predicted ncRNA �4.67 �3.66 �3.43 6.25E�06 9.90E�05 1.75E�04 25.5 12.7 10.8SCLAV_pnr029 Predicted ncRNA �2.73 �2.54 �2.54 9.73E�06 2.03E�05 2.02E�05 6.68 5.85 5.82

a Boldface data correspond to downregulated fold changes.

Martínez-Burgo et al.

6644 aem.asm.org October 2015 Volume 81 Number 19Applied and Environmental Microbiology

on April 2, 2020 by guest

http://aem.asm

.org/D

ownloaded from

20-fold were observed for an ATP grasp superfamily enzyme(SCLAV_1184), for putative hydroxylase- and putative acetyl-transferase-encoding genes (SCLAV_5199, SCLAV_0254), andfor genes encoding a copper oxidase, a flavodoxin, and a fumaratehydratase (SCLAV_5198, SCLAV_p0560, SCLAV_3946). Themost affected genes were those encoding a CnaB domain-contain-ing protein (SCLAV_p1381) and a putative surface layer protein(SCLAV_p1431), which seemed to be not expressed at any time inthe culture (decreased 100-fold compared to the wild-type strain).Sixteen genes (about 13% of these genes) encode oxidoreductases,oxidases, flavodoxins, peroxidases, or reductases, which mightform part of the RpoE regulon (see Discussion) as occurs with theoxidoreductases encoded by SCLAV_1808 and SCLAV_4869.From them, SCLAV_1808, SCLAV_4869, and SCLAV_5583, en-coding oxidoreductases, SCLAV_5198, encoding a copper oxi-dase, SCLAV_p0560, encoding a flavodoxin, and SCLAV_p0842,coding for an NADPH-dependent FMN reductase, are upregu-lated, while all the other 10 genes are downregulated.

Complementation of S. clavuligerus �claR::aac. To confirmthe ClaR effect on antibiotic production and the lack of aerialmycelium formation, the deleted �claR mutant was comple-mented with plasmid pMS83-claR. S. clavuligerus �claR::aac, S.clavuligerus �claR::aac(pMS83-claR), and the control strains S.clavuligerus �claR::aac(pMS83) and S. clavuligerus ATCC 27064were grown in SA medium to compare the antibiotic productionlevels. The complementation did not affect appreciably cephamy-cin C production (Fig. 1B, right panel); however, a clear effect onclavulanic acid and holomycin production was observed. Clavu-lanic acid was produced by the complemented strain, although toa lower level than by S. clavuligerus ATCC 27064 (Fig. 1B, leftpanel). No holomycin production was observed in the comple-mented claR mutant (Fig. 1B, central panel), confirming that thelack of ClaR was responsible for the holomycin production phe-notype. Aerial mycelium formation and sporulation were fullyrestored in the complemented claR strain (Fig. 4C).

Validation of the transcriptomic data. The transcriptomicdata have been validated using RT-qPCR on the same RNA sam-ples as those used for the transcriptomic studies at 46.5 h. Fifteengenes were validated (Fig. 5), including genes for the biosynthesisof clavulanic acid (SCLAV_4183), cephamycin C (SCLAV_4199),holomycin (SCLAV_5267, SCLAV_5275), and staurosporine(SCLAV_p1122) and several genes encoding regulatory proteins(SCLAV_4956, SCLAV_5384, SCLAV_5409, SCLAV_5692,SCLAV_p1581), as well as five genes for miscellaneous proteins.The RT-qPCR values consistently confirmed those obtained in themicroarrays; a Pearson’s correlation of 0.918 between the dataobtained by the two techniques was obtained (Fig. 5B).

DISCUSSION

The detection of a low copy number of plasmids pSCL2 andpSCL4 in the mycelium of the old S. clavuligerus claR::aph indi-cates that our previous results on the loss of large plasmids inStreptomyces mutants (21) is a rather frequent event, probablyassociated to protoplast preparation and regeneration. Control ofthe cellular levels of these large plasmids is essential to avoid errorsin the interpretation of the phenotypes caused by mutants, espe-cially those obtained by classical mutagenesis and methods thatutilize protoplasts.

