Vol. 175, No. 3

Roles of a Ribosome-Binding Site and mRNA Secondary Structurein Differential Expression of Shiga Toxin Genes

NADIA F. HABIBt AND MATTHEW P. JACKSON*Department ofImmunology and Microbiology, Wayne State University School

of Medicine, 540 East Canfield Avenue, Detroit, Michigan 48201

Received 8 September 1992/Accepted 11 November 1992

The Shiga toxin operon (stx) is composed of two genes for the A and B subunits, which are transcribed froma promoter 5' to the strA gene. The 1A:5B subunit stoichiometry of the holotoxin suggests that the stxA and strBgenes are differentially regulated. In a previous study, we demonstrated the existence of a second promoterwhich independently transcribes the strB gene. However, transcription fusion analysis revealed that theindependent stxB gene promoter is not solely responsible for a fivefold increase in B polypeptide production.In this study, we have investigated the role of an independent stxB gene ribosome-binding site (RBS) in theoverexpression of STX B subunits. Site-directed mutagenesis was used to eliminate this RBS and establish itsrole in StxB production. Examination of the nucleotide sequences surrounding the strB gene RBS revealed apotential for the formation of a stem-loop structure with a calculated AG of -7.563 kcal/mol (ca. -31.64kJ/mol). Sequences surrounding the sixA gene RBS were found not to possess a similar potential forsecondary-structure formation. Disruption of the stem-loop surrounding the stxB gene RBS by 2- and4-nucleotide substitutions caused a significant reduction in B polypeptide and holotoxin production, establish-ing the role of this secondary structure in the enhancement of translation of the stxB gene.

Members of the Shiga toxin family, which includes Shigatoxin (STX) and Shiga-like toxin (SLT) types I, II, and thevariants of SLT-II (27), are multimeric molecules composedof an enzymatically active (A) subunit noncovalently asso-ciated with five copies of a receptor-binding (B) subunit (2,11, 29, 39). Each member of the STX family is encoded by an

operon which contains two A and B subunit gene openreading frames separated by an intergenic space of 12 to 15nucleotides. The operons are transcribed from a promoterwhich is located 5' to the A subunit gene, and each gene ispreceded by a putative ribosome-binding site (RBS) (5, 10,20, 21, 23, 40, 45). The holotoxin stoichiometry suggests thatexpression of the A and B subunit genes is differentiallyregulated, permitting overproduction of the B polypeptides.This differential regulation may be at the level of transcrip-tion, translation, or both.

Previous reports suggesting the existence of an indepen-dent B subunit gene promoter for the six or slt operons havebeen equivocal (10, 19, 43). Sung et al. (42) conclusivelydemonstrated that the slt-II operon is transcribed as a singlebicistronic mRNA, with no evidence for an slt-IIB genepromoter. We recently established the existence of an inde-pendent promoter for the stxB gene and demonstrated that,although this promoter directs synthesis of an additionaltranscript, it is not solely responsible for the 1A:5B stoichi-ometry of STX (17).

Nucleotide sequence analysis has demonstrated that boththe A and B subunit genes of the STX family are preceded byan RBS (36). Jackson et al. (20) proposed that these se-quences may serve as independent translation signals for theA and B subunit genes and that translation of the B subunitgene may be more efficient than translation of the A subunitgene. This may result in the synthesis of several B subunits

* Corresponding author.t Present address: U.S. NAMRU-3, Box 5000, FPO AE 09835-

0007.

for every A subunit, as required for the 1A:5B stoichiometryof STX. A similar model has been proposed for the heat-labile toxin operons of Vibrio cholerae and Eschenchia coli.As with STX, cholera toxin is composed of a single A

subunit and five B subunits (14), which are translated from apolycistronic mRNA (25). Mekalanos et al. (25) demon-strated that the RBS contiguous with the cholera toxin Bsubunit gene functions more efficiently than the RBS pre-ceding the A subunit gene. Heat-labile toxin of E. coli ishighly homologous to cholera toxin in structure and function(7, 8), and although the actual molar ratio of subunit synthe-sis is not known, minicell analysis showed that the Bsubunits are produced in excess of the A subunits (9). Thetwo factors proposed to regulate overproduction of the E.coli heat-labile toxin B subunits by Spicer and Noble (37)were differential efficiencies of the A and B subunit geneRBS and secondary structure in the mRNA surrounding theRBS. Previous studies have demonstrated that the fidelity ofthe RBS sequence and its proper positioning with respect tothe AUG initiation codon are essential factors for efficienttranslation initiation (15). In addition, mRNA secondarystructure affects translation initiation by influencing theaccessibility of the RBS to the ribosome (31). Selker andYanofsky (35) proposed that a stem-loop structure surround-ing an RBS enhances translational efficiency by placing theRBS in the single-stranded region of the loop, thus forcingexposure of the sequence which is homologous to 16SrRNA. Conversely, if an RBS is buried in the double-stranded region of the stem, ribosome initiation at this sitemay be diminished (38). Examination of the E. coli heat-labile toxin A and B subunit gene RBS and surroundingsequences failed to reveal any particular feature which mightcontribute to increased B subunit production (37). In con-trast, we have found that the stxB gene RBS and surroundingsequences contribute to overproduction of the B polypep-tides.The purpose of this study was to investigate the transla-

tional regulation of the stxB gene. We established a model

597

JOURNAL OF BACTERIOLOGY, Feb. 1993, p. 597-6030021-9193/93/030597-07$02.00/0Copyright © 1993, American Society for Microbiology

