Response of plant growth and development to different ...

141
Retrospective eses and Dissertations Iowa State University Capstones, eses and Dissertations 2001 Response of plant growth and development to different light conditions in three model plant systems Hanhong Bae Iowa State University Follow this and additional works at: hps://lib.dr.iastate.edu/rtd Part of the Molecular Biology Commons is Dissertation is brought to you for free and open access by the Iowa State University Capstones, eses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective eses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Recommended Citation Bae, Hanhong, "Response of plant growth and development to different light conditions in three model plant systems " (2001). Retrospective eses and Dissertations. 911. hps://lib.dr.iastate.edu/rtd/911

Transcript of Response of plant growth and development to different ...

Page 1: Response of plant growth and development to different ...

Retrospective Theses and Dissertations Iowa State University Capstones, Theses andDissertations

2001

Response of plant growth and development todifferent light conditions in three model plantsystemsHanhong BaeIowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/rtd

Part of the Molecular Biology Commons

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State UniversityDigital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State UniversityDigital Repository. For more information, please contact [email protected].

Recommended CitationBae, Hanhong, "Response of plant growth and development to different light conditions in three model plant systems " (2001).Retrospective Theses and Dissertations. 911.https://lib.dr.iastate.edu/rtd/911

Page 2: Response of plant growth and development to different ...

INFORMATION TO USERS

This manuscript has been reproduced from the microfilm master. UMI films

the text directly from the original or copy submitted. Thus, some thesis and

dissertation copies are in typewriter face, while others may be from any type of

computer printer.

The quality of this reproduction is dependent upon the quality of the

copy submitted. Broken or indistinct print, colored or poor quality illustrations

and photographs, print bleedthrough, substandard margins, and improper

alignment can adversely affect reproduction.

in the unlikely event that the author did not send UMI a complete manuscript

and there are missing pages, these will be noted. Also, if unauthorized

copyright material had to be removed, a note will indicate the deletion.

Oversize materials (e.g., maps, drawings, charts) are reproduced by

sectioning the original, beginning at the upper left-hand comer and continuing

from left to right in equal sections with small overlaps.

Photographs included in the original manuscript have been reproduced

xerographically in this copy. Higher quality 6" x 9" black and white

photographic prints are available for any photographs or illustrations appearing

in this copy for an additional charge. Contact UMI directly to order.

Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, Ml 48106-1346 USA

800-521-0600

Page 3: Response of plant growth and development to different ...
Page 4: Response of plant growth and development to different ...

Response of plant growth and development to different light conditions

in three model plant systems

By

Hanhong Bae

A dissertation submitted to the graduate faculty

in partial fulfillment of the requirement for the degree of

DOCTOR OF PHILOSOPHY

Major: Genetics

Major Professors: Richard B. Hall and Steven R. Rodermel

Iowa State University

Ames. Iowa

2001

Copyright © Hanhong Bae, 2001. All rights reserved.

Page 5: Response of plant growth and development to different ...

UMI Number: 3003224

UMT UMI Microform 3003224

Copyright 2001 by Bell & Howell Information and Learning Company. All rights reserved. This microform edition is protected against

unauthorized copying under Title 17, United States Code.

Bell & Howell Information and Learning Company 300 North Zeeb Road

P.O. Box 1346 Ann Arbor, Ml 48106-1346

Page 6: Response of plant growth and development to different ...

ii

Graduate College Iowa State University

This is to certify that the Doctoral dissertation of

Hanhong Bae

has met the dissertation requirements of Iowa State University

Co-major Professor

Co-major Professor

For the Major Program

For'the Gr^dtfafe College

Signature was redacted for privacy.

Signature was redacted for privacy.

Signature was redacted for privacy.

Signature was redacted for privacy.

Page 7: Response of plant growth and development to different ...

iii

TABLE OF CONTENTS

ABSTRACT

CHAPTER 1. INTRODUCTION 1 Dissertation Organization 1 Literature Review 1 Literature Cited 23

CHAPTER 2. COMPETITION RESPONSES OF WHITE ASPEN TO 37 RED:FAR-RED LIGHT

Abstract 37 Introduction 38 Materials and Methods 41 Results 44 Discussion 45 Literature Cited 48

CHAPTER 3. IMMUTANS AND GHOST ARE PLASTID QUINOL OXIDASES: EVIDENCE FOR A NEW STRUCTURAL MODEL OF THE MITOCHONDRIAL ALTERNATIVE OXIDASE 60

Abstract 60 Introduction 61 Materials and Methods 63 Results 65 Discussion 70 References 75

CHAPTER 4. PLASTID-TO-NUCLEUS SIGNALING: THE IMMUTANS GENE OF ARABIDOPSIS CONTROLS PLASTID DIFFERENTIATION AND LEAF MORPHOGENESIS 88

Abstract 88 Introduction 89 Results 92 Discussion 97 Materials and Methods 103 Literature Cited 107

CHAPTER 5. GENERAL SUMMARY 128 General Conclusions 128 Literature Cited 130

ACKNOWLEDGEMENTS 132

Page 8: Response of plant growth and development to different ...

iv

ABSTRACT

Shade avoidance response to the reduced ratio of red:far-red (R:FR) light was studied

in a white aspen Populus alba clone 'Bolleana' using two filter systems: a clear plastic filter

system that allows a R:FR ratio less than 1.0 to pass from adjacent border plant reflection;

and a special commercial plastic that blocks FR light and creates a R:FR ratio above 3.0.

The response to low R:FR The reduced R:FR signals enhanced the stem elongation in

response to competition at the expense of relative stem diameter growth. Trees grown inside

clear chambers were 27% taller and 22% heavier in stem dry weight than trees grown inside

the FR-blocking filter chambers. Stem taper of clear chamber trees was 16% less than the

FR-blocking filter trees. Low R:FR also induced 13% greater petiole length per leaf

compared to the FR-blocking filter trees.

The immutans (im) variegation mutant of Arabidopsis has green and white leaf

sectors due to the action of a nuclear recessive gene. IM is a chloroplast homolog of the

mitochondrial alternative oxidase. The ghost (gh) variegation mutant of tomato bears

phenotypic similarities to im. We show that the im and gh phenotypes arise from mutations

in orthologous genes. Structural analyses reveal that AOX, IM and GH are RNR R2 di-iron

carboxylate proteins with perfectly conserved Fe-coordinating ligands that define a quinol-

binding catalytic site. IM has a global impact on plant growth and development and that it is

Page 9: Response of plant growth and development to different ...

V

required for the differentiation of multiple plastid types. IM transcript levels do not

necessarily correlate with carotenoid pool sizes, raising the possibility that IM function is not

limited to carcinogenesis. Leaf anatomy is radically altered in the green and white sectors

of im. The green im sectors have significantly higher than normal rates of O? evolution and

significantly elevated chlorophyl a/b ratios, typical of those found in "sun" leaves. We

conclude that IM and GH are plastid quinol oxidases that act downstream from a quinone

pool to dissipate electrons in plastids. In addition, im interrupts plastid-to-nucleus signaling

pathways that control Arabidopsis leaf developmental programming.

Page 10: Response of plant growth and development to different ...

1

CHAPTER 1. GENERAL INTRODUCTION

Dissertation Organization

Due to funding circumstances and a desire to explore different areas, I worked on

three different plant systems. I used a tree system to study the growth changes in response to

altered light condition. Herbaceous plants (tomato and Arabidopsis) were used to learn

molecular techniques, interpretations, and knowledge. This dissertation consists of five

chapters, three of which are formatted for submission to specific journals. Chapter 1 is a

general introduction that reviews the literature pertinent to the research performed. This

chapter includes the nature of the plant responses to the changed red:far-red photon flux

ratio, tomato ghost and Arabidopsis immutans variegation mutants, carotenoid biosynthesis,

and the proposed mechanisms of variegation in ghost and immutans. Chapter 2 includes the

changes in growth traits in the shade avoidance response of Populus alba clone 'Bolleana'.

Chapter 3 focuses on the cloning, characterization and a structural model of GHOST. In

chapter 4, the biological function of IMMUTANS is examined by studying its expression

pattern and anatomical features. Chapter 5 is an overall summary of the findings.

Literature Review

Light environment

Light has properties of both waves and particles (Taiz and Zeiger, 1998).

Wavelength is the distance between successive wave crests. The frequency is the number of

Page 11: Response of plant growth and development to different ...

2

wave crests that pass in a given time. Light particles, photons, of different wavelengths are

characterized by their quantum level. There are three important parameters to understand

with respect to light: 1) quantity, 2) quality and 3) spectral distribution (Hopkins, 1998).

Light quantity is a fluence and is expressed as photon numbers or quanta (in moles). The

total number of photons incident on surfaces is called photon fluence (mol m"2). Photon

fluence rate (mol m"2 s"1) is commonly used in plant research. Sunlight contains a spectrum

of photons with different frequencies. While the range of sunlight wavelengths is between

290 to 3000 nanometer (nm), plants use radiation energy only from 380 to 730 nm. The

range between 400-700 nm is known as photosynthetically active radiation (PAR) (Larcher,

1995; Hopkins, 1998; Taiz and Zeiger, 1998).

Phytochrome system as a sensor of R:FR

Plants use light as a source of energy for photosynthesis, a time-keeping mechanism,

and as information to detect the proximity of neighbors. There are at least three

photoreceptors in plants to perceive information about their light environment, each

specifically absorb different spectral ranges: red:far-red (R:FR)-sensing phytochromes,

blue/UV-A photoreceptors, and UV-B photoreceptors (Kendrick and Kronenberg, 1994).

Phytochromes can detect R:FR (665-670 / 730-735 nm) fluctuations and provide important

information to a plant: 1) the length of the diurnal dark period, 2) potential and actual

shading by other vegetation, 3) depth of immersion in water. According to many

experiments, the phytochrome system is responsible for monitoring the changes in R:FR and

initiating the shade avoidance response (reviewed in Kendrick and Kronenberg, 1994; Casal

and Smith, 1989; Smith and Whitelam, 1990). In addition, phytochromes absorb red and far-

Page 12: Response of plant growth and development to different ...

3

red light most strongly and have important roles in light-regulated vegetative and

reproductive development.

Phytochromes are blue protein pigments with molecular mass around 125 kD.

Pytochromes are encoded by a multigene family and each phytochrome acts independently of

the others, sometimes redundantly, and sometimes antagonistically. Whereas only three

genes (PHYA, B1 and B2) have been discovered in Populus trichocarpa and Populus

balsamifera, five genes {PHYA, B, C, D and E) have been reported in Arabidopsis (Sharrock

and Quail, 1989; Howe et al., 1998). There are two types of phytochromes (Taiz and Zeiger,

1998). Phytochrome A belongs to type I that is transcriptionally active in the dark, but the

expression is strongly inhibited in the light. In dark-grown plants, phytochrome A is the

most abundant phytochrome. Expression of phytochrome A is negatively regulated in the

light and phytochrome A protein is degraded in the light. The rest of the phytochromes (B-

E) belong to type II that are detected both in the green and etiolated plants. The expression

of type II phytochrome is not significantly changed by light. The Pfr form of type II

phytochromes is more stable than the Pfr form of phytochrome A.

Phytochrome is produced in the red light-absorbing form called Pr in dark-grown

plants. The Pr form is converted to a far-red light-absorbing form called Pfr by red light. Pfr

is the physiologically active form of phytochrome. Photoreversibility is the most distinctive

characteristic of the photoreceptor (Kendrick and Kronenberg, 1994; Taiz and Zeiger, 1998).

Significant amount of absorbance spectra of the two forms overlap each other in the red

region, while the Pr form absorbs a small amount of light in the far-red region. When Pr

forms are exposed to red light, most of them are converted to Pfr form. However, some of

the converted Pfr form absorbs red light and is converted back to Pr form, because both

Page 13: Response of plant growth and development to different ...

4

forms absorb red light. Similarly, it is impossible to convert Pfr entirely to Pr by far-red

light. A phytochrome response is not quantitatively related to the absolute amount of Pfr. It

has been suggested that the ratio between Pfr and the total amount of phytochrome

(Pfr/Ptotal) determines the magnitude of the response. Lower ratios of R:FR convert greater

portions of Pfr into the Pr form generating reduced ratios of Pfr/Ptotal. This kind of

reduction was also reported in field experiments with tree species. Higher density canopies

produced lower ratios of Pfr/Ptotal in Populus trichocarpa x deltoides 'Beaupré' and

Douglas-fir seedlings (Gilbert et al., 1995; Ritchie, 1997). Negative linear relationships were

found between stem growth rate and plant spacing or Pfr/Ptotal. Therefore, the red and far-

red wavelengths of light function as a signal for plants to adjust to the environment through

modification in growth.

Shade avoidance syndrome is controlled by multiple phytochrome species

Multiple phytochromes are involved in the shade avoidance response. This has been

established through studies of phytochrome deficient mutants, especially in Arabidopsis.

Arabidopsis is a typical shade avoidance plant that shows reduced cotyledon and leaf

expansion and elongated hypocotyl and petiole growth under low R:FR (Morelli and Ruberti,

2000). A phytochrome A deficient mutant grown in the light showed a similar phenotype to

wild type and this mutant did not respond to FR-rich light (Johnson et al., 1994). This

indicates that phytochrome A is not normally important in the shade avoidance response.

This may be due to the light instability property of phytochrome A. Phytochrome B deficient

mutants of Arabidopsis showed elongated growth and early flowering, which are

characteristics of the shade avoidance syndrome of wild type seedlings grown under a low

Page 14: Response of plant growth and development to different ...

5

R:FR light environment (Nagatani et al., 1991; Reed et al., 1993). This indicates that the

phytochrome B signal is responsible for the inhibition of hypocotyl elongation and has a

major role in the shade avoidance response. In addition, the phytochrome B null mutants

showed more elongation growth and early flowering under FR-rich light than phytochrome B

null mutants grown in normal light environment. This indicates that other phytochromes are

also involved in the shade avoidance response (Smith and Whitelam, 1997). The function of

phytochrome C is still unknown in shade avoidance response due to the lack of phytochrome

C null mutants (Morelli and Ruberti, 2000). However, a reduced level of phytochrome C

was detected in the Arabidopsis phytochrome B mutant, which indicates that the phenotype

of the mutant may result in part from the reduced phytochrome C (Hirschfeld et al., 1998).

Phytochrome D mutants showed increased hypocotyl elongation and decreased cotyledon

expansion under continuous high R:FR (Aukerman et al., 1997). Phytochrome B and D

double mutants displayed enhanced elongation of petioles and early flowering than did

phytochrome B mutants, indicating that phytochrome D also has a role in shade avoidance.

Double mutants of phytochrome B and E had longer petioles and flowered earlier than did

phytochrome B mutants (Devlin et al., 1998). This also indicates the involvement of

phytochorme E in the regulation of shade avoidance.

Competition changes growth traits

Competition occurs between individual plants as they expand in size to capture more

resources from limited amounts of light, water, and nutrients to colonize a location (Lemaire

and Millard, 1999). As a result of competition, plants change their growth characteristics,

such as leaf structure and angle, stem growth and form, branching, branching angle, root

Page 15: Response of plant growth and development to different ...

6

growth, and biomass allocation (Larcher, 1995; Ritchie, 1997). Tree leaves are able to

change their position with respect to light in order to capture maximum light energy for

photosynthesis (Larcher, 1995). The number of branches and branching angle are also

influenced by competition (Heilman et al., 1993; Ceulemans, 1990).

Competition response varies according to the species and genetic background. Most

studies have been done in herbaceous plants. The most common response of shade

avoidance is extra elongation growth in intemodes. The elongation growth is also observed

in the hypocotyl and petioles. Most herbaceous plants show elongation growth at the

expense of leaf development and branching. However, different shade avoidance responses

have been reported in tree species. In coastal Douglas-fir (Pseudotsuga menziesii) seedlings,

crown biomass and branch number increased with decreasing growing space (Ritchie, 1997).

Although leaf numbers were reduced in more dense canopies in Populus trichocarpa x

deltoides 'Beaupré' trees, more leaf area and dry weight were reported (Gilbert et al., 1995).

In accordance with the above results, other studies reported that young trees in high density

plantations usually show rapid height growth that occurs long before actual shading

(Cameron et al., 1991; DeBell and Giordano, 1994; Knowe and Hibbs, 1996; Scott et al.,

1992).

The altered R:FR affects hormone levels

The shade avoidance response that causes organs to expand or elongate, is dependent

on the action of phytohormones (Morelli and Ruberti, 2000). Gibberellin biosynthesis

appears to be controlled by the phytochromes during seed germination, seedling growth, and

photoperiodic induction of flowering (Kamiya and Garcia-Martinez, 1999). Gibberellin is

Page 16: Response of plant growth and development to different ...

7

produced in higher levels in low R:FR, which leads to the intemode elongation, cell

extension and cell division, and leaf development (Weller et al, 1994; Beall et al., 1996).

Stem elongation and cell expansion are strongly correlated with gibberellin, but dry weight

deposition is not related to gibberellin concentration (Potter et al., 1999). Overexpression of

oat phytochrome A in aspen (Populus tremula x tremuloides) led to the reduction of

gibberellin and IAA levels in apical leaf and stem tissues, indicating that phytochrome A and

Pfr/Ptotal can control gibberellin and IAA metabolism (Olsen et al., 1997).

Auxin is also an important phytohormone that regulates cell division, cell elongation,

and cell differentiation (e.g., vascular tissue) (Taiz and Zeiger, 1998). Auxin synthesis

occurs in apical meristems and young leaves and is transported to the root tips through the

vascular system. Auxin is also an important component of the elongation process that is

induced by shade. Stem elongation that is regulated by phytochrome is partly the result of

changes in IAA levels; an auxin response deficient mutant did not elongate significantly in

response to FR-rich light (Behringer and Davies, 1992). In addition, treatments with an

auxin transport inhibitor reduced hypocotyl elongation in FR-rich light (Steindler et al.,

1999). It has been hypothesized that higher lateral transport of auxin to epidermal and

cortical cells occurs in the hypocotyl of shaded seedlings at the expense of auxin transport

through the developing vascular system. This leads to elongation of these tissues and

reduces the vascular differentiation and root auxin concentration, which causes the reduction

in lateral root formation and eventually primary root growth (Morelli and Ruberti, 2000).

Page 17: Response of plant growth and development to different ...

8

Variegation mutants

Plant pigments are essential for the capturing of light energy for photosynthesis. The

main pigments in this regard are the green chlorophylls and carotenoids, which exist inside of

plastids. In addition to light harvest, carotenoids are also important in preventing

photooxidation. Plants turn into albinos and they can not survive. Because albino plants are

not suitable for developmental investigations, variegated plants have been used for such

studies. Plastid development could be affected by three genomes: nuclear, mitochondrial and

plastid genomes. Therefore, variegation phenotypes could be generated by mutations within

any one of the genomes. Nuclear-encoded proteins are essential for plastid development and

function, indeed, most plastid proteins are encoded by the nuclear genome. Defective

mitochondria might have problems in generating energy and precursors for plastid

development resulting in a variegated phenotype (Raghavendra et al., 1994). Thus,

variegated mutants are an excellent system to study nuclear-organellar communication.

Variegation due to genetic damage in the organelle genome

There are two types of mutants in this category: defective in 1) plastid genome and 2)

mitochondrial genome. In both cases, the causal effect of the defective organelle can be a

recessive nuclear gene, but these can also be caused by organelle mutation.

The maize iojap (ij) mutant produces striped plants with normal chloroplasts in green

tissues and poorly developed chloroplasts in the white tissues (Walbot et al., 1979; Coe et al.,

1988; Han et al., 1992; Byrne and Taylor, 1996). IJ gene encodes a 24.8-kD protein that is

associated with the 50S subunit of chloroplast ribosome (Han et al., 1995). The albostrians

mutant of barley is another example of a nuclear recessive gene that causes plastid genome

Page 18: Response of plant growth and development to different ...

9

mutation. The plastids of this mutant lack ribosomes and photosynthetic activity. Plastids

have impaired membrane structures in white sectors (Hedtke et al., 1999; Hess et al., 1994).

The plastome mutator (pm) of Oenothera hookeri causes deletions and duplications in the

plastid genome (Stubbe et al., 1982; Johnson et al., 1991; Stoike and Sears, 1998). The

mutant is chlorotic and the plastid internal membrane is impaired. Stoike and Sears (1998)

proposed that PM might encode a protein that affects the helicity or rigidity of the plastome.

Another type of mutation is due to a mutation in a recessive nuclear gene that

generates abnormal nonfunctional mitochondria. Chloroplast mutator (chm) of Arabidopsis

shows rearrangements in two mitochondrial DNA fragments associated with RPS3-RP115

genes that encode ribosomal proteins S3 and L16, respectively (Martinez-Zapater et al.,

1992; Sakamoto et al., 1996). Nonchromosomal stripe mutants of maize (NCS) show yellow

stripes on leaves due to mitochondrial DNA mutations (Newton et al., 1986). MCS2 has a

mutation in NAD4-NAD7 mitochondrial genes that encode subunits of complex I (NADH

dehydrogenase) of the mitochondrial electron transfer chain, resulting in the reduced

complex I function (Marienfeld and Newton, 1994). Mitochondrial cytochrome oxidase

subunit 2 (COX2) gene is partially deleted in NCS5 and NCS6 (Newton et al., 1990; Lauer et

al., 1990, respectively). It is not clear how mutated mitochondrial genome affects the

chloroplast development. The explanation might be that mitochondria provide energy and

biosynthetic precursors for chloroplast development (Raghavendra et al., 1994).

Variegated mutants that have normal organelle DNA

Arabidopsis var2 is one of the examples of this type of mutation, which displays

green and yellow sectors in leaves (Chen et al., 1999). The white sectors contain non-

Page 19: Response of plant growth and development to different ...

10

pigmented plastids with unorganized lamellar structures. VAR2 has similarity to the FtsH

family of AAA proteins (ATPases associated with diverse cellular activities). It is an ATP-

dependent metalloprotease and functions in membrane associated events. Chen et al. (1999)

suggested that VAR2 may mediate thylakoid membrane biogenesis in early stages through

vesicle fusion.

Arabidopsis immutans (im) and tomato ghost (gh) are other examples of this type of

mutants. Both mutants share common characteristics: I) caused by nuclear recessive gene;

2) light sensitivity in white sector formation; 3) phytoene accumulation and impaired internal

membrane of chloroplasts in white tissues (Rick et al., 1959; Rédei et al., 1963; Rédei et al.,

1967; Scolnik et al., 1987; Wetzel et al., 1994; Wu et al., 1999). IM shows similarity to the

alternative oxidase (AOX) of the mitochondrial respiratory pathway (Wu et al., 1999). I

found that the gh mutant phenotype is caused by an IM homolog (Chapter 3). Both mutant

phenotypes occur due to a block in carotenoid biosynthesis and/or plastid development.

Carotenoids

Carotenoids, C40 terpenoid compounds, are synthesized in all photosynthetic and

some of non-photosynthetic organisms. There are over 600 different, naturally-synthesized

carotenoids (Pogson et al, 1998). In plants, carotenoids are yellow, orange, and red pigments

that are synthesized in the plastids (reviewed in Cunningham and Gantt, 1998). In

chloroplsts, carotenoids are located in the photosynthetic membranes in the form of

chlorophyll-carotenoid-protein complexes, which serve in light harvesting, in

photoprotecting, and as stabilizers of the three-dimensional integrity of the light-harvesting

complexes (LHCs) and photosystem II (Green and Dumford, 1996; Havaux, 1998;

Page 20: Response of plant growth and development to different ...

11

Vishnevetsky et al., 1999). Carotenoids are accumulated in membranes, oil bodies, or other

structures within the stroma of chromoplats of ripening fruits and flower petals and the

chloroplasts of senescing leaves. They also serve as precursors for the plant growth regulator

abscisic acid, and as coloring agents to attract pollinators and as seed dispersal agents in

flowers and fruits (Demmig-Adams et al., 1996; Walton and Li, 1995). Carotenoids are also

precursors of vitamin A in humans and animals (Krinsky et al., 1994).