The construction of a new strain, S. clavuligerus �claR::aac,carrying a wild-type dosage of pSCL2 and pSCL4, allowed us to

confirm by transcriptomic methods the results obtained previ-ously by Northern and S1 high-resolution transcriptional analyses(1). These authors described that ClaR controls genes encodingenzymes for the late steps of CA biosynthesis (oppA1, car, and cyp).In addition, the transcriptomic approach showed that also gcaS,oppA2, and the orf12, orf13, orf14, and orf16 genes of the CA genecluster were downregulated in the �claR mutant with an averagetranscription of 2.3% in relation to the control strain. It was pre-viously described that the genes for the early steps of the CA path-way were not affected by the claR mutation (1); in this study, wefound that they are also downregulated, although to a lower extent(39 to 56%). This low expression allows a partial flux of the earlypart of the pathway to clavaminic acid and explains that this in-termediate is accumulated in the S. clavuligerus �claR::aac mutantgrown in SA medium barely above the levels found for the wild-type strain (data not shown). The flux of the clavam pathway,starting with clavaminic acid, is probably weak and unable to useall the clavaminic acid accumulated in the �claR mutant cells.

Pérez-Redondo et al. (2) described that increasing the copynumber of claR resulted in lower cephamycin C production. Thistranscriptomic study confirms that the lack of ClaR upregulatesthe expression of the cephamycin C genes (up to 1.7-fold) at earlytimes of the fermentation, which results in a 3-fold increase ofcephamycin C production at 72 h of culture. The effect of the claRdeletion is much stronger on the upregulation of the holomycinbiosynthesis gene cluster (3- to 572-fold increase, depending onthe gene), a metabolite that was overproduced in the deleted�claR mutant and in S. clavuligerus claR::aph (16). In this work, wedemonstrate that lack of ClaR upregulated all the genes of thehlmABCDEFG cluster (289-fold change on average) at the 22.5-hculture sample, and then their expression decreased gradually at46.5 and 60 h. Two genes, hlmI and hlmH, showed a continuousupregulation along the entire fermentation with a maximum at46.5 h (555-fold change on average). HlmI is a flavin-dependentdithiol oxidase using oxygen as a cosubstrate, which might be partof the RpoE regulon. HlmH is an MFS-type transporter; the S-methylation of holomycin has been described as the mechanism ofholomycin resistance in S. clavuligerus (45); however, the highexpression of hlmH when the strain is actively producing holomy-cin suggests that the pumping out of holomycin might be an al-ternative resistance mechanism.

While ClaR has been described as involved in clavulanic acidbiosynthesis regulation and related to overproduction of holomy-cin, in this work we demonstrate that additional blocks of genesnot directly related to antibiotic production are also controlled byClaR, including genes encoding other regulators. The most af-fected regulator in the S. clavuligerus �claR mutant is that encodedby SCLAV_4956, a gene that is almost completely silent in themutant, especially at 46.5 h of growth. AmfR is a NarL/FixJ-typeregulator, orthologous to S. griseus AmfR and to S. coelicolorRamR. AmfR activates the expression of the amfTSBA operon in S.griseus, and the same occurs with RamR in the ramCSAB operonin S. coelicolor or S. lividans (44, 46, 47). The lack of amfR expres-sion in S. clavuligerus �claR strongly downregulates amfT (100-fold), which encodes a putative protein kinase orthologous toRamC. The effect of the low amfR expression on amfA and amfB,encoding subunits of an ABC transporter, is lesser, and their tran-scription decreased only 6- to 7-fold in relation to the wild-typestrain (Fig. 4). The amfTBAR cluster of S. clavuligerus appears tobe similar to the ramCSABR cluster of S. coelicolor, but no S. cla-

The ClaR Regulator of S. clavuligerus

October 2015 Volume 81 Number 19 aem.asm.org 6645Applied and Environmental Microbiology

on April 2, 2020 by guest

http://aem.asm

.org/D

ownloaded from

vuligerus amfS gene can be found in public databases (see Adden-dum in Proof). The ramS gene encodes the 42-amino-acid peptidethat, after posttranslational modification, produces SapB, a “lan-tibiotic-like” peptide required for aerial mycelium formation in S.coelicolor (48). RamC, initially described as a protein kinase, isnow considered to be the putative enzyme that dehydrates andcyclizes the RamS peptide (49, 50) to produce the pro-SapB pep-tide. While an amfS (ramS) annotated gene is not present in the S.clavuligerus genome, a RamS-like peptide must be produced by S.clavuligerus ATCC 27064 since it induces aerial mycelium forma-tion in S. clavuligerus �claR::aac when the two strains are grownclose together (Fig. 4B, right), suggesting that a diffusible com-pound is produced by the wild-type strain. This extracellular com-plementation phenomenon, a cross-feeding experiment betweenthe wild-type strain and the amfS mutant, was also observed in S.griseus cocultures (51) of the wild type and the amfS mutant. Asimilar phenomenon occurs in S. coelicolor when the RamS pep-tide is added to solid cultures of a ramS mutant (52). The observedeffect on amfT appears to be characteristic of ClaR and not of