598 HABIB AND JACKSON

TABLE 1. Recombinant M13 bacteriophages

Designationa Restriction fragment (gene)

mpl8HE. 1.8-kb HindIII-EcoRI (stxA'B)mpl8HE(RBS1).......... mpl8HE with RBS1 mutationmpl8HE(RBS2).......... mpl8HE with RBS2 mutationmpl8HE(STL1).......... mpl8HE with STL1 mutationmpl8HE(STL2) .......... mpl8HE with STL2 mutationmpl8KP.......... 0.6-kb KpnI-PstI (slt-ILA'B)mpl8KP(RBS3) .......... mpl8KP with RBS3 mutation

a Abbreviations: RBS, mutations in the stxB or slt-IIB RBS; STL, muta-tions in the stem-loop surrounding the stxB gene RBS.

for the genetic regulation of STX production which demon-strates that overproduction of the B polypeptides is gov-erned by an independent and more efficient RBS. Thistranslational regulation coupled with the transcription of thestxB gene from an independent promoter contributes to the5B:1A stoichiometry of the holotoxin.

MATERIALS AND METHODS

Bacteria, bacteriophage, and plasmids. E. coli HB101 (3)and DH5a (18) were used as hosts in transformation exper-iments. E. coli JM109 (46) was used as a host for the M13bacteriophages. The single-stranded form of a recombinantbacteriophage M13mpl8 (26) was used as a template forsite-directed mutagenesis. The recombinant phages con-structed in this study are listed in Table 1. Plasmid vectorspBR329 and pBS (Stratagene, La Jolla, Calif.) were used toconstruct wild-type and mutated forms of the sti and slt-IIoperons. Recombinant plasmids constructed in this studyare listed in Table 2.Media and reagents. Chelex-treated glucose-syncase agar

(41) was used to propagate bacterial cultures for the colonyblot enzyme-linked immunosorbent assay (ELISA). Galac-tose-a-1,4-galactose conjugated to bovine serum albumin(Gal-Gal-BSA) (Carbohydrate International, Chicago, Ill.)was used to bind STX in the receptor analog ELISA. Ahybridoma supernatant containing monoclonal antibody13C4 which is specific for the STX B subunit (41) was usedin the ELISAs.

Preparation of plasmid DNA and restriction endonucleasefragments. Plasmid DNA was prepared as described bySambrook et al. (33), using a minilysate procedure adaptedfrom the method of Birnboim and Doly (1). Individual

TABLE 2. Recombinant plasmids

Designation' Restriction fragment (gene)

pEW3b...... 2.5-kb BglII-EcoRI (stxAB)pNH56b. 1.8-kb HindIII-EcoRI (stxA'B)pRBS1.B...... pNH56 with RBS1 mutation

pRBS2.B...... pNH56 with RBS2 mutation

pRBS2.AB...... pEW3 with RBS2 mutation

pSTL1.B...... pNH56 with STL1 mutation

pSTL2.B...... pNH56 with STL2 mutation

pSTL1.AB...... pEW3 with STL1 mutation

pSTL2.AB...... pEW3 with STL2 mutation

pMJ100b...... 2.4-kb SphI-KpnI (slt-IfLB)pRBS3.AB...... pMJ100 with RBS3 mutation

a RBS and STL designations are defined in Table 1, footnote a. Recombi-nant plasmids with the B suffix encode the B subunits of STX or SLT-II, andrecombinant plasmids with the AB suffix encode the A and B subunits.

b Plasmids from previous studies: pEW3 (22), pMJ100 (44), and pNH56(17).

TABLE 3. Oligonucleotides used for site-directed mutagenesis

Oligonucleotide Sequence' Positionsname

RBSMUT1 TTAGCAGTTGTCGGGTAAAATG 1098-1120RBSMUT2 TTAGCAGTTGA(3=GTAAAATG 1098-1120STLMUT1 CTGATGCG(iGAACTATTAGCAG 1082-1104STLMUT2 AAAACATTATT-ATTGCTGCATCG 1124-1147RBSMUT3 CGGGTAAATAA=TTAAGC 1187-1208

a Underlined nucleotides were mutated from the wild-type sx (40) or slt-II(20) sequences.

restriction endonuclease fragments were isolated from aga-rose gels by using a model UEA electroelutor from Interna-tional Biotechnologies Inc., New Haven, Conn., accordingto the instructions of the manufacturer.

Oligonucleotide synthesis and nucleotide sequence analysis.Synthetic oligonucleotides used in this study are shown inTable 3. Oligonucleotides were prepared by the WSU Bio-chemistry Department Core Facility with an Applied Biosys-tems model 380A DNA synthesizer with phosphoramiditechemistry. Nucleotide sequence analysis was performed bythe dideoxynucleotide-chain termination method of Sangeret al. (34). Predictions of dyad symmetries, RNA secondarystructures, and sequence homologies were made by usingthe IntelliGenetics DNA sequence analysis program.

Oligonucleotide-directed site-specific mutagenesis. The dou-ble-primer method of Zoller and Smith (47) was used tointroduce nucleotide sequence changes in the six and slt-IIoperons. Synthetic oligonucleotides containing the desiredmutations on the coding strand are shown in Table 3.Templates used for mutagenesis were the single-stranded

forms of M13mpl8 containing (i) a 1.8-kb HindIII-EcoRIfragment carrying the 3' stxA sequences and the entire sixBgene on the noncoding strand (M13mp18HE; Table 1) and (ii)a 0.6-kb KpnI-PstI fragment carrying the 3' slt-IL4 se-quences and the entire slt-IIB gene on the noncoding strand(M13mp18KP; Table 1).

