The functional relevance of passenger leukocytes and microchimerism for heart allograft acceptance...

1292 NATURE MEDICINE • VOLUME 5 • NUMBER 11 • NOVEMBER 1999

ARTICLES

Donor-derived hematopoietic cells are transferred to the recipi-ent by organ transplantation. These cells can be detected inblood and tissues of graft recipients, a state called hematopoietic‘microchimerism’. Persistence of donor-derived cells in bloodand in peripheral tissues of long-term stable organ transplant re-cipients has been descibed1,2, and an essential role for this persis-tent microchimerism for long-term graft acceptance has beensuggested3,4. A correlation between the degree of mi-crochimerism in blood and postoperative allograft function hasalso been described5; however, most studies have not been ableto show a correlation between microchimerism and the post-transplant immunological risk in clinical as well as experimentaltransplantation6–9. Those last observations indicate that mi-crochimerism in graft recipients may be a consequence of long-term graft acceptance rather than the cause.

To clarify the functional relevance of microchimerism for allo-graft acceptance, we selectively depleted donor-derivedhematopoietic cells in recipients of allogeneic heart grafts usinga di-allelic genetic polymorphism (RT7 system) of the commonleukocyte antigen (CD45). The RT7 allotypes (RT7a and RT7b) arepresent on all CD45 isoforms generated by alternative splicing.They are of very low immunogenicity, and an allotype differencedoes not induce graft rejection10,11. Because of the selective ex-pression of CD45/RT7 antigens on hematopoietic cells, particu-larly on leukocytes, allotype-specific antibodies againstdonor-type RT7 could be valuable tools for selective targeting ofdonor-derived hematopoietic cells without affecting any othercells of the graft in organ transplantation with RT7-disparatestrain combinations. Here, we determined whether depletion ofpassenger leukocytes by a monoclonal antibody against RT7a in arat heart transplant model of cyclosporine-induced tolerance isable to modify the development of allograft acceptance.

Efficacy of in vivo hematopoietic cell depletionWe first tested the ability of the monoclonal antibody detectingthe RT7a allotype in chimeras created by injection of LEW (RT7a)rat lymph node cells into congenic LEW.7B (RT7b) recipients

(Fig. 1). Before treatment with monoclonal antibody againstRT7a on day 21, injected LEW (RT7a) cells and their progenymade up 5% of peripheral blood leukocytes in the LEW.7B recip-ients. A single intravenous injection of 10 mg/kg monoclonalantibody against RT7a depleted the circulating donor cells within24 hours to less than 0.1% (day 22 after cell transfer). In contrast,chimeric rats not receiving the monoclonal antibody injectionshowed persistence of the transferred cells (4% of peripheralblood leukocytes) for more than 28 days. All rats were killed onday 28 to analyze leukocytes in lymphoid organs. We analyzedsingle-cell suspensions of lymph node, spleen and bone marrowcells by fluorescence-activated cell sorting (FACS) to detect in-jected cells in these organs. Injected LEW cells were depleted inthese organs in rats treated with monoclonal antibody (< 0.1%),whereas they were detectable (4–5%) in untreated rats (data notshown). Moreover, the monoclonal antibody was also able toeliminate RT7a multilineage hematopoietic cells in stable allo-geneic mixed bone marrow chimeras (LEW.1W × LEW.7B), andto cause lethal bone marrow aplasia after two injections (with aninterval of a few days) into RT7a rats (data not shown). Thesefindings indicate the potency of the available RT7 allotype-spe-cific monoclonal antibody for efficient systemic depletion ofmultilineage hematopoietic chimerism.

Antibody treatment after heart transplantationWe next studied the effect of the depletion of donor-derivedhematopoietic cells by the monoclonal antibody against RT7a

in LEW.7B (RT7b) recipients of major histocompatibility com-plex (MHC)-incompatible LEW.1W (RT7a) heart grafts. In thisstrain combination, long-term graft survival is obtained bytransient cyclosporine treatment for 14 days. To study the de-velopment and functional relevance of microchimerism in thissetting, we analyzed the following groups of rats (Table 1): sixrats received no treatment with monoclonal antibody (groupA); six rats were given a single dose (10 mg/kg) of monoclonalantibody against RT7a intravenously immediately after reperfu-sion of the graft (day 0; group B); and six rats received the same

The functional relevance of passenger leukocytes andmicrochimerism for heart allograft acceptance in the rat

SAIHO KO, ANDREA DEIWICK, MARK D. JÄGER, ASTRID DINKEL, FRANK ROHDE, RAINER FISCHER,TUNG-YU TSUI, KARL L. RITTMANN, KURT WONIGEIT & HANS J. SCHLITT

Klinik für Viszeral-und Transplantationschirurgie, Medizinische Hochschule Hannover, Carl-Neuberg Strasse 1, D-30623 Hannover, Germany

Correspondence should be addressed to H.J.S.; email: [email protected]

With an organ transplant, hematopoietic donor cells are transferred to the recipient. To study therelevance of the resulting microchimerism for allograft acceptance, we analyzed a rat model of cy-closporine-induced tolerance for strongly incompatible heart allografts. Using a monoclonal anti-body that detects a donor-specific CD45 allotype (RT7a), we selectively depleted donor leukocytesat different times after transplantation (days 0 or 18). Depletion was similarly effective at bothtimes. However, only depletion on day 0 prevented tolerance induction and was associated withsevere acute or chronic graft rejection. This indicates that passenger leukocytes have an essentialimmunomodulatory effect on the induction phase of allograft acceptance.

