1  

Supplemental Material

A monocarboxylate transporter required for hepatocyte secretion of ketone bodies during

fasting

Sarah E. Hugo, Lourdes Cruz-Garcia, Santhosh Karanth, Ryan M. Anderson, Didier Y.R.

Stainier, and Amnon Schlegel

Supplemental Tables- 1

Supplemental Figures- 5

Supplemental Materials and Methods

Supplemental References- 14

2  

Supplemental Tables

Table S1. Ppara agonist treatment does not rescue rmn mutants.

1Fraction of 6 dpf animals that were steatotic after 24 hours of treatment with Ppara agonist.

2At higher concentrations, all animals were found dead after 24 hours.

Clofibrate Fenofibrate Gemfibrozil WY 14,643

Agonist (nM)

WT rmn WT rmn WT rmn WT rmn

0 01 1 0 1 0 1 0 1

1 0 1 0 1 0 1 0 1

10 0 1 0 1 0 1 0 1

100 0 1 0 1 0 1 all

dead2

all dead

1000 0 1 all dead

all dead

all dead

all dead

all dead

all dead

3  

Supplemental Figures

Supplemental Fig. S1.

(A) Hematoxylin and eosin staining of axial 10 m sections showed no inflammatory cell infiltration.

(B) Masson trichrome staining of axial 10 m sections showed no evidence of excessive extracellular matrix deposition in rmn mutant livers.

(C) Whole-mount ORO staining of 12 dpf larvae.

4  

Supplemental Fig. S2.

Histological analysis of adult livers. Livers from animals fed and fasted for the experiment shown in Figure 2 were analyzed with Hematoxylin an Eosin (H&E) and Trichrome staining.

5  

Supplemental Fig. S3.

(A) Intrahepatic beta-hydroxybutyrate in fasted adult livers.

(B) Serum beta-hydroxybutyrate in fed and fasted animals

(C) Serum free fatty acids in fed and fasted animals.

n = 4 for all experiments.

6  

Supplemental Fig. S4.

The inserted sequence is 686 base pairs (bp) long and replaces the bracketed 159 bp end of exon 2 and the first 67 bp of intron 2 in the slc16a6a gene. The middle 250 bp of the insertion show highest similarity to the DrNgaro4 retrotransposon (Accession: AL603743). The initiator codon is underlined. Exons are in upper case, and introns are in lower case.

7  

Supplemental Fig. S5.

(A) Protein alignment o human SLC16A6, mouse Slc16a6, and the 2 putative zebrafish paralogs Slc16a6a and Slc16a6b. There is no evidence that Slc16a6b protein is expressed. The membrane spanning regions are highlighted in red. Invariant residues are shown in bold. The immunogenic peptide used in raising rabbit anti-Slc16a6a IgGs is indicated in green. Based on sequence comparisons to rat Slc16a1 (Wilson et al. 2009), the catalytic residues Lys45, Glu332, and Arg336 are marked in blue. Two stretches of amino acid residues (at the start of transmembrane domains 1 and 5) that are highly conserved among all Slc16a family members in vertebrates are indicated (‘Invariant Consensus’) (Halestrap and Meredith 2004).

(B) Percent identity (black) and similarity (red) of Slc16a6 orthologs.

8  

(C) Percent identity (black) and similarity (red) of Slc16a6 orthologs, when the large, divergent intracellular loop between transmembrane domains 6 and 7 is excluded (comparison of residues 1-205 and 293-523 in human Slc16A7 among the other orthologs).

9  

Supplemental Materials and Methods

Positional Cloning

A standard set of simple sequence length polymorphism markers (SSLP, “z markers”) on a

meiotic map (Knapik et al. 1998) was used in bulk segregant analysis to assign the mutated gene

to chromosome 12. For this analysis, DNA pools from 16 WT and 16 rmn mutant larvae derived

from crossing the initially identified pair of heterozygous carriers (VH5.2) were used. The

critical interval was flanked by markers z22103 on the north and z8450 on the south (not shown).