In the absence of colored carotenoids, plants have an albino phenotype due to the

destruction of chlorophyll by photooxidation. Carotenoids have many important roles in the

prevention of photooxidation. In general, harmful oxidizing molecules are produced from

three sites of the photosynthetic apparatus: the light-harvesting complex (LHC) of

photosystem II, the photosystem II reaction center, and the acceptor side of photosystem I.

Xanthophylls bind to the LHC proteins of photosystem II and efficiently quench excited

triplet chlorophylls (3Chl) and 'Oi (Kiihlbrandt et al., 1994). (3-carotene in the photosystem

II reaction center also can quench lOi that is generated through interactions between 3P680

(3Chl dimer) and Oi (Telfer et al., 1994). De-epoxidized xanthophyll pigments can carry out

thermal dissipation and quench lChl in the photosystem II antenna (Gilmore, 1997). On the

acceptor side of photosystem I, superoxide anion radical (O2") can be generated by reduction

of O2, and O2' can be metabolized to toxic reactive oxygen species (H2O2 and hydroxyl

radical (OH )) (Asada, 1994; Mehler, 1951).

The extent of photooxidation is increased when the absorbed light energy exceeds the

maximum utilization capacity of photosynthesis. Photosystem II is a main target for

photooxidation. In this process, lipids, proteins, and pigments are oxidized by 'Ot (Anderson

et al., 1998; Andersson and Barber, 1996; Barber and Andersson, 1992; Knox and Dodge,

Page 21: Response of plant growth and development to different ...

12

1985). Due to the unsaturated fatty acid side chains, the thylakoid membrane is vulnerable to

lC>2 attack resulting in reducing hydroperoxides that initiate peroxyl radical chain reactions.

On the acceptor (stromal) side of photosystem I, the key enzymes of photosynthetic carbon

metabolism can be damaged by O2", H2O2, and OH (Asada, 1994; Kaiser, 1979).

Carotenoid biosynthesis pathway

The lipid-soluble carotenoid pigments are synthesized by the isoprenoid biosynthetic

pathway (McGarvey and Croteau, 1995; Cunningham and Gantt, 1998). The 5-carbon

isopentenyl pyrophosphate (IPP) is the building block of all isoprenoid compounds. IPP

isomerase (IPS) catalyzes the formation of dimethylallyl pyrophosphate (DMAPP) from IPP.

Geranylgeranyl pyrophosphate (GGPP) synthase (GGPS) catalyzes the addition of three IPP

molecules to one DMAPP to form the C20 compound, GGPP. From immunogold

cytochemistry, GGPS was found to be concentrated in the developing stroma globli of pepper

fruit, where carotenoid accumulation occurs during fruit ripening (Cheniclet et al., 1992).

Pepper GGPS mRNA reaches a maximum at the early ripening stage and decreases in very

ripe fruit, however, enzyme activity increases throughout fruit ripening (Kuntz et al., 1992).

This indicates GGPS gene expression is under post-transcriptional control. The first

colorless C40 carotenoid, phytoene, is formed from two molecules of GGPP by phytoene

synthase (PSY). PSY from pepper chromoplasts was purified as a soluble, monomelic

polypeptide (Dogbo et al., 1988). PSY is thought to be loosely associated with chloroplast or

chromoplast membranes and phytoene is delivered to the plastid membranes for production

of further step products of the pathway (Bartley et al., 1991; Schledz et al., 1996).

Page 22: Response of plant growth and development to different ...

13

Phytoene turns into the red pigment, lycopene, by four consecutive desaturation

reactions forming carbon-carbon double bonds. The desaturation reactions are catalyzed by

two enzymes in plants: two membrane-associated enzymes, phytoene desaturase (PDS) and Ç

-carotene desaturase (ZDS) (Beyer et al., 1989). Phytofluene and Ç-carotene are the products

of the phytoene desaturation reaction, and neurosporene and lycopene are the products of the

ZDS reaction. PSY and PDS transcript levels are highest in flower petals and ripening fruits

(Giuliano et al., 1993). During flower development, PSY and PDS increase more than 10-

fold immediately before anthesis. During fruit ripening, PSY increases more than 20-fold,

but PDS increases only 3-fold. Both transcripts are also detected in the root; this organ

contains the lowest carotenoid amounts. There is no light effect on the expression of either

PSY or PDS. Two forms of PDS have been reported: one soluble and inactive, the other

membrane-bound and active (Al-Baili et al., 1996). For PDS to be active, FAD binding is

required. Electrons liberated during double-bond formation are transferred to membrane-

bound quinones from the PDS-FAD/FADHi complex (Mayer et la., 1990; Nievelstein et al.,

1995; Noms et al., 1995). The requirement of quinones for PDS activity was recognized in a

study of a quinone biosynthesis mutant in Arabidopsis; phytoene accumulates in this mutant

(Norris et al., 1995). PDS also requires NADPH and oxygen for its activity. Based on all of

these data, it has been suggested that phytoene desaturation is carried out by a redox chain

between phytoene and oxygen.

Cyclization of lycopene synthesizes either a-carotene or ^-carotene through lycopene

^-cyclase (LCYB) and lycopene E-cyclase (LCYE). LCYB catalyzes the formation of

bicyclic ^-carotene from the linear, symmetrical lycopene (Hugueney et al., 1995;

Page 23: Response of plant growth and development to different ...

14

Cunningham et al., 1996; Pecker et al., 1996). (3-carotene has two P-rings that are generated

by LCYB. (3-carotene is the precursor for the carotenoids that are commonly found in the

photosynthetic apparatus of plants, a-carotene has one P and one a-ring, which are

generated by LCYB and LCYE, respectively, a-carotene is the immediate precursor of lutein

that is the predominant carotenoid in the photosynthetic membranes of green plants. The

only difference between the (3 and a rings is the position of the double bond within the

cyclohexene ring. Further hydroxylation of each ring of the hydrocarbons of a-carotene and

P-carotene by CHYE and CHYB produces the xanthophyll pigments lutein and zeaxanthin,

respectively. The relative amounts of the P, P-carotenoids (e.g. P-carotene, zeaxanthin,

antheraxanthin, and violaxnthin) versus P, a-carotenoids (e.g. lutein) is determined by the

relative amounts and/or activities of LCYB and LCYE. In the lutein deficient mutants (lutl

and lut2), which have mutations in CHYE and LCYE, respectively, P, P-carotenoids are

significantly higher than P, a-carotenoids, and this results in the functional compensation of

lutein by other xanthophylls, in particular violxanthin and antheraxanthin (Pogson et al.,

1996; Pogson et al., 1998).

The epoxidation of zeaxanthin forms violaxanthin via antheraxanthin, and the de-

epoxidation of violaxanthin regenerates zeaxanthin. These conversions are referred to as the

xanthophyll cycle (Yamamoto and Bassi, 1996). The main function of the xanthophyll cycle

is to protect the photosynthetic apparatus from excessive light and oxidative stress (Demmig-

Adams and Adams, 1990; Owens, 1994; Havaux and Niyogi, 1999). Xanthophylls are the

most abundant carotenoids in the photosynthetic thylakoid membranes of plants. Neoxanthin

is generated by an additional rearrangement of violaxanthin. The violaxanthin and

Page 24: Response of plant growth and development to different ...

15

neoxanthin are the precursors for biosynthesis of the plant growth regulator, abscisic acid

(ABA) (Zeevaart and Creelman, 1988).

Cummingham and Gantt (1998) suggested that carotenogenic complexes are

organized into supercomplexes. The first one is the soluble enzyme complex that consists of

one IPS, two copies of GGPS, and one PSY; the final product of this complex is phytoene.

The other complex is a plastid membrane-associated enzyme complex that consists of two

copies of each desaturase (PDS and ZDS) and two copies of the cyclase subunits (LCYB and

LCYE). The soluble complex is actually proposed to be loosely associated with membranes

so that PSY can easily transfer phytoene to the membrane-associated enzyme complex to

perform further desaturation and hydroxylation reaction.

Respiration and alternative oxidase

During respiration, the six-carbon sugar, glucose, is oxidized generating H?0, CO]

and ATP (reviewed in Taiz and Zeiger, 1998). In the inner mitochondrial membrane, there is

an electron transport chain that transfers electrons from NADH (and FADHi), produced

during glycolysis and the tricarboxylic acid (TCA) cycle, to oxygen. During electron

transfer, a large amount of free energy, ATP, is produced. There are four multiprotein

complexes that are localized in the inner mitochondrial membrane. Electrons from NADH

are oxidized by complex I (NADH dehydrogenase) and electrons are transferred to

ubiquinone. Ubiquinone is similar chemically and functionally to plastoquinone in the

photosynthetic electron transport chain. Electrons derived from the oxidation of succinate by

Complex II (succinate dehydrogenase) are transferred to ubiquinone. Complex III

(ubiquinol:cytochrome c oxidoreductase) oxidizes the reduced ubiquinone (ubiquinol) and

Page 25: Response of plant growth and development to different ...

transfers the electrons to complex IV (cytochrome c oxidase) via cytochrome c. Complex IV

transfers the electrons to O2 and generates H2O.

There are two electron transport pathways that transfer electrons from ubiquinone to

O2 in the respiration pathway (reviewed in Vanlerberghe and Mcintosh, 1997). The first

pathway is the cytochrome pathway, and it is inhibited by cyanide and uses cytochrome c

oxidase (complex IV) as a terminal oxidase. The second pathway is the alternative pathway,

and it is inhibited by salicylhydroxamic acid and uses alternative oxidase (AOX) as a

terminal oxidase. Electron transport through the alternative pathway generates heat instead

of ATP. Heat volatilizes aromatic chemicals to attract pollinators during voodoo lily floral

development (Meeuse, 1975; Meeuse and Buggeln, 1969). The physiological function of the

alternative pathway is unclear, but stresses such as chilling, drought, and osmotic stress

activate the alternative pathway (Wagner and Krab, 1995). Since over-reduction of the

ubiquinone pool occurs in the presence of these stresses, and because over-reduction is able

to generate harmful reactive oxygens, a possible function of the alternative pathway is that it

prevents ubiquinone from over-reduction by removing electrons and transferring then to O2

(Mcintosh, 1994; Vanlerberghe and Mcintosh, 1996).

Tomato ghost mutant

The gh mutant arose spontaneously and has two independent origins. The first one

arose from a hybrid between a line of 'San Marzano' and another line with Verticillium-wilt

resistance in cultures in 1953 at the Agricultural Experiment Station, Davis, California (Rick

et al., 1959). Selfed hétérozygotes segregated in a Mendelian fashion generating about 3

normal to 1 gh, and reciprocal crosses between gh and normal generate only normal

Page 26: Response of plant growth and development to different ...

17

progenies. This indicates that the gh phenotype is controlled by a single nuclear recessive

gene. The second allele of gh was reported in 1953 from the variety 'Stokesdale' at the

Illinois Agricultural Experiment Station, Urbana, Illinois (Rick et al., 1959). Allelism tests

confirmed that both mutants are in the same gene (ghost or gh).

The phenotype of gh was examined by Rick et al. (1959) and the following

description of gh is according to their findings unless mentioned separately. The cotyledons

and hypocotyls are variegated or totally white. The degree of variegation is enhanced by

elevated light intensity. In general, gh cotyledons are smaller than wild type. While the

cellular organization of green sectors of gh cotyledon is normal, palisade pigmentation in the

paler sectors is less intense and there are less chloroplasts. The chloroplasts in the white

sectors do not have organized internal membranes and have large vacuoles.

All vegetative tissues of gh seedlings are variegated. Longitudinal streaks are formed

on the stem, petioles, and peduncles of gh plants. These streaks are mostly limited to a single

subepidermal layer of cells, which suggests that the green streaks are derived from one or

several primordial cells that contains normal chloroplasts. Green islands on leaves have

irregular swollen masses of large undifferentiated cells. Epidermal cells of white sectors are

irregularly-shaped and much larger than normal. The internal parenchymas of white sectors

are not differentiated into palisade and spongy layers. While cells in the palisade are

elongated and larger than normal, cells in the vascular bundles are smaller than normal.

Other organs of gh mutants (roots, stems, and petioles) are relatively unaffected in terms of

morphology (Scolnik, et al., 1986). gh green cotyledons and leaves contain colored

carotenoids and chlorophylls, while the colorless carotenoid (phytoene) accumulates in the

white leaves. While the ultrastructure of plastids from white leaves contain no internal

Page 27: Response of plant growth and development to different ...

18

membrane structures, normal chloroplasts are found in green leaves of gh (Scolnik et al.,

1986).

The yellow color of petals of tomato flowers is due to carotenoid accumulation, but

gh petals are variegated, with strong yellow stripes along the midrib, and a loss of

pigmentation at the margins of petals (Scolnik, et al., 1986). The flowers from the white

branches usually fail to open, but the pollen from these flowers are viable. The size of gh

fruits is proportional to the degree of greening in the corresponding branch, which is

probably due to the availability of nutrient from the branch. Fruits are usually white before

reaching the ripe stage and turn yellow and finally orange with normal softening. Fruits

arising from green branches reach almost wild type size.

Impaired plastid structures are also found in the white fruits of gh, similar in

structures of those in white leaves. That is, thylakoid membrane structures are not developed

in white fruit, but osmiophilic globules are detected, which might be the site of phytoene

accumulation.

Arabidopsis immutans mutant

Cells in the white tissues of im are heteroplastic, that is, they contain predominantly

abnormal plastids but also a few normal-appearing plastids (Wetzel et al., 1994). The

heteroplastidic condition has not been detected in gh white tissues. White reproductive bolts

of im can produce progenies that are green, white, or variegated, depending on growth

conditions of light and temperature. Due to this reversibility, Rédei (1975) called the mutant

immutans for "immutable" in Latin. The defective plastids are not maternally-inherited

indicating that the mutation is not in the organelle genome (Wetzel et al., 1994).

Page 28: Response of plant growth and development to different ...

19

Wu et al. (1999) cloned the IM gene, and found that it codes for a protein with a high

similarity to AOX. However, IM does not have the two conserved cystein residues that are

responsible for dimerization and regulation of enzyme activity. In addition, the IM protein is

imported into the chloroplast and inserted into the thylakoid membrane, while AOX is an

inner mitochondrial protein (Carol et al., 1999). Also, phylogenetic analyses show that IM is

distantly related to AOX, indicating that IM is a novel type of chloroplast AOX. IM shares

conserved domains, such as membrane domains and iron-binding domains. However, recent

analysis with many AOX sequences shows that AOXs are interfacial proteins rather than

proteins having transmembrane domains (Andersson and Nordlund, 1999).

IM affects phytoene desaturase activity

White sector formation is due to the lack of phytoene desaturase (PDS) activity in

Arabidopsis im (Wu et al., 1999). In im white tissues, phytoene is accumulated, but the PDS

protein is detected at wild type levels, which indicates that phytoene desaturase is inactive in

the white tissues (Wetzel and Rodermel, 1998). Chemical treatments that block carotenoid

biosynthesis at later step of carotenogenesis also leads to albino phenotype, but do not cause

phytoene accumulation (Sandmann and Boger, 1989). This result indicates that phytoene

accumulation due to PDS inactivation is not the direct result of photooxidation. According to

precursor-feeding experiments, chlorophyll synthesis is not blocked in im (Wetzel and

Rodermel, unpublished data). Thus, a lack of carotenoid accumulation causes either

inhibition of chlorophyll accumulation and/or photodestruction of chlorophyll.

Page 29: Response of plant growth and development to different ...

20

Variegation model of immutans

Based on the sequence analyses of three im alleles, a functional IM protein is not

made in im mutants (Wu et al., 1999). Yet, even without a functional IM protein, im has

normal looking plastids in green sectors. This indicates that there is a redundant function that

can compensate for the IM deficiency in some cells and plastids. Wu et al. (1999)

hypothesized two working models for im variegation. The models were based on the

assumption that IM is one of the electron transport components in phytoene desaturation,

which is required for carotenoid biosynthesis during early chloroplast biogenesis. In the first

model, IM serves as a cofactor for PDS, which transfers electrons from PDS to plastoquinone

or generates water by accepting electrons directly from PDS. In the second model, IM acts

as a terminal oxidase of the plastoquinone pool and the redundant function is photosystem I.

During an early stage of thylakoid membrane development, PDS activity would be limited in

the absence of IM leading to the accumulation of phytoene because the redundant function is

inefficient in the first model or is not yet fully functional in the second model. In either case,

carotenoid biosynthesis is limited and an absence of carotenoids causes photooxidation under

high light conditions.

According to Wu et al. (1999), several factors control tissue-level sectoring in im.

First of all, the level of light illumination is important. Plant tissues, cells and plastids

receive different levels of illumination due to differences in the angle of incident light,

presence of shading structures, and thickness of tissue layers (reviewed in Smith et al., 1997).

The amount of existing thylakoid material that is from progenitors is another important

factor. The daughter plastids that are from white plastids are more vulnerable to

photooxidation due to the lack of electron transport capacity for PDS function. The

Page 30: Response of plant growth and development to different ...

21

abundance and activities of components of carotenoid biosynthesis, such as electron transport

and radical scavenging are also different in cell levels. Overall, sector formation is due to an

interplay of the above factors. Even in the green plastids, electron transport capacity is less

than wild type plastids. Thus, lower illumination, more thylakoid material and carotenoid

biosynthesis components would increase the possibility of generating normal plastids and

green tissues.

Expression of PDS and PSY in ghost and immutans

Giuliano et al. (1993) compared the expression levels of PDS and PSY between gh

and wild type tomato leaves using reverse transcriptase-polymerase chain reaction (RT-PCR)

amplification assays. This was done because PSY and PDS mRNAs are not detectable by

northern blot analysis. The expression levels were the same in the green leaf sector of gh and

wild type leaves. They also compared the transcript levels of the white leaves of gh and

norflurazon-treated wild type seedlings. Norflurazon is an inhibitor of PDS activity that

results in the accumulation of phytoene and generation of white leaves. The expression of

PSY in white leaves was induced two- and three-fold in gh and norflurazon-treated wild type,

respectively. PDS was induced even more, both in gh white leaves and norflurazon-treated

white leaves (5 and 10 times, respectively). This induction might be for two reasons: 1)

photooxidation or 2) end-product regulation of carotenogenesis. In general, the transcription

of photosynthesis-related genes is depressed in photooxidative conditions (Giuliano and

Scolnik, 1988; Taylor, 1989). It is thought that a "plastid factor" is required for nuclear-

encoded plastid proteins and that the plastid factor is no longer produced in photooxidative

conditions (Taylor, 1989). While photooxidative stress acts as a negative regulator of genes

Page 31: Response of plant growth and development to different ...

22

that encode chlorophyll binding proteins, other genes involved in the biosynthesis and

accumulation of carotenoids are induced (Sagar and Briggs, 1990; Tonkyn et al., 1992;

Guiliano et al., 1993). Another example of induction of PDS gene transcription by

norflurazon treatment was performed by Corona et al. (1996). In their experiment, a GUS

reporter gene was fused to 1.5 kb tomato PDS promoter and 0.5 kb 5' untranslated region and

expressed in tobacco seedlings. Treatment of the transgenic plants with norflurazon induced

PDS/GUS transgene expressing three-fold in the light, and two-fold in the dark in the

transgenic tobacco seedlings. The induction of PDS in the absence of light and chlorophyll

indicates that the PDS promoter is controlled by end-product regulation.

As mentioned above, in the previous studies, PDS mRNA levels are controlled by

end-product regulation (Giuliano et al., 1993; Corona et al., 1996). However, Wetzel et al.

(1998) found that PDS expression is independent of leaf pigment content in Arabidopsis.

PDS mRNA levels were not significantly different between wild type and im in any light or

pigment condition during the early stage of seedling development (6-day old). In mature

leaves of 4-week old seedlings, im accumulated more PDS mRNA than wild type in every

treatment by a factor of 2.2 (norflurazon > high light > low light). Interestingly, there was no

difference in PDS mRNA levels between im white and im green leaves grown under high

light conditions. Wetzel et al. (1998) explained the differences between im and gh in the two

experiments as difference in the normalization methods used to quantify RNA amounts.

Giuliano et al. (1993) normalized the RNA amount by total RNA per sample, while Wetzel et

al. (1998) used cytoplasmic 18S rRNA. Because photobleaching degrades chloroplast

ribosomes but not cytoplasmic ribosomes (Blume and McClure, 1980; Reiss et al., 1983),

Page 32: Response of plant growth and development to different ...

23

normalization by total RNA would give an over-estimation of the PDS mRNA in white

compared to green tissue.

Literature Cited

Anderson JM, Park Y-I, Chow WS (1998) Unifying model for the photoinactivation of

Photosystem II in vivo under steady-state photosynthesis. Photosynth. Res 56: 1-13

Andersson B, Barber J (1996) Mechanisms of photodamage and protein degradation during

photoinhibition of photosystem II. Baker NR, ed. Photosynthesis and the

Environment. Dordrecht: Kluwer pp. 101-21

Al-Babili S, Lintig JV, Haubruck H, Beyer P (1996) A novel, soluble form of phytoene

desaturase from Narcissus pseudonarcissus chromoplasts is Hsp70-complexed and

competent for flavinylation, membrane association and enzymatic activation. Plant J

9: 601-612

Asada K (1994) Production and action of active oxygen species in photosynthetic tissues. In

Causes of Photooxidative Stress and Amelioration of Defense Systems in Plants, ed.

CH Foyer, PM Mullineaux,pp. 77-104. Boca Raton: CRC Press

Aukerman MJ, Hirschfeld M, Wester L, Weaver M, Clack T, Amasino RM, Sharrock RA

(1997) A deletion in the PHYD gene of the Arabidopsis Wassilewskija ecotype

defines a role for phytochrome 0 in red/far-red light sensing. Plant Cell 9: 1317-1326

Barber J, Andersson B (1992) Too much of a good thing: Light can be bad for

photosynthesis. Trends Biochem Sci 17: 61-66

Page 33: Response of plant growth and development to different ...

24

Hartley GE, Viitanen PV, Pecker I, Chamovitz D, Hirschberg J, Scolnik PA (1991)

Molecular cloning and expression in photosynthetic bacteria of a soybean cDNA

coding for phytoene desaturase, an enzyme of the carotenoid biosynthesis pathway.

Proc Natl Acad Sci USA 88: 6532-6536

Beall FD, Yeung EC, Pharis RP (1996) Far-red light stimulates intemode elongation, cell

division, cell elongation, and gibberellin levels in bean. Can J Bot 74: 743-752

Behringer JF, Davies PJ (1992) Indole-3-acetic acid levels after phytochrome-mediated

changes in the stem elongation rate of dark- and light-grown Pisum seedlings. Planta

188:85-92

Beyer P, Mayer M, Kleinig H (1989) Molecular oxygen and the state of geometric

isomerism of intermediates are essential in the carotene desaturation and cyclization

reactions in daffodil chromoplasts. Eur J Biochem 184: 141-50

Blume DE, McClure JW (1980) Developmental effects of Sandoz 6706 on activities of

enzymes of phenolic and general metabolism in barley shoots grown in the dark or

under low or high intensity light. Plant Physiol 65: 238-244

Byrne M, Taylor WC (1996) Analysis of Mt/totor-induced mutations in the lojap gene of

maize. Mol Gen Genet 252: 216-20

Cameron DM, Ranee SJ, Jones RM, Charles-Edwards DA (1991) Trees and pasture: a study

on the effects of spacing. Agrofor Today 3: 8-9

Carol P, Stevenson D, Bisanz C, Breitenbach J, Sandmann G, Mache R. Coupland G,

Kuntz M (1999) Mutations in the Arabidopsis gene IMMUTANS cause a variegated

phenotype by inactivating a chloroplast terminal oxidase associated with phytoene

desaturation. Plant Cell 11: 57-68

Page 34: Response of plant growth and development to different ...