© 1999 Nature America Inc. • http://medicine.nature.com©

199

9 N

atu

re A

mer

ica

Inc.

• h

ttp

://m

edic

ine.

nat

ure

.co

m

NATURE MEDICINE • VOLUME 5 • NUMBER 11 • NOVEMBER 1999 1293

ARTICLES

dose of monoclonal antibody against RT7a on postoperativeday 18 (group C). Six recipients of allogeneic heart transplantswithout cyclosporine treatment (group D), and six recipients ofisogeneic transplants (male LEW.7B donor organs into femaleLEW.7B recipients; group E) served as controls.

Microchimerism in bloodAlthough control rats showed persistent presence of donor-typeDNA in their blood for more than 10 weeks after transplanta-tion, treatment with monoclonal antibody against RT7a on ei-ther day 0 or day 18 led to the subsequent loss of PCR-detectabledonor-type signals in peripheral blood from the transplantedrats (Fig. 2). The main difference between groups B and C wasthe consistent presence of microchimerism during the first 2weeks in group C; only one rat in group B had a positive resultduring this period. Although depletion of microchimerism bytreatment with monoclonal antibody was obviously very effec-tive, some treated rats sporadically had positive PCR results atcertain times after transplantation.

Microchimerism in tissuesTo obtain more detailed information about the effect of anti-body treatment on microchimerism, we used a very sensitivePCR analysis of tissues from rats killed in the early phase (day 30)or in the late phase (day 200). Of three rats per group killed onday 30, those without antibody treatment had positive resultsfor Y-chromosome-specific PCR in blood and (faintly) in thymussamples, whereas liver, lymph nodes and bone marrow producednegative results. In contrast, rats that had received antibodytreatment on day 0 had negative results in blood and thymussamples, as did the rats that had received antibody on day 18.Rats of all three groups, however, had positive PCR results inspleen samples.

On day 200, all of six rats not treated with monoclonal anti-body had consistently positive PCR results for Y-chromosome

markers in thymus samples, and four of six rats also had faintlypositive results in lymph node samples. After antibody treatmenton day 0 as well as on day 18, none of six rats per group had pos-itive PCR findings in thymus samples (Table 2). However, spleenand liver tissue produced positive PCR results in all rats with andwithout monoclonal antibody treatment. In immunohistologyusing a monoclonal antibody against RT7a, however, no donor-type leukocytes could be detected in any of the tissues studied atday 200. Thus, there was a considerable difference in the distrib-ution of donor-derived DNA signals in rats with and without an-tibody treatment concerning their detection in the thymus, bothin the early and late phase after transplantation. There was, how-ever, no detectable difference between rats after antibody treat-ment on day 0 or on day 18.

Effect of antibody treatment on allograft acceptanceRats not treated with monoclonal antibody and with persistentdonor-type microchimerism in blood showed long-term allo-graft acceptance with good graft function for more than 200days. These findings were identical in rats in which mi-crochimerism was depleted on postoperative day 18. In contrast,of the six rats that had received monoclonal antibody treatmenton day 0, one rat showing no evidence of microchimerism inblood at days 14 and 21 acutely rejected its graft on postopera-tive day 23; in all others, the grafts survived for 200 days, butcontractility had become very weak (Table 1). This considerablefunctional difference was explained by the histological findingsof the grafts at day 200, when all rats were killed. Although thegrafts of rats not treated with monoclonal antibody (Fig. 3a, dand g) or with treatment on day 18 (Fig. 3c, f and i) showed no oronly minimal signs of inflammation and graft vasculopathy,samples from rats that had received treatment with monoclonalantibody against RT7a on day 0 showed strong cellular infiltra-tion and severe graft vasculopathy (Fig. 3b, e and h and Table 3).The one rat of this group that had produced a positive PCR resultat week 2 had the mildest degree of graft damage compared withthat of the others.

Cytokine mRNA expression in graftsAnalysis of cytokine gene expression within grafts by competi-tive RT–PCR showed that there were considerable increases in cy-

Fig. 1 In vivo effect of treatment with monoclonal antibody against RT7a

on circulating RT7a-positive blood cells. LEW (RT1l, RT7a) lymph node cellswere injected into congeneic LEW.7B (RT1l, RT7b) rats and depleted by asingle injection of monoclonal antibody against RT7a on day 21 after celltransfer. Analysis of peripheral blood mononuclear cells by staining with an-tibodies specific for RT7a and RT7b shows complete depletion of RT7a posi-tive cells after antibody treatment (< 1%) and persistence of 4% RT7a cellsin the absence of antibody treatment. Upper left and right corners, percent-age of cells in quadrant.