Through fine mapping with approximately 250 individual larvae from crosses of the original F2

pair, the proximal boundary was reassigned to z24996. There were no polymorphic markers

north of z8450. In order to narrow the critical interval further, a map cross of the heterozygous

carriers to the polymorphic WIK line was performed (Rauch et al. 1997). Two pairs of

heterozygous adults from this cross were used to generate all the meioses scored for fine

mapping in Fig 3A. The mutation was found to be flanked by the north marker z24996 and the

south marker z26459. On the MGH meiotic map, these markers are 1.3 cM apart, but reversed in

position (43.3 and 41.0 cM, respectively). For SSLP z25096, we designed primers that yielded

larger and more easily scored products. Notably, this marker is not on either genetic map, and

was assigned this physical position in the course of our sequencing the bacterial artificial

chromosome (BAC) clone 106L8 from the Danio Key library (zK106L8). The Tübingen

radiation hybrid map was used to confirm the correct orientation of the other custom SSLP (CA

repeat) markers (with distance reported in centiRays, cR), and to identify individual clones and

short contigs that span the critical region (Kwok et al. 1998; Geisler et al. 1999). In silico

analysis; sequencing of the fosmid clone zFishFos754C12 (zF754C12) and the BAC clone

zK106L8; and consultation with the Sanger Centre allowed assembly of one contig spanning the

10  

entire critical region. Custom CA repeat markers were generated from sequences within

individual clones to narrow the critical interval. Full-length transcripts in the critical region

were identified by searching the RNASeq track on the Zv9 release of the genome

(ensemble.org). The EST database was not adequately robust in this region. Individual cDNAs

were cloned by performing reverse transcription and PCR. The other BAC and fosmid clones in

the contig shown in Fig. 3A are from the following libraries: zC, Children’s Hospital of Oakland

Research Institute (CHORI) library 211; zFD, CHORI library 1073, zH, CHORI library 73, zKp,

Danio Key Pilot library. The clones between zC29A20 and zK29B5 are zF904G1, zK204L23,

zK41D18, zC194J3, zC176J23, and zK48K21. They cover approximately 6 MB of genomic

sequences. Genomic DNA was obtained from individual 6 dpf larvae after fixation and staining

in Oil Red O by digesting at 65°C with proteinase K (10 g/ml final) in 10 mM Tris, pH 9, 50

mM KCl, 1.5 mM MgCl2, 0.3 % Tween-20, 0.3% IGEPAL-CA630. Following heat inactivation

of proteinase K, DNA was diluted 1:10 in water and used in PCR-based genotyping.

cDNA Synthesis

Four WT and 4 rmn mutant livers were dissected from adult livers, pooled and frozen in liquid

nitrogen. Total RNA was extracted by homogenization with a tissue grinder into Qiagen RNeasy

MINI lysis buffer (RTL with 2-mercaptoethanol) and purified following the manufacturer’s

protocol for tissue samples. cDNA was prepared using SuperScript III reverse transcriptase and

Platinum Taq High-Fidelity polymerase (Invitrogen). Two forward and two reverse primers were

used to successfully amplify the message: forward primer A 5’-

TAAAGCCCTCACTCAGGAGC and, forward primer B 5’- TGAACTCCTGGCAGTGAACA,

reverse primer A 5’- TTCCTAATGTTCTGTGTTTTCAAGA and reverse primer B 5’-

TCCAGTACATTCAGTTTGAAAGTGT were designed to amplify sequences from the

11  

untranslated first exon through the 3’-untranslated region of the final exon of the slc16a6a gene

(RNASEQG00000013896). The previously annotated “LOC564872 Danio rerio

monocarboxylate transporter 7-like” (Gene ID: 564872, accession XM_688196.5) does not

include the first, untranslated exon. All primer pairs amplified the same cDNA, which was

cloned into pCR2.1 (Invitrogen). Plasmids were purified with the Accuprep Mini kit (Bioneer)

and sequencing was performed with M13(forward) and M13(reverse) sequencing primers and

internal slc16a6a primers at the University of Utah School of Medicine Sequencing Facility. The

slc16a6b gene was previously annotated as “LOC561766 monocarboxylate transporter 7-like

(Gene ID: 561776, accession XM_685174.5).