25

Casai JJ, Smith H (1989) The function, action and adaptive significance of phytochrome in

light-grown plant. Plant Cell Environ 12: 855-862

Ceulemans R (1990) Genetic variation in functional and structural productivity determinants

in Poplar. Eds. Thesis publisher, Amsterdam, pp 25-46

Chen M, Jensen M, Rodermel S (1999). The yellow variegated mutant of Arabidopsis is

plastid autonomous and delayed in chloroplast biogenesis. J Heredity 90: 207-214

Cheniclet C, Rafia F, Saint-Guily A, Verna A, Carde J-P (1992) Localization of the enzyme

geranylgeranylpyrophosphate synthase in Capsicum fruits by cytochemistry after

conventional chemical fixation or quick-freezing followed by freeze-substitution:

labelling evolution during fruit ripening. Biol Cell 75: 145-154

Coe EH, Thompson D, Walbot V (1988) Phenotypes mediated by the iojap genotype in

maize. Am J Bot 75: 634-644

Corona V, Aracri B, Kosturkova G, Bartley GE, Pitto L, Giorgetti L, Scolnik PA,

Giuliano G (1996) Regulation of a carotenoid biosynthesis gene promoter during

plant development. Plant J 9(4): 505-512

Cunningham FX, Gantt E (1998) Genes and enzymes of carotenoid biosynthesis in plants.

Annu Rev Plant Physiol Plant Mol Biol 49: 557-583

DeBell DS, Giordano PA (1994) Growth patterns of red alder. In The Biology and

Management of Red Alder. Eds. D.E. Hibbs, O.S. DeBell and R.F. Tarrant. Oregon

State University Press, pp 116-130

Page 35: Response of plant growth and development to different ...

26

Demmig-Adams, B (1990) Carotenoids and photoprotection in plants: A role for the

xanthophyll zeaxanthin. Biochim Biophys Acta 1020: 1-24

Demmig-Adams B, Gilmore AM, Adams WW III (1996) In vivo functions of carotenoids in

higher plants. FASEB J 10: 403-412

Devlin PF, Patel SR, Whitelam GC (1998) Phytochrome E influences intemode elongation

and flowering time in Arabidopsis. Plant Cell 10: 1479-1488

Dogbo O, Laferrière A, D'Harlingue A, Camara B (1988) Carotenoid biosynthesis: isolation

and characterization of a Afunctional enzyme catalyzing the synthesis of phytoene.

Proc Natl Acad Sci USA 85: 7054—58

Gilbert IR, Seavers GP, Jarvis PG, Smith H (1995) Photomorphogenesis and canopy

dynamics, phytochrome-mediated proximity perception accounts for the growth

dynamics of canopies of Populus trichocarpa x deltoides "Beaupre". Plant Cell

Environ 18: 475-497

Gilmore AM (1997) Mechanistic aspects of xanthophyll cycle-dependent photoprotection in

higher plant chloroplasts and leaves. Physiol Plant 99: 197-209

Giuliano G, Bartley GE, Scolnik PA (1993) Regulation of carotenoid biosynthesis during

tomato development. Plant Cell 5(4): 379-387

Green BR, Dumford DG (1996) The chlorophyll-carotenid proteins of oxygenic

photosynthesis. Annu Rev Plant Physiol Plant Mol Biol 47: 685-714

Han CD, Coe EH and Martienssen RA (1992)Molecular cloning and characterization of iojap

(ij), pattern striping gene of maize. EMBO J 11: 4037-4046.

Han CD and Martienssen RA (1995) The iojap protein (IJ) is associated with 50S chloroplast

ribosomal subunits. Maize Coop. Newsletter 69: 32

Page 36: Response of plant growth and development to different ...

27

Havaux, M (1998) Carotenoids as membrane stabilizers in chloroplasts. Trends Plant Sci

3(4): 147-151

Havaux M, Niyogi KK (1999) The violaxanthin cycle protects plants from photooxidative

damage by more than one mechanism. Proc Natl Acad Sci USA 96: 8762-8767

Hedtke B, Bagner 1, Borner T and Hess WR (1999) Inter-organellar crosstalk in higher

plants: impaired chloroplast development affects mitochondrial gene and transcript

levels. Plant J 19: 635-43

Heilman PE, Fu-Guang X (1993) Effect of nitrogen fertilization on leaf area, light

interaction, and productivity of short-rotation P. trichocarpa x P.deltoides hybrids.

Can J For Res 24: 166-173

Hess WR, Hoch B, Zeltz P, Hiibschmann T, Kôssel H, Bôrner T (1994) Inefficient rpll

slicing in barley mutants with ribosome-deficient plastids. Plant Cell 6: 1455-1465

Hirschfeld M, Tepperman JM, Clack T, Quail PH, Sharrock RA (1998) Coordination of

phytochrome levels in phyB mutants of Arabidopsis as revealed by apoprotein-

specific monoclonal antibodies. Genetics 149: 523-535

Hopkins WC (1998) Introduction to plant physiology. 2nd ed. John Willey and Son, Inc.

Howe GT, Bucciaglia PA, Hackett WP, Fumier GR, Cordonnier-Pratt MM, Gardner G

(1998) Evidence that the phytochrome gene family in black cottonwood has one

PHY A locus and two PHYB loci but lacks members of the PHYC/F and PHYE

subfamilies. Mol Biol Evol 15(2): 160-75

Hugueney P, Romer S, Kuntz M, Camara B (1992) Characterization and molecular cloning

of a flavoprotein catalyzing the synthesis of phytofluene and Ç-carotene in Capsicum

chromoplasts. Eur J Biochem 209: 399-407

Page 37: Response of plant growth and development to different ...

Hugueney P, Badillo A, Chen HC, Klein A, Hirschberg J (1995) Metabolism of cyclic

carotenoids: a model for the alteration of this biosynthetic pathway in Capsicum

annuum chromoplasts. Plant J 8: 417-24

Johnson EM, Schnaberlrauch LS, Sears BB (1991) A plastome mutation affects processing of

both chloroplast and nuclear DNA-encoded plastid proteins. Mol Gen Genet 225(1):

106-12

Johnson E, Bradley M, Harberd NP, Whitelam GC (1994) Photoresponses of light-grown

phyA mutants of Arabidopsis. Phytochrome A is required for the perception of

daylength extensions. Plant Physiol 105: 141-149

Kaiser WM (1979) Reversible inhibition of the Calvin cycle and activation of oxidative

pentose phosphate cycle in isolated intact chloroplasts by hydrogen peroxide. Planta

145: 377-82

Kamiya Y, Garcia-Martinez JL (1999) Regulation of gibberellin biosynthesis by light. CUIT

Opin Plant Biol 2: 398-403

Kendrick RE, Kronenberg GHM (1994) Photomorphogenesis in plants, 2nd ed. Kluwer

Academic Publishers, Dordrecht, The Netherlands

Knowe SA, Hibbs DE (1996) Stand structure and dynamics of young red alder as affected by

planting density. For Ecol Manage 82: 69-85

Knox JP, Dodge AD (1985) Singlet oxygen and plants. Phytochem 24: 889-896

Krinsky NI, Wang X-D, Tang T, Russell RM (1994) Cleavage of 6-carotene to retinoids. In

Retinoids: Basic Science and Clinical Applications, ed. MA Livrea, G Vidali, pp. 21-

28. Basel: Birkhaeuser

Page 38: Response of plant growth and development to different ...

29

Kiihlbrandt W, Wang DN, Fujiyoshi Y (1994) Atomic model of plant light-harvesting

complex by electron crystallography. Nature 367: 614-621

Kuntz M, Chen HC, Simkin AJ, Rômer S, Shipton CA, Drake R, Schuch W, Bramley PM

(1998) Upregulation of two ripening-related enes from a non-climacteric plant

(pepper) in a transgenic climacteric plant (tomato). Plant J 13: 351-361

Larcher, W (1995) Physiological Plant Ecology. Ecophysiology and Stress Physiology of

Functional Group. 3rd ed. Springer-Verlag, Berlin Heidelberg

Lauer M, Knudsen C, Newton KJ, Gabay-Laughnan S, Laughnan JR (1990) A partially

deleted mitochondrial cytochrome oxidase gene in the NCS6 abnormal growth mutant

of maize. New Biol 2(2): 179-86

Lemair G, Millard P (1999) An ecophysiological approach to modeling resource fluxes in

competing plants. J Exp Bot 50: 15-28

Marienfeld JR, Newton KJ (1994) The maize NCS2 abnormal growth mutant has a chimeric

nad4-nad7 mitochondrial gene and is associated with reduced complex I function.

Genetics 138(3): 855-63

Martfnez-Zapater JM, Gil P, Cape I J, Somerville CR (1992) Mutations at the Arabidopsis

CHM locus promote rearrangements of the mitochondrial genome. Plant Cell 4: 889-

899

Mayer MP, Beyer P, Kleinig H (1990) Quinone compounds are able to replace molecular

oxygen as terminal electron acceptor in phytoene desaturation in chromoplasts of

Narcissus pseudonarcissus L. Eur J Biochem 191: 359-363

Page 39: Response of plant growth and development to different ...

30

McGarvey DJ, Croteau R (1995) Terpenoid metabolism. Plant Cell 7(7): 1015-1026

Mcintosh L (1994) Molecular biology of the alternative oxidase. Plant Physiol 105: 781

786

Meeuse BJD, Buggeln RG (1969) Time, space, light and darkness in the metabolic flare-up

of the Sauromatum appendix. Acta Bot Neerl 18: 159-72

Meeuse BJD (1975) Thermogenic respiration in aroids. Annu Rev Plant Physiol 26: 117-

126

Mehler AH (1951) Studies on reactions of illuminated chloroplasts. I. Mechanism of the

reduction of oxygen and other Hill reagents. Arch Biochem Biophys 33: 65-77

Morelli G, Ruberti I (2000) Shade avoidance responses, driving auxin along lateral routes.

Plant Physiol 122: 621-626

Nagatini A, Reed JW, Chory J (1993) Isolation and initial characterization of Arabidopsis

mutants that are deficient in phytochrome A. Plant Physiol 102: 269-277

Nievelstein V, Vandekerkchove J, Tadros MH, Lintig JV, Nitschke W, Beyer P (1995)

Carotene desaturation is linked to a respiratory redox pathway in Narcissus

pseudonarcissus chromoplast membranes. Involvement of a 23-kDa oxygen-

evolving-complex-like protein. Eur J Biochem 233: 864-872

Newton KJ, Knudsen C, Gabay-Laughnan S and Laughnan JR (1990) An abnormal growth

mutant in maize has a defective mitochondrial cytochrome oxidase gene. Plant Cell

2: 107-113

Newton KJ and Coe EH (1986) Mitochondrial DNA changes in abnormal growth mutants of

maize. Proc Natl Acad Sci USA 83: 7363-7366

Page 40: Response of plant growth and development to different ...

31

Noms SR, Barrette TR, DellaPenna D (1995) Genetic dissection of carotenoid synthesis in

Arabidopsis defines plastoquinone as an essential component of phytoene

desaturation. Plant Cell 7: 2139-2149

Olsen EJ, Junttila O, Nilsen J, Eriksson ME, Martinussen I, Olsson O, Sandberg G, Moritz T

(1997) Ectopic expression of oat phytochrome A in hybrid aspen changes critical

day length for growth and prevents cold acclimatization. Plant J 12: 1339-1350

Owens TG (1994) Excitation energy transfer between chlorophylls and carotenoids: a

proposed molecular mechanism for non-photochemical quenching. In NR Baker, JR

Bowyered, eds, Photoinhibition of Photosynthesis. Bios Scientific, Oxford, pp 95-

107Potter TI, Rood SB, Zanewich KP (1999) Light intensity, gibberellin contents and

the resolution of shoot growth in Brassica. Planta 207: 505-511

Pogson, BJ., McDonald, K.A., Truong, M., Britton, G., and DellaPenna, D (1996)

Arabidopsis carotenoid mutants demonstrate that lutein is not essential for

photosynthesis in higher plants. Plant Cell 8: 1627-1639

Pogson BJ, Niyogi KK, Bjorkman O, DellaPenna D (1998) Altered xanthophyll

compositions adversely affect chlorophyll accumulation and nonphotochemical

quenching in Arabidopsis mutants. Proc Natl Acad Sci USA 95: 13324-29

Pecker I, Chamovitz D, Linden H, Sandmann G, Hirschberg J (1992) A single polypeptide

catalyzing the conversion of phytoene to zeta-carotene is transcriptionally regulated

during tomato fruit ripening. Proc Natl Acad Sci USA 89: 4962-4966

Pecker I, Gabbay R, Cunningham FX Jr,Hirschberg J (1996) Cloning and characterization of

the cDNA for lycopene B-cyclase from tomato reveals decrease in its expression

during fruit ripening. Plant Mol Biol 30: 807-19

Page 41: Response of plant growth and development to different ...

32

Raghavendra AS, Padmasree K and Saradadevi K (1994) Interdependence of photosynthesis

and respiration in plant cells: interactions between chloroplasts and mitochondria.

Plant Science 97: 1-14

Rédei GP (1963) Somatic instability caused by a cysteine-sensitive gene in Arabidopsis.

Science 139: 767-769

Rédei GP (1967) Biochemical aspects of a genetically determined variegation in

Arabidopsis. Genetics 56: 431-443

Rédei GP (1975) Arabidopsis as a genetic tool. Annu Rev Genet 9: 111-127

Reed JW, Nagpal P, Poole SD, Furuya M, Chory J (1993) Mutations in gene for the red:far-

red light receptor phytochrome B alter cell elongation and physiological responses

throughout arabidopsis development. Plant Cell 5: 147-157

Reiss, T., R. Bergfeld, G. Link, W. Thien and H. Mohr (1983) Photooxidative destruction of

chloroplasts and its consequences for cytosolic enzyme levels and plant development.

Planta 159: 518-528

Rick CM, Thomson AE, Brauer O (1959) Genetics and development of an unstable

chlorophyll deficiency in Lycopersicon esculentum. Amer J Bot 46: 1-11

Ritchie GA (1997) Evidence for red:far-red signaling and photomorphogenic growth

response in Douglas-fir (Pseudotsuga menziesii) seedlings. Tree Physiol 17: 161-168

Sandmann G, Bôger P (1989) Inhibition of carotenoid biosynthesis by herbicides. In Target

Sites of Herbicide Action, ed. P Bôger, G Sandmann,pp. 25-44. Boca Raton, FL:

CRC

Sagar, AD and WR Briggs (1990) Effects of high light stress on carotenoid-deficient

chloroplasts in Pisum sativum. Plant Physiol 94: 1663-1670.

Page 42: Response of plant growth and development to different ...

33

Sakamoto W, Kondo H, Murata M, Motoyoshi F (1996) Altered mitochondrial gene

expression in a maternal distorted leaf mutant of Arabidopsis induced by chloroplast

mutator. Plant Cell 8: 1377-1390

Schledz M, al-Babili S, von Lintig J, Haubruck H, Rabbani S (1996) Phytoene synthase

from Narcissus pseudonarcissus: functional expression, galactolipid requirement,

topological distribution in chromoplasts and induction during flowering. Plant J 10:

781-92

Scolnik P, Giuliano G, Pollock D, Hinton P (1986) Molecular genetics of carotenoid

biosynthesis: the tomato ghost mutant and mutants of the photosynthetic bacterium

Rhodopseudomonas capsulata. Curr-Top-Plant-Biochem-Physiol-Proc-Plant-

Biochem-Physiol-Symp-Univ-Mo-Columbia. Columbia, MO: The Interdisciplinary

Plant Biochemistry and Physiology Program 5: 142-152

Scolnik PA, Hinton P, Greenblatt IM, Giuliano G (1987) Somatic instability of carotenoid

biosynthesis in the tomato ghost mutant and its effect on plastid development. Planta

171: 11-18

Scott W, Meade R, Leon R (1992) Observations from 7- to 9-year old Douglas-fir variable

density plantation test beds. Weyerhaeuser Forestry Research Filed Notes 92-2,

Centralia, WA, 2 p

Sharrock RA, Quail PG (1989) Novel phytochrome sequences in Arabidopsis thaliana:

Structure, evolution, and differential expression of a plant regulatory photoreceptor

family. Gene & Dev 3: 1745-1757

Smith H, Whitelam GC (1997) The shade avoidance syndrome: Multiple responses mediated

by multiple phytochromes. Plant Cell Environ 20: 840-844

Page 43: Response of plant growth and development to different ...

34

Steindler C, Matteucci A, Sessa G, Weimar T, Ohgishi M, Aoyama T, Morelli G, Ruberti I.

(1999) Shade avoidance responses are mediated by the ATHB-2 HD-Zip protein, a

negative regulator of gene expression. Development 126: 4235-4245

Siedow JN, Umbach AL (1995) Plant mitochondrial electron transfer and molecular biology.

Plant Cell 7: 821-831

Smith WK, Vogelmann TC, DeLucia EH, Bell DT, Shepherd KA (1997) Leaf form and

photosynthesis. Bioscience 47: 785-793

Stoike LL, Sears BB (1998) Plastome mutator-induced alterations arise in Oenothera

chloroplast DNA through template slippage. Genetics 149(1): 347-53

Stubbe W, Herrmann RG (1982) Selection and maintenance of plastome mutants and

interspecific genome/plastome hybrids from Oenothera. In Methods in Chloroplast

Molecular Biology, Edelman M, Hallick RB and Chua NH, eds. (Elsevier Biomedical

Press, New York) pp. 149-165

Taylor,W.C (1989) Regulatory interactions between nuclear and plastid genomes. Annu

Rev Plant Physiol Plant Mol Biol 40: 211-233

Telfer A, Dhami S, Bishop SM, Phillips D, Barber J (1994) B-carotene quenches singlet

oxygen formed by isolated photosystem II reaction centers. Biochemistry 33: 14469-

74

Taiz L, Zeiger E (1998) Plant physiology, 2nd Eds. Sinauer Associates, Inc.

Tonkyn, JC, Deng X-W, Gruissem W (1992) Regulation of plastid gene expression

during photooxidative stress. Plant Physiol 99: 1406-1415

Vanlerberghe GC, Mcintosh L (1997) Alternative oxidase: From gene to function. Annu

Rev Plant Physiol Plant Mol Biol 48: 703-734

Page 44: Response of plant growth and development to different ...

35

Vanlerberghe GC, Vanlerberghe AE, Mcintosh L (1997) Molecular genetic evidence of

the ability of alternative oxidase to support respiratory carbon metabolism. Plant

Physiol 113:657-661

Vishnevetsky M, Ivadus M, Vainstein A (1999) Carotenoid sequestration in plants: the

role of carotenoid-associated proteins. Trends in Plant Science 4(6): 232-235

Wagner AM. Krab K (1995) The alternative respiration pathway in plants: role and

regulation. Physiol Plant 95: 318-325

Walbot V, Coe EH (1979) Nuclear gene iojap conditions a programmed change to ribosome-

less plastids in Zea mays. Proc Natl Acad Sci USA 76: 2760-2764

Walden R, Frtize K, Hayashi H, Miklashevichs E, Harling H, Schell J (1994) Activation

tagging: means of isolating genes implicated as playing a role in plant growth and

development. Plant Mol Biol 26: 1521-1528

Weller JL, Ross JJ, Reid JB (1994) Gibberellins and phytochrome regulation of stem

elongation in pea. Planta 192: 489-496

Wetzel CM, Jiang CZ, Meehan LJ, Voytas DF, Rodermel SR (1994) Nuclear-organelle

interactions: the immutans variegation mutation of Arabidopsis is plastid autonomous

and impaired in carotenoid biosynthesis. Plant J 6: 161-175

Wetzel CM, Rodermel SR (1998) Regulation of phytoene desaturase expression is

independent of leaf pigment content in Arabidopsis thaliana. Plant Mol Biol 37:

1045-1053

Wu D, Wright DA, Wetzel C, Voytas DF, Rodermel S (1999) The IMMUTANS

variegation locus of Arabidopsis defines a mitochondrial alternative oxidase homolog

that functions during early chloroplast biogenesis. Plant Cell 11: 43-55

Page 45: Response of plant growth and development to different ...

36

Yamamoto HY, Bassi R (1996) Carotenoids: loclization and function. IN oxygenic

Photosynthesis: The Light Resactions, ed. DR Ort, CF Yocum, pp. 539-563 The

Netherlands: Kluwer

Zeevaart, JAD,Creelman RA (1988) Metabolism and physiology of abscisic-acid. Annu.

Rev. Plant Physiol. Plant Mol Biol 39: 439-473

Page 46: Response of plant growth and development to different ...

37

CHAPTER 2. COMPETION RESPONSES OF WHITE ASPEN

TO RED:FAR-RED LIGHT

A paper to be submitted to the journal of Tree Physiology

Hanhong Bae and Richard B. Hall

Abstract

The reduced ratio of red:far-red (R:FR) light acts as a measure of the proximity of

competitors and plants can detect the potentially competing neighbor plants by perceiving

reflected R:FR signals and initiate the response of "shade avoidance" before actual shading

occurs. The phytochrome system is responsible for monitoring the changes in the R:FR and

initiating the shade avoidance response. The response to low R:FR ratio was studied in a

white aspen Populus alba clone 'Bolleana' using two filter systems: a clear plastic filter

system that allows a R:FR ratio less than 1.0 to pass from adjacent border plant reflection;

and a special commercial plastic that blocks FR light and creates a R:FR ratio above 3.0.

The reduced R:FR signals enhanced the stem elongation in response to competition at the

expense of relative stem diameter growth. Trees grown inside clear chambers were 27%

taller than trees grown inside the FR-blocking filter chambers. Stem taper of clear chamber

trees was 16% less than the FR-blocking filter trees. Low R:FR also induced 22% more stem

dry weight and 13% greater petiole length per leaf compared to the FR-blocking filter trees.

There were no statistically significant differences in leaf area, leaf number increment, and

total dry weight between the two light filter treatments.

Page 47: Response of plant growth and development to different ...

38

Introduction

Plants use light as energy, information to detect neighbors, and to keep track of time

throughout the seasonal growth cycle. Plants can detect their neighbors by sensing the

spectral properties of light reflected from the foliage of nearby plants and initiate the

response of "shade avoidance" before actual shading occurs (Ballaré et al., 1987, 1990, 1994;

Smith et al., 1990). Ambient light has a ratio of red to far-red light (R:FR at -660 nm to

-730 nm) of about 1.2 (Kendrick and Kronenberg, 1994). The photosynthetic pigments

absorb R light preferentially, but reflect or transmit FR light, which reduces the R:FR photon

ratio below 1.0 and acts as a signal for detection of neighbors (Ballaré et al., 1987, 1990,

1994; Ritchie, 1997; Smith et al., 1990; Smith and Whitelam, 1997). The changes in the

R:FR ratio function as a measure of the proximity of competitors and acts as an "early

warning signal" (Ballaré et al., 1987). The shade avoidance includes enhanced stem

elongation and other morphological changes to increase the chance of receiving direct

sunlight. The shade avoidance reaction varies according to the species and genetic

background. Most studies have been done with herbaceous plants (reviewed in Kendrick and

Kronenberg, 1994). The most common response of shade avoidance is extra elongation

growth in intemodes. The elongation growth is also observed in the hypocotyl and petioles.

Most herbaceous plants show the elongation growth at the expense of leaf development and

branching. However, different shade avoidance responses have been reported in some tree

species. In coastal Douglas-fir (Pseudotsuga menziesii) seedlings, crown biomass and

branch number increased with decreasing growing space (Ritchie, 1997). Although leaf

numbers were reduced in more dense canopies in Populus trichocarpa x deltoides clone

'Beaupré' trees, increased leaf area and dry weight were reported (Gilbert et al., 1995). In

Page 48: Response of plant growth and development to different ...

39

accordance with the above results, other studies reported that young trees in high density

plantations usually show rapid height growth that occurs long before actual shading

(Cameron et al., 1991; DeBell and Giordano, 1994; Knowe and Hibbs, 1996; Scott et al.,

1992).

Many experiments have shown that the phytochrome pigment system is responsible

for monitoring the changes in the R:FR and initiating the shade avoidance response

(reviewed in Kendrick and Kronenberg, 1994). Phytochromes are blue protein photo-

reversible pigments that absorb R and FR light most strongly. They have important roles in

light-regulated vegetative and reproductive development. Phytochromes are encoded by a

multigene family and each phytochrome controls a different process with overlapping

functions. While five genes (PHYA, B, C, D and E) have been reported in Arabidopsis, only

three genes (PHYA, Bl and B2) have been reported in Populus trichocarpa and Populus

balsamifera (Sharrock and Quail, 1989; Howe et al., 1998). There are two types of

phytochromes: type I is light labile (phytochrome A) and type II (phytochrome B-E) is light

stable. In dark-grown plants, phytochrome A is the most abundant phytochrome. Expression

of phytochrome A is negatively regulated in the light and the protein is degraded in the light

(Kendrick and Kronenberg, 1994).

