Section 2 DNA Replication in Eukaryotes. Biomolecules involved in DNA replication Substrate: dNTPs...
-
Upload
michael-henderson -
Category
Documents
-
view
222 -
download
0
Transcript of Section 2 DNA Replication in Eukaryotes. Biomolecules involved in DNA replication Substrate: dNTPs...
Section 2DNA Replication in
Eukaryotes
Biomolecules involved in DNA replication
Substrate: dNTPs (dATP, dGTP, dCTP, dTTP)
Template unwinding parent DNA double strands
Primer a short segment of RNA with 3’-OH for adding dNTPs by polymerases.
Others: many enzymes and protein factors
1. Eukaryotic Enzymes and Associated Protein Factors involved in DNA Replication
• DNA dependent DNA polymerase• Primase • Helicase• Replication protein A (Single strand DNA binding protein)• Topoisomerase• Proliferating cell nuclear antigen (PCNA)• Replication factor C• RNase H and Flap endonuclease 1• DNA ligase
(1) DNA polymerase
(dNMP)n + dNTP (dNMP)n +1 + PPi
DNA polymerase
① the basic chemical reaction
The polymeration direction: 5’3’. DNA polymerase needs primer (a segment of oli
gonucleotide to provide free 3’-OH, to which nucleotide is able to add one by one.
P P2
4Pi
end
② the classification and functions of Eukaryotic DNA polymerase DNA polymerase
Molecular weight
>250103 (36-38)103 (160-300) 103
170 103 256 103
Location in cells nucleus nucleus mitochodrion nucleus nucleus
5’3’ polymerase activity
middle exist high high high
3’5’exonuc-lease activity no no exist exist exist
primase exist no no no no
Major function Primase activity, initiate replication, partly synthesize lagging strand
Involve in repair of DNA damage with low degree of fidelity
DNA replication in Mt
The major enzyme in DNA replication (elongate daughter strands and helicase activity)
filling Gap left from primer removing, excision repair, and recombination.
( 2 ) primase DNA polymerase is unable to connect two deoxy-ribonucleot
ides together, the primer is required to provide 3’-OH for adding the nucleotide one by one .
1. Primase combines with DNA-polαto form a complex.2. Primase can synthesize a RNA primer (ATP, CTP, UTP, GT
P as substrates ) , an oligo-nucleotide with 10 nucleotides long.
3. Based on the primer, an oligodeoxyribonucleotide with 15~30 nucleotides long can be synthesized by DNA-polα for further elongation.
Primer (10nt) DNA segment (1530nt)
( 3 ) Helicase To separate parental DNA double helix into
two single strands, and move along the single stranded DNA to make DNA synthesis easier.
Replication forkend
( 4 ) Single-strand DNA binding protein, SSB
SSB combines with single stranded DNA to stabilize the single strand in the replication region, and prevents the single strands rewind to form double helix again. In eukaryotic cells, the SSB is called replication protein A, RPA.
helicase SSB (RPA)
(5) Topoisomerase
Topoisomerase has both endonuclease and DNA ligase activities, it can hydrolyze and ligate the DNA phosphodiester bond. The function is to change the conformation of DNA molecule and relieve the torsional stress of positive supertwisting state.
Normal helix
Supertwisted with torsional stress
The best way to relieve the stress is to cut one or two strands, and then link together
The types of topoisomerase :①Type I topoisomerase : cuts off one strand of the
DNA double helix (endonuclease activity) , and then links the two end together ( DNA ligase activity) ,this process need not ATP. This enzyme is the major enzyme and involves in replication and transcription.
②Type II topoisomerase: cut off DNA double strands, and then links together. This process needs ATP, and involves in replication.
( 6 ) Proliferating cell nuclear antigen, PCNA
PCNA is the adapter protein of DNA polymerase . The 3 subunits of PCNA are assembled to form a ring around DNA, to which DNA polymerase attaches. So the PCNA is a sliding clamp to carry polymerase to slide along the template.
DNA
The trimer of PCNA
(7) Replication factor C, RFC
RFC is a clamp-loading protein, helping PCNA rin
g to assemble to the DNA template. RFC as a adapter
attaches both DNA polymerase α and , and help t
he synthesis of leading strand and lagging strand sim
ultaneously.
(8) RNaseH and flap endonuclease 1 (FEN1) These enzymes catalyze the hydrolysis of primer. RNaseH degrades the RNA primer and leaves the
last ribonucleotide for FEN1 to hydrolyze.