Fig. 2 Serial analyses of peripheral blood microchimerism by PCR for a Y-chromosome marker. Allograft recipients not treated with monoclonal an-tibody (no Mab) show positive microchimerism (�) for at least 100 daysafter transplantation. After treatment with monoclonal antibody againstRT7a (mAb) on either day 0 or day 18, most allograft recipients show con-sistently negative PCR results (�), although positive results are sometimesobtained. Each column of symbols represents findings obtained in an indi-vidual animal.

Before treatment(day 21)

24 h aftertreatment(day 22)

RT7a (donor type) RT7b (recipient type)

RT1.A1(M

HC

class I)

Control rat(day 28)

Weeks aftertransplant

Allograft recipients

no mAb mAb on day 0 mAb on day 18


199

9 N

atu

re A

mer

ica

Inc.

• h

ttp

://m

edic

ine.

nat

ure

.co

m


ARTICLES

tokine mRNA transcripts only in some rats after treatment withmonoclonal antibody on day 0, although the inter-individualvalues varied considerably (Fig. 4). Only gamma interferon (IFN-γ) expression showed a statistically significant difference be-tween rats treated with monoclonal antibody on day 0 and thoseof other experimental groups (P < 0.05). The cytokine analysesindicate that the cellular infiltrates on day 200 in these rats rep-resent a strong ongoing immune response.

DiscussionIn the strongly incompatible heart transplant model, transientcyclosporine treatment consistently leads to long-term accep-tance with excellent graft function and only minimal histologi-cal signs of chronic rejection by postoperative day 200.Depletion of graft-associated passenger leukocytes immediatelyafter transplantation (day 0) results in severechronic rejection associated with an ongoing im-mune process12 and graft dysfunction in the longterm or, individually, to early graft loss fromacute rejection. In contrast, later depletion ofpassenger leukocytes (day 18) had no detectableadverse effect on graft function and histologycompared with that in untreated rats. The pro-found effect seen after early but not late deple-tion strongly indicates that passenger leukocytestransmitted by a heart allograft may have largebeneficial immunomodulatory effects.

Donor leukocytes transferred by an allogeneicorgan are essential for sensitizing the recipient’simmune system through direct presentation ofthe respective alloantigens13. Apart from this neg-ative effect on graft survival, positive effects ofpassenger leukocytes have also been suggested,particularly in liver transplantation14. Moreover,passenger hematopoietic cells transferred withthe graft are also considered as basis for what iscalled ‘microchimerism’, a phenomenon oftenseen after various types of experimental and clin-ical organ transplantation3,6,9. This phenomenonalso occurs in the rat model of long-term heart al-lograft acceptance induced by transient cy-closporine treatment. In control rats here,persistent microchimerism was indicated by theconsistent detection of (donor-type) Y-chromo-some DNA sequences in blood and later also inthymus of transplanted rats by a sensitive PCR

technique. After rats were treated with a monoclonal antibodydirected selectively against a donor-specific allotype of theleukocyte common antigen (CD45), the positive PCR results dis-appeared almost completely in samples from blood and thymus,indicating substantial depletion of the donor-derivedhematopoietic cells by this treatment, whether treatment wasgiven on day 0 or on day 18 after transplantation. Thus, anti-body treatment at either time obviously led to a considerableand apparently similarly effective decrease in graft-associatedmicrochimerism.

In our experiments, complete depletion of hematopoietic mi-crochimerism by antibody treatment cannot be proven conclu-sively. In fact, the sporadically detectable weak PCR signals inblood from some antibody-treated rats as well as consistentlypositive PCR findings for donor-type DNA in liver and spleen ofall rats by day 200 may raise some doubts. However, the positivePCR results for donor-specific DNA sequences after organ trans-plantation do not prove the presence of hematopoietic cells,that is, true microchimerism. Positive PCR results in blood andtissues of the recipient may also be due to non-hematopoieticdonor cells, such as endothelial cells, that are released from thegraft and are degraded in the reticuloendothelial system. As thepositive PCR results in antibody-treated rats were mainly inliver and spleen samples, this explanation must be considered,particularly as no donor-type hematopoietic cells could bedemonstrated by immunohistology. In the long term, the fre-quency and distribution of donor-specific PCR patterns wereidentical after antibody treatment on day 0 and day 18. As onlytreatment on day 0 was associated with a deleterious effect onlong-term graft acceptance, the findings strongly indicate thatin this model, graft-derived passenger cells contribute to the de-

Table 1 Experimental groups and heart graft survival

Strains Treatment

Group Donor Recipient CsA Anti-RT7a mAb Graft survival (days)

A LEW.1W LEW.7B + – >200 × 6B LEW.1W LEW.7B + day 0 23*, >200 × 5C LEW.1W LEW.7B + day 18 >200 × 6D LEW.1W LEW.7B – – 7 ×3*, 8 × 3*

E LEW.7B LEW.7B – – >200 × 6

n = 6 per group. CsA, cyclosporine (injected intramuscularly at a dose of 15 mg/kg perday from day 0 to day 13; +, injected; –, not injected); Anti-RT7a mAb, monoclonal an-tibody against RT7a (10 mg/kg injected through the tail vein on day 0 or day 18; –, notinjected). For graft survival, the graft was palpated daily to assess heartbeat until day200; rats were killed for histological evaluation when the heart stopped beating.*Histology of graft showed severe acute rejection.