Construction of the mutagenized stx operon. The mutat-ed recombinant plasmids pRBS2.AB, pSThl.AB, andpSTL2.AB (Table 2) were constructed as previously de-scribed (22) for plasmid pEW3, which carries the six operon.A 1.8-kb HindIII-EcoRI fragment carrying the 3' sequencesof the sixA gene and the entire sixB gene was isolated fromthe double-stranded forms of M13mpl8HE(RBS2), M13mpl8HE(STL1), and M13mp18HE(STL2) (Table 1) andligated simultaneously with a 0.75-kb BgiII-HindIII fragmentcarrying the upstream sequences of sixA into pBR329 re-stricted with BamHI and EcoRI. The fidelity of the muta-genesis was assessed by double-stranded DNA sequenceanalysis of the recombinant plasmids. The 1.8-kb HindIII-EcoRI containing the wild-type sicB gene (pNH56), withmutations in the putative RBS (pRBS1.B and pRBS2.B) orwith mutations in the secondary structure surrounding theRBS (pSTL1.B and pSTL2.B) (Table 2), was ligated toHindIII-EcoRI-restricted pBS to construct plasmids thatproduce only StxB.

Construction of mutagenized si-II operon. Double-stranded DNA from M13mpl8KP(RBS3) carrying the 3'sequences of the slt-IL4 gene and the entire slt-IIB gene(Table 1) was isolated from the replicative form of the phageand restricted with PstI and KpnI. The 0.6-kb PstI-KpnIfragment containing the mutation was purified and ligatedsimultaneously with a 1.8-kb SphI-PstI fragment carryingthe 5' sequences of the slt-IIA gene into pBS restricted with

J. BACTERIOL.

TRANSLATION OF SHIGA TOXIN OPERON 599

Consensus rbs:

stxB gene rbs (nt 1108-1113):

RBS1 mutation in stxB gene rbs:

GGAGGT

AGGGGG

TCCGGG

RBS2 mutation in stxB gene rbs:

slt-IIB gene rbs (nt 1198-1203): AGGAGT

RBS3 mutation in slt-IIB gene rbs: ACCCTFIG. 1. Mutations in the stxB gene and slt-IIB gene RBS. Un-

derlined nucleotides were mutated from the wild-type sequence.The consensus sequence for the E. coli RBS was taken from Shineand Dalgarno (36). Nucleotide sequences were taken from Strock-bine et al. (40) for six and from Jackson et al. (20) for slt-II.

SphI and KpnI. The fidelity of the DNA sequence of therecombinant plasmid designated pRBS3.AB (Table 2) wasassessed by double-stranded-DNA sequence analysis.

Preparation of crude bacterial lysates. Bacterial cultureswere grown overnight at 37°C with shaking and lysed bysonication (28) in a sonic dismembrator (model 300; Fisher,Itasca, Ill.) either directly or after a 10-fold concentration ofthe culture. Sonic lysates were clarified by centrifugation at13,000 x g for 5 min. The protein concentration of theclarified lysate was measured spectrophotometrically byusing a protein assay kit with BSA as the standard. Soniclysates were used for cytotoxicity assays and the receptoranalog ELISA.

Cytotoxicity assay. Cytotoxicity expressed by the wild-type and mutated six and slt-II operons was assessed byusing African green monkey kidney (Vero) cells and byfollowing published procedures (13). The last dilution of thesample which killed 50% or more of the cells was taken asthe 50% cytotoxic dose (CD50) and was expressed in relationto the total protein concentration of the cell lysate (CD50 permilligram).ELISA. The colony blot (41) and receptor analog (45)

ELISAs were performed as previously described. StxBproduction was quantified by using a 1:25 dilution of mono-clonal antibody 13C4 (41).

Isolation of total bacterial RNA and Northern (RNA) blotanalysis. Bacterial RNA was isolated by the method ofChirgwin et al. (6) with some previously described modifi-cations (17). Total bacterial RNA was denatured withglyoxal and dimethyl sulfoxide and separated by agarose gelelectrophoresis. RNA species were transferred to nitrocel-lulose membranes, and specific mRNA bands were detectedby using an isotopically labeled 755-bp HinclI fragmentcarrying both the sixA and sixB gene sequences.

RESULTS

Mutagenesis of the putative stxB RBS. Previous nucleotidesequence analysis of the six operon identified sequencescomplementary to the 3' end of E. coli 16S rRNA whichcould serve as an RBS for the independent translation of thestxA and sixB genes (23, 40). Two mutations, designatedRBS1 and RBS2 (Fig. 1), were introduced by site-directedmutagenesis in the sixB gene RBS, and the effect of thesemutations on B subunit and toxin production was assessed.The 3-nucleotide substitution designated RBS1 (TCCGGG,Fig. 1) was introduced at positions 1 to 3 of the stiB RBS

TABLE 4. Effect of RBS and STL mutations on Bsubunit production

Production as measured by:

Strain Colony blot Receptor ytotoxicityELISA~ (mean ± SD) asa

HB1O1(pEW3) + + 1.000 ± 0.050 2.5 x 106HB1O1(pRBS2.AB) - 0.008 + 0.003 2.5 x 104HB1O1(pSTL1.AB) + 0.047 ± 0.013 2.5 x 105HB101(pSTL2.AB) + 0.063 ± 0.003 2.5 x 105

