Teaching about time a biologists perspective Biochemistry Physiology Ecology Evolution Origins of...

Teaching about timea biologists perspective

Biochemistry

PhysiologyEcology

Evolution

Origins of biodiversity and estimates of divergence times

TIME

Integrative CoursesVertebrate or Invertebrate Zoolgy

Comparative AnatomyBiogeography

10-6s 109

years

*not drawn to scale

Biologist’s general modus operandus

• We had no training on how to teach about deep time other than memorizing the chart

• We focus on teaching biological processes, not so much the time scales during which they proceed

• We make modest attempts to talk about deep time (give out handouts)

• We give our geology/paleontology colleagues absolute authority to provide dates of events (with no discussion of error, methods, etc.)

• We do not assess whether students grasp time concepts within evolution

• We avoid confrontations with students who challenge us with biblical timelines of events

QuickTime™ and a decompressor

are needed to see this picture.













Teaching deep time through macroevolution and phylogenetics







Stories of evolution through phylogenies of many topologies



Biomedcentral.com

Genetic diversity/no morphological diversity Plethodontid salamanders

Desmognathus wrighti (pygmy salamander)

P. hubrichtiRM 1RM 2

SI 1SI 2CW 1CW 2

BM 1BM 2DG VA 1GF 1GF 2WT VA1DG VA 2WT VA 2

RBB 1RBB 2BR 1CM 1CM 2BR 2PG 1SM. 1SM. 2PG 2ML 1ML 2CD 1CD 2

N1

N2

S1

S2

S3

N1

N2

S3

S2

S1

mt DNA sequence Combination mtDNA and allozyme

3.1 mya (Pliocene)



BMC Genetics 2004, 5:23

Genetic variation among Indian groups of peoples



Phylogeography of Drosophila in Hawaii

(Bromham and Penny, 2003)

Molecular clocks

• Implicitly used when choosing a region to assay for variation given the expected evolutionary distance of interest

• Explicitly used when attempting to date divergence times

• Need to calibrate divergence times estimated with DNA variation with historical geological dates/events

• Lots of debate and criticism about the use of molecular clocks

Zuckerkandl and Pauling 1962

Inquiry-based integrated instructional unit:

Phylogenetic analysis of the bony fishes: Morphological and mtDNA sequence

3-4 week moduleComparative Anatomy

Evolution

Genetics

Molecular Biology

Ichthyology, etc

Introductory Biology

What are the phylogenetic relationships among orders of Actinopterygii?

150 mya

200 mya

250 mya

300 mya

Learning activities1. Students assign traits to a set of sea shells and generate a

“tree” based on the similarity of characters--this is done by hand. [cladograms are visual representations of calculated relationships]

2. Students create character matrix and extract DNA/ sequence the 28s rRNA gene. [scaled up repetition, base pair differences are empirically determined]

3. Students align sequences, calculate the number of differences among taxa and use a computer program to generate a phylogenetic tree [more complex iteration of initial exercise; introduces bioinformatics]

4. Students download cytb sequence and generate another tree for the same taxa [repeat tree making skills]

AssessmentExam questions: “What is a molecular clock, and how is it relevant to

phylogenetic analysis?”

“Compare the cytb tree to the tree you constructed from the 28S rRNA gene you made earlier in the week. Which gave a more robust hypothesis (and why), and what are the reasons why the two genes resolved different hypotheses?”

….but that’s it.

Goals of this workshop (for me)

1. Learn more formal pedagogy behind teaching deep time

2. Learn how to integrate cognitive science in pedagogy of phylogenetics

• Analogy

• Diagram reasoning (“tree thinking” Catley and Novick,2009)

3. Form collaborations with geoscientists to generate a working group interested in integrating teaching methods of deep time from geoscience and evolutionary biology perspectives.

Molecular clocksWhen is a molecule not appropriate?

Questions to ask yourself

Do molecular clocks tick evenly through time?

Is there a geological or climatic date/event for calibration?

Are geological calibrations accurate?

Molecules can evolve at different rates than organisms (or other molecules)!

Is the clock ticking at different rates among lineages?

Deuterostome phylogeny: Morphology

Morphological Analysis

MTR WHI BUT TRO FLO POR LUN CIC SUN MAC BOW GAR GOL SHKno Character 1 2 3 4 5 6 7 8 9 10 11 12 13 14

1 Body form 1 0 2 1 2 2 0 1 0 0 1 0 2 02 lateral compression 0 2 1 1 1 1 2 2 1 0 2 2 0 03 lat assym body 0 0 0 0 1 0 0 0 0 0 0 0 0 04 Head shape 2 3 2 2 2 2 1 1 1 2 1 1 2 05 # dorsal fins 0 0 1 0 1 1 1 1 1 0 1 1 1 06 dorsal fin spike 0 0 1 1 1 1 1 1 1 0 1 1 1 07 hard fin rays (Y/n) 1 1 0 0 1 1 0 1 1 1 0 1 1 08 dorsal ray type 1 1 0 1 0 1 0 1 1 1 1 1 0 09 fleshy dorsal fin 0 1 0 0 0 1 1 0 0 1 0 0 0 0