Amplification of genomic DNA

To amplify exon 2 of slc16a6a and flanking intronic regions, we used the Failsafe polymerase kit

from Epicentre Biotechnology exactly as suggested by the manufacturer. The template genomic

DNA was purified using the Qiagen blood and tissue DNA purification kit. Amplified DNA was

purified from an agarose gel using a kit (Bioneer) and submitted directly for sequencing. For the

smaller genotyping reactions (involving 3 primers), we used Promega GoTaq polymerase. The

primer sequences used in Fig. 3E are as follows: A, 5’- ACCTTCTATCCCAAGCCTGA; B, 5’- 

AGCCTTTCAAGAAGTGACTCG; C, 5’-GCACAGTGGATTTTCCGACT; D, 5- 

GGTACATATTTTTGTTAACTTGGTCTG; E, 5’- CACTAAATTACTCTAACGAGGATCG.

The isolates of the AB, WIK, and TL strains we worked with do not carry the rmn mutation in

slc16a6a. The Singapore strain and Tü (the genomic sequences from clone zK106L8) strains

carry the rmn mutation. We used TL animals in our previous studies (Schlegel and Stainier

2006).

12  

Quantitative real-time PCR gene expression profiling

RNA from 30 WT and 30 rmn mutant larvae of the indicated ages were prepared and analyzed

by quantitative real-time PCR. Larvae were collected in 1.5 ml tubes, water was removed, and

samples were flash frozen in liquid nitrogen. RNA was prepared using the Qiagen RNeasy kit

exactly as suggested by the manufacturer: samples were homogenized with a tissue grinder

directly into buffer RTL containing 2-mercaptoethanol. Samples were reverse-transcribed using

SuperScript III First-Strand Synthesis for qRT-PCR (Invitrogen). Real-time PCR analysis was

performed in triplicate using a Stratagene Mx3005P instrument measuring SYBR Green I

fluorescence (Wittwer et al. 1997) with the following amplification conditions: 95 °C for 30

seconds, 60 °C for 30 seconds for 40 cycles. The relative expression ratio (R) of a target gene

was determined using the expression in the rmn mutant sample versus the expression in the WT

sample in comparison to a house-keeping gene (rpp0). R was calculated based on the following

equation: R = 2-∆∆Ct, where Ct represents the first cycle in which the fluorescence signal (SYBR

Green) is significantly different from background. ΔΔCt is (Ct,target – Ct,house-keeping gene)rmn

mutant − (Ct,target −Ct,house-keeping gene)WT (Pfaffl 2001). Results are reported as mean ± standard

deviation, and significance is determined using a two-sided student’s t test. Published primer sets

for acadl, acadm, acc1, agpat4, cebpa, cpt1a, ehhadh, elovl5, fads2, fasn, cpt1a, hmgcra,

hmgcs1, mt-co1, mt-nd1, mt-atp6, nr1h3, pparab, pparg, ppap2ab, rpp0, scd, srebf1, srebf2,

mlxip, and mtp, transcripts (Archer et al. 2008; Drew et al. 2008; Levi et al. 2009; Matthews et

al. 2009; Passeri et al. 2009; Shieh et al. 2010; Jurczyk et al. 2011), and the following pairs of

primers were used: acaa1 forward 5- and reverse primer 5’-, bcat2 forward primer 5’-

TCAAAGTGACTGAGCGGAGA and reverse primer 5’-CCAGTCCCTCTGAAGACGTC,

bckdhbl forward primer 5’-. AACAGCTCCACGTGCTCTCT and reverse primer 5’-

13  

TTAGATTGCCCGTCACCTTC, bdh1 forward primer 5’-TTGTGACTGAAAACCTGCCA and

reverse primer 5’-GATGAAGTTTCCGGGTTCAA, dgat2 forward primer 5’-

TTGTGAAACTGGCTCTAAAGCA and reverse primer 5’-

TGAATGATAAGGGTATCGCTCT, hmgcl forward primer 5’-

GATGCTGAACGCTGTGAAGA and reverse primer 5’-ACAGTCTGGGCAGATCCACT,

oxct1b forward primer 5’-GAAAAGGCGGTGTTTGATGT and reverse primer 5’-

TCTGTCTCCATCTGGCTGTG, slc16a6a forward primer 5’-GAGGATGCCCTTAGCTGTTG

and reverese primer 5- CAATTCCTCTGGCTTGCTTT, and slc16a6b forward primer 5’-

GTTTGTACGGGTTCCTGCTG and reverse primer 5’-TGTTGTCAGTCTCCATGTCCA . The

primer sets for bhd1, hmgcl, oxct1b, slc16a6a, and slc16a6b span the final 3 exons of each gene.