AdpA or BldD, which have been described to control amfT expres-sion in S. griseus (44, 53), since expression of the geneSCLAV_0719 (bldD) was not affected in S. clavuligerus �claR::aacand SCLAV_1957 (adpA) was upregulated (3.7-fold) only at 60 hof culture.

The SCLAV_4082 and SCLAV_4083 genes are orthologous tothe sigR-rsrA system of S. coelicolor and encode, respectively, anRNA polymerase sigma factor (RpoE), and an anti-sigma factor(RsrA). Both genes are upregulated in the �claR mutant (6- and4-fold above their level in the control strain, respectively). TheSigR regulon controls oxidative stress, allowing thiol homeostasis,correct protein folding, and flavin- or Fe-S protein-dependentredox reactions (41). Oxidative stress leads to RsrA inactivation,releasing SigR for the expression activation of genes in the SigRregulon (54). The anti-sigma factor RsrA detects thiol oxidationand modulates the SigR activity in Streptomyces coelicolor (54, 55,56). The SigR regulon is formed by at least 160 genes (41). In S.clavuligerus �claR, 73 of 117 genes orthologous to those of the S.coelicolor SigR regulon are upregulated with a level equal to or

FIG 5 Validation of the transcriptomic results. (A) Comparison of the data obtained for each gene analyzed in the transcriptomic experiment and by RT-qPCR.(B) Representation of the correlation between the results shown in panel A.

Martínez-Burgo et al.

6646 aem.asm.org October 2015 Volume 81 Number 19Applied and Environmental Microbiology

on April 2, 2020 by guest

http://aem.asm

.org/D

ownloaded from

greater than 1.5-fold at some of the three sampling times, 31 ofthem being upregulated at all the sampling times (see Table S1 inthe supplemental material). S. clavuligerus �claR does not pro-duce clavulanic acid, and this compound might be a sink for cel-lular oxygen, since several steps of the pathway (as those involvingthe clavaminate synthase) consume oxygen and, therefore, CAproduction might help in controlling the oxidative stress. Theactivation of the RpoE regulon in the �claR mutant would ac-count for the upregulation of the thioredoxin reductase(SCLAV_5275) for holomycin biosynthesis and also for the differ-ential transcription of many oxidases, oxidoreductases, and re-ductases genes (see Table S1 in the supplemental material).

In summary, deletion of the claR gene affects all the genes forclavulanic acid biosynthesis, especially those encoding the latesteps of the pathway. It affects also all the genes for holomycinbiosynthesis but also results in downregulation of several clustersfor cryptic metabolites. The downregulation observed for amfRconfirms the concomitant loss of aerial mycelium formation.Genes involved in oxidative stress are also affected, which wouldaccount for the differential transcription of many genes of theRpoE regulon.

ACKNOWLEDGMENTS

This work was supported by grant BIO2013-34723 from the Spanish Min-istry of Economy and Competitiveness. Y. Martínez-Burgo and R. Álva-rez-Álvarez received PFU fellowships from the Spanish Ministry of Sci-ence and Innovation.

The collaboration of R. Pérez Redondo and Juan F. Martín in differentsteps of this work is appreciated.

ADDENDUM IN PROOF

An ORF previously unidentified in public databases has been lo-cated in the S. clavuligerus genome between amfT and amfB (nt5822261 to 5822392). It encodes a 43-amino-acid peptide (56%identical to SapB) which contains the RamS-conserved positionsS24, S27, C31, S35, S38, and C42. The ORF should be named amfS.

REFERENCES1. Paradkar AS, Aidoo KA, Jensen SE. 1998. A pathway-specific transcrip-

tional activator regulates late steps of clavulanic acid biosynthesis in Strep-tomyces clavuligerus. Mol Microbiol 27:831– 843. http://dx.doi.org/10.1046/j.1365-2958.1998.00731.x.