The involvement of multiple phytochromes in response to shade avoidance has been

reported through the studies of phytochrome deficient mutants. For example, light-grown

phytochrome B deficient mutants of Arabidopsis showed elongated growth and early

flowering that are characteristics of the shade avoidance syndrome of wild type seedlings

grown under a low R:FR light environment (Nagatani et al., 1991; Reed et al., 1993). This

indicates that the phytochrome B signal is responsible for the inhibition of hypocotyl

Page 49: Response of plant growth and development to different ...

40

elongation and has a major role in the shade avoidance response. Under FR-rich light,

Arabidopsis phytochrome B null mutants showed additional elongation growth and even

earlier flowering than phytochrome B null mutants grown in a normal light environment.

This indicates that other phytochromes are also involved in the shade avoidance response

(Smith and Whitelam, 1997). According to the analyses of other phytochrome null mutants,

phytochrome B, D and E regulate the shade avoidance response (Aukerman et al., 1997;

Devlin et al., 1998, 1999). Normally, phytochrome A has little effect on shade avoidance,

probably due to the property of light instability of phytochrome A. The function of

phytochrome C is still unknown in the shade avoidance response due to the lack of

phytochrome C null mutants (Morelli and Ruberti, 2000). However, a reduced level of

phytochrome C was detected in the Arabidopsis phytochrome B mutant, which indicates that

the mutant phenotype may result in part from the reduced phytochrome C (Hirschfeld et al.,

1998).

Phytochrome is produced in the R light-absorbing form called Pr in dark-grown

plants. Pr is converted by R light to the FR light-absorbing form called Pfr, which is the

physiologically active form of phytochrome and the two forms are photoreversible (reviewed

in Kendrick and Kronenberg, 1994). It has been suggested that the ratio between Pfr and the

total amount of phytochrome (Pfr/Ptotal) determines the magnitude of the response. Lower

ratios of R:FR convert greater portions of Pfr into the Pr form generating reduced ratios of

Pfr/Ptotal. The changes were also reported in tree experiments: lower Pfr/Ptotal was detected

with higher canopy density of Populus trichocarpa x deltoides clone 'Beaupré' and Douglas-

fir seedlings (Gilbert et al., 1995; Ritchie, 1997). They found negative linear relationships

between stem height growth rate and plant spacing or Pfr/Ptotal. Therefore, the R and FR

Page 50: Response of plant growth and development to different ...

41

wavelengths of light function as a signal for plants to adjust to the competition environment

through modification in growth.

The objective of this study was to understand the growth changes in Populus alba

clone 'Bolleana' in its juvenile stage in response to the changes in R:FR. The long term

objective is to develop a controlled-environment assay to study genetic variation in the shade

avoidance response of Populus clones. A commercial plastic filter system that selectively

absorbs FR light was used to produce a high ratio of R:FR (van Haeringen et al., 1998).

Although many studies have been performed on the response to the different R:FR light

conditions, most of the data are from herbaceous plants. An understanding of the shade

avoidance response of poplar trees would be useful for the management of poplar stands in

the field to maximize production through genetic selection for the best growth response and

to choose optimal spacings.

Materials and Methods

Plant Material and Growth Conditions

The white aspen Populus alba clone 'Bolleana' was used to study the effect of R:FR

on growth as a competition signal. Ramets were propagated through a greenwood cutting

method (Faltonson et al., 1983). Stems were cut into small sizes that contained two

intemodes with two fully-expanded leaves. The lower leaf was removed and the base of the

stem was dipped into 1,000 mg/L of indole 3-butyric acid (IB A) to induce rooting. The IBA-

treated stem segments were inserted into Jiffy-7 Peat Pellets (Jiffy Products of America,

Batavia, IL) that were moisturized overnight before use. The stem cuttings were placed in a

Page 51: Response of plant growth and development to different ...

42

mist chamber for rooting over a 20-day period. The rooted stem cuttings were potted in a

mixture of peat:perlite:vermiculite (1:1:1) and used for the R:FR light treatment when plant

height reached around 14 -19 cm. All plants were fertilized once a week with a mixture of

Miracle-GroExcel All Purpose® (21:5:20, Scotts, Columbus, OH) and watered daily. Plants

were grown in the Forestry Greenhouse at Iowa State University under 20 °C and 16-h light

period.

Light Treatment and Growth Measurements

Two plants of similar height were randomly assigned to one of two filter chambers.

Trees in the filter chambers were surrounded by four border trees arranged in a 40-cm square

to create the reflected light environment. Four more border trees were added at the 12lh day

of treatment to reduce the R:FR ratio inside the clear filter chamber below 1.0, which is the

threshold light condition that induces the shade avoidance response (Fig. 1). Open toped

chambers constructed from plastic films (30-cm diameter and 50-cm height) were used to

establish the two different R:FR ratios. A special FR-blocking plastic filter was used to

create a ratio of above 3.0 for a plant grown inside (Visqueen, Cleveland, UK; van Haeringen

et al., 1998). The FR filter selectively blocks FR light and thereby increases the R:FR ratio.

A transparent plastic filter was used as a control, transmitting a R:FR ratio of below 1.0

produced by the border trees. The filter chambers surrounded whole plants during the

treatment period that continued for 27 days. Photosynthetically active radiation (PAR, 400-

700 nm) inside the two filter chambers was measured using a LI-1000 spectroradiometer (LI-

COR, Lincoln, NE). According to preliminary measurements, the clear filter chambers

allowed -25% more PAR to pass through than the FR filter chambers. To maintain the same

Page 52: Response of plant growth and development to different ...

43

level of PAR for the two filter chambers, six 3.7-cm width strips of duct tape were attached

vertically to the sides of the clear filter chambers at every 60° around the circumference of a

chamber to reduce light penetration. To homogenize the growing conditions in the

greenhouse, plants were rotated into different positions on different benches every six days.

The R:FR was measured horizontally at the mid-height of the filter chamber with an

integrating cylinder, on loan from Weyerhaeuser Company (Ballaré et al., 1987). This

integrating cylinder has a cylindrical bar of transparent acrylic with a 45° cone removed from

the upper end to focus light entering from the sides on to the filter optic cable of a LI-COR

remote sensing attachment on a LI-1800 spectroradiometer (LI-COR, Lincoln, NE). The

R:FR ratios were calculated as the ratio of photon irradiance between 655 and 665 nm (R)

over photon irradiance between 725 and 735 nm (FR) (Smith, 1994).

To study the effect of R:FR light on plant growth, the following traits were measured

on five replications. Plant height was measured during the treatment at 3-day intervals. At

the end of the treatment period, height, intemode length, stem diameter at every intemode,

leaf area, leaf number, and petiole length were measured from LPI 0 (Leaf Plastochron

Index, first leaf > 3.0 cm) to the base of each tree (Larson and Isebrands, 1971). Leaf area

was measured using a LI 3000 area meter (Li-Cor, Lincoln, NE). Stem tapers were

calculated as follows: stem taper = (D2-D1) / L, where D1 = diameter at the LPI 2 (mm), D2

= diameter at the LPI nearest to 25 cm basipetal from Dl (mm), and L = actual stem distance

between Dl and D2 (cm). The potted root mass was soaked in water in a cold room at 4 °C

overnight and then washed clean of potting debris. Dry weights were determined for leaf,

stem, petiole and root after drying in an oven at 70 °C for 72 h.

Page 53: Response of plant growth and development to different ...

44

One-way analysis of variance (ANOVA) was used to compare treatment means with

a threshold of P = 0.05 used to classify statistical significance. The SAS statistical package

program version 6.12 was used to compute the analysis of variance (SAS institute, 1996).

Results

The R:FR ratio averaged 1.0 inside the clear filter chambers and 3.7 inside FR-

blocking filter chambers when the filter chambers were surrounded by four border trees. An

additional four border trees were added at the 12th day of treatment and the ratios were

decreased to 0.8 and 3.3, respectively. The temperatures inside the two types of filter

chambers were not significantly different (Sin, 2000). PAR levels were similar inside both

filter chambers during the period of treatment. The major response to low R:FR was the

enhanced stem growth. Trees inside clear filter chambers were taller than trees inside the

FR-blocking filter chambers (Table 1 and Fig. 2\P- 0.01). The difference in growth

increment between the two filter systems became significant after 15 days of treatment and

reached a maximum at the end of the treatment (Fig. 3). Average stem growth inside the

clear filter chamber was 6.9 cm (27%) taller than trees inside the FR-blocking filter chambers

through 27 days of treatment. Average intemode lengths were greater for trees in the clear

chambers at all positions except the lowest one that would have formed at the beginning of

the treatment. LPI 0-1 and LPI 5-6 of the clear filter trees showed the most significant length

advantage over trees inside the FR filter chambers (Fig. 4).

Stem taper showed a significant difference between the two filter treatments (P =

0.004). Average stem taper for the FR-blocking filter treatment was 16% greater than the

clear filter treatment. Stem dry weight showed a significant difference between the two filter

Page 54: Response of plant growth and development to different ...

45

treatments in the reverse direction (P = 0.005). Average stem dry weight of the clear filter

trees was 22% heavier than the stem dry weight of the FR-blocking filter trees.

Average petiole length also showed a significant difference between the two filter

treatments (P = 0.01). Petioles of clear filter trees averaged 13% longer than petioles of FR-

blocking filter trees. However, the difference in total petiole dry weight did not show a

significant difference between the two filter treatments. Average petiole length of the clear

filter trees between LPI 0 and LPI 2 was significantly longer than the FR-blocking filter trees

and this trend was present in older leaves as well (Fig. 5). The pattern of petiole length

development at each LPI was similar between the two filter treatments.

There were no significant differences in leaf number increment, leaf area, leaf dry

weight, and root dry weight (Table 1). Total biomass was not significantly different between

the two filter chambers. In addition, the ratio of top dry weight (leaf, stem and petiole) to

root dry weight was not significantly different between the two filter chambers.

Discussion

Two different filter systems were used to analyze the effect of the R:FR ratio on the

stem elongation and other growth traits in a poplar clone. Not many studies have been done

with tree species and most work has been performed in the field. The field studies used

different plant spacings to analyze the effect of changed R:RF. However, different spacings

influence many other variables, such as light intensity, root competition, water use efficiency

and gas exchange. So, it is not usually clear from field studies what the direct effect of R:FR

is on growth traits. The filter system we used gives better conditions to study the effect of

R:FR on growth and morphological changes because the filters modify only the R:FR ratios.

Page 55: Response of plant growth and development to different ...

46

The results of this study indicate that R:FR signals change stem elongation, stem

taper, stem dry weight, and petiole length in young Populus alba clone 'Bolleana' trees.

However, other traits, such as leaf number increment, leaf area, and dry weight (leaf, petiole

and root) showed no significant differences. The main effect of low R:FR is to induce the

competition response that enhances stem elongation. While the reduction in R:FR inside

filter chambers appears to be the cause of stem elongation, we have checked for other

possible conditions that might affect the changes, such as differences in temperature and

PAR. However, no differences were found in temperature and PAR in the two filter

chambers. The two filter chambers act the same in reducing air movement. Air movement

does affect the allocation of photosynthate to mechanically support stems, reducing stem

height and increasing stem taper (Cleugh et al., 1998).

The combined dry weight of leaf, stem and petiole (top dry weight) in each treatment

was not significantly different. This suggests that elongated stem growth was due to

enhanced allocation of resources to stem intemode elongation at the expense of other growth

centers, not the result of increased photosynthesis. This result is consistent with previous

studies in herbaceous species, in which reduced R:FR redirected dry mass towards stem and

petioles and away from leaves, although the difference in leaf dry weight was not

statistically significant in our experiment (Morgan and Smith, 1979; Keiller and Smith,

1989). However, the response to changed R:FR is dependent on genetic background, which

suggests that the allocation of biomass in different tissues is controlled through genetic

mechanisms.

At day 12, an additional four trees were added around the filter chambers to reduce

R:FR. Over the next three days, growth differences in the two filter chambers became

Page 56: Response of plant growth and development to different ...

47

significantly different and stayed that way (days 15-27 of the combined treatment schedule in

Fig. 3). This is supportive evidence that the competition response occurs quickly in the low

R:FR condition. R:FR less than 1.0 is known as the starting point of inducing competition

response. From day 15, the growth increment difference between the two treatments kept

getting larger until the last day of treatment.

Gibberellin production is indcreased under low R:FR, which leads to the intemode

elongation, cell extension and cell division, and leaf development (Weller et al, 1994; Beall

et al., 1996). Stem elongation and cell expansion are strongly correlated with gibberellin

levels, but dry weight deposition is not related to gibberellin concentration (Potter et al.,

1999). Auxin is also an important component of the elongation process that is induced by

shade (Behringer and Davies, 1992; Steindler et al., 1999). It has been hypothesized that

higher lateral transport of auxin to epidermal and cortical cells occurs in the hypocotyl of

shaded seedlings at the expense of auxin transport through the developing vascular system.

This leads to elongation of these tissues and reduction of the vascular differentiation and root

auxin concentration, which causes a reduction in lateral root formation and eventually

primary root growth (Morelli and Ruberti, 2000). We did not find significant root dry weight

reduction in our low R:FR treatment, but the trend in the data was in that direction. The

control of hormonal effects is probably dependent on genetic background and/or

developmental stage, showing different competition responses.

The average leaf areas at LPI 0 and LPI 1 for clear filter trees were larger than FR-

blocking filter trees. This may be an adaptation of leaves in the fast growing region of the

stem to produce leaf area more rapidly at the top region of elongating stems in the

competition condition. Enhanced stem elongation and reduced stem taper in response to

Page 57: Response of plant growth and development to different ...

48

reduced R:FR is consistent with the previous studies (Casai et al., 1990; Ritchie, 1997).

Stem taper is an important indicator of mechanical support of trees and also indicates the

relative allocation to height and diameter growth. This kind of plant response to reduced

R:FR is probably a physiological process for better light harvest, which increases the

possibility of survival during competition.

Through this study, we found that there was large variability in the response of trees

during the treatment for the same filter chamber. Even though the starting plants were

similar in terms of height and leaf number, the subsequent growth rate fluctuated tree by tree.

This indicates that the physiological condition of each tree was not the same although they

looked the same. To eliminate this problem, trees need to be grown for a longer period of

time under the same growth conditions and then monitored for their growth rate to be sure

they have similar potential once treatment starts. Finally, we should choose trees that show

similar growth rate and have the same height and leaf number.

This study provides clear evidence that competition conditions (low R:FR) alter tree

biomass allocation to stem elongation. However, this study was performed using the juvenile

trees, which might respond differently as they age. This phenomenon is common in other

physiological processes. Therefore, further experiments with plants of various ages are

needed.

LITERATURE CITED

Aukerman, M.J, Hirschfeld M, Wester L, Weaver M, Clack T, Amasino R.M. and Sharrock

R.A. 1997. A deletion in the PHYD gene of the Arabidopsis Wassilewskija ecotype

defines a role for phytochrome D in red/far-red light sensing. Plant Cell 9:1317-1326

Page 58: Response of plant growth and development to different ...

49

Behringer J.F. and P.J. Davies. 1992. Indole-3-acetic acid levels after phytochrome-mediated

changes in the stem elongation rate of dark- and light-grown Pisum seedlings. Planta

188:85-92.

Ballaré, C L, A.L. Scopel, R.A. Sanchez, J.J. Casai and C.M. Gharsa. 1987. Early

detection of neighbor plants by phytochrome perception of spectral changes in

reflected sunlight. Plant Cell Environ 10:551-557.

Ballaré, C.L, A.L Scopel and R.A. Sanchez. 1994. Signaling among neighboring plants

and the development of size inequalities in plant populations.

Proc. Natl. Acad. Sci. USA. 1:10094-10098.

Ballaré, C.L, A.L. Scopel, and R.A. Sanchez. 1990. Far-red radiation reflected from

adjacent leaves: an early signal of competition in plant canopy. Science 247:329-332.

Beall, F.D., E.C. Yeung, and R.P. Pharis. 1996. Far-red light stimulates intemode

elongation, cell division, cell elongation, and gibberellin levels in bean. Can. J. Bot.

74:743-752.

Cameron, D.M., S.J. Ranee, R.M. Jones and D.A. Charles-Edwards. 1991. Trees and

pasture: a study on the effects of spacing. Agrofor. Today 3:8-9.

Casai J.J., and H. Smith. 1989. The function, action and adaptive significance of

phytochrome in light-grown plant. Plant Cell Environ. 12:855-862.

Casai J.J., R.A. Sanchez, and D. Gibson. 1990. The significance of changes in the red bar­

red ratio, associated with either neighbor plants or twilight for tillering in Lilium

multifloriim Lam. New Phytol. 116:565-572.

Ceulemans, R. 1990. Genetic variation in functional and structural productivity determinants

in Poplar. Eds. Thesis publisher, Amsterdam, pp 25-46.

Page 59: Response of plant growth and development to different ...

Cleugh, H.A., J.M. Miller, and M. Bohm. 1998. Direct mechanical effects of wind on crops.

Agroforestry Syst. 41:85-112.

DeBell, D.S. and P A. Giordano. 1994. Growth patterns of red alder. In The Biology and

Management of Red Alder. Eds. D.E. Hibbs, D.S. DeBell and R.F. Tarrant. Oregon

State University Press, pp 116-130.

Devlin, P.P., S.R. Patel, and G.C. Whitelam. 1998. Phytochrome E influences intemode

elongation and flowering time in Arabidopsis. Plant Cell 10: 1479-1488.

Devlin, P.P., P.R. Robson, S.R. Patel, L. Goosey, R.A. Sharrock, and G.C. Whitelam. 1999.

Phytochrome D acts in the shade-avoidance syndrome in Arabidopsis by controlling

elongation growth and flowering time. Plant Physiol. 119: 909-915.

Faltonson, R., D. Thompson, and J.C. Gordon. 1983. Propagation of poplar clones for

controlled-environment studies. USDA Forest service General Technical Report NC-

81.

Gilbert, I.R., G.P. Seavers, P.G. Jarvis, and H. Smith. 1995. Photomorphogenesis and canopy

dynamics, phytochrome-mediated proximity perception accounts for the growth

dynamics of canopies of Populus trichocarpa x deltoides "Beaupre". Plant Cell and

Environment 18:475-497.

Givnesh, J.T. 1995. Plant stems: Biomechanical adaptation for energy capture and influence

on species distributions. In Plant Stems. Physiology and Functional Morphology.

Eds. B.L. Gartner. Academic Press, Neew York, pp 10-58.

Hikosaka K., S. Sudoh and T. Hirose. 1999. Light acquisition and use by individuals

competing in a dense stand of an annual herb, Xanthium canadense. Oecologia

118:388-396.

Page 60: Response of plant growth and development to different ...

51

Hirschfeld, M., J.M. Tepperman, T. Clack, P.H. Quail, and R.A. Sharrock. 1998.

Coordination of phytochrome levels in phyB mutants of Arabidopsis as revealed by

apoprotein-specific monoclonal antibodies. Genetics 149: 523-535.

Howe, G.T., P.A Bucciaglia, W.P. Hackett, G.R. Fumier, M.M. Cordonnier-Pratt, G.

Gardner. 1998. Evidence that the phytochrome gene family in black cottonwood has

one PHY A locus and two PHYB loci but lacks members of the PHYC/F and PHYE

subfamilies. Mol Biol Evol. 15(2): 160-75.

Keiller, D. and H. Smith. 1989. Control of carbon partitioning by light quality mediated by

phytochrome. Plant Science 63:25-29.

Kendrick, R.E. and G.H.M. Kronenberg. 1994. Photomorphogenesis in plants, 2nd ed.

Kluwer Academic Publishers, Dordrecht, The Netherlands.

Knowe, S.A. and D.E. Hibbs. 1996. Stand structure and dynamics of young red alder as

affected by planting density. For. Ecol. Manage. 82:69-85.

Larson, P.R. and J.G. Isebrands. 1971. The piastochron index as applied to developmental

studies of cottonwood. Can. J. For. Res. 1:1-11.

Morelli, G. and I. Ruberti. 2000. Shade avoidance responses, driving auxin along lateral

routes. Plant Physiol. 122:621-626.

Morgan, D. C. and H. Smith. 1976. Linear relationship between phytochrome

photoequilibrium and growth in plants under simulated natural radiation. Nature 262:

210-212.

Nagatini, A., J.W. Reed, and J. Chory. 1993. Isolation and initial characterization of

arabidopsis mutants that are deficient in phytochrome A. Plant Physiol. 102:269-277.

Page 61: Response of plant growth and development to different ...

52

Panetso, C.K.P. 1980. Selection of new poplar clones under various spacings. Silvae Genet.

29:130-135.

Potter, T.I., S B. Rood and K.P. Zanewich. 1999. Light intensity, gibberellin content and the

resolution of shoot growth in Brassica. Planta 207: 505-511.

Reed, J.W., P. Nagpal, S.D. Poole, M. Furuya, and J. Chory. 1993. Mutations in gene for

the red:far-red light receptor phytochrome B alter cell elongation and physiological

responses throughout arabidopsis development. The Plant Cell 5:147-157.

Ritchie, G.A. 1997. Evidence for red:far-red signaling and photomorphogenic growth

response in Douglas-fir (Pseudotsuga menziesii) seedlings. Tree Physiol. 17:161-168.

SAS Institute Inc. 1996. S AS/STAT user's guide, release 6.12. Edn. SAS Inst., Cary, NC.

Scott, W., R. Meade and R. Leon. 1992. Observations from 7- to 9-year old Douglas-fir

variable density plantation test beds. Weyerhaeuser Forestry Research Filed Notes

92-2, Centralia, WA, 2 p.

Sharrock, R.A. and P H. Quail. 1989. Novel phytochrome sequences in Arabidopsis thaliana:

Structure, evolution, and differential expression of a plant regulatory photoreceptor

family. Gene Dev. 3:1745-1757.

Sin, S. 2000. Tree spacings and red:far-red light effects on juvenile Populus growth and

morphology. Ph.D. Thesis, Iowa State University, Ames, IA.

Smith, H., J.J. Casal, and G.M. Jackson. 1990. Reflection signals and the perception by

phytochrome of the proximity of neighboring vegetation. Plant Cell Environ. 13:73-

78.

Page 62: Response of plant growth and development to different ...

53

Smith, H. 1994. Sensing the light environment: the functions of the phytochrome family. In

Photomorphogenesis in plants, 2nd ed. (ed. R E. Kendrick and G.H.M. Kronenberg),

pp. 377-416. Kluwer Academic Publishers, Dordrecht, The Netherlands.

Smith, H. 1995. Physiological and ecological function within the phytochrome family.

Annu. Rev. Plant Physiol. Plant Mol. Biol. 46:289-315.

Smith, H. and G.C. Whitelam. 1997. The shade avoidance syndrome: Multiple responses

mediated by multiple phytochromes. Plant Cell Environ. 20: 840-844.

Steindler, C„ A. Matteucci, G. Sessa, T. Weimar, M. Ohgishi, T. Aoyama, G. Morelli, and I.

Ruberti. 1999. Shade avoidance responses are mediated by the ATHB-2 HD-Zip

protein, a negative regulator of gene expression. Development 126: 4235-4245.

van Haeringen, C.J., J.S. West, F.J. Davis, A. Gilbert, P. Hadley, S. Pearson, A.E. Wheldon

and R.G.C. Henbest. 1998. The development of solid spectral filters for the

regulation of plant growth. Photochem photobiol. 67(4):407-413.

Weller, J.L., J.J. Ross, and J.B. Reid. 1994. Gibberellins and phytochrome regulation of

stem elongation in pea. Planta 192:489-496.

Page 63: Response of plant growth and development to different ...

