The human genome of is found where in the human body?
-
Upload
marshall-jaidyn -
Category
Documents
-
view
14 -
download
1
description
Transcript of The human genome of is found where in the human body?
![Page 1: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/1.jpg)
The human genome of is found where in the human body?
• Nucleus• Ribosome• Smooth ER• Cell membrane
![Page 2: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/2.jpg)
The cellular structure where proteins are made is called the
• Nucleus• Smooth ER• Ribosome• Cell membrane
![Page 3: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/3.jpg)
DNA and Biotechnology
![Page 4: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/4.jpg)
Announcements
• Circulation lab: Due Today!• Homework Assignment #2: Due Wednesday!• Textbook Reading:– Chapter 21: Pgs 449-461– Chapter 19: Pgs 406-412
• Online work: Chapter 21- Due Wednesday!
![Page 5: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/5.jpg)
Lecture Outline
• DNA- Structure, function, and importance• How DNA works– The central dogma– Transcription and Translation– The DNA code– DNA replication
• PCR- Function, usefulness, how it works• PCR Lab
![Page 6: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/6.jpg)
The importance of DNA
![Page 7: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/7.jpg)
The DNA double helix is the code of life
• The blueprint for all structures in your body which are made of protein
• DNA is comprised of nucleotides
![Page 8: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/8.jpg)
Nulceotides are the monomers of nucleic acid polymers
• Consist of a sugar, a phosphate, and a nitrogen-containing base
• Sugar can be deoxygenated
• Bases contain the genetic information
![Page 9: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/9.jpg)
There are 4 kinds of DNA bases
![Page 10: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/10.jpg)
Adenine always matches with
Thymine, Cytosine always
matches with Guanine-
Hydrogen bonds hold bases together
![Page 11: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/11.jpg)
Living things are extremely complex• Cellular machinery is
sophisticated and required for life
• Cellular machinery is made largely of proteins
• Blueprints for all cellular machinery are contained in genes
• Genes are inherited from parents
• Humans have ~30,000 genes
![Page 12: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/12.jpg)
Proteins give living things the variety of their structures
![Page 13: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/13.jpg)
Protein variety is generated by 1o structure- the sequence of amino acids
which make the protein
![Page 14: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/14.jpg)
Figure 2.12
Amino Acids
• Proteins consist of subunits called amino acids
![Page 15: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/15.jpg)
How DNA works
• Replication• Transcription• Translation
![Page 16: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/16.jpg)
The sequence of DNA bases is the code for the primary structure of
proteins
![Page 17: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/17.jpg)
All cells require a copy of the genome
• Genome- all the genes of the cell • Human genome is made of DNA• DNA is similar in all cells• Gene- 1 DNA Molecule (+
proteins the genetic information to produce a single product (protein)
• DNA replication copies all cellular DNA
![Page 18: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/18.jpg)
Replication of DNA
Figure 21.2
![Page 19: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/19.jpg)
In vivo, enzymes such as DNA polymerase make DNA replication happen
![Page 20: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/20.jpg)
The DNA code
![Page 21: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/21.jpg)
Computers use binary digital code
• 01100001 = A• 01100010 =B• 01000011 =c• 00100111 = apostrophe• Etc.
• http://www.geek-notes.com/tools/17/text-to-binary-translator/
01000011 01101000 01100101 01100101 01110011 01100101 01100010 01110101 01110010 01100111 01100101 01110010 00100000 01000100 01100101 01101100 01110101 01111000 01100101 = cheeseburger deluxe
![Page 22: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/22.jpg)
How does the DNA code work?
• atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttc=GFP
![Page 23: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/23.jpg)
The DNA code is (nearly)
universalIt uses groups of 3 bases (codon)
3 bases = 1 codon = 1 amino acid
![Page 24: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/24.jpg)
And what are these U’s for?
![Page 25: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/25.jpg)
RNA is ribonucleic acid
• Ribose sugar is not deoxygenated
• RNA is single-stranded
• RNA has Uracil, not Thymine
• There are many kinds: mRNA, rRNA, tRNA, siRNA, etc.
![Page 26: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/26.jpg)
RNA can fold back on itself
• Single strand offers greater flexibility
![Page 27: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/27.jpg)
Kinds of RNA
mRNA tRNA
![Page 28: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/28.jpg)
The Central Dogma of Molecular Biology
• DNA RNA Protein • DNARNA :
Transcription• RNA Protein:
Translation
![Page 29: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/29.jpg)
DNA RNA Protein Trait
![Page 30: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/30.jpg)
The Universality of the DNA code makes
this possible
Firefly gene (Luciferase) in a tobacco plant
![Page 31: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/31.jpg)
Transcription and Translation
![Page 32: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/32.jpg)
Transcription: DNA RNA
![Page 33: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/33.jpg)
DNA Codes for RNA, Which Codes for Protein
Figure 21.3
![Page 34: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/34.jpg)
DNA information is transcribed into mRNA
Note in DNA: sense strand vs. antisense strand
![Page 35: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/35.jpg)
Translation: RNA Protein
![Page 36: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/36.jpg)
tRNA’s carry an amino acid at one end, and have an anticodon at the other
Figure 21.6
Amino acid(phenylalanine)
mRNA
Anticodon
Amino acidattachment site:Binds to a specific amino acid.
Anticodon:Binds to codon on mRNA, following complementary base-pairing rules.