( 9 ) DNA ligase
DNA ligase catalyzes the joining of the end of two DNA chains by forming 3’,5’-phosphodiester bond.
nick
2. DNA replication in eukaryotic cells
( 1 ) The initiation of DNA replication
① Origin recognition
• Origin recognition complex (ORC) recognizes the origi
n sequence ( AT rich regions called autonomously repli
cating sequence, ARS, or replicator), and assembles on
it.
• Then mini-chromosome maintenance protein, MCM
(with helicase activity) binds to it to form replication f
ork and replication bubble. Then replication protein A
and helicase assemble to the bubble too.
replicator
A+T rich
起始辨认复合物
Origin recognition complex, ORC
小染色体维系蛋白
Mini-chromosome maintenance protein, MCM
复制蛋白 A
Replication protein A, RPA
RPA
解旋酶Helicase
引物酶 -DNApolα
Primase/DNA Pol
Replication fork 复制叉
end
②formation of primers
The complex formed from DNA-pol and primase assembles t
o the origin, and synthesizes a 10bp long RNA primer , then D
NA-pol catalyzes the synthesis of a DNA segment with 15~30 d
eoxyribonucleotide.
end
primase pol
10bp 15~30bp
While DNA replication, the direction of elongation is the same of that of replication fork movement. The leading strand is synthesized continuously in 5’3’ direction.
( 2 ) Elongation of DNA chains Formation of DNA fragment; Hydrolysis of RNA primer; Formation of DNA molecule
While DNA replication, the lagging strand is synthesized discontinuously in 5’→3’ direction, the opposite direction of replication fork movement to form many short segments named Okazaki fragments.
Reiji Okazaki (1930-1975)
origin5’
5’
3’
3’
3’primase
polprimer
RFCpol
RFCpolRFCpol
RNase H FEN 1
?
?
After hydrolyzing the primers at 5’ end of the telomere, how the gaps are filled ? telomerase can solve the problem.
End
The fidelity of DNA replication1 、 The base pairing rule is extremely obeyed, A=T, G≡C
2 、 DNA polymerase accommodates only correct base pairs.
3 、 DNA polymerase has proofreading function (3’5’ exonuclease activity)
(In E. coli, a mistake is made only once for every 109 to 1010 nucleotides added. For the E.coli chromosome of ~4.6 106 bp, this means that an error occurs only once per 1000 to 10000 replications. )
ATGGTCGGATTACGTAAGTCTAC
TACCAGCCTAATG
3’ 5’AATTCAGATG5’ 3’
3’ 5’ exonuclease activity has very high proofreading funct
ion, can recognize the mismatch base and hydrolyze it.
end
(3) DNA synthesis in telomere—Replication of the ends of linear DNA
5’5’
5’5’
5’5’
5’5’
??
Hydrolysis, polymerization, ligation
Telomere Chromosomal DNA in eukaryotes is linear, telomeres are repetitive sequences that cap the ends of the chromosomes.
1. Structural properties 1) Telomeres consist of the repeat sequence TTAGGG repeated in tandem between 500 and 5000 times. 2) The telomeric repeats bind proteins to cap the chromosome.
2. Function To protect DNA from enzymatic attack and to help stabilize the chromosome.
AATCCCAATCCCAATCCCAATTTAGGGTTAGGGTTAGGGTTA
Telomerase1. The structure of human telomerase 1) Human telomerase RNA (template of reverse transcriptase) 2) Human telomerase reverse transcriptase 3) Human telomerase-associated protein 1 2. Function Telomerase is responsible for telomere synthesis and thus for maintaining the length of the telomere. Telomerase can proceed telomere DNA synthesis by reverse transcription, and its own RNA serves as the template. TTAGGGTTAGGGTTAGGGTTA-3’
-5’
CCCCAACCCCAACCCC 5’
AACCCCAAC
3’ 5’
GGGTTG5’
3’
TGGG TGGGGTTGGGGTTGGGGTTG -3’
CCCAACCCCAACCCCAACCCCAACCCCAAC-5’
2/3Lagging strand origin
Leading strand origin
3/3(4) Mitochondrial DNA replication——D-loop replication
There are two origins. The leading strand synthesis precedes lagging strand synthesis. The leading strand displaces the lagging strand template to form a displacement or D loop. When is has reaches a point 2/3 of the way around the chromosome, the lagging strand origin is exposed and its synthesis proceeds in the opposite direction around the chromosome. Therefore, the synthesis of the two strands are both continuous.