2. Pérez-Redondo R, Rodríguez-García A, Martín JF, Liras P. 1998. TheclaR gene of Streptomyces clavuligerus, encoding a LysR-type regulatoryprotein controlling clavulanic acid biosynthesis, is linked to the clavu-lanate-9-aldehyde reductase (car) gene. Gene 211:311–321. http://dx.doi.org/10.1016/S0378-1119(98)00106-1.

3. Maddocks SE, Oyston PC. 2008. Structure and function of the LysR-typetranscriptional regulator (LTTR) family proteins. Microbiology 154:3609 –3623. http://dx.doi.org/10.1099/mic.0.2008/022772-0.

4. Schlaman HR, Okker RJ, Lugtenberg BJ. 1992. Regulation of nodulationgene expression by NodD in rhizobia. J Bacteriol 174:5177–5182.

5. Lehnen D, Blumer C, Polen T, Wackwitz B, Wendisch VF, Unden G.2002. LrhA as a new transcriptional key regulator of flagella, motility andchemotaxis in Escherichia coli. Mol Microbiol 45:521–532. http://dx.doi.org/10.1046/j.1365-2958.2002.03032.x.

6. Parsek MR, Ye RW, Pun P, Chakrabarty AM. 1994. Critical nucleotidesin the interaction of a LysR-type regulator with its target promoter region.catBC promoter activation by CatR. J Biol Chem 269:11279 –11284.

7. Tropel D, van der Meer JR. 2004. Bacterial transcriptional regulators fordegradation pathways of aromatic compounds. Microbiol Mol Biol Rev68:474 –500. http://dx.doi.org/10.1128/MMBR.68.3.474-500.2004.

8. Martínez-Costa OH, Martín-Triana AJ, Martínez E, Fernández-MorenoMA, Malpartida F. 1999. An additional regulatory gene for actinorhodin

production in Streptomyces lividans involves a LysR-type transcriptionalregulator. J Bacteriol 181:4353– 4364.

9. Rodríguez M, Núñez LE, Braña AF, Méndez C, Salas JA, Blanco G.2008. Identification of transcriptional activators for thienamycin andcephamycin C biosynthetic genes within the thienamycin gene clusterfrom Streptomyces cattleya. Mol Microbiol 69:633– 645. http://dx.doi.org/10.1111/j.1365-2958.2008.06312.x.

10. Martín JF, Liras P. 2010. Engineering of regulatory cascades and net-works controlling antibiotic biosynthesis in Streptomyces. Curr Opin Mi-crobiol 13:263–273. http://dx.doi.org/10.1016/j.mib.2010.02.008.

11. Mao XM, Sun ZH, Liang BR, Wang ZB, Feng WH, Huang FL, Li YQ.2013. Positive feedback regulation of stgR expression for secondary me-tabolism in Streptomyces coelicolor. J Bacteriol 195:2072–2078. http://dx.doi.org/10.1128/JB.00040-13.

12. Álvarez-Álvarez R, Rodríguez-García A, Santamarta I, Pérez-RedondoR, Prieto-Domínguez A, Martínez-Burgo Y, Liras P. 2014. Transcrip-tomic analysis of Streptomyces clavuligerus �ccaR::tsr: effects of the cepha-mycin C-clavulanic acid cluster regulator CcaR on global regulation. Mi-crob Biotechnol 7:221–231. http://dx.doi.org/10.1111/1751-7915.12109.

13. Santamarta I, López-García MT, Kurt A, Nárdiz N, Alvarez-Álvarez R,Pérez-Redondo R, Martín JF, Liras P. 2011. Characterization of DNA-binding sequences for CcaR in the cephamycin-clavulanic acid superclus-ter of Streptomyces clavuligerus. Mol Microbiol 81:968 –981. http://dx.doi.org/10.1111/j.1365-2958.2011.07743.x.

14. Aidoo KA, Wong A, Alexander DC, Rittammer RA, Jensen SE. 1994.Cloning, sequencing and disruption of a gene from Streptomyces clavulig-erus involved in clavulanic acid biosynthesis. Gene 147:41– 46. http://dx.doi.org/10.1016/0378-1119(94)90036-1.

15. Sánchez L, Braña A. 1996. Cell density influences antibiotic biosynthesisin Streptomyces clavuligerus. Microbiology 142:1209 –1220. http://dx.doi.org/10.1099/13500872-142-5-1209.