10 adipose fin 0 0 0 1 0 0 0 0 0 0 0 0 0 011 # anal fins 1 1 2 1 1 1 2 1 1 1 1 1 1 012 Caudal fin type 2 2 2 2 2 2 2 2 2 2 1 1 2 013 Caudal fin shape 0 2 0 3 2 0 1 1 1 0 1 1 0 014 pectoral fin shape 0 2 0 0 2 0 2 0 0 0 1 0 0 015 pectoral fin ratio 1 1 1 0 0 1 1 0 1 0 1 1 0 016 pelvic fin ratio 2 2 ? 1 2 1 0 2 1 2 1 1 1 017 pelvic fin (yes/no) 0 0 1 0 0 0 0 0 0 0 0 0 0 018 Muscular fin 0 0 0 0 0 0 1 0 0 0 0 0 0 019 loc pelvic fin 1 1 ? 0 1 1 0 1 1 1 0 1 0 020 scale type 3 2 2 2 2 3 3 3 3 ? 2 1 2 021 loss of scales 0 0 1 0 0 0 0 0 0 1 0 0 0 022 scale distribution 0 1 0 0 0 0 1 1 0 1 1 0 0 023 scale shape 2 3 3 3 3 2 3 2 2 3 2 1 2 024 # nostril pairs 1 0 0 0 0 0 0 0 1 0 0 0 0 025 Deviated nostrils (yes/no)0 1 0 0 0 0 1 1 0 1 1 0 1 026 nostril position 1 1 1 1 1 1 1 1 1 1 1 1 1 027 eye location in skull 2 2 1 0 1 1 2 2 1 1 2 0 1 028 eye placement 0 0 0 0 1 0 0 0 0 0 0 0 0 029 jaw type 2 1 2 2 2 1 2 2 2 1 2 2 2 030 Jaw protrusion 2 1 2 2 2 2 1 1 2 1 2 1 2 031 Jaw hinge type 1 0 1 1 1 0 1 1 1 0 1 1 1 032 teeth 1 0 1 0 0 0 1 1 0 0 0 0 1 033 teeth pointed/blunt 0 0 1 0 0 1 1 0 0 0 0 0 2 034 >1 teeth row 0 1 1 1 1 0 0 0 0 1 0 1 0 035 Fleshy lips 1 0 0 0 1 1 1 0 1 0 0 0 1 036 mouth position 2 3 1 2 2 2 2 2 2 2 2 3 2 037 elongate rostrum 0 0 0 0 0 0 0 0 0 0 0 0 1 038 Gular plate (yes/no) 0 0 1 0 0 0 0 0 0 0 1 1 0 039 peduncle:tail ratio 1 1 1 2 1 1 ? 2 1 0 2 1 1 040 Lateral line coloration 0 1 0 0 1 1 0 0 0 1 0 0 1 0

no Character 1 2 3 4 5 6 7 8 9 10 11 12 13 14

Genomic/mt DNA extraction

PCR target gene sequence

DNA sequence

Alignment

Phylogenetic analysis

gi|38154450|gb|AY452491.1| GTGAGCTCTCGCTG GCCCTTGAAAATCCGGGGGAGAAGGTGTAAATCTCG gi|1144505|gb|U34341.1|OMU3434 GTGAGCTCTCGCTGGCCCTTGAAAATCCGGGGGAGAGGGTGTAAATCTCG gi|1144500|gb|U34340.1|ABU3434 GTGAGCTCTCGCTGGTCCTTGAAAATCCGGGGGAGAAGGTGTAAATCTCG ********* ****** ******************** ************* gi|38154450|gb|AY452491.1| CGCCAGGCCGTACCCATATCCGCAGCAGGTCTCCAAGGTGAACAGCCTCT gi|1144505|gb|U34341.1|OMU3434 CGCCGGGCCGTACCCATATCCGCAGCAGGTCTCCAAGGTGAACAGCCTCT gi|1144500|gb|U34340.1|ABU3434 CGC CGGGCCGTACCCATATCCGCAGCAGGTCTCCAAGGTGAACAGCCTCT **** ********************************************* fl REV PRIMER gi|38154450|gb|AY452491.1| GGCATGTTAGATCAAGGTAGATAAGGGA AGTCGGCAAATCAGATCCGTAA gi|1144505 |gb|U34341.1|OMU3434 GGCATGTTAGAACAATGTATGTAAGGGAAGTCGGCAAGTCAGATCCGTAA gi|1144500|gb|U34340.1|ABU3434 GGCATGTTAGAACAATGTAGGTAAGGGA AGTCGGCAAGTCAGATCCGTAA *********** *** *** **************** ************ gi|3 8154450|gb|AY452491.1| CTTCGGGATAAGGATTGGCTCTAAGGGCTGGGTCGGTCGGGCTGGAGTGC gi|1144505|gb|U34341.1|OMU3434 CTTCGGGATAAGGATTGGCTCTAAGGGCTGGGTCGGTCGGGCTGGGGTGC gi|1144500|gb|U34340.1|ABU3434 CTTCGGGATAAGGATTGGCTCTAAGGGCTGGGTCGGTCGGGCTGGGGTGC ********************************************* **** gi|38154450|gb|AY452491.1| GAAGCGGGGCTGGGCTCGTGCCGCGGCTGGGGGAGCAGTCGCCCCGTCGC gi|1144505|gb|U34341.1|OMU3434 GAAGCGGGGCTGGGCTCGAGCCGCGGCTGGGGGAGCAGTTGCTCCGCCTC gi|1144500|gb|U34340.1|ABU3434 GAAGCGGGGCTGGGCACGCGCCGCGGCTGGACGAG----- GCGTCGCCT- *************** ** *********** *** ** ** *

Variation in mutation rates among genomic regions

Hartl & Clark, Principles of Population Genetics

Biological factors that affect molecular clocks

Neutral Theory

Limitations:1. Gene to gene variation in rates of mutation2. Lineage to lineage variation in rates of mutation3. Variation if portions of genome under selection (vs. neutral)

Molecular clocksWhen is a molecule not appropriate?

Saturation (homoplasy)

Teaching about time a biologists perspective Biochemistry Physiology Ecology Evolution Origins of...

Documents

Transcript of Teaching about time a biologists perspective Biochemistry Physiology Ecology Evolution Origins of...