Fig. 3 Graft histology on day 200 after transplantation. Allografts not treated with mono-clonal antibody against RT7a (group A; a,d,g) or allografts after treatment with monoclonalantibody against RT7a on day 0 (group B; b,e,h) or day 18 (group C; c,f,i), stained withhematoxylin and eosin (a–c), monoclonal antibody against αβ-T-cell receptor (d–f) or mon-oclonal antibody against ICAM-1 (g–i). Severe destruction and fibrosis of myocytes with ex-tensive infiltration of mononuclear cells are shown by hematoxylin and eosin staining in ratstreated with monoclonal antibody against RT7a on day 0 (b), whereas there are no or onlyminimal pathologic findings in other groups (a and c). Immunohistology shows that infiltra-tion of cells positive for T-cell receptor (e) and ICAM-1 expression (h) are considerablygreater in grafts of rats treated with monoclonal antibody against RT7a on day 0 than inother rats. h, Severe myointimal proliferation is present. These findings in rats treated withmonoclonal antibody against RT7a on day 0 are consistent with chronic rejection. Originalmagnification, ×100.

a

b

c

d

e

if

g

h


199

9 N

atu

re A

mer

ica

Inc.

• h

ttp

://m

edic

ine.

nat

ure

.co

m


ARTICLES

velopment of allograft acceptance during the early, inductionphase. A functional relevance of potentially persisting donorcells during the later, maintenance phase of graft acceptancecould not be shown by our experiments.

Detailed analysis of graft-associated microchimerism afterclinical transplantation has indicated that the early postopera-tive phase and the long-term phase must be considered sepa-rately2,4,15,16. In the early postoperative period (about 2–3 weeks),microchimerism is mainly due to the redistribution of (mature)donor-type T, B and natural killer lymphocytes ‘washed out’from the graft17 and to the migration of antigen-presentingcells18. In the later postoperative period, detection of a very lowlevel of microchimerism generally requires very sensitive PCRtechniques. This late phase, which is often separated from theearly phase by a period without detectable microchimerism inblood, may be due to the survival and engraftment of a fewdonor-type hematopoietic stem cells16 originating from theorgan graft19. In conjunction with our experimental results,these observations indicate that both phases also differ in theirfunctional relevance.

The huge number of passenger leukocytes in liver allograftsmay have a considerable immunomodulatory effect20. The de-velopment of spontaneous liver allograft acceptance in a ratmodel can be prevented by irradiation of donor animals beforeorgan collection14. As irradiation produces very effective deple-tion of leukocytes, particularly of lymphocytes, it was con-cluded that these cells have considerable functional relevancefor the development of tolerance in this model14. In addition tothe depletion of leukocytes, however, irradiation also has othereffects on the tissues, including an increase in tissue immuno-genicity21. Therefore, from these frequently used models, itcannot be concluded that the depletion of passenger leuko-cytes was responsible for the observed break of tolerance. Onthe basis of observations in the so-called ‘parking’ model, itwas concluded that both passenger leukocytes as wellas parenchymal tissues contribute to spontaneous livergraft acceptance22. These studies14,22, however, focusedon models of spontaneously accepted liver grafts. Ourmodel has conclusively shown that very selective de-pletion of the small number of passenger cells in aheart graft can also be of considerable functional rele-vance.

Alloantigen-expressing spleen cells but not infusionof soluble peptide can induce long-term skin graft ac-ceptance for a single class I-presented antigen (gp33)(ref. 23). After comparison of the effect of gp33 peptideas transient antigen with that of gp33-expressingspleen cells as long-lasting antigen, it was suggestedthat long-term graft acceptance in this model dependson persistence of the tolerizing donor antigen.However, the duration of the tolerizing antigen is not

the only difference between these two types of antigen. Theroutes of administration, the nature of the antigen and probablythe tissue distribution also differ. Spleen cells can act as antigen-presenting cells that directly stimulate a T-cell response,whereas the soluble protein antigen gp33 must first beprocessed by recipient-type antigen-presenting cells. Althoughadditional antigen presentation seems relevant in this weaklyimmunogeneic skin graft model, this does not necessarily indi-cate that long-term persistence of the antigen-expressing leuko-cytes, or microchimerism, is also required for tolerance of organallografts expressing large amounts of strongly allogeneic MHCmolecules.