16. de la Fuente A, Lorenzana LM, Martín JF, Liras P. 2002. Mutants ofStreptomyces clavuligerus with disruptions in different genes for clavulanicacid biosynthesis produce large amounts of holomycin: possible cross-regulation of two unrelated secondary metabolic pathways. J Bacteriol184:6559 – 6565. http://dx.doi.org/10.1128/JB.184.23.6559-6565.2002.

17. Pospiech A, Neumann B. 1995. A versatile quick-prep of genomic DNAfrom gram-positive bacteria. Trends Genet 11:217–218. http://dx.doi.org/10.1016/S0168-9525(00)89052-6.

18. Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA. 2000.Practical Streptomyces genetics. John Innes Foundation, Norwich, Eng-land.

19. Gust B, Challis GL, Fowler K, Kieser T, Chater KF. 2003. PCR-targetedStreptomyces gene replacement identifies a protein domain needed forbiosynthesis of the sesquiterpene soil odor geosmin. Proc Natl Acad SciU S A 100:1541–1546. http://dx.doi.org/10.1073/pnas.0337542100.

20. Lee C, Kim J, Shin SG, Hwang S. 2006. Absolute and relative qPCRquantification of plasmid copy number in Escherichia coli. J Biotechnol123:273–280. http://dx.doi.org/10.1016/j.jbiotec.2005.11.014.

21. Álvarez-Álvarez R, Rodríguez-García A, Martínez-Burgo Y, Robles-Reglero V, Santamarta I, Pérez-Redondo R, Martín JF, Liras P. 2014. A1.8-Mb-reduced Streptomyces clavuligerus genome: relevance for second-ary metabolism and differentiation. Appl Microbiol Biotechnol 98:2183–2195. http://dx.doi.org/10.1007/s00253-013-5382-z.

22. López-García MT, Santamarta I, Liras P. 2010. Morphological differen-tiation and clavulanic acid formation are affected in an S. clavuligerus�adpA-deleted mutant. Microbiology 156:2354 –2365. http://dx.doi.org/10.1099/mic.0.035956-0.

23. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression datausing real-time quantitative PCR and the 2���CT. Methods 25:402– 408.http://dx.doi.org/10.1006/meth.2001.1262.

24. Schmittgen TD, Zakrajsek BA. 2000. Effect of experimental treatment onhousekeeping gene expression: validation by real-time, quantitative RT-PCR. J Biochem Biophys Methods 46:69 – 81. http://dx.doi.org/10.1016/S0165-022X(00)00129-9.

25. Aigle B, Wietzorrek A, Takano E, Bibb MJ. 2000. A single amino acidsubstitution in region 1.2 of the principal sigma factor of Streptomyces coeli-colorA3(2) results in pleiotropic loss of antibiotic production. Mol Microbiol37:995–1004. http://dx.doi.org/10.1046/j.1365-2958.2000.02022.x.

26. Kin T, Yamada K, Terai G, Okida H, Yoshinari Y, Ono Y, Kojima A,Kimura Y, Komori T, Asai K. 2007. fRNAdb: a platform for mining/annotating functional RNA candidates from non-coding RNA sequences.Nucleic Acids Res 35:D145–D148. http://dx.doi.org/10.1093/nar/gkl837.

The ClaR Regulator of S. clavuligerus

October 2015 Volume 81 Number 19 aem.asm.org 6647Applied and Environmental Microbiology

on April 2, 2020 by guest

http://aem.asm

.org/D

ownloaded from

27. Herbig A, Nieselt K. 2011. nocoRNAc: characterization of non-codingRNAs in prokaryotes. BMC Bioinformatics 12:40. http://dx.doi.org/10.1186/1471-2105-12-40.

28. Dufour YS, Wesenberg GE, Tritt AJ, Glasner JD, Perna NT, Mitchell JC,Donohue TJ. 2010. chipD: a web tool to design oligonucleotide probes forhigh-density tiling arrays. Nucleic Acids Res 38:W321–W325. http://dx.doi.org/10.1093/nar/gkq517.

29. Yagüe P, Rodríguez-García A, López-García MT, Rioseras B, Martín JF,Sánchez J, Manteca A. 2014. Transcriptomic analysis of liquid non-sporulating Streptomyces coelicolor cultures demonstrates the existence ofa complex differentiation comparable to that occurring in solid sporulat-ing cultures. PLoS One 9:e86296. http://dx.doi.org/10.1371/journal.pone.0086296.