![Page 37: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/37.jpg)
The ribosome matches tRNA’s to the mRNA, thereby linking amino acids in
sequence
![Page 38: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/38.jpg)
tRNA’s add amino acids one by one according to mRNA instructions until the protein is complete
![Page 39: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/39.jpg)
In this way, the proteins in nature are virtually limitless
![Page 40: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/40.jpg)
Proteins are incredibly diverse at the molecular level
Insulin
ATP synthase
Rubisco
NitrogenaseFibrin
A few examples
Protein function depends greatly on shape
![Page 41: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/41.jpg)
In the DNA code, syntax is critical
• THE RED DOG ATE THE BIG CAT• THE RED DOT ATE THE BIG CAT• THG ERE DDO GAT ETH EBI GCA• THR EDD OGA TET HEB IGC AT • THE RED DOG ATE THE BBI GCA T• THE RED RED DOG ATE THE BIG CAT• RED DOG ATE THE BIG CAT
![Page 42: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/42.jpg)
Damaged DNA (a mutation) causes damaged proteins
![Page 43: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/43.jpg)
Consequences of a single base substitution
• Misshapen protein• Misshapen red blood
cell• Clogged capillaries• Cellular damage• Resistance to malaria
![Page 44: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/44.jpg)
Because the DNA code is universal, genes can be moved from one living thing to another
Figure 21.14 (1 of 2)
Step 1: Isolate DNA fromtwo sources.
Step 2: Cut both DNAswith the same restriction enzyme.
Step 3: When mixed, the DNAs recombine by base pairing.
Bacterium
Plasmid
Cell with gene of interest
Source (donor) DNA
Fragments of source DNA
![Page 45: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/45.jpg)
PCR
![Page 46: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/46.jpg)
PCR can replicate DNA in vitro
1. dNTPs2. Mg++ containing Buffer3. Taq polymerase4. Primers for your gene
of interest5. Thermal cycler6. A gene (piece of DNA)
you are interested in All together = DNA xerox
machine!
![Page 47: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/47.jpg)
PCR can replicate DNA in vitro• Step 1- Melting
– DNA denatures• Step 2- Annealing
– Primers bind to complementary sequences
• Step 3- Elongation– Taq DNA polymerase adds
free nucleotides to strands• Cycle is complete, DNA has
doubled• Process can begin again
![Page 48: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/48.jpg)
dNTPs
• Individual DNA nucleotides
• Four kinds- A, C, G, and T
• They match up with template DNA
![Page 49: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/49.jpg)
Taq Polymerase
• DNA polymerase isolated from Thermophilus aquaticus bacteria
• Lives in hot springs- heat resistant
• Optimal Taq temp- 72C
![Page 50: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/50.jpg)
Primers
• Single-stranded DNA sequences of 15-30 bp specific to gene of interest
• One at the 5’ start, the other at the 3’ end of your gene
![Page 51: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/51.jpg)
Thermal Cycler
• Melting point of DNA= ~94C
• Annealing temp = 55C
• Optimal Taq polymerase temp= 72C
![Page 52: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/52.jpg)
When one DNA molecule is copied to make two DNA molecules, the new DNA contains
1. A) 25% of the parent DNA. 2. B) 50% of the parent DNA. 3. C) 75% of the parent DNA. 4. D) 100% of the parent DNA. 5. E) none of the parent DNA.
![Page 53: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/53.jpg)
Importance of PCR
![Page 54: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/54.jpg)
With 6 billion base pairs in a human genome still means 6 million differences
![Page 55: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/55.jpg)
PCR can amplify DNA, a great help in forensics and diagnostics
• Other uses: modifying genes, detecting genes
• How it works:1. High heat breaks H-bonds
between base pairs2. Primers bind to sequence of
interest3. Heat-tolerant Taq
polymerase copies4. Goto 15. Each round doubles the
amount of DNA
![Page 56: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/56.jpg)
DNA is pretty stable, and ancient DNA can be studied- PCR allows amplification of a very small
sample
![Page 57: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/57.jpg)
Whodunnit? Suspect 1 or
2?
![Page 58: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/58.jpg)
Genetic Engineering
Figure 21.15
![Page 59: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/59.jpg)
Genetic Engineering
Figure 21.15 (1 of 2)
Step 1:Double-stranded DNA is unzipped by gentle heating, forming single strands that serve as templates for new strands.
Step 2: The templates are mixed with primers, nucleotides, and DNA polymerase.
Step 3: The mixture is cooled to allow for base pairing.
Primer
+
Double-stranded DNAsample
![Page 60: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/60.jpg)
Genetic Engineering
Figure 21.15 (2 of 2)
Step 4:Complementary DNA strands form on each template strand. The amount of DNA is now doubled.
Repeatprocedure: The amount of DNA is doubled again.
The procedure is repeated many times, doublingthe amount of DNA with each round.
![Page 61: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/61.jpg)
Different sequences of DNA are cut by
different restriction enzymes
• Sequences which are cut differently have different sized pieces
• Electrophoresis can differentiate them in the same way
![Page 62: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/62.jpg)
Human DNA can differ in length at various sites
![Page 63: The human genome of is found where in the human body?](https://reader035.fdocuments.us/reader035/viewer/2022062422/5681361c550346895d9d9175/html5/thumbnails/63.jpg)
DNA of different length is easily measured using gel electrophoresis