How the donor-derived hematopoietic cells contribute to theinduction of allograft acceptance in the early post-transplantperiod in the model remains to be elucidated. As lymphocytesare numerically the main constituent in the early postoperativephase of microchimerism16, and as T lymphocytes are particu-larly sensitive to in vivo elimination by a single injection ofmonoclonal antibody against RT7 antibodies (M.D.J. et al., un-published data), perhaps donor T cells are responsible for thefunctional effect seen. Potential mechanisms include inductionof anergy in recipient T cells by non-professional presentationof alloantigens by transferred donor T cells24,25; limited graft-versus-host effects, causing a suppression of the recipient’s im-mune system26; or ‘veto’ effects, which have been demonstratedin rodent27 as well as monkey28 and human systems29. However,these immunological effects of early postoperative mi-crochimerism are different from those of stable mixed allo-geneic (macro)chimerism, which is associated with stabledonor-specific transplantation tolerance due to thymic, dele-tional mechanisms30,31.

In conclusion, our study has demonstrated that small num-bers of donor-derived hematopoietic cells, such as those trans-ferred by a heart allograft, may have importantimmunoregulatory functions after organ transplantation, thedetails of which have not been fully elucidated. Our resultsalso show that the most relevant beneficial effect of these cellsis limited to the early postoperative phase, that is, the induc-tion events of allograft acceptance/tolerance. Early postopera-tive immunological interactions seem essential for thedevelopment or prevention of chronic rejection in the longterm. A requirement for long-term persistence of donor leuko-cytes (that is, low-level microchimerism) for the maintenanceof acceptance/tolerance could not be demonstrated in theseexperiments.

Table 2 Microchimerism in tissues on day 200

Positive PCR resultsGroup Spleen Liver LN Thymus BM Heart

A (no antibody treatment) 6/6 6/6 4/6 6/6 0/6 5/6B (antibody treatment day 0) 5/5 5/5 0/5 0/5 0/5 0/5C (antibody treatment day 18) 6/6 6/6 0/6 0/6 0/6 0/6

The tissues of all surviving heart allograft recipients were analyzed for microchimerismon day 200, by PCR for a (donor-type) Y-chromosome marker. Data represent positiveresults/tested rats. LN, lymph nodes; BM, bone marrow; Heart, native heart.

Table 3 Histology of heart grafts on day 200

AllograftsIsografts no mAb mAb day 0 mAb day 18(group E) (group A) (group B) (group C)

Myointimal proliferation 0.0 ± 0.0 0.8 ± 0.8 2.6 ± 0.5b 0.7 ± 0.5of coronary arteriesa

MHC class II 0.0 ± 0.0 1.0 ± 0.6 2.8 ± 0.4* 1.0 ± 0.0expressionb

ICAM-1 0.0 ± 0.0 0.8 ± 0.4 2.6 ± 0.9* 1.2 ± 0.4expressionb

α/β-TCR+ cell infiltrationc 27 ± 24 57 ± 31 1094 ± 588* 38 ± 30

Grafts of all surviving rats were analyzed on day 200 (group E, n = 5; group A, n = 6; group B, n =5; group C, n = 6). Data represent mean ± s.d. for each group. aSemiquantitative scoring of vessels(scores, 0–3). bSemiquantitative scoring (scores, 0–3). cTotal number of positively stained infiltratesin ten high-power fields. mAb, monoclonal antibody; TCR, T-cell receptor. *, P < 0.05, group Bcompared with all other groups.


199

9 N

atu

re A

mer

ica

Inc.

• h

ttp

://m

edic

ine.

nat

ure

.co

m


ARTICLES

MethodsAnimals. The rat strains used were LEW.1W/Ztm and LEW/Ztm, main-tained in the Central Animal Laboratory of the Medizinische HochschuleHannover, and LEW.7B/Won, originally called LEW.LY1.2 (ref. 10), main-tained in the rat colony of one of the authors (K.W.).

Heart transplantation model. Heart grafts from male LEW.1W (RT1u,RT7a) donors were transplanted heterotopically into the abdomens ofcompletely MHC-disparate and RT7-different female LEW.7B (RT1l, RT7b)recipients by a published method32. After transplantation, graft contrac-tion was evaluated daily by palpation. Rejection of allografts was definedas cessation of visible or palpable cardiac contractions and was con-firmed by histologic analysis. Rats were treated from day 0 to day 13after transplantation with intramuscular injection of 15 mg/kg per day ofcyclosporine (Novartis, Nürnberg, Germany) dissolved in olive oil.

Monoclonal antibody against RT7a. The rat monoclonal antibody of theIgG2b isotype with specificity for the RT7.1 epitope was produced instudies of the RT7 system (K.W. and A.D., unpublished data). This anti-body reacts with the gene product of the RT7a allele and is called mono-clonal antibody against RT7a. Culture supernatant from the hybridomaproducing this monoclonal antibody was purified by affinity chromatog-raphy using Protein-G 4 Fast Flow (Pharmacia), and was dissolved in PBSfor intravenous injection.