HB1O1(pNH56) ++ 1.000 ± 0.050 NAdHB1O1(pRBS1.B) ++ 0.254 ± 0.018 NAHB1O1(pRBS2.B) + 0.230 ± 0.014 NAHB1O1(pSTL1.B) + 0.213 + 0.050 NAHB1O1(pSTL2.B) + 0.198 ± 0.012 NA

DH5ca(pMJ100) NDd ND 2.5 x 103DH5a(pRBS3.AB) ND ND 25

a The StxB-specific monoclonal antibody 13C4 (41) was used as the primaryantibody. Sonic extracts from HB101 and DH5ot were not immunoreactive inthese assays.

b Optical density values are expressed relative to those for the positivecontrols HB101(pEW3) and HB101(pNH56).

c Cytotoxicity titers were expressed as CD50 per milligram of total proteinin sonic lysates. Values were corrected for the cytotoxicity of HB101 andDH5a sonic extracts.

d NA, not applicable; ND, not done.

because these first three nucleotides are highly conserved inthe RBS of E. coli genes (36) as well as the RBS of the A andB subunit genes of the STX family (20, 21, 40, 45) and in thecholera toxin operon (25). Plasmid pRBS1.B was con-structed by introducing a 1.8-kb HindIlI-EcoRI fragmentcontaining the entire sixB gene with the RBS1 mutation intothe vector pBS (Table 2).STX B subunit production by HB1O1(pRBS1.B) was as-

sessed by using a colony blot ELISA and a receptor analogELISA with the StxB-specific monoclonal antibody 13C4.Although no effect on B polypeptide production was de-tected when using the colony blot ELISA, the increasedsensitivity of the receptor analog ELISA revealed that StxBproduction was reduced to 25% of wild-type levels by theRBS1 mutation (Table 4). Because the RBS1 mutationeliminated the stv.A gene termination codon, the effect of thismutation on holotoxin production was not assessed.The 4-base substitution designated RBS2 (ACCCCG, Fig.

1) was designed to alter the putative stxB RBS from theconsensus sequence while retaining the sixA gene termina-tion codon. Recombinant plasmids pRBS2.AB and pRBS2.Bcarried the six operon or stxB gene, respectively, with theRBS2 mutation. StxB production by HB1O1(pRBS2.AB) andHB1O1(pRBS2.B) was assessed by the colony blot ELISAand the receptor analog ELISA. Holotoxin production byHB1O1(pRBS2.AB) was measured by using the cytotoxicityassay. The RBS2 mutation reduced B subunit production tobarely detectable levels in the colony blot assay (Table 4).The effect of the RBS2 mutation was approximately equiv-alent to that of the RBS1 mutation assessed by using thereceptor analog ELISA with the stxB constructs:HB1O1(pRBS1.B) and HB101(pRBS2.B) produced 25 and23% of the wild-type levels of StxB, respectively. A moresignificant effect on StxB production was observed when theRBS2 mutation was incorporated into the entire sti operon.B subunit production by pRBS2.AB assessed by using thereceptor analog ELISA was reduced to 0.8% of wild-type

VOL. 175, 1993

600 HABIB AND JACKSON

u16S GrRNA \

G CG CA UG CCUUAOHuuG

A

AGA_- OGAArg Arg

kg Ag

AA A

A UGAAAAAAA

cA

uu

C A

G UA UU A_- Q 1135U AA UU A- T 1138

A-C GA-G C

1091 C --A U

1090 Q C GC-G; C

G-U A1085 A U 1145

1TA _ TWiLeu Leu

ATA_- Alrlie lie

5'

STLl: C 1090 to G and A 1091 to C; AG= -4.163 kcal/mol.STL2: C 1090 to G, A 1091 to C, A 1135 to G and A 1138 to T; AG=- 0.

FIG. 2. Stem-loop structure surrounding the stxB gene RBS.Computer analysis of the mRNA sequence surrounding the stxBgene RBS predicted the formation of a stem-loop structure with a

AG of -7.563 kcal/mol. The stxB gene RBS (in bold) is shown basepaired with the 3' sequence of 16S rRNA. The STL1 and STL2mutations designed to destabilize the secondary structure and theresultant stxA gene codon changes are shown.

levels (Table 4). A reduction in holotoxin production wasalso induced by the RBS2 mutation: HB1O1(pRBS2.AB)produced 100-fold-lower Vero cell toxicity than did HB101(pEW3) (Table 4). Because of the potential influence ofupstream sequences and the high copy number of the pBSvector used to construct pRBS1.B and pRBS2.B, recombi-nant plasmid pRBS2.AB provided a better assessment of therole of the RBS in translation of the stxB gene.Northern blot analysis of whole-cell RNA demonstrated

that the RBS2 mutation had no effect on mRNA stability (seeFig. 3). Therefore, the observed reduction in STX B poly-peptide production was a consequence of reduced transla-tion and not decreased transcript levels.