30. Smyth G. 2005. limma: linear models for microarray data, p 397– 420. InGentleman R, Carey VJ, Huber W, Irizarry RA, Dudoit S (ed), Statistics forbiology and health. Springer, New York, NY.

31. Mehra S, Lian W, Jayapal KP, Charaniya SP, Sherman DH, Hu W-S.2006. A framework to analyze multiple time series data: a case study withStreptomyces coelicolor. J Ind Microbiol Biotechnol 33:159 –172. http://dx.doi.org/10.1007/s10295-005-0034-7.

32. Lorenzana LM, Pérez-Redondo R, Santamarta I, Martín JF, Liras PP.2004. Two oligopeptide-permease-encoding genes in the clavulanic acidcluster of Streptomyces clavuligerus are essential for production of the�-lactamase inhibitor. J Bacteriol 186:3431–3438.

33. Pérez-Llarena FJ, Liras P, Rodríguez-García A, Martín JF. 1997. Aregulatory gene (ccaR) required for cephamycin and clavulanic acid pro-duction in Streptomyces clavuligerus: amplification results in overproduc-tion of both �-lactam compounds. J Bacteriol 179:2053–2059.

34. Li R, Khaleeli N, Townsend CA. 2000. Expansion of the clavulanic acidgene cluster: identification and in vivo functional analysis of three newgenes required for biosynthesis of clavulanic acid by Streptomyces clavu-ligerus. J Bacteriol 182:4087– 4095. http://dx.doi.org/10.1128/JB.182.14.4087-4095.2000.

35. Mellado E, Lorenzana LM, Rodríguez-Sáiz M, Díez BB, Liras P, BarredoJL. 2002. The clavulanic acid biosynthetic cluster of Streptomyces clavulig-erus: genetic organization of the region upstream of the car gene. Micro-biology 148:1427–1438.

36. Gomez-Escribano JP, Martín JF, Hesketh A, Bibb MJ, Liras P. 2008.Streptomyces clavuligerus relA-null mutants overproduce clavulanic acidand cephamycin C; negative regulation of secondary metabolism by(p)ppGpp. Microbiology 154:744 –755. http://dx.doi.org/10.1099/mic.0.2007/011890-0.

37. Tahlan K, Anders C, Wong A, Mosher RH, Beatty PH, Brumlik MJ,Griffin A, Hughes C, Griffin J, Barton B, Jensen SE. 2007. 5S clavambiosynthetic genes are located in both the clavam and paralog gene clustersin Streptomyces clavuligerus. Chem Biol 14:131–142. http://dx.doi.org/10.1016/j.chembiol.2006.11.012.

38. Medema MH, Trefzer A, Kovalchuk A, van den Berg M, Müller U,Heijne W, Wu L, Alam MT, Ronning CM, Nierman WC, BovenbergRAL, Breitling R, Takano E. 2010. The sequence of a 1.8-Mb bacteriallinear plasmid reveals a rich evolutionary reservoir of secondary metabolicpathways. Genome Biol Evol 2:212–224. http://dx.doi.org/10.1093/gbe/evq013.

39. Li B, Walsh CT. 2011. Streptomyces clavuligerus HlmI is an intramoleculardisulfide-forming dithiol oxidase in holomycin biosynthesis. Biochemis-try 50:4615– 4622. http://dx.doi.org/10.1021/bi200321c.

40. Liras P. 2014. Holomycin, a dithiolopyrrolone compound produced byStreptomyces clavuligerus. Appl Microbiol Biotechnol 98:1023–1030. http://dx.doi.org/10.1007/s00253-013-5410-z.

41. Kim MS, Dufour YS, Yoo JS, Cho YB, Park JH, Nam GB, Kim HM, LeeKL, Donohue TJ, Roe JH. 2012. Conservation of thiol-oxidative stress

responses regulated by SigR orthologues in actinomycetes. Mol Microbiol85:326 – 434. http://dx.doi.org/10.1111/j.1365-2958.2012.08115.x.

42. Onaka H, Taniguchi S, Igarashi Y, Fumurai T. 2002. Cloning of thestaurosporine biosynthetic gene cluster from Streptomyces sp. TP-A0274and its heterologous expression in Streptomyces lividans. J Antibiot 55:1063–1071.