Monoclonal antibodies for flow cytometry and immunohistology. TheRT7b gene product was detected by mouse monoclonal antibody HIS41directed against the RT7.2 specificity11. Other monoclonal antibodiesused were G4.18 (mouse monoclonal antibody against CD3), 5F3A (ratalloantibody against RT1.Al), 3.2.3, R73 (mouse monoclonal antibodyagainst α/β-T-cell receptor), OX-12 (mouse monoclonal antibody againstrat immunoglobulin), OX-1 (mouse monoclonal antibody against CD45common), OX-4 (mouse monoclonal antibody against rat MHC class II)and 1A29 (mouse monoclonal antibody against ICAM-1).

Evaluation of leukocyte depletion in vivo. To evaluate the depleting effectof monoclonal antibody against RT7a in vivo, 2 × 108 lymph node cells ofLEW (RT1l, RT7a) rats were injected intravenously into congeneic LEW.7B(RT1l, RT7b) rats. Because they are syngeneic except for RT7, LEW cells arenot rejected in LEW.7B rats and can persist for prolonged periods. The pres-ence of injected LEW cells in peripheral blood of the LEW.7B rats was de-

tected by flow cytometry using two-color staining with biotinylated mono-clonal antibody against RT1.Al (5F3A) and FITC-conjugated monoclonal an-tibody against RT7a as described33. Staining with monoclonal antibodyagainst RT7b (HIS41) was used to show the recipient origin of RT7a-negativecells and to exclude the possibility that RT7a cells were not detected be-cause of coating with injected monoclonal antibody against RT7a. Single-cell suspensions of lymph node, spleen and bone marrow cells wereprepared as described34, and were also analyzed by FACS to detect injectedcells in these organs.

Histology. All grafts were analyzed histologically on day 200, and slideswere evaluated by experimenters ‘blinded’ to sample identity. The degreeof myointimal proliferation was assessed by staining with hematoxylinand eosin as described35,36. All arteries of the largest vertical cross-sectionof the graft ventricle that were visible with low-power magnification (×40)were scored using high-power magnification (×300) as follows: 0, no lu-minal narrowing; 1 (mild), 5–20% narrowing; 2 (moderate), 21–60% nar-rowing; 3 (severe) >60% narrowing. The median score of all vesselsassessed was used as the score of the graft. Immunoperoxidase micro-scopic studies were done as described37. Sections were stained withmouse monoclonal antibodies against rat, reactive with rat MHC class II(OX-4), ICAM-1 (1A29) or T-cell receptor (R73). The intensity of expres-sion was assessed semiquantitatively using a scale from 0 (no expression)to 3 (maximal expression) as described37. The number of positively stainedinfiltrates were counted in ten high-power fields (magnification, ×400) ineach section of all rats; the result represents the sum of counts from tenhigh-power fields per graft. All scored values were analyzed by a Mann-Whitney U test; the number of cells positive for α/β-T-cell receptor wereanalyzed by an unpaired Student t-test.

PCR for detection of microchimerism. Genomic DNA was preparedusing Tripure Isolation Reagent (Boehringer) from peripheral leuko-cytes isolated from 1 ml of heparinized whole blood samples or ‘snap-frozen’ tissues. The PCR mixture contained 0.5 µg genomic DNA, 1 UTaq DNA polymerase (Quiagen), 25 pmol rat Sry-gene specific oligonu-cleotide primers (5’–CCCGCGGAGAGAGGCACAAGT–3’ and5’–TAGGGTCTTCAGTCTCTGCGC–3’), 0.5 µl of 2 µmol/1dNTP, and 5µl 10× PCR buffer containing 15 µl/1 MgCl2, pH 8.3). DNA was ampli-fied by 40 cycles of denaturation, annealing and extension. Productswere separated by electrophoresis in a 2% agarose gel, then visualizedby staining with ethidium bromide. The Sry-gene specific oligonu-cleotide primers amplified Sry-gene of male donors with a minimal de-tection level of 1:105 (male:female cells).

Competitive RT–PCR. Cytokine mRNA was analyzed by quantitativeRT–PCR with a modification of described method38. Total RNA was isolatedfrom ‘snap-frozen’ tissues of grafts using RNeasy Mini Kit (Quiagen) andwas reverse-transcribed into cDNA using Superscript (Life Technologies).Before cytokine cDNA concentration was determined, the total cDNA sam-ples were adjusted to equal input concentration based on their content ofglyceraldehyde phosphate dehydrogenase (GAPDH), a ‘housekeeping’gene. The GAPDH content was determined by competitive PCR usingcommercially available primers for GAPDH (forward, 5’–ACCACAGTCCAT-GCCATCAC–3’; reverse, 5’–TCCACCACCCTGTTGCGTTA–3’; MWG-Biotech, Ebersberg, Germany). Sample cDNA was co-amplified withknown monocompetitor fragments synthesized by composite primers (for-ward, 5’–ACCACAGTCCATGCCATCACGAGGGTTAATTTCGAGCTTG–3’;reverse, 5’–TCCACCACCCTGTTGCTGTAATAACCGTATTACCGCCTT–3’;MWG-Biotech, Ebersberg, Germany) as described39. The competitive cy-tokine PCR used primers and competitors for interleukin (IL)-2, IL-4, IL-10,IFN-γ, transforming growth factor (TGF)-β and CD25 (IL-2 receptor) genesas described40. The PCR products were separated by agarose gel elec-trophopresis and visualized by staining with ethidium bromide. The mag-nitude of gene expression was quantified by scanning the visualized bandsusing electrodensitometry (NIH software). Results were calculated by astandard curve of amplification for each gene, generated for a wide rangeof competitor concentrations.