Mutagenesis of the sit-IIB RBS. The role of the putativeslt-IIB gene RBS (AGGAGT) (20) in the production ofSLT-II B subunits was assessed by mutational analysis.Mutation RBS3 introduced a 4-nucleotide substitution (ACCC-T, Fig. 1) in the stxB gene RBS and was equivalent tothe RBS2 mutation introduced in the stxB gene RBS. Re-combinant plasmid pRBS3.AB carried the entire slt-IIoperon with the RBS3 mutation on a 2.4-kb SphI-KpnIfragment in the vector pBS. As with the RBS2 mutation inthe stxB gene RBS, the RBS3 mutation caused a 100-folddecrease in SLT-II production as assessed by using thecytotoxicity assay (Table 4). Because computer analysis ofthe sequences surrounding the slt-IIB RBS did not reveal a

potential for mRNA secondary structure, no further muta-tional analysis of the translational signal for this gene was

performed.Mutational analysis of the secondary structure surrounding

the stxB RBS. As shown in Fig. 2, computer analysisdemonstrated that the mRNA nucleotides 1085 to 1145which surround the stxB gene RBS have the potential forsecondary-structure formation. This stem-loop structure hada calculated AG of -7.563 kcallmol (-31.64 kJ/mol) andplaced the RBS in the single-stranded region of the loop.Nucleotides surrounding the RBS of the stxA, st-IL4, andslt-IIB genes had no such potential. Two mutations, desig-nated STh1 and STL2, were introduced in the 3' sequencesof the stixA gene to destabilize this potential stem-loopstructure and investigate its role in translation of the stxBgene.

Mutation STL1, which was made up of the nucleotidesubstitutions C-1090 to G and A-1091 to C (Fig. 2), reducedthe calculated AG of the mRNA secondary structure from-7.563 to -4.163 kcallmol (ca. -17.42 kJ/mol). A secondpair of nucleotide substitutions designed to abolish thepredicted stem-loop was introduced into the single-strandedDNA template containing the STL1 mutation. This muta-tion, designated STL2, contained the nucleotide substitu-tions A-1135 to G and A-1138 to T in addition to theC-1090-to-G and A-1091-to-C substitutions of STL1 (Fig. 2).The calculated energy of the stem-loop was reduced to 0kcallmol by these four nucleotide changes. These STLmutations were designed so that the amino acid sequences ofthe STX A and STX B polypeptides were not altered.However, a deviation from the codon usage for stronglyexpressed E. coli genes (16) was introduced by the C-1090-to-G substitution, and therefore this mutation may havedecreased the efficiency of sixA translation. Recombinantplasmids with the STL mutations were designatedpSThl.AB and pSTL2.AB if they carried the entire stxoperon and pSThl.B and pSTL2.B if they carried the stxBgene (Table 2).The effect of the STL1 and STL2 mutations on B polypep-

tide production was assessed by using the colony blotELISA, the receptor analog ELISA, and the cytotoxicityassay. The immunoreactivity of E. coli strains carryingmutations designed to destabilize the potential stem-loopstructure surrounding the stxB RBS was significantly re-duced from wild-type levels (Table 4). B subunit productionby pSThl.AB and pSTL2.AB was reduced to trace levels inthe colony blot ELISA. StxB production by HB101(pSTLl.B) and HB1O1(pSTL2.B) assessed by using thereceptor analog ELISA was reduced to approximately 20%of wild-type levels. This value was equivalent to the amountof B subunit produced by the stxB plasmids carrying theRBS1 and RBS2 mutations. As with the RBS2 mutation,StxB production was significantly reduced when the SThmutations were introduced in the recombinant plasmidspSTLl.AB and pSTL2.AB, which carried the entire stxoperon. In comparison with the level of STX B polypeptideproduced by HB101(pEW3), HB1O1(pSTL1.AB) and HB101(pSTL2.AB) produced 4.7 and 6.3%, respectively, of wild-type levels. The STL1 and STL2 mutations also causedequivalent reductions in cytotoxicity: HB101(pSTL1.AB)and HB1O1(pSTL1.AB) both produced 2.5 x 105 CD50ml,and HB101(pEW3) produced 2.5 x 106 CD50/ml (Table 4).Northern blot analysis of whole-cell RNA demonstrated thatthe STL2 mutation had no effect on mRNA stability (Fig. 3).Therefore, destabilization of the predicted stem-loop sur-rounding the stxB gene RBS induced by either a 2- or4-nucleotide substitution caused a significant reduction in Bsubunit production, supporting a role for mRNA secondarystructure in the translation of the stxB gene.

J. BACTERIOL.

TRANSLATION OF SHIGA TOXIN OPERON 601

1 2 3 4 5 6

44002900

1540

FIG. 3. Northern blot analysis of the mutated six operon. Lanes1 to 4 contain 100 pLg of total RNA extracted from HB101 (lane 1),HB101(pEW3) (lane 2), HB101(pRBS2.AB) (lane 3), HB101(pSTL2.AB) (lane 4). Lanes 5 and 6 carry total RNA from strainsHB101(pPRM-35-10AB) and HB101(pNH28), which were describedin a previous study (17). The Northern blot was hybridized with a

32P-labeled HincII fragment which is sixA and stxB specific. Thearrow indicates the stx-specific hybridization zone. RNA molecularweight markers are shown on the left.

DISCUSSION

Although STX is composed of one A subunit and five Bsubunits (2, 11, 39), the actual stoichiometry of subunitproduction is not known. If the subunits were synthesized inequivalent amounts, holotoxin assembly would be limited bythe A subunit concentration. Conversely, if the syntheticratio were greater than 5B:1A, holotoxin assembly may

result in the accumulation and release of free B subunits,which could compete with the holotoxin for receptor-bindingsites (32). Therefore, the most efficient synthetic ratio ofSTX subunits would be 5B:1A. This suggests that expressionof the sixA and sixB genes is not equivalent and that thereare additional regulatory signals for the stiB gene whichwould permit overexpression of the B polypeptides. In a

previous study (17), we demonstrated the existence of twopromoters in the six operon. An iron-regulated promoter 5'to the sixA gene is responsible for the production of a

bicistronic mRNA, and an independent promoter in the 3'sequences of the sixA gene directs the transcription of thesixB gene. However, mutational analysis showed that thestrength of the independent stxB gene promoter is notsufficient to account for a fivefold increase in B polypeptidesynthesis in comparison with StxA. Therefore, in the currentstudy we investigated the role of an independent sixB RBS inthe overproduction of STX B subunits. Our results demon-strated that mutagenesis of the sixB RBS, as well as a

potential stem-loop structure in the mRNA surrounding theRBS, caused a significant reduction in StxB production andcytotoxicity levels. These observations, coupled with previ-ous results, led to the establishment of a model for thegenetic regulation of the six operon.