43. O’Connor TJ, Kanellis P, Nodwell JR. 2002. The ramC gene is requiredfor morphogenesis in Streptomyces coelicolor and expressed in a cell type-specific manner under the direct control of RamR. Mol Microbiol 45:45–57. http://dx.doi.org/10.1046/j.1365-2958.2002.03004.x.

44. Yamazaki H, Takano Y, Ohnishi Y, Horinouchi S. 2003. amfR, anessential gene for aerial mycelium formation, is a member of the AdpAregulon in the A-factor regulatory cascade in Streptomyces griseus. MolMicrobiol 50:1173–1187. http://dx.doi.org/10.1046/j.1365-2958.2003.03760.x.

45. Li B, Forseth RR, Bowers AA, Schroeder FC, Walsh CT. 2012. A backupplan for self-protection: S-methylation of holomycin biosynthetic inter-mediates in Streptomyces clavuligerus. Chembiochem 13:2521–2526. http://dx.doi.org/10.1002/cbic.201200536.

46. Keijser B, van Wezel JG, Canters PGW, Vijgenboom EJ. 2002. Devel-opmental regulation of the Streptomyces lividans ram genes: involvementof RamR in regulation of the ramCSAB operon. J Bacteriol 184:4420 –4429. http://dx.doi.org/10.1128/JB.184.16.4420-4429.2002.

47. O’Connor TJ, Nodwell JR. 2005. Pivotal roles for the receiver domain inthe mechanism of action of the response regulator RamR of Streptomycescoelicolor. J Mol Biol 351:1030 –1047. http://dx.doi.org/10.1016/j.jmb.2005.06.053.

48. Flärdh K, Buttner MJ. 2009. Streptomyces morphogenetics: dissectingdifferentiation in a filamentous bacterium. Nat Rev Microbiol 7:36 – 49.http://dx.doi.org/10.1038/nrmicro1968.

49. Kodani S, Hudson ME, Durrant MC, Buttner MJ, Nodwell JR, WilleyJM. 2004. The SapB morphogen is a lantibiotic-like peptide derived fromthe product of the developmental gene ramS in Streptomyces coelicolor.Proc Natl Acad Sci U S A 101:11448 –11453. http://dx.doi.org/10.1073/pnas.0404220101.

50. Goto Y, Li B, Claesen J, Shi Y, Bibb MJ, van der Donk WA. 2010.Discovery of unique lanthionine synthetases reveals new mechanistic andevolutionary insights. PLoS Biol 8:e1000339. http://dx.doi.org/10.1371/journal.pbio.1000339.

51. Ueda K, Oinuma KG, Ikeda K, Hosono K, Ohnishi Y, Horinouchi S,Beppu T. 2002. AmfS, an extracellular peptidic morphogen in Streptomy-ces griseus. J Bacteriol 184:1488 –1492. http://dx.doi.org/10.1128/JB.184.5.1488-1492.2002.

52. Willey J, Santamaría R, Guijarro J, Geistlich M, Losick R. 1991. Extra-cellular complementation of a developmental mutation implicates a smallsporulation protein in aerial mycelium formation by S. coelicolor. Cell65:641– 650. http://dx.doi.org/10.1016/0092-8674(91)90096-H.

53. Ueda K, Hideaki T, Nishimoto M, Inaba H, Beppu T. 2005. Dualtranscriptional control of amfTSBA, which regulates the onset of cellulardifferentiation in Streptomyces griseus. J Bacteriol 187:135–142. http://dx.doi.org/10.1128/JB.187.1.135-142.2005.

54. Antelmann H, Helmann JD. 2011. Thiol-based redox switches and generegulation. Antioxid Redox Signal 14:1049 –1063. http://dx.doi.org/10.1089/ars.2010.3400.

55. Paget MS, Buttner MJ. 2003. Thiol-based regulatory switches. AnnuRev Genet 37:91–121. http://dx.doi.org/10.1146/annurev.genet.37.110801.142538.

56. D’Autréaux B, Toledano MB. 2007. ROS as signalling molecules: mech-anisms that generate specificity in ROS homeostasis. Nat Rev Mol Cell Biol8:813– 824.

Martínez-Burgo et al.

6648 aem.asm.org October 2015 Volume 81 Number 19Applied and Environmental Microbiology

on April 2, 2020 by guest

http://aem.asm

.org/D

ownloaded from