AcknowledgmentsThe authors thank L. Hänisch for animal care, M. Giesecke for microsurgical

Fig. 4 Cytokine mRNA expression in heart graft tissue on day 200, ana-lyzed by quantitative RT–PCR. Dots, results of individual rats; horizontalbars, median values. Units for vertical axis: IL-2 and IL-4, ag/100 fg GAPDH;IL-10, IL-2R, IFN-γ and TGF-β, ag/fg GAPDH. IFN-γ expression is significantlyhigher (*, P < 0.05) in rats treated with monoclonal antibody against RT7a

on day 0 (lane 3) than in other rats (lane 1, isografts; lane 2, no antibodytreatment; lane 4, antibody treatment, day 18). Some intense signals for IL-4, IL-10, IL-2R, TGF-β mRNA were also obtained in samples from ratstreated with monoclonal antibody on day 0, but these values vary consider-ably and show no statistically significant difference.

IL-2 IL-4 IL-10 Il-2R IFN-γ TGF-β

amou

nt o

f PC

R p

rod

ucts


199

9 N

atu

re A

mer

ica

Inc.

• h

ttp

://m

edic

ine.

nat

ure

.co

m


ARTICLES

assistance and M.W. Hoffmann for critical review of the manuscript. This workwas supported by the Deutsche Forschungsgemeinschaft throughSonderforschungsbereich 265. S.K. was supported by a fellowship of theAlexander von Humboldt Stiftung; his present affiliation is First Department ofSurgery, Nara Medical University, Kashihara, Nara 634, Japan.

RECEIVED 6 JUNE; ACCEPTED 7 SEPTEMBER 1999

1. Starzl, T.E. et al. Cell migration, chimerism, and graft acceptance. Lancet 339,1579–1582 (1992).

2. Starzl T.E. et al. Cell migration and chimerism after whole organ transplantation:The basis of graft acceptance. Hepatology 17, 1127–1152 (1993).

3. Starzl, T.E. et al. Donor cell chimerism permitted by immunosuppressive drugs: anew view of organ transplantation. Immunol. Today 14, 326–332 (1993).

4. Starzl, T.E. & Zinkernagel, R.M. Antigen localization and migration in immunityand tolerance. N. Engl. J. Med. 339, 1905–1913 (1998).

5. McSherry, C. et al. Sequential measurement of peripheral blood allogeneic mi-crochimerism levels and association with pulmonary function. Transplantation 62,1811–1818 (1996).

6. Wood, K. & Sachs, D.H. Chimerism and transplantation tolerance: cause and ef-fect. Immunol. Today 17, 584–587 (1996).

7. Schlitt, H.J. et al. Patterns of donor-type microchimerism after heart transplanta-tion. Lancet 343, 1469–1471 (1994).

8. Schlitt, H.J., Hundrieser, J., Ringe, B. & Pichlmayr, R. Systemic microchimerism ofdonor-type associated with irreversible acute liver graft rejection eight years aftertransplantation. N. Engl. J. Med. 330, 646–647 (1994).

9. Hisanaga, M. et al. Development, stability, and clinical correlations of allogeneicmicrochimerism after solid organ transplantation. Transplantation 61, 40–45(1996).

10. Wonigeit, K. Characterization of the RT-Ly-1 and RT-Ly-2 alloantigenic systems bycongenic rat strains. Transplant. Proc. 11, 1631–1635 (1979).

11. Kampinga, J. et al. RT7-defined alloantigens in rats are part of the leukocyte com-mon antigen family. Scand. J. Immunol. 31, 699–710 (1990).

12. Heidecke, C.-D. et al. α/β-T cell receptor-directed therapy in rat allograft recipi-ents. Transplantation 61, 948–956 (1996).

13. Lechler, R.I. & Batchelor, J.R. Restoration of immunogenicity to passenger cell-de-pleted kidney allografts by the addition of donor strain dendritic cells. J. Exp. Med.155, 31–41 (1982).

14. Sun, J. et al. Deletion of spontaneous rat liver allograft acceptance by donor irradi-ation. Transplantation 60, 233–236 (1995).

15. Schlitt, H.J. Is microchimerism needed for allograft tolerance? Transplant. Proc. 29,82–84 (1997).

16. Ueda, M. et al. Development of microchimerism in pediatric patients after living-related liver transplantation. Clin. Transplant. 11, 193–199 (1997).

17. Schlitt, H.J. et al. Persistence of donor lymphocytes in liver allograft recipients.Transplantation 56, 1001–1007 (1993).