The effect of the RBS and stem-loop mutations was more

significant when expressed from the entire six operon

(pRBS2.AB, pSTL1.AB, and pSTL2.AB) than from the stiBgene recombinants (pRBS1.B, pRBS2.B, pSTL1.B, andpSTL2.B). This may have been due to the high copy numberof the pBS vector which carried the stxB gene or to tran-scription from a strong vector promoter and a different

interaction between the ribosomes and a bicistronic versusmonocistronic mRNA. The low-level StxB production bypRBS2.AB may have been due to translational readthroughby the sixA gene ribosome in the absence of the stxB geneRBS. Regardless of the reason for the apparent difference inthe effect of the mutations in the two recombinant plasmids,the results of expressing the RBS and STL mutations fromthe entire sti operon more closely reflected the role of theslxB gene RBS and surrounding secondary structures in theproduction of STX.

Previous studies have reported that various insertions andsubstitutions at the RBS affect the rate of mRNA degrada-tion (30) and that the hairpin structures impart stability toselected regions of polycistronic mRNAs (12). However,Northern blot analysis of total cellular RNA isolated fromstrains containing the six operon with the RBS and STLmutations showed that there was no effect on the steady-state level of six mRNA. Therefore, the effects of themutations on B polypeptide production could be attributedsolely to a decrease in transitional efficiency.

In the model proposed by Selker and Yanofsky (35), astem-loop structure which places an RBS in the single-stranded region of the loop forces the exposure of the RBS tothe complementary 16S rRNA sequences and enhances thetranslational efficiency. Although translation may precludeformation of hairpin loops, the existence of the sixB genepromoter may contribute to secondary-structure formationby permitting stem-loop formation near the 5' terminus ofthe monocistronic mRNA prior to translation initiation. Ourfindings that destabilization of the predicted stem-loop sur-rounding the saxB gene RBS caused a reduction in Bpolypeptide and holotoxin production suggest a role for thissecondary structure in the genetic regulation of the sixoperon. Furthermore, this is the first demonstration of therole of mRNA secondary structure in the regulation oftranslation of a bacterial toxin operon. There was no signif-icant decrease in StxB production induced by the STL2mutation compared with that induced by the STL1 mutation,although the calculated free energy of the stem-loop wasreduced from -7.563 kcal/mol in the wild type to -4.163kcal/mol in STL1 to 0 kcal/mol in STL2. Perhaps a degree ofstem-loop stability with a free energy of formation in excessof -4 kcal/mol was required for the mRNA structure to haveany effect on translational efficiency.Our results indicated that the independent translation of

the stxB gene is mediated by an RBS which exists in thedownstream sequences of the sixA gene. Furthermore, astem-loop structure surrounding the stiB gene RBS influ-ences the level of B subunit production. It is noteworthy thatthe nucleotide adjacent to the initiation codon is an A in thestxB gene, which is presumed to enhance ribosome binding(35), but a T in the sixA gene. In addition, nucleotidessurrounding the stx;A gene RBS had no potential for second-ary-structure formation. Therefore, the regulatory mecha-nisms acting at the level of translation in the sti operon aredifferent and may be more efficient for the sixB gene RBS,thereby promoting overproduction of STX B polypeptides,which is necessary for the 5B:1A stoichiometry of theholotoxin. Mutation RBS2 caused the most significant reduc-tion in B subunit production because it eliminated basepairing between the 16S rRNA and the sixB mRNA(s). Thisindicated that although the secondary structure surroundingthe stxB gene RBS has a role in B subunit production, thefidelity of the sequence which forms base pairs with the 16SrRNA is essential for translation.As with the RBS2 mutation which eliminated the sixB

VOL. 175, 1993

602 HABIB AND JACKSON

gene RBS, the mutation designated RBS3 eliminated theslt-IIB gene RBS and caused a significant reduction inSLT-II production. However, genetic regulation of the slt-IIoperon differs from that of the six operon because (i) theslt-II operon is transcribed as a single bicistronic mRNA (42)and (ii) computer analysis showed that the mRNA sequencessurrounding the slt-IIB gene RBS have no potential forsecondary-structure formation. Therefore, we propose thatindependent translation of the slt-IL4 and slt-IIB genes is thesole factor governing the stoichiometry of SLT-II subunitproduction. Perhaps this explains why the level of SLT-IIproduced in vitro is significantly lower than that of STX (24).