Table 1. Effect of different red:far-red light on tree morphological characteristics. All numbers are average of five replications

after 27 days of filter chamber treatment. The P values from the ANOVA are shown for each trait in the bottom row. Top dry

weight is the combined dry weight of leaf, stem and petiole. Total dry weight is the combined dry weight of top and root. NS, not

significant.

Filter Growth Stem Petiole Leaf No. Leaf Leaf dry Stem dry Petiole Top dry Root dry Top/root Total dry system increment taper length increment area weight weight dry weight weight weight dry weight

(cm) (cm) (cm2) (g) (g) (g) (g) (g) weight (g)

Clear 25.7 0.066 2.94 6.2 602 1.60 0.78 0.11 2.49 0.69 3.85 3.18

FR- 18.8 0.079 2.57 6.0 613 1.64 0.61 0.10 2.35 0.75 3.09 3.10 blocking

Increment 27% (+) 19%(-) 13%(+) NS NS NS 22% (+) NS NS NS NS NS for the

clear filler trees (%)

P value 0.011 0.004 0.014 0.749 0.885 0.749 0.005 0.675 0.430 0.307 0.112 0.884

Page 64: Response of plant growth and development to different ...

Figure 1. Arrangement of two filter chambers in greenhouse experiment. Left chamber is

--iear filter and right chamber is FR-blocking filter. Trees in the filter chambers were

surrounded by eight border trees to create the reflected light environment. To maintain the

same level of photosynthetically active radiation for the two filter chambers, six 3.7-cm

width strips of duct tape were attached to the sides of the clear filter chambers to reduce light

penetration.

Page 65: Response of plant growth and development to different ...

56

35

g 30

a

i 2 5

i 0 c £

1 O

20

15

10

Clear filter FR-blocking filter

Chamber treatment

Figure 2. Average growth increment after 27-day treatment of five replications exposed to

different red:far-red under two different filter chambers. Trees inside clear filter chambers

(R:FR = 0.8) were 27% taller than trees inside the FR-blocking filter chambers (R:FR = 3.2,

P = 0.01). The vertical bars represent standard error.

Page 66: Response of plant growth and development to different ...

57

30

E 25 o

g 20

I O c

! o

15

10

Clear filter

FR-blocking filter

9 12 15 18 21

Days after treatment

24 27

Figure 3. Increase in cumulative stem growth in response to low red:far-red light (clear

filter, R:FR = 0.8) during 27 days of treatment. Growth increments are averages of five

replications for each treatment exposed to two different red:far-red light. The vertical bars

represent standard error.

Page 67: Response of plant growth and development to different ...

58

6

Clear filter

FR-blocking filter ' 5 0-

4 O)

3

2

1

0-1 1-2 2-3 3-4 4-5 5-6 6-7 7-8 8-9 9-10

Intemode between each leaf plastochron index

Figure 4. Average intemode length after 27-day filter treatment of five replications exposed

to two different red:far-red light under two different filter chambers. Leaf plastochron index

(LPI) was used to compare the leaves between the two treatment in the same stage of

development and same age of leaves (LPI 0 > 3.0 cm). The vertical bars represent standard

error.

Page 68: Response of plant growth and development to different ...

59

E o

4.5

4

3.5

3

O) 2.5

» 0) "3

I 2

1.5

1

0.5

0

Clear filter

FR-blocking filter

2 3 4 5 6 7 8 9

Leaf plastochron index

10

Figure 5. Average petiole length at each leaf plastochrom index (LPI 0 > 3.0 cm) after 27-

day treatment of five replications exposed to two different red:far-red light under two

different filter chambers. The vertical bars represent standard error.

Page 69: Response of plant growth and development to different ...

60

CHAPTER 3. IMMUTANS AND GHOST ARE PLASTID QUINOL OXIDASES:

EVIDENCE FOR A NEW STRUCTURAL MODEL OF THE MITOCHONDRIAL

ALTERNATIVE OXIDASE

A paper submitted to Proceedings of the National Academy of Sciences

Hanhong Baea, Friedrich Behringer3, Carolyn Wetzel0 and Steve Rodermel3

Abstract

The immutans (im) variegation mutant of Arabidopsis has green- and white-sectored

leaves due to the action of a nuclear recessive gene. The white sectors of im accumulate

phytoene, a carotenoid biosynthetic intermediate. IMMUTANS codes for a plastid protein

that bears similarity to alternative oxidase (AOX), an inner mitochondrial membrane protein

that serves as a terminal oxidase in the alternative pathway of respiration. The function of

IM is unclear, but by analogy to AOX, it may function in a poorly understood redox pathway

in which electrons are transferred from phytoene to molecular oxygen. The ghost (gh)

variegation mutant of tomato bears phenotypic similarities to immutans. In this paper we

show that the im and gh phenotypes arise from mutations in orthologous genes, and we take

interdepartmental Genetics Major, Iowa State University, Ames, IA 50011

^Department of Botany and Plant Pathology, Oregon State University, Corvallis, OR 97331

^Department of Biological Sciences, East Tennessee State University, Johnson City, TN

37614

Page 70: Response of plant growth and development to different ...

61

advantage of the tomato system to demonstrate that GH is expressed in plastid-types that

accumulate high levels of carotenoids, viz., chloroplasts in leaves and chromoplasts in

developing fruit and flowers. This suggests that GH (and IM) play a major role in

carotenogenesis. We also exploit the distant phylogenetic relatedness of GH (and IM) versus

AOX to test structural models of AOX. Our analyses reveal that AOX, IM and GH are RNR

R2 di-iron carboxylate proteins with perfectly conserved Fe-coordinating ligands that

define a quinol-binding catalytic site. This provides strong support for the hypothesis that

IM and GH are plastid quinol oxidases that act downstream from a quinone pool to dissipate

electrons in both chloroplast and chromoplast membranes. Importantly, our phylogenetic

analyses provide compelling evidence that AOX, IM and GH are interfacial membrane

proteins, indicating that structure/function studies based on currently accepted models of

AOX as a transmembrane protein will need to be re-evaluated.

Introduction

Carotenoids are C40 terpenoids that accumulate to high levels in the chloroplasts and

chromoplasts of photosynthetic eukaryotes (1,2). In chloroplasts, carotenoids function as

accessory pigments in photosynthesis, as structural determinants in the thylakoid membrane,

and as photoprotective agents, where they quench triplet excited state chlorophyll and singlet

oxygen that can occur as a byproduct of light absorption (3,4,5). In the absence of colored

carotenoids, chloroplasts are rendered nonfunctional in high light conditions due to

photooxidative damage. In chromoplasts, which are found in some nonphotosynthetic tissues

(e.g., some fruits and flowers), carotenoids are thought to serve primarily as visual attractants

Page 71: Response of plant growth and development to different ...

62

for pollinators (5). Carotenoids with provitamin A activity are essential components of the

human diet and many have anti-cancer activity (6).

All the steps of carotenoid biosynthesis occur in plastids by nuclear DNA-encoded

enzymes that are imported into the organelle post-translationally (5). Whereas genes for

most of these enzymes have been cloned and characterized (2), the identification and

isolation of factors that regulate higher plant carotenogenesis are poorly understood. To gain

insight into these factors we have been studying the immutans (im) variegation mutant of

Arabidopsis (7,8). Cells in the green sectors of im contain morphologically normal

chloroplasts, whereas cells in the white sectors have abnormal plastids that lack organized

internal lamellar structures. All im alleles examined to date are nuclear recessive (8,9,

unpublished data) and white sector formation is promoted by growth in enhanced light

intensities (7,9).

The white plastids of im accumulate phytoene, a colorless C40 carotenoid

intermediate, suggesting that im is impaired in the activity of phytoene desaturase (PDS),

which converts phytoene to zeta-carotene (7). We have recently positionally cloned

IMMUTANS (8) and found that it codes for a plastid homolog of the mitochondrial

alternative oxidase (AOX), an inner membrane protein that acts as a terminal oxidase in the

alternative pathway of mitochondrial respiration (10,11). This pathway branches from the

cytochrome pathway at the ubiquinone pool; AOX transfers electrons from ubiquinone to

molecular oxygen, forming water. IM is only distantly related to AOX, but because of its

similarity to the AOX class of proteins we suggested that it may be a component of a poorly

understood redox pathway in which the desaturation of phytoene by PDS results in the

transfer of electrons to a quinone pool and thence to molecular oxygen (12,13,14,15). We

Page 72: Response of plant growth and development to different ...

63

hypothesized that IM could act either as a cofactor of PDS, passing electrons to the quinone

pool, or as a redox component downstream from the quinone pool (8).

We and others (5,7) have noted that there are many phenotypic similarities between

im and the well-known ghost (gh) variegation mutant of tomato (16) (Fig. 1). Like im,

variegation arises in gh due to the action of a nuclear recessive gene (16); the white gh

sectors accumulate phytoene (16,17,18); and white sector formation in gh is promoted by

elevated light intensities (16,18). In this paper we show that im and gh arise from mutations

in orthologous genes and we use the tomato system as a tool to clarify the function of IM and

GH in carotenogenesis. We further exploit the phylogenetic distance between IM and GH

versus AOX to gain insight into the structure of these proteins. Our analyses provide

compelling evidence that the active sites of these proteins are highly conserved, indicating

that current structural models of AOX need to be revised.

Materials and Methods

Plant Material and Growth Conditions

Tomato (Lycopersicon esculentum Mill.) seeds heterozygous for the ghost (gh)

mutation were obtained from the Tomato Genetics Resource Center (University of

California, Davis). The plants were maintained in a greenhouse. The hétérozygotes were

sel fed and the F1 progeny were used for analysis; the genotypes of normal-appearing F1

plants (gh/+ or +/+) were determined by examining the phenotypes of F2 progeny from

selfed F1 plants. For some experiments, seeds were surface sterilized (50% Chlorox),

germinated on Gamborg medium supplemented with 3% sucrose, and maintained on a lab

Page 73: Response of plant growth and development to different ...

64

bench under continuous light (100 |imol/m2sl). In some cases, the tissue culture medium was

supplemented with 5 x 10"5 M Norflurazon (Sandoz 9789).

Nucleic Acid Manipulations

A tomato (cv. VFNT cherry) green-fruit cDNA library (kindly provided by D.

Hannapel, Iowa State University) was screened for the presence of /M-like sequences using

established procedures (19); the filters were probed with a radiolabeled Arabidopsis IM

cDNA (8). Tomato genomic DNAs were isolated and genomic DNA gel blot analyses were

conducted, also by established methods (19). GH genomic sequences were determined by

primer walking using DNAs from +/+ and gh/gh F1 progeny plants; the PCR products were

sequenced directly. DNA and derived protein sequences were analyzed using DNASIS

(Hitachi Software Engineering America, San Francisco, CA); Biology WorkBench

(http//biology.ncsa.uiuc.edu) and ChloroP (http://www.cbs.dtu.dk/services/ChloroP/).

Total cell RNA was isolated using an RNA isolation kit (Quiagen, Valencia, CA).

RNA gel blot and RT-PCR analyses were performed as previously described (7,20).

Northern filters were probed with random-primed cDNAs specific for the tomato IM

homolog (GH) or for Lhcb (CAB40, for the tobacco light-harvesting chlorophyll a/b binding

proteins of photosystem II) (21).

Page 74: Response of plant growth and development to different ...

65

Results

im and gh Arise from Mutations in Orthologous Genes

A tomato gene with homology to IM was isolated by screening a tomato fruit cDNA

library with IM sequences. Four cDNAs were identified, all of which were identical in

sequence but differed in their 3' lengths. The size of the longest cDNA (1,463 bp) was

similar to that of transcripts from this gene on RNA gel blots (see later, Fig. 6), suggesting

that it is a near full-length cDNA (Fig. 2). This cDNA contains an open reading frame of

366 amino acids with a predicted molecular mass of 42.1 kD, similar to IM (40.5 kD) (8).

The protein also bears 67% amino acid sequence identity to IM, with most of the variability

in the putative N-terminal plastid targeting sequences of the two proteins. We conclude that

we have isolated an IM homolog from tomato.

Genomic Southern blot analyses performed under low stringency hybridization

conditions revealed that the IM homolog is a single-copy gene in tomato (data not shown).

IM is also a single-copy gene in Arabidopsis (8). Sequencing of tomato genomic DNA

showed that the IM-homolog contains nine exons, identical to the number found in the IM

genomic sequence (Fig. 3A). As a first step to determine whether the gene for the IM

homolog is the same as the gene for GH, we used a collection of 45 F2 plants generated from

an interspecific cross between Lycopersicon esculentum (L.) Mill, and L pennellii (Correll)

D'Arcy to physically map the IM homolog on the tomato genome. We found that it mapped

6.4 cM (+/- 0.29 cM) from RFLP marker TG47 on chromosome 11 ; TG47 maps ~3 cM from

GH (23). This map location is consistent with the idea that the IM homolog maps to the GH

locus.

Page 75: Response of plant growth and development to different ...

66

If IM and GH are homologs, then the IM homolog should bear a mutation in gh

plants. To test this hypothesis, we determined the genomic sequence of the I M homolog in

gh/gh and +/+ F1 progeny plants. Compared to the wild type, the IM homolog contains a T

nucleotide insertion near the 3'end of the seventh exon of the gene in the mutants (Fig. 3A).

This would be predicted to generate an mRNA species with a premature stop codon ~40 nt

downstream from the site of the insertion (Fig. 3B). However, mutations near splice sites of

plant genes sometimes result in the activation of cryptic splicing sites that generate mRNAs

in which the normal reading frame is reconstituted (A. Manuell and S. Rodermel,

unpublished data). To examine this question in gh, we isolated mRNAs from gh/gh plants

and performed reverse transcriptase-PCR (RT-PCR). Sequencing of the PCR products

revealed that the IM homolog transcripts bears the T insertion and contains the expected

premature stop codon (Fig. 3B). This suggests that a truncated protein would be generated

from the gh mRNA; if stable, this polypeptide would lack critical functions of the GH protein

(below, Fig. 4).

In summary, we have shown that the tomato genome contains a single copy gene for

an IM homolog, that this homolog maps to gh, and that its mRNAs bear a premature stop

codon in gh plants. These data support the notion that GH and IM are orthologous proteins.

Further support for this conclusion comes from the observation that im and gh have similar

phenotypes.

Structural Model of GH, IM and AOX

Phylogenetic analyses revealed that IM is a distantly related member of the AOX

class of inner mitochondrial membrane proteins (8). The substrates of AOX are ubiquinol

Page 76: Response of plant growth and development to different ...

67

and dioxygen, and iron is essential for activity (10,11). The currently accepted structural

model of AOX, proposed by Siedow and colleagues (24,25) was based on that of the "RNR

R2" class of di-iron carboxylate proteins (named after the R2 subunit of ribonucleotide

reductase). The active sites of RNR R2-type proteins consist of a binuclear iron center

coordinated by two histidines and four carboxylate residues (26). In the Siedow model,

AOX contains two transmembrane domains, with the N and C termini exposed to the matrix

side of the membrane (Fig. 4A). Of three "EXXH" motifs in the C-terminal portion of the

protein (Bl, B2 and B3), B2 and B3 were proposed to form part of the di-iron center because

only these two would reside on the same side of the membrane. It has proven difficult to test

the Siedow model, and it enjoys little unequivocal experimental support (26).

Taking advantage of a larger number of AOX sequences than were available when

the Siedow model was proposed, Andersson and Nordlund (26) have recently proposed a

revised structural model of AOX. They hypothesized that the hydrophobic regions of AOX

are not transmembrane segments but rather, as with other RNR R2 proteins, they proposed

that AOX is an interfacial membrane protein with an active site contained within a four helix

bundle, with helices 1 and 3 (and helices 2 and 4) oriented anti-parallel to one another. In

this model, the active site consists of a di-iron center coordinated by the B1 and B3 "EXXH"

motifs on the paired second and fourth helices (Fig. 4A), while the other two carboxylates

are contributed by the paired first and third helices. El83 on helix 1 and E274 on helix 3

were proposed as these carboxylate residues, based on the spacing between helices 1 and 2

(usually 30 amino acids) and between helices 3 and 4 (also, usually 30 amino acids) found in

other RNR R2 type proteins.

Page 77: Response of plant growth and development to different ...

68

Because we found that IM and GH are only distantly related to AOX (8), we reasoned

that phylogenetic comparisons of these sequences might offer an opportunity to test the

validity of the Andersson and Nordlund model, i.e., AOX sequences that are evolutionary

conserved in GH and IM are likely important for structure and function. In Fig. 4B, the

sequences of 20 AOX proteins were compared with those of IM and GH in the C-terminal

two-thirds of the protein. This is the most conserved region of the three proteins (Fig. 2).

Consistent with the Andersson and Nordlund model, GH (and IM) are predicted to contain

four helices. Importantly, the B1 and B3 "EXXH" sites are precisely conserved between

AOX, GH, and IM; the B2 site is not conserved. This suggests strongly that these sequences

provide four of the six expected Fe-ligands. The only conserved carboxylates in helices 1

and 3 are E147 and E238, respectively, suggesting that these residues serve as the other two

Fe ligands.

The strict conservation of the B1 and B3 sequences (on helices 2 and 4, respectively)

indicates that if these sequences provide four of the six Fe-ligands, they must reside on the

same side of the membrane to form a bi nuclear iron center. Considered together with the

precise conservation of the E147 and E238 sequences (on helices I and 3, respectively), our

data thus lend striking support to the Andersson and Nordlund hypothesis that the four

helices in AOX are oriented anti-parallel to one another, as in other RNR R2 proteins, and

that AOX is an interfacial membrane protein, also as in other RNR R2 proteins (26). We

propose that IM and GH have a similar structure to AOX (Fig. 5). As with AOX, we

hypothesize that the hydrophobic portions of GH and IM insert only partially through the

lipid bilayer, providing a surface for dimerization, which has been observed with AOX

(10,11), or other protein/protein interactions.

Page 78: Response of plant growth and development to different ...

69

GH Expression

As a first approach to assess the physiological function of GH and the mechanism of

gh variegation, we examined the patterns of GH mRNA accumulation in various tomato

tissues, organs and developmental stages. CAB mRNA expression served as a control. GH

transcripts were detected in all organs tested. They were highest in expanding (young)

leaves, flowers, and fruits, and lowest in stems and roots (Fig. 6A). Similar levels

accumulated in the green leaf tissues of WT and gh, but much lower levels were found in the

white sectors of gh leaves (Fig. 6A). GH mRNAs increased markedly in abundance during

flower and fruit development (Fig. 6B), two processes that involve the biogenesis of

chromoplasts from either proplastids (during flower development) or chloroplasts (during

fruit development) (27). GH transcript amounts were also elevated by treatment with

Norflurazon (NF), a chemical inhibitor of PDS (Fig. 6C). Etiolated and greening seedlings

had similar GH mRNA levels (Fig. 6C), suggesting that GH transcription is not

photoregulated.

As anticipated, CAB transcripts were abundant in all normally green organs of the

plant (Fig. 6A). They also declined during flower and fruit development (Fig. 6B) and were

induced during de-etiolation (Fig. 6C), also as expected (27); expression in the flowers is

from the sepals. Fig. 6C further reveals that CAB mRNAs are detectable in the white leaf

tissues of gh, but not in white, NF-treated leaves. Moreover, CAB mRNA levels were

markedly higher in the green leaf sectors of gh than in the leaves of WT plants (Fig. 6A).

This is also the case in im (28), where we suggested that higher CAB mRNA levels in the

green sectors is part of a physiological strategy to maximize growth that involves an increase

Page 79: Response of plant growth and development to different ...

70

in light-harvesting capacity and photosynthesis in the green sectors to compensate for a lack

of photosynthesis in the white sectors.

Discussion

Structure of AOX, GH and IM

The primary lesion in the gh variegation mutant has been a matter of intense

speculation since its discovery nearly 50 years ago (16). In support of the idea that GH is the

tomato ortholog of IM, we found that a tomato IM homolog is a single copy gene in tomato

(as is IM in Arabidopsis) (8); that the IM homolog maps to the gh locus; that its mRNA

contains an insertion mutation in the gh background; and that the phenotypes of gh and im

are very similar. Interestingly, this phenotype has not yet been described for any other

Arabidopsis or tomato mutant loci. It will be of interest to determine whether light-sensitive

variegations in other species, such as albescent in maize (29), are orthologous to IM and GH.

Our phylogenetic analyses have provided compelling evolutionary evidence for the

validity of the Andersson and Nordlund model (26) of the structure of the AOX. Not only

are the active site helices conserved between AOX, GH, IM, and other RNR R2 type di-iron

proteins, but our evolutionary filtering allowed us to identify precisely the six carboxylates

that likely act as coordinating Fe ligands; these will be the target of future mutagenesis

experiments. Also consistent with the Andersson and Nordlund model, we predict that AOX,

GH and IM are interfacial membrane proteins. One possibility is that the hydrophobic

helices (previously modeled as transmembrane domains) are involved in protein-protein

interactions. Regardless, the conservation of active site residues between GH, IM and AOX

argues convincingly that GH is a quinol oxidase, and suggests that these proteins have

Page 80: Response of plant growth and development to different ...

71

similar reaction mechanisms. The active sites of RNR R2 type di-iron proteins examined to

date have a small hydrophobic crevice that reaches down to the Fe center and that serves as

the quinol-binding site. We suggest that this, too, is the case for the active sites of IM, GH

and AOX.

Whereas our analyses are in broad agreement with the idea that IM, GH and AOX

have structures like other RNR R2-type proteins, there are some differences. Most notably,

there is an insertion of 19 amino acids between helices 3 and 4 in the GH (and IM) versus

AOX sequences, which results in an abnormally long second helix pair. Yet, this may be a

trend in the AOX class of RNR R2 proteins inasmuch as the spacing between the two co­

ordinating carboxylates within the pair of helices 3 and 4 in AOX is 50 residues (versus a

normal 30 residues); the significance of this spacing is not clear. It is also likely that there

are differences in the regulatory properties of IM and GH versus AOX. For instance, GH

(and IM) lack the conserved cysteines that are involved in dimerization and activation of

AOX (30,31). Any contribution to structure and function by sequences in the N termini of

the mature proteins might also be unique, since GH, IM and AOX are not conserved in this

region. Despite these apparent differences, the proposed structural model of AOX, IM and

GH offers testable hypotheses about residues and domains that are important for structure

and function. In this light, it would be worthwhile to re-evaluate results from previous

structure/function studies on AOX that were designed assuming AOX is a transmembrane

protein and that B2 and B3 are the active site Fe-ligands (e.g., 32,33,34).

Page 81: Response of plant growth and development to different ...

72

Role of GH in Carotenogenesis and the Mechanism of Variegation

The accumulation of phytoene in gh indicates that GH affects (directly or indirectly)

the activity of PDS, suggesting that GH plays a central role in carotenoid biosynthesis. In

support of this notion, GH transcripts are abundant in tissues whose plastids accumulate high

levels of carotenoids- leaves, flowers and fruits. They are also abundantly expressed during

chromoplastogenesis. The expression profile of GH is similar to that of PDS and PSY, two

genes in the carotenogenic pathway (27,35-39). We conclude that carotenoid accumulation

and GH expression are coordinated, at least at the level of transcript abundance, arguing that

GH plays a role in carotenogenesis.

The enzymes of carotenoid biosynthesis starting with the PDS step appear to be part

of a membrane-localized metabolon (2), and thus one possibility is that GH (IM) is a

component of this complex in both chromoplast and chloroplast membranes. In our current

working model, we envision that electrons from the desaturation of phytoene are transferred

by PDS to a quinone pool and thence to GH, reducing molecular oxygen. GH may also be

involved in the other desaturation step of carotenoid biosythesis, viz., the conversion of zeta

carotene to lycopene by zeta carotene desaturase (ZDS) (2). However, because GH mRNAs

appear to be present in plastid types that accumulate only trace levels of carotenoids, such as

etioplasts in dark-grown seedlings and amyloplasts in roots (27,36), it is possible that GH

plays a more general role in plastid metabolism. For instance, we have suggested that IM

functions during chloroplast biogenesis to help optimize electron dissipation while the

photosynthetic apparatus is being assembled (8). According to this hypothesis, im leaves are

variegated because photoprotective (colored) carotenoids are not synthesized in the absence

of IM, making the contents of the developing chloroplast susceptible to photooxidation under

Page 82: Response of plant growth and development to different ...