The primer set for acaa1 and bckdhbl spans the final 2 exons of the gene. Signal validity was

confirmed with DNA melting curve analysis.

14  

Supplemental References

Archer A, Lauter G, Hauptmann G, Mode A, Gustafsson J-Å. 2008. Transcriptional activity and

developmental expression of liver X receptor (lxr) in Zebrafish. Dev Dyn 237: 1090-

1098.

Drew RE, Rodnick KJ, Settles M, Wacyk J, Churchill E, Powell MS, Hardy RW, Murdoch GK,

Hill RA, Robison BD. 2008. Effect of starvation on transcriptomes of brain and liver in

adult female zebrafish (Danio rerio). Physiol Genomics 35: 283-295.

Geisler R, Rauch G-J, Baier H, van Bebber F, Bro L, Dekens MPS, Finger K, Fricke C, Gates

MA, Geiger H et al. 1999. A radiation hybrid map of the zebrafish genome. Nat Genet

23: 86-89.

Halestrap A, Meredith D. 2004. The SLC16 gene family—from monocarboxylate transporters

(MCTs) to aromatic amino acid transporters and beyond. Pflügers Arch 447: 619-628.

Jurczyk A, Roy N, Bajwa R, Gut P, Lipson K, Yang C, Covassin L, Racki WJ, Rossini AA,

Phillips N et al. 2011. Dynamic glucoregulation and mammalian-like responses to

metabolic and developmental disruption in zebrafish. Gen Comp Endocrinol 170: 334-

345.

Knapik EW, Goodman A, Ekker M, Chevrette M, Delgado J, Neuhauss S, Shimoda N, Driever

W, Fishman MC, Jacob HJ. 1998. A microsatellite genetic linkage map for zebrafish

(Danio rerio). Nat Genet 18: 338-343.

Kwok C, Korn RM, Davis ME, Burt DW, Critcher R, McCarthy L, Paw BH, Zon LI,

Goodfellow PN, Schmitt K. 1998. Characterization of whole genome radiation hybrid

mapping resources for non-mammalian vertebrates. Nucleic Acids Res 26: 3562-3566.

15  

Levi L, Pekarski I, Gutman E, Fortina P, Hyslop T, Biran J, Levavi-Sivan B, Lubzens E. 2009.

Revealing genes associated with vitellogenesis in the liver of the zebrafish (Danio rerio)

by transcriptome profiling. BMC Genomics 10: 141.

Passeri MJ, Cinaroglu A, Gao C, Sadler KC. 2009. Hepatic steatosis in response to acute alcohol

exposure in zebrafish requires sterol regulatory element binding protein activation.

Hepatology 49: 443-452.

Pfaffl MW. 2001. A new mathematical model for relative quantification in real-time RT-PCR.

Nucleic Acids Res 29: e45.

Rauch G-J, Granato M, Haffter P. 1997. A polymorphic zebrafish line for genetic mapping. Tech

Tips Online: T01208.

Shieh Y-S, Chang Y-S, Hong J-R, Chen L-J, Jou L-K, Hsu C-C, Her GM. 2010. Increase of

hepatic fat accumulation by liver specific expression of Hepatitis B virus X protein in

zebrafish. Biochim Biophys Acta 1801: 721-730.

Wilson MC, Meredith D, Bunnun C, Sessions RB, Halestrap AP. 2009. Studies on the DIDS-

binding site of Monocarboxylate Transporter 1 suggest a homology model of the open

conformation and a plausible translocation cycle. J Biol Chem 284: 20011-20021.

Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP. 1997. Continuous fluorescence

monitoring of rapid cycle DNA amplification. Biotechniques 22: 130-138.