In conclusion, the following model for the genetic regula-tion of the six operon is proposed. (i) A bicistronic mRNA istranscribed from an iron-regulated promoter which is 5' tothe stxA gene. (ii) An independent promoter in the 3' regionof the six4 gene separately transcribes the stxB gene.Independent transcription from this sixB gene promoter maycontribute to but is not the sole factor governing B subunitoverproduction. (iii) The sixB gene RBS is independent ofand more efficient than the sixA gene RBS because of theexistence of secondary structure in the surrounding mRNA.Because the stem-loop surrounding the RBS exists near the5' terminus of the sixB gene mRNA, there is an enhancedpotential for secondary-structure formation prior to transla-tion initiation. These independent regulatory sequences con-tribute to the StxB overexpression and the 5B:1A subunitstoichiometry of STX. Finally, although the actual stoichi-ometry of subunit production has yet to be established,complementation analysis has shown that the STX B poly-peptides may be produced in excess of the 5B:1A subunitstoichiometry of the holotoxin (unpublished data).

ACKNOWLEDGMENTSThis work was supported by Public Health Service research grant

AI29929 from the National Institute of Allergy and InfectiousDisease and a PEO Peace Program Fellowship to N.F.H.

REFERENCES1. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extraction

procedure for screening recombinant plasmid DNA. NucleicAcids Res. 7:1513-1523.

2. Boodhoo, A., R. J. Read, and J. Brunton. 1991. Crystallizationand preliminary X-ray crystallographic analysis of Verotoxin-1B-subunit. J. Mol. Biol. 221:729-731.

3. Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementa-tion analysis of the restriction and modification of DNA inEscherichia coli. J. Mol. Biol. 41:459-472.

4. Brawerman, G. 1987. Determinants of mRNA stability. Cell48:5-6.

5. Calderwood, S. B., F. AuClair, A. Donohue-Rolfe, G. T. Keusch,and J. J. Mekalanos. 1987. Nucleotide sequence of the Shiga-like toxin genes of Escherichia coli. Proc. Natl. Acad. Sci. USA84:4364-4368.

6. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, and W. J.Rutter. 1979. Isolation of biologically active ribonucleic acidfrom sources enriched in ribonuclease. Biochemistry 18:5294-5299.

7. Clements, J. D., R J. Yanuy, and R. A. Finkelstein. 1980.Properties of homogeneous heat-labile enterotoxin from Esch-erichia coli. Infect. Immun. 29:91-97.

8. Dallas, W. S., and S. Falkow. 1980. Amino acid sequencehomology between cholera toxin and Escherichia coli heat-labile toxin. Nature (London) 288:499-501.

9. Dallas, W. S., D. M. Gill, and S. Falkow. 1979. Cistronsencoding Escherichia coli heat-labile toxin. J. Bacteriol. 139:850-858.

10. DeGrandis, S., J. Ginsberg, M. Toone, S. Climie, J. Friesen, andJ. Brunton. 1987. Nucleotide sequence and promoter mapping

of the Escherichia coli Shiga-like toxin operon of bacteriophageH-19B. J. Bacteriol. 169:4313-4319.

11. Donohue-Rolfe, A., G. T. Keusch, C. Edson, D. Thorley-Lawson,and M. Jacewicz. 1984. Pathogenesis of Shigella diarrhea. IX.Simplified high yield purification of Shigella toxin and charac-terization of subunit composition and function by the use ofsubunit-specific monoclonal and polyclonal antibodies. J. Exp.Med. 160:1767-1781.

12. Emory, S. A., and J. G. Belasco. 1990. The ompA 5' untranslatedRNA segment functions in Escherichia coli as a growth-rate-regulated mRNA stabilizer whose activity is unrelated to trans-lational efficiency. J. Bacteriol. 172:4472-4481.

13. Gentry, M. K., and J. M. Dalrymple. 1980. Quantitative micro-titer cytotoxicity assay for Shigella toxin. J. Clin. Microbiol.12:361-366.

14. Gill, D. M. 1976. The arrangement of subunits in cholera toxin.Biochemistry 15:1242-1248.

15. Gold, L., D. Pribnow, T. Schneider, S. Shinedling, B. S. Singer,and G. Stormo. 1981. Translational initiation in prokaryotes.Annu. Rev. Microbiol. 35:365-403.

16. Grosjean, H., and W. Fiers. 1982. Preferential codon usage inprokaryotic genes: the optimal codon-anticodon interactionenergy and the selective codon usage in efficiently expressedgenes. Gene 18:199-209.

17. Habib, N. F., and M. P. Jackson. 1992. Identification of a Bsubunit gene promoter in the Shiga toxin operon of Shigelladysenteriae 1. J. Bacteriol. 174:6498-6507.

18. Hanahan, D. 1983. Studies on transformation of Escherichia coliwith plasmids. J. Mol. Biol. 166:557-580.

19. Huang, A., S. DeGrandis, J. Friesen, M. Karmali, M. Petric, R.Congi, and J. L. Brunton. 1986. Cloning and expression of thegenes specifying Shiga-like toxin production in Escherichia coliH19. J. Bacteriol. 166:375-379.

20. Jackson, M. P., R. J. Neill, A. D. O'Brien, R. K. Holmes, andJ. W. Newland. 1987. Nucleotide sequence analysis and com-parison of the structural genes for Shiga-like toxin I andShiga-like toxin II encoded by bacteriophages from Escherichiacoli 933. FEMS Microbiol. Lett. 44:109-114.

21. Jackson, M. P., J. W. Newland, R. K. Holmes, and A. D.O'Brien. 1987. Nucleotide sequence analysis of the structuralgenes for Shiga-like toxin I encoded by bacteriophage 933J fromEscherichia coli. Microb. Pathog. 2:147-153.