73

high light intensities. We further hypothesized that the formation of green versus white

plastids is conditioned by variations in IM activity and in the light intensity perceived by

individual plastids in the developing leaf primordium; once formed, white and green plastids

divide to form clones of plastids and cells (sectors) in the mature leaf (8).

We propose that variegated gh tissues that are normally green arise by a mechanism

similar to im (8). Yet, tomato tissues that contain chromoplasts, as well as chloroplasts, are

variegated in gh (flowers, fruits). The chromoplasts in these tissues are non-pigmented and

lack organized internal membrane structures (18, H. Bae and S. Rodermel, unpublished

observations). Because chromoplasts do not undergo photosynthesis and photooxidation, we

suggest that a lack of GH results in an inhibition of carotenogenesis and a consequent

blockage of chromoplast development at an early stage. Consistent with this idea, colored

carotenoid accumulation is necessary for the assembly and stability of chromoplast

membranes (4).

Regardless of the precise mechanisms of variegation in im and gh, perusal of the

cyanobacterial genome database reveals that IM, GH and AOX are not found in

cyanobacteria, the evolutionary progenitors of plastids. One possibility is that a nuclear gene

for the mitochondrial AOX duplicated and diverged, and once it acquired plastid targeting

signals, it became functional in multiple plastid types, serving primarily as a redox

component in carotenogenesis, but also as a more generalized electron sink. In agreement

with this hypothesis, recent evidence in Chlamydomonas suggests that IM may serve as a

terminal oxidase of chlororespiration (40).

Page 83: Response of plant growth and development to different ...

74

Expression of gh: Feedback Regulation

In addition to enhanced GH expression in carotenoid-accumulating tissues, our

expression analyses revealed that GH transcripts are induced in NF-treated tomato leaf

tissues. This is consistent with the notion that GH, like PDS and PSY, is subject to feedback

regulation of transcription, with higher rates in non-pigmented tissues (27,39). Against this

suggestion, we did not find induction of GH mRNAs in the white tissues of gh, as reported

for PDS and PSY (27). We cannot explain this difference, but it points toward the possibility

that the plastid states in the two types of phytoene-accumulating white tissues (i.e., gh and

NF-treated) are not identical, even though both are presumably photooxidized due to a lack

of colored carotenoid production. In support of this idea, Fig. 6 showed that CAB mRNAs

are detectable in the white leaf tissues of gh but not in NF-treated tomato leaves; we

observed a similar phenomenon in im (28). The lack of CAB mRNA accumulation in the

NF-treated tissues of both im and gh is consistent with the "plastid signal" hypothesis that the

transcription of some nuclear genes for plastid proteins is dependent on a signal that requires

developing or mature chloroplasts for its generation and/or transmission (41). However, the

presence of CAB mRNAs in the white sectors of gh and im suggests that CAB transcription is

partially uncoupled from its normal dependence on chlorophyll accumulation and chloroplast

development in these mutants. CAB transcription appears to be sensitive to the redox state of

the plastid (42), and thus one way GH (and IM) could influence this process is via altering

the redox poise of the PQ pool. How a lack of GH activity affects photosynthetic electron

transport is currently under investigation.

Page 84: Response of plant growth and development to different ...

75

References

1. McGarvey, D.J. & Croteau, R. (1995) Plant Cell 7, 1015-1026.

2. Cunningham, F.X. & Gantt, E. (1998) Annu. Rev. Plant. Physiol. Plant. Mol. Biol. 49,

557-583.

3. Demmig-Adams, B., Gilmore, A.M. & Adams, W.W. III. (1996) FASEB J. 10,403-412.

4. Havaux, M. (1998) Trends Plant Sci. 3, 147-151.

5. Bartley, G.E. & Scolnik, P.A. (1995) Plant Cell 7, 1027-1038.

6. Bendich, A. (1994) Pure Appl. Chem. 66, 1017-1024.

7. Wetzel, C M., Jiang, C.-Z., Meehan, L.J., Voytas, D.F. & Rodermel, S R. (1994) Plant J.

6, 161-175.

8. Wu, D., Wright, D.A., Wetzel, C„ Voytas, D.F. & Rodermel, S. (1999) Plant Cell 11, 43-

55.

9. Rédei, G.P. (1967) Genetics 56,431-443.

10. Siedow, J.N. & Umbach, A.L. (1995) Plant Cell 7, 821-831.

11. Vanlerberghe, G.C. & Mcintosh, L. (1997) Annu. Rev. Plant Physiol. Plant Mol. Biol. 48,

703-734.

12. Mayer, M P., Beyer, P. & Kleinig, H. (1990) Eur. J. Biochem. 191, 359-363.

13. Schulz, A., Ort, O., Beyer, P. & Kleinig, H. (1993) FEBS Lett. 318, 162-166.

14. Nievelstein. V., Vandekerkchove, J., Tadros, M.H., Lintig, J.V., Nitschke, W. & Beyer,

P. (1995) Eur. J. Biochem. 233, 864-872.

15. Morris, S R., Barrette, T.R. & DellaPenna, D. (1995) Plant Cell 7, 2139-2149.

16. Rick, C.M., Thompson, A.E. & Brauer, O. (1959) Am. J. Bot. 46, 1-11.

Page 85: Response of plant growth and development to different ...

17. Mackinney, G., Rick, C.M. & Jenkins, J.A. (1956) Proc. Natl. Acad. Sci. USA 42,404-

408.

18. Scolnik, P.A., Hinton, P., Greenblatt, I.M., Giuliano, G., Delanoy, M.R., Spector, D.L. &

Pollock, D. (1987) Planta 171,11-18.

19. Ausubel, P.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. &

Struhl, K. (1998) Current Protocols in Molecular Biology. (Greene Publishing

Associates/Wiley Interscience, New York).

20. Wetzel, C.M. & Rodermel, S R. (1998) Plant Mol. Biol. 37, 1045-1053.

21. Rodermel, S R., Haley, J., Jiang, C.-Z., Tsai, C.-H. & Bogorad, L. (1996) Proc. Natl.

Acad. Sci. USA 93, 3881-3885.

22. Carol, P., Stevenson, D., Bisanz, C., Breitenbach, J„ Sandmann, G., Mache, R.,

Coupland, G. & Kuntz, M. (1999) Plant Cell 11, 57-68.

23. Tanksley, S.D. et al. (1992) Genetics 132, 1141-1160.

24. Siedow, J.N., Umbach, A.L. & Moore, A.L. (1995) FEBS Lett 362, 10-14.

25. Moore, A.L., Umbach, A.L. & Siedow, J.N. (1995) J. Bioenerg. Biomembr. 27, 367-377.

26. Andersson, M.E. & Nordlund, P. (1999) FEBS Lett. 449, 17-22.

27. Giuliano, G., Bartley, G.E. & Scolnik, P A. (1993) Plant Cell 5, 379-387.

28. Meehan, L„ Harkins, K„ Chory, J. & Rodermel, S. (1996) Plant Physiol. 112, 953-963

29. Troxler, R.F., Lester, R., Craft, P.O. & Albright, J.T. (1969) Plant Physiol. 44, 1609-

1618.

30. Umbach, A.L. & Siedow, J.N. (1993) Plant Physiol. 103, 845-854.

31. Vanlerberghe, G.C., Mcintosh, L. & Yip, J.Y.H. (1998) Plant Cell 10, 1551-1560.

Page 86: Response of plant growth and development to different ...

77

32. Albury, M.S, Affurtit, C. & Moore, A.L. (1998) J. Biol. Chem. 273, 30301-30305.

33. Chadhuri, M., Ajayi, W. & Hill, G.C. (1998) Mol. Biochem. Parasit. 95, 53-68.

34. Berthold, D.A. (1998) Biochim. Biophys. Acta 1364, 73-83.

35. Maunders, M.J., Holdsworth, M.J., Slater, A., Knapp, J.E., Bird, C.R., Schuch, W. &

Grierson, D. (1987) Plant Cell Environ. 10, 177-184.

36. Fraser, P.O., Truesdale, M.R., Bird, C.R., Schuch, W. & Bramley, P.M. (1994) Plant

Physiol. 105,405-413.

37. Pecker, I., Chamovitz, D., Linden, H., Sandmann, G. & Hirschberg, J. (1992) Proc. Natl.

Acad. Sci. USA 89, 4962-4966.

38. Pecker, I., Gabbay, R., Cunningham, F.X. & Hirschberg, J. (1996) Plant Mol. Biol. 30,

807-819.

39. Corona, V., Aracri, B„ Kosturkova, G., Bartley, G.E., Pitto, L., Giorgetti, L„ Scolnik,

P.A. & Giuliano, G. (1996) Plant J. 9, 505-512.

40. Cournac, L., Redding, K., Ravenel, J., Rumeau, D„ Josse, E.-M., Kuntz, M. & Peltier, G.

(2000)7. Biol. Chem. 275, 17256-17262.

41. Leon, P., Arroyo, A. & Mackenzie, S. (1998) Annu. Rev. Plant Physiol. Plant Mol. Biol.

49, 453-480.

42. Escoubas, J.-M., Lomas, M., LaRoche, J. & Falkowski, P.G. (1995) Proc. Natl. Acad.

Sci. USA 92, 10237-10241.

Page 87: Response of plant growth and development to different ...

78

FIGURE LEGENDS

Fig. 1. The gh variegation mutant of tomato.

Fig. 2. GH is homologous to IM. The translated GH cDNA sequence (deposited in Genbank

as Accession number AF302931) is compared to that of IM (8). Identical amino acid

residues are boxed. The arrow indicates a putative protease cleavage site for removal of an

N-terminal transit sequence (predicted by ChloroP software). The location of this site

correlates with the size of the IM transit sequence, as estimated by in vitro chloroplast import

experiments (8,22) *, site of the insertion mutation in gh (See Fig. 3).

Fig. 3. gh mRNA has an insertion mutation.

A) Schematic of the GH genomic sequence (deposited in Genbank as Accession number

AF302932). Exons are shown as filled boxes, introns as open boxes. The numbering below

the gene refers to bp in the genomic sequence (5.01 kbp), commencing with the first base of

the GH cDNA. The numbering above the gene diagram refers to the codon position in the

translated sequence. *, site of the insertion mutation in gh.

B) The translated sequence of the IM homolog has a T insertion in gh/gh plants, resulting in a

premature stop codon.

Page 88: Response of plant growth and development to different ...

79

Fig. 4. Structural and functional domains of AOX, GH and IM.

A) The predicted structure of AOX according to the Siedow model (top) (24,25) and to the

Andersson-Nordlund model (middle) (26). The structure of GH is modeled after the

Andersson-Nordlund model. Shaded boxes (I-IV) are alpha helical regions: T1 and T2 are

putative transmembrane segments; "EXXH" (Bl, B2 and B3), "D" and "E" are putative Fe

binding carboxylate ligands; TP are putative transit peptides. Size of the protein is from

initiating ATG (codon 1) to the termination codon.

B) Comparison of AOX, GH and IM derived amino acid sequences. Non-identical residues

are shown. The sequences of GH and IM are compared downstream from codon 135 in the

GH sequence. The sequences were compared with 20 AOX sequences from GenBank

(.Arabidopsis thaliana AOX la, Arabidopsis thaliana AOX lb, Arabidopsis thaliana AOXlc,

Arabidopsis thaliana AOX2, Glycine max AOXl, Glycine max AOX2, Glycine max AOX3,

Nicotiana tabacum AOXl, Nicotiana tabacum AOX2, Oryza sativa AOX la, Oryza sativa

AOX lb, Sauromatum guttatum AOXl, Catharanthus roseus AOX, Mangifera indica AOXl,

Zea mays AOX, Chlamydomonas reinhardtii AOXl, Neurospora crassa AOX, Hansenula

anomala AOX, Trypanosoma brucei brucei AOX, Chlamydomonas sp AOX). Open and

shaded boxes, identical amino acids between all three sequences; the six perfectly conserved

Fe-ligands are indicated by the shaded boxes. Alpha helices are single-underlined;

hydrophobic regions are double-underlined. *, site of the insertion mutation in gh. —, gaps

in the alignment.

Page 89: Response of plant growth and development to different ...

80

Fig. 5. Structural model of GH. GH is proposed to be an interfacial membrane protein with

a di-iron center coordinated by two EXXH motifs on helices 2 and 4 (oriented anti-parallel to

one another), and two carboxylates on helices 1 and 3 (also oriented anti-parallel to one

another).

Fig. 6. GH mRNA expression.

A) Total cell RNAs were isolated from stems, roots, young expanding leaves, flowers

(corresponding to stage 3, Fig. 6B), and fruit (Turning stage) from WT plants, and from

white and green sectors of young expanding leaves of ghost. The samples were from

greenhouse-grown plants. Seven ng of each sample was electrophoresed through

formaldehyde-agarose gels and the filters were probed with random-primed cDNAs specific

for GH and CAB. Gel loadings are shown by EtBr-staining of rRNA bands.

B) RNAs were isolated from five developmental stages of flowers: stage 1 (< 0.2 cm); stage

2 (< 0.5 cm); stage 3 (< 1 cm); stage 4 (open sepal stage); and stage 5 (open petal stage)

(stages defined in 27). For tomato fruits, RNAs were isolated from total pericarp from

mature green (MG), breaker (BR), turning (TU), and red-ripe (RR) fruits. The samples were

from greenhouse-grown plants. Two gg of each sample were electrophoresed through

formaldehyde-agarose gels then treated as in A).

C). Total cell RNAs were isolated from WT seedlings germinated for 7 days in the dark on

tissue culture medium (dark), then exposed to light for 4 h or 12 h (100 (imol/mY, 22 °C).

Page 90: Response of plant growth and development to different ...

81

WT and gh seedlings were also germinated in the light on tissue culture medium for 7 days,

then transferred to new medium for 10 days; RNAs were isolated from expanding WT leaves

and from dissected white sectors of expanding ghost leaves (gh white). Some WT type

plants growing in the light were transferred to medium containing Norflurazon (5 X 10"5 M)

for the 10 days; total cell RNAs were isolated from bleached leaf tissue (NF).

Page 91: Response of plant growth and development to different ...

Figure 1

Page 92: Response of plant growth and development to different ...

83

n» 164

rTTACCTAACAACGGTATTAATTTCATTCrrGTGCGAA 3GAAJAALX3A7CAACAA7CZX:GATTrC£yVTTTCrGCTAT'2ACTrr?OGAACCTCAôTrrC «a : : m ? : : a: ?

S i 3 ? l A K

TAATTCTCTTTTT*;CTTC'V.AAAT :TnATCCCCCTTCAC:X7T': : R F N J V F e : s K j 2 A «551? : 4 m L :. H H L i L - - - - - J S£?1S R -TA^-JVUiTCATOTA^AirrrCGAGCAACCTrCTT/urAAJAÔAArGAACAAà'A : t £ ii iiSS ;iS3 '• SEES S

•AAr' -lAA.X:-' Aù - A- - --.ATCATTC AT •CTCTAACCGrrT/VJAtîAAAT V«CTTATAAA U - . * V ? - z ? . m m -• m l E K « v :. r. £ » N M .i :: *^53 ? A F W ? # : -r ie

^-TT:A—ACT -TCTAAATATrrTALrrCAC^CATTCACTCATAAACATTCTTCACACTTT s ses v r «aBaaBBmmmeM

TTAT A.V\A::UAAACTAT^T^A^;TTTT rT;TT-:TryiAAA :AATTr;CAA î t « s . s

ï M ï i 'Waaaa ? 'BmBgBBa

;« i r & z V.AAATV .TTt U7Î •

ïï 5 gB#mEamag*«gRB : $

TIAATITCTr^A^CCCATCCATA^A^CTTACCATAAATTtAT AUGATZAAk^A^A i : % 3 a

* V.AATT-JUCMXATrTCi.'C-^rrcrA/xAi ATTtkrAiTrfA^ACTACTACAC^r^AGr.-riACrT EEGSS S 5 HB# Ï

ATATTTATTT-.ATCAJT TTCAAACTTCAL"AJAJCCTAATAJT:_1AA^A: "TAAAAATAJA v i :

TAATTT^TATIA,—TATT "AT">AA "ATTAv".A^ATCACT.AA»>~AinAc^A7T'7rAAAA^rw\T

. ;:•) w%v. :TTTr:AAACT:Ajn,viA^"rrT':rrrr rT- TA:ACA':AGA-—-:AT V-T.ATSA % S 3RBM • i ï : ï ; 83S

% ' ï i V I t ; s ï ï l ë m m . ; •; TT::TATAAAL^w\JT:ACTCACC:;ATATr:AAL;TAACCAAAA(X7TALK;AAAACX:AAAAA«.':: 353 C : WWÎ?m •'• .1 D T ; v r K •* * 3*4 c :. i r* '* : * s . : K . ACAAA-rrATACrTGTATATACTAOTA-rA^Ai AAAAAAAAAAAAATAL-AAAÔATArA TTACAT'TrrerTATZTTTTTITrTGAGCTACAÛATG: .T : OC AAAJTTTT -" AA^GCAAAA T : : : : AHATAGTrTACCTrATTTAAJdrTCTTTACTA^ArTSTTTTTATATTTAGAATTTiTTA . r: -TC^AAACrzrrTATA^TC^ATJCATTrT^ACAArrTTT^GATATATCrJArrrJCATGAC . 4 -T7TTTACATA'"r,7AAAAAAAAAAAAAAA

J91 264

Figure 2

Page 93: Response of plant growth and development to different ...

84

A

ATG(l) *(259) TAG (367)

1 4263 4762 5019

B

WT RNA aat ttg ccc get cca aag att gca gtg gac tac tac acg gga ggt gac tta tat protein N L P A P K I A V ' D Y Y T G G D L Y

ghost RNA aat ttl gcc cgc tcc aaa gat tgc agt gga eta eta cac ggg agg tga ctt ata protein NFARSKDCSGLLHGR stop

Figure 3

Page 94: Response of plant growth and development to different ...

85

rz lxxh n kxxh

Figure 4

Page 95: Response of plant growth and development to different ...

86

1 1 Btetid Këmbrape I I I ! 1 i I < i ( I l l >, I I < I ( ( ,1 I ( ( I I I '

Figure 5

Page 96: Response of plant growth and development to different ...

9 3-m3ij

WT stem

WT root

gh white leaf

gh green leaf

WTlcaf

WT flower

WT fruit

light 4 fa

light 12 h

WT leal

NF-lref

wihlc leaf

Z.8

Page 97: Response of plant growth and development to different ...

88

CHAPTER 4. PLASTID-TO-NUCLEUS SIGNALING: THE IMMUTANS GENE OF

ARABIDOPSIS CONTROLS PLASTID DIFFERENTIATION AND LEAF

MORPHOGENESIS

A paper submitted to The Plant Physiology

Maneesha Aluru, Hanhong Bae, Dongying Wu and Steven Rodermel

Department of Botany and Interdepartmental Genetics Program, Iowa State University,

Ames, Iowa 50011

Abstract

The immutans (im) variegation mutant of Arabidopsis has green and white leaf

sectors due to the action of a nuclear recessive gene. IM is a chloroplast homolog of the

mitochondrial alternative oxidase. Because the white sectors of im accumulate the

noncolored carotenoid, phytoene, IM likely serves as a redox component in phytoene

desaturation. In this paper we show that IM has a global impact on plant growth and

development and that it is required for the differentiation of multiple plastid types, including

chloroplasts, amyloplasts and etioplasts. Consistent with these observations, IM promoter

activity and IM mRNAs are expressed ubiquitously in Arabidopsis. IM transcript levels do

not necessarily correlate with carotenoid pool sizes, raising the possibility that IM function is

not limited to carotenogenesis. Leaf anatomy is radically altered in the green and white

sectors of im. In particular, mesophyll cell sizes are dramatically enlarged in the green

sectors and palisade cells fail to expand in the white sectors. These findings suggest that im

interrupts plastid-to-nucleus signaling pathways that control Arabidopsis leaf developmental

programming. The green im sectors have significantly higher than normal rates of O,

Page 98: Response of plant growth and development to different ...

89

evolution and significantly elevated chlorophyl a/b ratios, typical of those found in "sun"

leaves. We conclude that the changes in structure and photosynthetic function of the green

leaf sectors are part of an adaptive mechanism that attempts to compensate for a lack of

photosynthesis in the white leaf sectors, while maximizing the ability of the plant to avoid

photodamage.

Introduction

Variegation mutants provide an excellent system to explore the nature of

communication between the nucleus-cytoplasm, chloroplast and mitochondrial genetic

compartments (reviewed by Leôn et al., 1998; Rodermel, 2001). The leaves of these mutants

have green and white (or yellow) sectors that arise as a consequence of mutations in nuclear

or organellar genes (Tilney-Bassett, 1975). Whereas the green sectors contain cells with

morphologically normal chloroplasts, cells in the white sectors contain plastids that lack

pigments and normal lamellar structures. One common mechanism of variegation involves

the induction of defective mitochondria or chloroplasts by mutations in nuclear genes. This

is sometimes due to transposable element activity, in which case the green and white cells

have different genotypes. In other cases the two types of cells have the same (mutant)

genotype, indicating that the gene defined by the mutation codes for a product that is required

for organelle biogenesis in some, but not all, cells of the mutant.

Despite the large number of mutant screens that have been conducted in Arabidopsis,

surprisingly few nuclear "variegation" loci have been reported. These include cab

underexpressed (cue 1), chloroplast mutator (chm), differential development of vascular-

associated cells (dov), immutans (im),pale cress (pac), varl and varl (e.g., Rédei, 1963;

Page 99: Response of plant growth and development to different ...

90

1967; 1973; Rôbbelen, 1968; Martinez-Zapater et al., 1992; Reiter et al., 1994; Li et al.,

1995; Grevelding et al., 1996; Sakamoto et al., 1996; Lôpez-Juez et al., 1998; Meurer et al.,

1998; Tirlapur et al., 1999; Streatfield et al., 1999). Of these, we have focused on immuians

(Wetzel et al., 1994; Meehan et al., 1996; Wetzel and Rodermel, 1998; Wu et al., 1999) and

varl (Chen et al., 1999; Chen et al., 2000); im is the topic of the present investigation, im

was first isolated and partially characterized nearly 40 years ago by Rédei (1963; 1967) and

Rôbbelen (1968). Sectoring in im is due to the action of a nuclear recessive gene, and white-

sector formation is promoted by growth in elevated light or temperature (Rédei, 1963;

Rôbbelen, 1968; Wetzel et al., 1994). Visually white reproductive structures of im give rise

to variegated progeny that are predominantly green or white, again depending on growth

illumination and temperature. Because of this apparent phenotypic reversibility and an

inability of the mutant to convert permanently from an all-green ("wild-type-like") to an

albino phenotype, Rédei (1975) called the mutant immutans (for "immutable"). Consistent

with this reversibility, abnormal plastids are not maternally-inherited in im, suggesting that

the plastid defect can be cured (Wetzel et al., 1994).

Biochemical analyses revealed that im white sectors accumulate phytoene, a colorless

Cw carotenoid intermediate (Wetzel et al., 1994). This suggests that the mutant is impaired in

the activity of phytoene desaturase (PDS), the plastid enzyme that converts phytoene to (3-

carotene (Bartley et al., 1991). We cloned IM by map-based methods and found that it codes

for a plastid homolog of the mitochondrial alternative oxidase (AOX) (Wu et al., 1999); a

transposon-tagged im allele has also been reported (Carol et al., 1999). AOX is an inner

mitochondrial membrane protein that functions as a terminal oxidase in the alternative

(cyanide-resistant) pathway of mitochondrial respiration where it generates water from

Page 100: Response of plant growth and development to different ...

91

ubiquinol (reviewed by Siedow and Umbach, 1995; Vanlerberghe and Mcintosh, 1997).

This similarity to AOX suggested that IM may be a component of a redox pathway that

functions in the desaturation of phytoene (Beyer et al., 1989; Mayer et al., 1990; 1992;

Schulz et al., 1993; Nievelstein et al., 1995; Morris et al., 1995). Consistent with this

interpretation, IM has quinokoxygen oxidoreductase activity when expressed in E. coli (Josse

et al., 2000).