18. Larsen, C.P, Morris, P. & Ausytn, J.M. Migration of dendritic leukocytes from car-diac allografts into host spleens: a novel pathway for initiation of rejection. J. Exp.Med. 171, 307–314 (1990).

19. Murase, N. et al. Effect in supralethally irradiated rats of granulocyte colony-stim-ulating factor and lisofylline on hematopoietic reconstitution by syngeneic bonemarrow or whole organ passenger leukocytes. Transplantation 63, 1840–1843(1997).

20. Demetris, A.J. et al. Hematolymphoid cell trafficking, microchimerism, and GVHreactions after liver, bone marrow, and heart transplantation. Transplant. Proc.

25, 3337–3344 (1993).21. Santin, A.D. et al. The effects of irradiation on the expression of a tumour rejec-

tion antigen (heat shock protein gp96) in a human cervical cancer. Int. J. Radiat.Biol. 73, 699–704 (1998).

22. Sriwatanawongsa, V., Davies, H.ff., & Calne, R.Y. The essential roles of parenchy-mal tissues and passenger leukocytes in the tolerance induced by liver grafting inrats. Nature Med. 1, 428–432 (1995).

23. Ehl, S. et al. Antigen persistence and time of T-cell tolerization determine the effi-cacy of tolerization protocols for prevention of skin graft rejection. Nature Med. 4,1015–1019 (1998).

24. Schwarz, R.H. A cell culture model for T lymphocyte clonal anergy. Science 248,1349–1356 (1990).

25. Lombardi, G. et al. Antigen presentation by T cells inhibits IL-2 production andinduces IL-4 release due to altered cognate signals. J. Immunol. 156, 2769–2775(1996).

26. Tsui, T.Y., Deiwick, A., Ko, S. & Schlitt, H.J. Specific immunosuppression by post-operative infusion of allogeneic spleen cells. Requirement of donor MHC expres-sion and graft-versus-host reactivity. Transplantation (in the press).

27. Thomas, J.M. et al. Veto cells in transplantation tolerance. Clin. Transplant. 8,195–203 (1994).

28. Thomas, J.M. Further studies of veto activity in rhesus monkey bone marrow inrelation to allograft tolerance and chimerism. Transplantation 57, 101–115(1994).

29. Raddatz, G., Deiwick, A., Sato, T. & Schlitt, H.J. Inhibition of cytotoxic alloreactiv-ity by human allogeneic mononuclear cells: evidence for veto function of CD2+cells. Immunology 94, 101–108 (1998).

30. Tomita, Y., Khan, A. & Sykes, M. Role of intrathymic clonal deletion and periph-eral anergy in transplantation tolerance induced by bone marrow transplantationin mice conditioned with a nonmyeloablative regimen. J. Immunol. 153,1087–1098 (1994).

31. Khan, A., Tomita, Y. & Sykes, M. Thymic dependence of loss of tolerance inmixed allogeneic chimeras after depletion of donor antigen. Transplantation 62,380–387 (1996).

32. Ono, K. & Lindsey, E.S. Improved technique of heart transplantation in rats. J.Thorac. Cardiovasc. Surg. 57, 225–229 (1969).

33. Schwinzer, R., Hedrich H.-J. & Wonigeit, K. T cell differentiation in athymic nuderats (rnu/rnu): demonstration of a distorted T cell subset structure by flow cytom-etry analysis. Eur. J. Immunol. 19, 1841–1847 (1989).

34. Hoffman, R.A. et al. Alloantigen-induced activation of rat splenocytes is regulatedby the oxidative metabolism of L-arginine. J. Immunol. 145, 2220–2226 (1990).

35. Wood, P.J. et al. Prevention of chronic rejection by donor-specific blood transfu-sion in a new model of chronic cardiac allograft rejection. Transplantation 61,1440–1443 (1996).

36. Demetris, A.J. et al. Analysis of chronic rejection and obliterative arteriopathy.Am. J. Pathol. 150, 563–578 (1997).

37. Schmid, C., Heemann, U. & Tilney, N.L. Retransplantation reverses mononuclearinfiltration but not myointimal proliferation in a rat model of chronic cardiac allo-graft rejection. Transplantation 61, 1695–1699 (1996).

38. Strehlau, J. et al. The intragraft gene activation of markers reflecting T-cell-activa-tion and -cytotoxicity analysed by quantitative RT-PCR in renal transplantation.Clin. Nephrol. 46, 30–33 (1996).

39. Siebert, P.D. & Larrick, J.W. PCR MIMICS: competitive DNA fragments for use asinternal standards in quantitative PCR. BioTechniques 14, 244–249 (1993).

40. Siegling, A. et al. A novel multispecific competitor fragment for quantitative PCRanalysis of cytokine gene expression in rats. J. Immunol. Method 177, 23–28(1994).


199

9 N

atu

re A

mer

ica

Inc.

• h

ttp

://m

edic

ine.

nat

ure

.co

m

The functional relevance of passenger leukocytes and microchimerism for heart allograft acceptance...

Documents

Transcript of The functional relevance of passenger leukocytes and microchimerism for heart allograft acceptance...