22. Jackson, M. P., E. A. Wadolkowski, D. L. Weinstein, R K.Holmes, and A. D. O'Brien. 1990. Functional analysis of theShiga toxin and Shiga-like toxin type II variant binding subunitsby using site-directed mutagenesis. J. Bacteriol. 172:653-658.

23. Kozlov, Y. U., A. A. Kabishev, E. V. Lukyanov, and A. A.Bayev. 1988. The primary structure of the operons coding forShigella dysenteriae toxin and temperate phage H30 Shiga-liketoxin. Gene 67:213-221.

24. Marques, L., M. Moore, J. Wells, I. Wachsmuth, and A.O'Brien. 1986. Production of Shiga-like toxin by Escherichiacoli. J. Infect. Dis. 154:338-341.

25. Mekalanos, J. J., D. J. Swartz, G. D. N. Pearson, N. Harford, F.Groyne, and M. Wilde. 1983. Cholera toxin genes: nucleotidesequence, deletion analysis and vaccine development. Nature(London) 306:551-557.

26. Messing, J. 1983. New M13 vectors for cloning. MethodsEnzymol. 101:20-78.

27. O'Brien, A. D., and R. K. Holmes. 1987. Shiga and Shiga-liketoxins. Microbiol. Rev. 51:206-220.

28. O'Brien, A. D., and G. D. LaVecL 1982. Immunochemical andcytotoxic activities of Shigella dysenteriae 1 (Shiga) and Shiga-like toxins. Infect. Immun. 35:1151-1154.

29. Olsnes, S., R. Reisbig, and K. Eiklid. 1981. Subunit structure ofShigella cytotoxin. J. Biol. Chem. 256:8732-8738.

30. Petersen, C. 1991. Multiple determinants of functional mRNAstability: sequence alterations at either end of the lacZ geneaffect the rate of mRNA inactivation. J. Bacteriol. 173:2167-2172.

31. Queen, C., and M. Rosenberg. 1981. Differential translationefficiency explains discoordinate expression of the galactoseoperon. Cell 25:241-249.

J. BACTERIOL.

TRANSLATION OF SHIGA TOXIN OPERON 603

32. Ramotar, K., B. Boyd, G. Tyrrell, J. Gariepy, C. Lingwood, andJ. Brunton. 1990. Characterization of Shiga-like toxin I Bsubunit purified from overproducing clones of the SLT-I Bcistron. Biochem. J. 272:805-812.

33. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual, 2nd ed. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

34. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

35. Selker, E., and C. Yanofsky. 1979. Nucleotide sequence of thetrpC-trpB intercistronic region from Salmonella typhimurium. J.Mol. Biol. 130:135-143.

36. Shine, J., and L. Dalgarno. 1974. The 3-terminal sequence ofEscherichia coli 16S ribosomal RNA: complementarity to non-sense triplets and ribosome binding sites. Proc. Natl. Acad. Sci.USA 71:1342-1346.

37. Spicer, E. K., and J. A. Noble. 1982. Escherichia coli heat-labileenterotoxin. Nucleotide sequence of the A subunit gene. J. Biol.Chem. 257:5716-5721.

38. Steege, D. A. 1977. 5'-Terminal nucleotide sequence of Esch-erichia coli lactose repressor mRNA: features of translationalinitiation and reinitiation sites. Proc. Natl. Acad. Sci. USA74:4163-4167.

39. Stein, P. E., A. Boodhoo, G. J. Tyrrell, J. L. Brunton, and R. J.Read. 1992. Crystal structure of the cell-binding B oligomer ofverotoxin-1 from E. coli. Nature (London) 355:748-750.

40. Strockbine, N. A., M. P. Jackson, L. M. Sung, R. K. Holmes,and A. D. O'Brien. 1988. Cloning and sequencing of the genes

for Shiga toxin from Shigella dysenteriae type 1. J. Bacteriol.170:1116-1122.

41. Strockbine, N. A., L. R. M. Marques, R. K. Holmes, and A. D.O'Brien. 1985. Characterization of monoclonal antibodiesagainst Shiga-like toxin from Escherichia coli. Infect. Immun.50:695-700.

42. Sung, L. M., M. P. Jackson, A. D. O'Brien, and R. K. Holmes.1990. Transcription of the Shiga-like toxin type II and Shiga-liketoxin type II variant operons of Escherichia coli. J. Bacteriol.172:6386-6395.

43. Weinstein, D. L., R. K. Holmes, and A. D. O'Brien. 1988. Effectsof iron and temperature on Shiga-like toxin I production byEscherichia coli. Infect. Immun. 56:106-111.

44. Weinstein, D. L., M. P. Jackson, L. P. Perera, R. K. Holmes, andA. D. O'Brien. 1989. In vivo formation of hybrid toxins com-prising Shiga toxin and the Shiga-like toxins and role of the Bsubunit in localization and cytotoxic activity. Infect. Immun.57:3743-3750.

45. Weinstein, D. L., M. P. Jackson, J. E. Samuel, R. K. Holmes,and A. D. O'Brien. 1988. Cloning and sequencing of a Shiga-liketoxin type II variant from an Escherichia coli strain responsiblefor edema disease of swine. J. Bacteriol. 170:4223-4230.

46. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. ImprovedM13 phage cloning vectors and host strains: nucleotide se-quences of the M13mpl8 and pUC19 vectors. Gene 33:103-119.

47. Zoller, M. J., and M. Smith. 1984. Laboratory methods. Oligo-nucleotide-directed mutagenesis: a simple method using twooligonucleotide primers and a single-stranded DNA template.DNA 3:479-488.

VOL. 175, 1993