We are interested in determining the physiological function of IM and the mechanism

of im variegation. A powerful way to gain insight into IM function is to examine the

phenotype of im plants. Because previous studies of im have focused on leaf variegation, we

were interested in determining whether im has other phenotypes. In this report, we show that

the mutant is impaired in its growth and development, and that this impairment is due, in

part, to a blockage of plastid differentiation in diverse cell types. IM expression appears to

be ubiquitous, but expression levels are not always correlated with carotenoid accumulation,

opening the possibility that IM serves as a general electron sink in thylakoid membranes.

Mesophyll cell morphogenesis is affected in both the green and white sectors of im,

indicating that IM is required for the transmission of a plastid signal(s) to regulate leaf

developmental programming. Finally, we report that the green im sectors have higher than

normal photosynthetic rates, perhaps to compensate for a lack of photosynthesis in the white

sectors.

Page 101: Response of plant growth and development to different ...

92

Results

Phenotype of immutans

We have sequenced three im alleles and all are predicted to be null (Wu et al., 1999).

For the present studies we used the spotty allele. We have previously reported that im seeds

germinate normally under all light conditions (Wetzel et al., 1994), and that depending on the

illumination conditions, germinated seedlings have green, variegated or white cotyledons and

true leaves (Redei, 1967; Rôbbelen, 1968; Wetzel et al., 1994). Other normally-green

organs, including stems and sepals, are also variegated. Whereas im flowers are

morphologically normal, siliques are smaller than wild-type and are either variegated or all-

white. White siliques lack seeds and variegated siliques have significantly fewer seeds than

normal.

Under low light conditions that promote the formation of nearly all-green plants, im

grows more slowly than wild-type (Fig. 1); im ultimately attains the stature of wild-type

plants. Shoot growth is similarly retarded in mutant plants maintained under normal light

conditions. However, in this case it is difficult to ascribe the growth impairment to a lack of

IM per se since it can be argued that these plants have white sectors and, consequently, that

there is less green tissue than normal to support growth. Figure 2 shows that wild-type and

im roots increase in length as a function of growth illumination. Whereas both types of roots

have a similar size distribution in darkness and under low light conditions, there is a tendency

for the wild-type to have longer roots than im under normal light conditions. Considered

together, Figures 1 and 2 indicate that a lack of IM impacts root and shoot development.

Page 102: Response of plant growth and development to different ...

93

Expression of IM

The phenotype of im suggests that IM is expressed not only in leaves, but also in

other Arabidopsis tissues and organs. To determine the developmental- and tissue-specificity

of IM expression, we investigated the patterns of IM promoter activity in transgenic plants

that bear an IM promoter: GUS reporter gene fusion (Fig. 3). Seeds from each line were

germinated on MS medium or in soil and GUS activity assays were carried out at different

stages of development. The expression patterns were identical for each of five

independently-transformed lines; the results in Figure 4 are from one of the lines.

GUS activity is first observed in one day-old light-grown seedlings immediately after

seed coat breakage (Fig. 4A). All of the tissues (roots, hypocotyls and cotyledons) are

heavily stained. This pattern is maintained throughout vegetative development, as illustrated

by the presence of GUS staining in roots, cotyledons, hypocotyls and developing first leaves

of 7-day-old light-grown seedlings (Fig. 4B). High levels of GUS activity are also found in

the cotyledons of dark-grown seedlings; however, the hypocotyls are barely stained (Fig.

4C). This is in contrast to control experiments performed with transgenic 35S promoter:

GUS seedlings, in which the hypocoyls and cotyledons are uniformly stained (Fig. 4D).

GUS activity appears to increase during early leaf development. It is low in the shoot

apical meristem (Fig. 4E) and in very young expanding leaves (leaf number 1 in Fig. 4E). As

the leaves continue to expand, GUS activity increases (leaf number 2 in Fig. 4E). Mesophyll

cells, guard cells and trichomes are stained in young leaves, while epidermal cells lack

significant staining (Figs. 4F and 4G). GUS activity is present in old leaves of six-week-old

mature rosettes (Fig. 4H). Stems also have appreciable GUS activity (Fig. 41). A cross

section of a hypocotyl reveals that staining is very high in the vascular tissues, but lower in

Page 103: Response of plant growth and development to different ...

94

the ground tissues (Fig. 4J). GUS activity is also present throughout the root (Fig. 4K).

Staining is observed in all flower parts, including the sepals, petals, and anthers (Fig. 4L),

and also in green silique coats (Fig. 41). In young seeds, GUS is expressed specifically in the

funiculus (Fig. 4M). All tissues except seed coats are stained with GUS in the control 35S

promoter: GUS fusion plants (as Fig. 4D).

To obtain a quantitative estimate of IM mRNA levels, we performed northern blot

analyses on total cell RNAs isolated from various Arabidopsis tissues and organs. Fig. 5A

shows that IM mRNAs are present in all of the RNA samples analyzed. IM transcripts are

most abundant in leaves, cotyledons, flowers and stems, and least abundant in etiolated

seedlings and siliques. IM mRNAs increase in amount during leaf development. These

experiments validate the results of the IM promoter: GUS assays and indicate that IM is

expressed ubiquitously in Arabidopsis tissues and organs throughout development.

Pigment Analyses

Carotenoid and chlorophyll levels were examined in the same organs and tissues as

the RNA gel blot analyses to determine whether there is a correlation between IM mRNA

accumulation and pigment content (Fig. 5B). In general, tissues in which IM mRNAs are

abundant have high pigment levels. Yet, there is not a one-to-one correspondence. For

instance, IM mRNAs are nearly as abundant in roots as in cotyledons and stems, but roots

contain only trace pigment amounts. IM mRNAs also increase progressively during leaf

development, while carotenoid and chlorophyll levels decline. On the other hand, a lack of

GUS staining of etiolated hypocotyls (Fig. 4C) correlates well with a lack of detectable

Page 104: Response of plant growth and development to different ...

95

pigment in this tissue. We conclude that the patterns of IM mRNA expression and pigment

accumulation do not necessarily correspond.

Plastid Ultrastructure

We have previously examined the ultrastructure of plastids in the green and white leaf

sectors of im (Wetzel et al., 1994). Because of the ubiquity of IM expression, we wanted to

determine whether IM is required for the biogenesis of plastids in organs other than leaves.

As shown in Figure 6, normal chloroplasts are present in wild-type cotyledons and in the

green sectors of im cotyledons (Fig. 6A), while the white sectors of im cotyledons contain

vacuolated plastids that lack organized lamellar structures (Fig 6B). The latter plastids are

the size of normal chloroplasts, i.e., much larger (~6 gm) than undifferentiated proplastids in

meristem cells (0.5-1 gm) (Bowman, 1994). These findings are similar to TEM analyses of

plastids in wild-type and im leaves (Wetzel et al., 1994).

Amyloplasts are small (approximately the size of proplastids), irregularly-shaped

plastids in roots (Bowman, 1994). They usually contain starch granules and a few extended

lamellar structures. Figure 6C shows that roots from wild-type Arabidopsis contain typical

amyloplasts. Examination of a large number of plastids in sections of im roots reveals that

some resemble wild type amyloplasts, but that most are devoid of extended lamellae and

starch granules (Fig. 6D). This heterogeneity in structure suggests that root tissues have a

heteroplastic amyloplast population. Cells in the white leaf sectors of im are also

heteroplastidic (Wetzel et al., 1994).

Etioplasts are achlorophyllous plastids found in dark-grown seedlings (reviewed by

von Wettsein et al., 1995). They contain a distinctive paracrystalline lattice of interconnected

Page 105: Response of plant growth and development to different ...

96

membrane tubules (the prolamellar body, or PLB). Figure 6E shows a representative

etioplast from a dark-grown wild-type cotyledon; it has a single large PLB. In contrast,

etioplasts from dark-grown im seedlings do not contain PLBs, but rather have a large,

organized molecular array (Fig. 6F). A large number of sections of im etioplasts have been

examined, and PLB-like structures have not been observed, i.e., the molecular array structure

is not an artifact of sectioning. Taken together, the data in Figure 6 indicate that IM is

required for the normal development of several plastid-types in Arabidopsis.

Anatomy of im Leaves

Although a lack of IM results in variegated green organs and retards plant growth,

light microscopy of tissue sections reveals that the morphology of non-green im organs (e.g.,

roots, hypocotyls and cotyledons of etiolated seedlings) is not detectably perturbed (data not

shown). This is in contrast to green organs such as leaves. We have previously shown that

chloroplast development is impaired in the white sectors of im leaves, but that the green leaf

sectors contain morphologically normal chloroplasts (Wetzel et al., 1994). Figure 7 shows

representative tissue sections of wild-type leaves, green im sectors, white im sectors and a

transition zone between green and white sectors. The wild-type leaves have typical

epidermal, columnar palisade mesophyll and spongy mesophyll cell layers; the latter two

layers have densely staining chloroplasts (Fig. 7A). In contrast, the tissue organization of the

green and white sectors of im leaves is perturbed. In particular, the green sectors are thicker

than normal due to a marked enlargement in the sizes of the mesophyll cells, epidermal cells

and air spaces (Fig. 7B). The white leaf sectors have a normal thickness, but the palisade

cells fail to expand normally (Fig. 7C). The distinctive characteristics of the white and green

Page 106: Response of plant growth and development to different ...

97

sectors are apparent in regions where the two tissue-types abut and overlay one another (Fig.

7D). This suggests that the factors that cause the abnormalities in cell structure are cell

autonomous.

The significant anatomical differences between the wild-type and im green sectors

raise the question whether the two types of green tissue have similar photosynthetic rates. As

a first approach to address this question, we measured the amount of oxygen evolved from im

versus wild-type plants on a per chlorophyll basis. We analyzed the response of plants

germinated and maintained under both low light and normal light conditions. We found that

the im green sectors evolve approximately twice as much oxygen as the wild type under both

illumination conditions (Fig 8A). In normal light conditions, the enhancement in oxygen

evolution is accompanied by a significantly enhanced chlorophyll a/b ratio (Fig. 8B).

Discussion

IMMUTANS Plays an Important Role in Plant Development

Previous morphological, biochemical and molecular analyses of immutans have

focused on leaves (Rédei, 1963; 1967; Rôbbelen, 1968; Wetzel et al., 1994). These studies

showed that IM is required for normal chloroplast biogenesis in some, but not all, plastids

and cells of the expanding leaf. In the present study, we observed phenotypic alterations in

other major organ systems of the mutant. This was true for both green organs (e.g.,

cotyledons, stems, siliques) and non-green organs (e.g., roots, etiolated hypocotyls and

cotyledons). These data suggest that IM has a global impact on plant physiology and

development. Support for this conclusion is provided by our IM promoter: GUS fusion and

Page 107: Response of plant growth and development to different ...

98

northern blot analyses showing that the IM promoter is active and that IM mRNAs are

expressed ubiquitously in Arabidopsis tissues and organs throughout development.

Role of IMMUTANS in Plastid Metabolism

The accumulation of phytoene in im white sectors suggests that PDS activity is

impaired in im and that IM plays an important role in carotenoid biosynthesis (Wetzel et al.,

1994). Cloning and sequencing of IM revealed that the gene product is a chloroplast

membrane protein with homology to the AOX class of inner mitochondrial membrane

terminal oxidases (Wu et. al., 1999; Carol et al., 1999). IM also has quinol oxidase activity

when expressed in E. coli (Josse et. al., 2000). Considered together, these data suggest that

IM is a redox component of a phytoene desaturation pathway involving PDS, plastoquinol

and oxygen as a terminal acceptor (Beyer et al., 1989; Mayer et al., 1990; 1992; Schulz et al.,

1993: Nievelstein et al., 1995; Norris et al., 1995).

In support of the central role of IM in carotenogenesis, our data show that the IM

promoter is active and that IM transcripts are abundant in Arabidopsis tissues that accumulate

high levels of carotenoids, including cotyledons, leaves, stems, siliques and flowers. In like

manner, some tissues that do not accumulate carotenoids, e.g., hypocotyls of dark-grown

seedlings, have low levels of IM expression. In further support of the idea that IM expression

and carotenoid accumulation are normally coupled is the finding that transcripts from an IM

ortholog in tomato are abundantly expressed during tomato fruit ripening (Josse et. al., 2000;

H. Bae and S. Rodermel, in preparation). During ripening, chloroplasts are converted into

carotenoid-accumulating chromoplasts; Arabidopsis, versus tomato, does not have an

abundant chromoplast population.

Page 108: Response of plant growth and development to different ...

99

By contrast, we found that IM is expressed at appreciable levels in tissues whose

plastids accumulate only small carotenoid amounts. These include amyloplasts in roots and

etioplasts in dark-grown seedlings. Yet, IM appears to be required for the proper functioning

of these organelles. Particularly striking is the blockage in development of im etioplasts,

where ordered structures, but not PLBs, accumulate in the stroma. We speculate that these

represent unassembled intermediates of the PLB, and that IM may be a redox component of

the PLB membrane required for PLB assembly (directly or indirectly). One possibility is that

IM is a subunit of the recently-described PLB supercomplex that mediates the light-

dependent reduction of Chlide a (Reinbothe et al., 1999).

Further support for the idea that IM function is not limited to carotenogenesis is the

finding that IM is up-regulated during leaf development. In Arabidopsis and other dicots,

photosynthetic rates reach a maximum early in leaf development (usually coincident with

leaf expansion), then progressively fall during a prolonged senescent phase in the fully-

expanded leaf (Miller et al., 1997; 2000; Gan and Amasino, 1997; A. Miller, D. Stessman,

M. Spalding and S. Rodermel, unpublished findings). During senescence, chloroplasts are

converted into gerontoplasts and resources are mobilized to growing parts of the plant. Both

anabolic and catabolic processes are responsible for reductions that occur in many plastid

components during the senescence process (Matile, 1992). The up-regulation of IM

expression in the face of declining carotenoid production suggests that IM participates in

oxidative activities that occur during this phase of development.

Because all plastid types synthesize carotenoids (e.g. as precursors of ABA), the

possibility cannot be ruled out that IM is an electron transfer component involved solely in

carotenogenesis. Nevertheless, our data point the way toward a more global role of this

Page 109: Response of plant growth and development to different ...

100

protein in plastid metabolism. In agreement with this hypothesis, recent evidence in

Chlamydomonas suggests that IM serves as a terminal oxidase in chlororespiration (Coumac

et. al., 2000). In the context of its importance in plastid metabolism and its ubiquitous

expression in all plastid types, it is interesting that IM does not seem to be required in

cyanobacteria, since BLAST searches show that IM (and AOX) are not present in this

evolutionary precursor of chloroplasts. Our working hypothesis is that a plant nuclear gene

for mitochondrial AOX duplicated, and once it acquired plastid targeting signals, it became

functional in many plastid-types as a redox component mediating electron transfer in

multiple pathways.

Plastid Signals Regulate Leaf Development

A considerable body of evidence supports the notion that the transcription of nuclear

genes for many photosynthetic proteins is controlled by the developmental state of the plastid

(the "plastid signal" hypothesis) (reviewed by Taylor, 1989; Susek and Chory, 1992; Leôn et

al., 1998; Rodermel, 2001). As an example, Lhcb transcription is markedly reduced in

carotenoid-deficient seedlings produced either by mutation or by treatment with herbicides

that block the carotenoid biosynthetic pathway, such as norflurazon, which inhibits PDS

activity (e.g., Mayfield and Taylor, 1984; Oelmiiller, 1989). Consistent with these

observations, we have previously reported that the white sectors of im, which are also

blocked at the PDS step of carotenogenesis, have reduced rates of Lhcb transcription and

decreased Lhcb mRNA levels (Meehan et al., 1996). A number of plastid signals have been

identified, and they have in common that they are involved (directly or indirectly) in

photosynthesis (reviewed by Rodermel, 2001). These signals include chlorophyll

Page 110: Response of plant growth and development to different ...

101

biosynthetic intermediates (Johanningmeier, 1988; Oster et al., 1996; Kropat et al., 1997),

carotenoids (Corona et al., 1996), reactive oxygen intermediates (Gupta et al., 1993), and the

redox state of the thylakoid membrane, e.g., the redox poise of plastoquinone (Maxwell et al.,

1995; Escoubas et al., 1995; Karpinski et al., 1997). The pathways by which these signals

are transduced from the plastid to the nucleus are not understood, but Escoubas et al. (1995)

have presented evidence that plastoquinone signaling occurs via a phosphorylation cascade.

In addition to plastid signals that regulate the transcription of nuclear photosynthetic

genes, plastid signals appear to control tissue and organ developmental programming.

Identification of this type of plastid-to-nucleus signaling has come from an examination of a

handful of pigment mutants that have alterations in leaf anatomy. These include dag of

Antirrhinum (Chatterjee et al., 1996), del of tomato (Keddie et al., 1996), and several

Arabidopsis mutants, including clal (Mandel et al., 1996; Estévez et al., 2000), cue 1 (Li et

al., 1995; Streatfield et al., 1999) and pac (Reiter et al., 1994; Meurer et al., 1998). The

white leaf tissues of these mutants have abnormal plastids that resemble undifferentiated

proplastids, suggesting that they are blocked in early chloroplast biogenesis. These tissues

also have altered palisade and/or spongy mesophyll cell layer organizations. The genes

defined by these mutations have been cloned and all code for plastid proteins. While the

functions of most of these proteins are unclear, CUE 1 codes for the plastid

phosphoenolpyruvate/ phosphate trans locator (Streatfield et al., 1999) and CL41 codes for

DXP synthase, an enzyme in isoprenoid biosynthesis (Mandel et al., 1996; Estévez et al.,

2000).

In this report we found that im is similar to the other pigment mutants in that the

white im sectors have an abnormal palisade cell layer and plastids that lack organized

Page 111: Response of plant growth and development to different ...

102

lamellar structures. In contrast to the other mutants, the white plastids do not resemble

proplastids, inasmuch as they are vacuolated and significantly larger (Figure 6 and Wetzel et

al., 1994) and likely arise by photooxidation (Wu et al., 1999). Although these observations

suggest that im is blocked later in plastid biogenesis than the other mutants, there are other

explanations (e.g., an impairment in plastid division early in development). It is possible that

the products of genes like IM are required independently for chloroplast biogenesis and for

mesophyll cell development. Yet, because they are localized in the plastid, it is more likely

that they are required for chloroplast biogenesis, and that the effects on mesophyll cell

differentiation are a consequence of incomplete chloroplast differentiation. We conclude that

IM is required for the functioning of a plastid-to-nucleus signaling pathway in which plastids

transmit one or more signals (plastid developmental signals) to the nucleus to regulate leaf

developmental programming.

Are plastid developmental signals the same as the plastid signals that regulate

photosynthetic gene expression? Most of the mutants with altered leaf anatomies, including

im, do not express Lhcb mRNAs (e.g., cla 1, cue 1, dag, im). The one exception is pac, which

has normal Lhcb mRNA levels (Reiter et al., 1994; Meurer et al., 1998). This suggests that

the plastid signal(s) that participates in mesophyll cell differentiation is separable from the

plastid factors involved in regulating the expression of nuclear genes for plastid proteins.

Consistent with this notion, Lhcb transcription can be uncoupled from leaf morphology in

mutants such as gun 1 (Susek et al., 1993; Mochizuki et al., 1996). In this case, norflurazon-

treated (white) leaf tissues of wild type or gunl have a normal anatomy, but the wild-type

and gunl differ in their patterns of Lhcb expression—i.e., wild-type cells lack Lhcb mRNAs,

while gunl cells express them.

Page 112: Response of plant growth and development to different ...

103

Adaptations in the Green IM Sectors

Our anatomical studies showed that the green leaf sectors of im are thicker than

normal due to an enhancement in mesophyll cell size and intercellular air space volume

(Figure 7). Analyses of fluorescence-activated cell-sorter (FACS)-purified cells previously

demonstrated that cells from green im leaf sectors have more chlorophyll than similarly-sized

cells from wild-type plants (Meehan et al., 1996). As illustrated in Figure 8, the im green

sectors also have significantly elevated rates of photosynthesis on a chlorophyll basis. We do

not yet know why this is the case, but our observations point toward a complex mechanism

whereby the photosynthetic potential of the im green sectors is enhanced to compensate for a

lack of photosynthesis in the white sectors. We also found that the green im cells have

significantly higher chlorophyll a/b ratios than wild-type cells under normal light conditions.

High chlorophyll a/b ratios are typically found in "sun" versus "shade" plants and are

indicative of smaller light harvesting complexes and/or an altered stoichiometry of PSI and

PSII (reviewed by Stitt, 1991). These are typically adaptations to avoid light stress. Our

working hypothesis is that a lack of IM gives rise to morphological and biochemical

adaptations in the green sectors that make the leaf more "sun'Mike, perhaps as a way to avoid

photooxidative damage.

Materials and Methods

Plant Material and Growth Conditions

Seeds from wild-type Arabidopsis thaliana (Columbia ecotype) and the spotty allele

of immutans (im) (Wetzel et al., 1994) were germinated and grown at 25°C under continuous

illumination, either at 100 |imol-m'V (normal light; NL) or at 15 nmol-m'V (low light;

Page 113: Response of plant growth and development to different ...

104

LL). Samples were collected from various tissues and organs from 4-5 wk old plants. To

measure root lengths, wild-type and im seeds were plated on MS medium (pH 5.7)

supplemented with 1 % sucrose. Before plating, the seeds were surface sterilized for 1 min in

70% ethanol, 10 min in 5% NaCl, and washed 5X for 1 min each with sterile distilled water.

The plates were incubated in a vertical position under normal or low light conditions or in

continuous darkness.

RNA and Pigment Analyses

Total RNA isolation and RNA gel blot analyses were performed according to

procedures described previously (Wetzel et al., 1994). The formaldehyde gels contained

equal amounts of RNA per gel lane. The blots were probed with an IM cDNA (Wu et al.,

1999). The analyses were repeated twice to confirm the reproducibility of the results.

Pigment extractions and calculations of pigment concentrations were performed essentially

as described by Lichtenthaler (1987). Leaf tissues were extracted with several changes of

95% ethanol in the dark at 4*C, and absorbance measurements were made at 664nm, 649nm

and 470nm.

IM Promoter: GUS Fusion Constructs

Transgenic Arabidopsis were generated that contained either an IM promoter: GUS

fusion or a cauliflower mosaic virus (CaMV) 35S promoter: GUS fusion. The IM promoter:

GUS fusion was derived from the binary plasmid, pPZPZIMGUS. To generate

pPZP/IMGUS, an -2.1 kb Smal/EcoRI fragment of pBI121 (Clontech, Palo Alto, CA),

which contains the GUS gene (Jefferson et al., 1987) fused to the nos terminator, was

Page 114: Response of plant growth and development to different ...

105

subcloned into pPZP211 (Hajdukeiwicz et al., 1994), a binary vector that contains the NPTII

gene driven by the 35S promoter. This gave rise to pPZP/GUS. The IM promoter is a

Bcll/Xbal fragment that includes a portion of the N-terminal transit sequence of IM (25

amino acids) and ~3 kb of upstream sequence (Fig. 3). It was subcloned from a Ler lambda

genomic library (Voytas et al., 1990) and inserted as a Pstl/Xbal fragment into pPZPGUS.

The resulting construct (pPZP/IMGUS) is a translational fusion between the -25 amino acids

of the transit sequence and the GUS protein. The 35S promoter-GUS fusion sequence was

derived from the binary plasmid, pPZP/35SGUS. In this construct, the Xbal/SacI GUS-

containing sub-fragment of pPZPGUS was replaced by the 2.7 kb Pstl/SacI sub-fragment of

pBI121, which contains the GUS gene fused to the 35S promoter.

pPZP/IMGUS and pPZP/35SGUS were introduced into the Agrobacterium strain

C58CI by electroporation, and flowering Arabidopsis plants (Columbia ecotype) were

transformed by the floral dip method (Clough et al., 1998). After flowering, the T1 seeds

were collected and germinated on selective MS medium (50 ng/ml kanamycin). Forty-two

T1 lines of the IM promoter: GUS fusion were screened for the presence of the foreign DNA

by Southern hybridization (procedures described in Wetzel et al., 1994), and 5 lines were

identified with single-copy T-DNA insertions at different sites in the genome. Each of these

contained an intact reporter gene fusion. Similar procedures were carried out with the 35S

promoter: GUS lines. Two T1 lines were identified that had single intact inserts.

GUS activity assays were conducted on transgenic plants with a single IM promoter:

GUS insertion. For these assays, T2 seeds were sown on MS plates in the dark for two days

at 4°C. To obtain etiolated seedlings, the plates were maintained in darkness for another 4

days, but at 22°C. To obtain light-grown seedlings, the plates were transferred from the cold

Page 115: Response of plant growth and development to different ...

106

to a growth chamber (100 gmol m " s ' continuous illumination, 22°C). To obtain mature

plants, the seedlings were transplanted to soil then maintained in a growth chamber. Plants

of different developmental stages were collected and analyzed for GUS activity as described

by Horvath et al. (1993). In some experiments, the stained plant tissues were embedded in 4

% agarose, and sections (-50 |im) were examined by light microscopy.

Light and Electron Microscopy

For TEM, cotyledon and root samples were obtained from 7-day-old seedlings grown

on MS medium under either normal light conditions or darkness. The samples were fixed,

stained, and examined as in Homer and Wagner (1980). Samples for light microscopy were

obtained from fully-expanded leaves or roots from wild-type and im plants grown under

normal light conditions in the growth chamber. They were cut into 1 mm pieces, vacuum

infiltrated with fixative (1% paraformaldehyde and 2% glutaraldehyde), then incubated

overnight at 4°C. After washing in 0.1 M cacodylate buffer, the samples were dehydrated

through an ethanol series and embedded in Spurr's resin. Sections (1.5 gm) were attached to

glass slides, stained with 1% toluidine blue and observed in bright field with a light

microscope (Leitz Orthoplan).

Measurements of Oxygen Evolution

Leaves from 4-5 wk old wild-type and im plants grown under normal and low light

conditions were used for oxygen evolution experiments as described by (Van and Spalding,

1999). The leaves were cut into 1-2 mm size pieces and half of the sample was immersed

into 1 ml of 10 mM NaHCOr After vacuum infiltration for 15 min, the sample was placed

Page 116: Response of plant growth and development to different ...

107

in a Clark 02 electrode chamber and 02evolution was measured under 500 gmol m" s 'of

incident light at 25°C. The other half of the leaf sample was used for chlorophyll

determinations.

Literature Cited

Hartley GE, Viitanen PV, Pecker I, Chamovitz D, Hirschberg J, Scolnik PA (1991)

Molecular cloning and expression in photosynthetic bacteria of a soybean cDNA

coding for phytoene desaturase, an enzyme of the carotenoid biosynthesis pathway.

Proc Natl Acad Sci USA 88: 6532-6536

Beyer P, Mayer M, Kleinig H (1989) Molecular oxygen and the state of geometric

isomerism of intermediates are essential in the carotene desaturation and cyclization

reactions in daffodil chromoplasts. Eur J Biochem 184:141-50

Bowman J (1994) Arabidopsis: An Atlas of Morphology and Development. Springer-

Verlag, New York

Carol P, Stevenson D, Bisanz C, Breitenbach J, Sandmann G, Mache R, Coupland G,

Kuntz M (1999) Mutations in the Arabidopsis gene IMMUTANS cause a variegated

phenotype by inactivating a chloroplast terminal oxidase associated with phytoene

desaturation. Plant Cell 11: 57-68

Chatterjee M, Sparvoli S, Edmunds C, Garosi P, Findlay K, Martin C (1996) DAG, a

gene required for chloroplast differentiation and palisade development in Antirrhinum

majus. EMBO J 15: 4194-4207

Page 117: Response of plant growth and development to different ...

108

Chen M, Jensen M, Rodermel S (1999). The yellow variegated mutant of Arabidopsis is

plastid autonomous and delayed in chloroplast biogenesis. J. Heredity 90: 207-214

Chen M, Choi YD, Voytas D, Rodermel S (2000) Mutations in the Arabidopsis VAR2

locus cause leaf variegation due to the loss of a chloroplast FtsH protease. Plant J 22:

303-313

Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediaied

transformation of Arabidopsis thaliana. Plant J 16: 735-43

Corona V, Aracri B, Kosturkova G, Bartley GE, Pitto L, Giorgetti L, Scolnik PA,

Giuliano G (1996) Regulation of a carotenoid biosynthesis gene promoter during plant

development. Plant J 9: 505-512

Coumac L, Redding K, Ravenel J, Rumeau D, Josse E-M, Kuntz M, Peltier G. (2000)

Electron flow between photosystem II and oxygen in chloroplasts of photosystem-

deficient algae is mediated by a quinol oxidase involved in chlororespiration. J Biol

Chem 275: 17256-17262

Escoubas J-M, Lomas M, LaRoche J, Falkowski PG ( 1995) Light intensity regulation of

cab gene transcription is signaled by the redox state of the plastoquinone pool. Proc

Natl Acad Sci USA 92: 10237-10241

Estévez JM, Cantero A, Romero C, Kawaide H, Jimenez LF, Kuzuyama T, Seto H,

Kamiya Y, Leon P (2000) Analysis of the expression of CLA1, a gene that encodes

the 1-deoxyxylulose 5-phosphate synthase of the 2-C-methyI-D-erythritol-4-phosphate

pathway in Arabidopsis. Plant Physiol. 124: 95-103

Page 118: Response of plant growth and development to different ...

Gan S, Amasino RM (1997) Making sense of senescence. Plant Physiol 113: 313-319

Grevelding C, Suter-Crazzolara C, von Menges A, Kemper E, Masterson R, Schell J,

Reiss B (1996) Characterization of a new allele of pale cress and its role in greening in

Arabidopsis thaliana. Mol Gen Genet 251: 532-541

Gupta AS, Webb RP, Holaday SA, Allen RD (1993) Overexpression of superoxide

dismutase protects plants from oxidative stress. Induction of ascorbate peroxidsae in

superoxide dismutase-overexpressing plants. Plant Physiol 103: 1067-1073

Hajdukiewicz P, Svab Z, Maliga P (1994) The small, versatile pPZP family of

Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25: 989-994

Horner HT, Wagner BL (1980) The association of druse crystals with the developing

stomium of Capsicum annum (Solanaceae) anthers. Am J Bot 67:1347-1360

Horvath DP, McLarney BK, Thomashow MF (1993) Regulation of Arabidopsis thaliana

L. (Heyn) corl% in response to low temperature. Plant Physiol 103: 1047-1053

Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: ^-glucuronidase as a

sensitive and versatile gene fusion marker in higher plants. EMBO J 6: 3901-3907

Johanningmeier U (1988) Possible control of transcript levels by chlorophyll precursors in

Chlamydomonas. Eur J Biochem 177: 417-424

Josse E-M, Simkin AJ, Gaffé J, Labouré A-M, Kuntz M, Carol P (2000) A plastid

terminal oxidase associated with carotenoid desaturation during chromoplast

differentiation. Plant Physiol 123: 1427-1436

Page 119: Response of plant growth and development to different ...

Karpinski S, Escobar C, Karpinska B, Creissen G, Mullineaux P (1997) Photosynthetic

electron transport regulates the expression of cytosolic ascorbate peroxidase genes in

Arabidopsis during excess light stress. Plant Cell 9: 627-640

Keddie JS, Carroll B, Jones JDG, Gruissem W (1996) The DCL gene of tomato is

required for chloroplast development and palisade cell morphogenesis in leaves.

EMBOJ 15: 4208-4217

Kinsman EA, Pyke KA (1998) Bundle sheath cells and cell-specific plastid development in

Arabidopsis leaves. Development 125: 1815-1822

Kropat J, Oster U, Riidiger W, Beck CF (1997) Chlorophyll precursors are signals of

chloroplast origin involved in light induction of nuclear heat-shock genes. Proc Natl

Acad Sci USA 94: 14168-14172

Leon P, Arroyo A, Mackenzie S (1998) Nuclear control of plastid and mitochondrial

development in higher plants. Annu Rev Plant Physiol Plant Mol Biol 49: 453-480

Li H, Culligan K, Dixon RA, Chory J (1995) CUEl: a mesophyll cell-specific positive

regulator of light-controlled gene expression in Arabidopsis. Plant Cell 7: 1599-1610

Lichtenthaler HK (1987) Chlorophylls and carotenoids: Pigments of photosynthetic

biomembranes. In L Packer and R Douce, eds, Methods in Enzymology. Academic

Press, San Diego, pp 350-382

Lopez-Juez E, Jarvis RP, Takeuchi A, Page AM, Chory J (1998) New Arabidopsis cue

mutants suggest a close connection between plastid- and phytochrome regulation of

nuclear gene expression. Plant Physiol 118: 803-815

Page 120: Response of plant growth and development to different ...

I l l

Mandel MA, Feldmann KA, Herrera-Estrella L, Rocha-Sosa M, Leôn P (1996) CLAl, a

novel gene required for chloroplast development, is highly conserved in evolution.

Plant J 9: 649-658

Martmez-Zapater JM, Gil P, Capel J, Somerville CR (1992) Mutations at the

Arabidopsis CHM locus promote rearrangements of the mitochondrial genome. Plant

Cell 4: 889-899

Matile P (1992) Chloroplast senescence. In NR Baker and H Thomas, eds, Crop

Photosynthesis: Spatial and Temporal Determinants. Elsevier Science Publishers B.V.,

New York, pp 413-441

Mayer MP, Beyer P, Kleinig H (1990) Quinone compounds are able to replace molecular

oxygen as terminal electron acceptor in phytoene desaturation in chromoplasts of

Narcissus pseudonarcissus L. Eur J Biochem 191: 359-363

Mayer MP, Nievelstein V, Beyer P (1992) Purification and characterization of a NADPH

dependent oxidoreductase from chromoplasts of Narcissus pseudonarcissus: a redox-

mediator possibly involved in carotene desaturation. Plant Physiol Biochem 30: 389-

398

Mayfield SP and Taylor WC (1984) Carotenoid-deficient maize seedlings fail to

accumulate light-harvesting chlorophyll a/b binding protein (LHCP) mRNA. Eur J

Biochem 144: 79-84

Maxwell DP, Laudenbach DE, Huner NPA (1995) Redox regulation of light harvesting

complex II and cab mRNA abundance in Dunaliella salina. Plant Physiol 109: 787-795

Page 121: Response of plant growth and development to different ...

112

Meehan L, Harkins K, Chory J, Rodermel S (1996) Lhcb transcription is coordinated

with cell size and chlorophyll accumulation. Plant Physiol 112: 953-963

Meurer J, Grevelding C, Westhoff P, Reiss B (1998) The PAC protein affects the

maturation of specific chloroplast mRNAs in Arabidopsis thaliana. Mol Gen Genet

258: 342-351

Miller A, Tsai C-H, Hemphill D, Endres M, Rodermel S, Spalding M (1997) Elevated

CO, effects during leaf ontogeny: A new perspective on acclimation. Plant Physiol

115: 1195-1200

Miller A, Schlagnhaufer C, Spalding M, Rodermel S (2000) Carbohydrate regulation of

leaf development: prolongation of leaf senescence in Rubisco antisense mutants of

tobacco. Photosyn Res 63: 1-8

Mochizuki N, Susek R, Chory J (1996) An intracellular signal transduction pathway

between the chloroplast and nucleus is involved in de-etiolation. Plant Physiol 112:

1465-1469

Nievelstein V, Vandekerkchove J, Tadros MH, Lintig JV, Nitschke W, Beyer P (1995)

Carotene desaturation is linked to a respiratory redox pathway in Narcissus

pseudonarcissus chromoplast membranes. Involvement of a 23-kDa oxygen-evolving-

complex-like protein. Eur J Biochem 233: 864-872

Norris SR, Barrette TR, DellaPenna D (1995) Genetic dissection of carotenoid synthesis

in Arabidopsis defines plastoquinone as an essential component of phytoene

desaturation. Plant Cell 7: 2139-2149

Page 122: Response of plant growth and development to different ...

113

Oelmuller R (1989) Photooxidative destruction of chloroplasts and its effects on nuclear

gene expression and extraplastidic enzyme levels. Photochem Photobiol 49: 229-239

Oster U, Brunner H, Rudiger W (1996) The greening process in cress seedlings. V.

Possible interference of chlorophyll precursors, accumulated after thujaplicin treatment,

with light-regulated expression of Uic genes. J Photochem Photobiol 36: 255-261

Rédei GP (1963) Somatic instability caused by a cysteine-sensitive gene in Arabidopsis.

Science 139: 767-769

Rédei GP ( 1967) Biochemical aspects of a genetically determined variegation in

Arabidopsis. Genetics 56: 431-443

Rédei GP (1973) Extra-chromosomal mutability determined by a nuclear gene locus in

Arabidopsis. Mutation Research 18: 149-162

Rédei GP (1975) Arabidopsis as a genetic tool. Annu Rev Genet 9: 111-127

Reinbothe C, Lebedev N, Reinbothe S (1999) A protochlorophyllide light-harvesting

complex involved in de-etiolation of higher plants. Nature 397: 80-84

Reiter RS, Coomber SA, Bourett TM, Bartley GE, Scolnik PA (1994) Control of leaf and

chloroplast development by the Arabidopsis gene pale cress. Plant Cell 6: 1253-1264

Rôbbelen G (1968) Genbedingte Rotlicht-Empfindlichkeit der Chloroplastendifferenzierung

bei Arabidopsis. Planta 80: 237-254

Rodermel SR (2001) Regulatory interactions between the nucleus and the plastid: plastid-

to-nucleus signaling. Trends Plant Sci (in press)

Page 123: Response of plant growth and development to different ...

114

Sakamoto W, Kondo H, Murata M, Motoyoshi F (1996) Altered mitochondrial gene

expression in a maternal distorted leaf mutant of Arabidopsis induced by chloroplast

mutator. Plant Cell 8: 1377-1390

Schulz A, Ort O, Beyer P, Kleinig H (1993) SC-0051, a 2-benzoy 1-cyclohexane-1,3-dione

bleaching herbicide, is a potent inhibitor of the enzyme p-hydroxyphenylpyruvate

dioxygenase. FEES Lett 318: 162-166

Siedow JN, Umbach AL (1995) Plant mitochondrial electron transfer and molecular

biology. Plant Cell 7: 821-831

Stitt M (1991) Rising CO, levels and their potential significance for carbon flow in

photosynthetic cells. Plant Cell Environ 14: 741-762

Streatfield SJ, Weber A, Kinsman EA, Hausler RE, Li J, Post-Beittenmiller D, Kaiser

WM, Pyke KA, Fliigge U-I, Chory J (1999) The phosphoenolpyruvate/ phosphate

translocator is required for phenolic metabolism, palisade cell development, and

plastid-dependent nuclear gene expression. Plant Cell 11: 1609-1621

Susek RE, Ausubel FM, Chory J (1993) Signal transduction mutants of Arabidopsis

uncouple nuclear CAB and RBCS gene expression from chloroplast development. Cell

74: 787-799

Susek RE, Chory J (1992) A tale of two genomes: role of a chloroplast signal in

coordinating nuclear and plastid genome expression. Aust J Plant Physiol 19: 387-399

Taylor CB (1997) Promoter fusion analysis: an insufficient measure of gene expression.

Plant Cell 9: 273-275

Page 124: Response of plant growth and development to different ...

115

Taylor WE (1989) Regulatory interactions between nuclear and plastid genomes. Annu

Rev Plant Physiol Plant Mol Biol 40: 211-233

Tilney-Bassett RAE (1975). Genetics of variegated plants. In CW Birky, PS Perlman, TJ

Byers, eds, Genetics and Biogenesis of Mitochondria and Chloroplasts. Ohio State

University Press, Columbus, pp 268-308

Tirlapur UK, Dahse I, Reiss B, Meurer J, Oelmuller R (1999) Characterization of the

activity of a plastid-targeted green fluorescent protein in Arabidopsis. Eur J Cell Biol

78: 233-240

Van K, Spalding M (1999) Periplasmic carbonic anhydrase structural gene (cah 1) mutant in

Chlamydomonas reinhardtii. Plant Physiol 120: 767-764

Vanlerberghe GC, Mcintosh L (1997) Alternative oxidase: from gene to function. Annu

Rev Plant Physiol Plant Mol Biol 48: 703-734

von Wettsetin D, Gough S, Kannangara CG (1995) Chlorophyll biosynthesis. Plant Cell

7: 1039-1057

Voytas DF, Konieczny A, Cummings MP, Ausubel FM (1990) The structure, distribution

and evolution of the Tal retrotransposable element family of Arabidopsis thaliana.

Genetics 126: 713-721

Wetzel CM, Jiang CZ, Meehan LJ, Voytas DF, Rodermel SR (1994) Nuclear-organelle

interactions: the immutans variegation mutant of Arabidopsis is plastid autonomous and

impaired in carotenoid biosynthesis. Plant J 6: 161-175

Page 125: Response of plant growth and development to different ...

116

Wetzel CM, Rodermel SR (1998) Regulation of phytoene desaturase expression is

independent of leaf pigment content in Arabidopsis thaliana. Plant Mol Biol 37: 1045-

1053

Wu D, Wright DA, Wetzel C, Voytas DF, Rodermel S (1999) The 1MMUTANS

variegation locus of Arabidopsis defines a mitochondrial alternative oxidase homolog

that functions during early chloroplast biogenesis. Plant Cell 11: 43-55

FIGURES

Figure 1. Growth of wild-type and im. Plants were maintained under low light conditions

(15 p.mol m " s ') and photographed 8 wks after germination. The wild-type has an average of

four true leaves and im an average of two true leaves. The seeds germinated at the same time.

Figure 2. Root growth in wild-type and im. Root lengths were measured after four days of

growth on MS medium supplemented with 1% sucrose. The plants were grown under

normal light (100 gmolm" s '); low light (15 gmol-m'-s '); and in darkness. Each data point

represents an individual plant.

Figure 3. pPZP/IMGUS, the IM promoter: GUS fusion construct. pPZP/IMGUS contains

an -3 kb upstream region of IM fused to the GUS glucuronidase) gene and nos

terminator. The selectable marker is an NPTII gene fused to 35S promoter/noj terminator

elements. Twenty-five amino acids in the fusion protein are from the IM protein (Wu et al.,

1999). RB, right border; LB, left border.

Page 126: Response of plant growth and development to different ...

117

Figure 4. Expression patterns of the IM promoter: GUS transgene during development.

A.. 1 day-old light-grown seedlings.

B. 7 day-old light-grown seedling.

C. Dark field microscopy of a 4 day-old etiolated seedling (5X objective).

D. 4 day-old etiolated seedling (35S promoter: GUS fusion) (5X objective).

E. Cross-section of a shoot meristem of a 10 day-old light-grown seedling (25X objective).

F and G. Cross-sections of first true leaves of 10 day-old light-grown seedlings (10X and

25X objectives, respectively).

H 6 week-old rosette.

I. Bolt from a flowering plant.

J. Cross-section of a hypocotyl of a 10 day-old light-grown seedling (25X objective).

K. Root tip of a 10 day-old light-grown seedling.

L. Dark field microscopy of a flower (5X objective).

M. Young seeds.

AM: Apical meristem; AT: Anther; COT: Cotyledon; EP: Epidermis; GC: Guard cell; GT:

Ground tissues; HC: Hypocotyl; MC: Mesophyll cell; VT: Vascular tissues; TR: Trichome.

Figure 5. Expression analysis of IM mRNA and pigment levels in Arabidopsis.

A. RNA gel blot analyses were performed as described in Materials and Methods. The

RNA gel is stained with ethidium bromide to show rRNA's (loading control). The blot was

probed with a radiolabeled IM cDNA (Wu et al., 1999).

Page 127: Response of plant growth and development to different ...

118

B. Total carotenoids and chlorophylls were extracted from Arabidopsis as described in

Materials and Methods. Values are an average of three separate experiments ± SD. The

samples in A & B are from 4-5 wk old plants grown under normal light conditions (100

Hmol-m'V), with the exception of the samples from dark-grown seedlings (ET). RT, Root;

ST, Stem; SL, Green silique; FR, Flowers (petals + green sepals); ET, 7-day-old etiolated

seedling (cotyledon + hypocotyl); ET(H), Hypocotyls from 7-day old etiolated seedlings;

CO, 7-day-old cotyledon; YL, young leaf (5 mm length); FL, just fully-expanded leaf (40

mm length); OL, senescing, late-fully expanded leaf.

Figure 6. Plastid ultrastructure. Wild-type and im seedlings were grown on MS plates for 7

days under normal light conditions (A, B, C, D) or in darkness (E, F).

A. Chloroplast from a wild type cotyledon (Bar = 500nm)

B. Chloroplast from an im cotyledon (Bar = 500nm)

C. Amyloplast from a wild-type root (Bar = 200nm)

D. Amyloplast from an im root (Bar = 200nm)

E. Etioplast from a wild-type cotyledon (Bar = 200nm)

F. Etioplast from an im cotyledon (Bar = 200nm)

Figure 7. Light microscopy of fully-expanded leaves from wild-type and im plants grown

under normal light conditions. A magnification of 25X applies to all panels. The white

sectors stain less intensely than green sectors because their plastids are deficient in internal

structures.

Page 128: Response of plant growth and development to different ...

119

A. Wild-type.

B. Green leaf sector of im.

C. White leaf sector of im.

D. Adjacent green and white sectors of im.

Figure 8. Photosynthetic oxygen evolution and chlorophyll a/b ratios in wild-type leaves

and im green leaf sectors. Plants were grown under normal light (100 ^mol-m'-s ') or low

light (15 (imol-m'V). Oxygen evolution (A) and chlorophyll a/b ratios (B) were determined

as described in Materials and Methods. Each graph represents an average +/- SD of three

different leaf samples for each illumination condition.

Page 129: Response of plant growth and development to different ...

120

Figure 1

Page 130: Response of plant growth and development to different ...

121

• WT o immutans

3i> MMIMCO

#»03W •<aœox> •40

ooo

(BOO •*•00000

•«03333000 •

00

• •woo

wo «•

MMM 00

#0033330 ###ooo

00X0 00 00

Dark Low light Normal light

Growth illumination

Page 131: Response of plant growth and development to different ...

122

RB

U 25 aa

IM promoter IM GUS Tnos

4 ~ 3 kb »

- 35S NPTII Tnos

LB

U

Figure 3.

Page 132: Response of plant growth and development to different ...

123

/ ROOT

COT

B LEAF

COT 5,C

ROOT

-—TR >d NIC

STEM

ROOT

SILIQUE

STEM

K

AM ».

ROOT CAP

PETAL

\ \

SEPAL

G PPEB B .MC

FUNICULUS

Figure 4.

Page 133: Response of plant growth and development to different ...

124

B

RT ST SL FR ET CO YL FL OL

carotenoid chlorophyll

RT ST SL FR ET(H) CO YL FL OL

Figure 5

Page 134: Response of plant growth and development to different ...

125

Figure 6.

Page 135: Response of plant growth and development to different ...

126

Figure 7.

Page 136: Response of plant growth and development to different ...

127

u .c

140

>> 120

e £ 100

1 80 -

60 -

40

20

SE "S "5 l 6

I e

3.5

3

2.5

J o

v 1

f

0.5

0

*

l B

WT im WT un

Normal Light Low Light

Growth Illumination

Figure 8.

Page 137: Response of plant growth and development to different ...

128

CHAPTER 5. GENERAL SUMMARY

General Conclusion

Growth response to low R:FR in Populus alba

The photosynthetic pigments absorb red (R) light preferentially, but reflect or

transmit far-red (FR) light, which reduces the R:FR photon ratio below 1.0 and acts as a

signal for detection of neighbors (Ballaré et al., 1987, 1990, 1994; Ritchie, 1997; Smith et al.,

1990; Smith and Whitelam, 1997). Although many studies have been performed on the

response to the different R:FR light conditions, most of the data are from herbaceous plants.

In this study, we used two different filter systems to analyze the effect of R:FR ratio on the

stem elongation and other growth traits in young white aspen Populus alba clone 'Bolleana'.

Trees grown inside clear chambers (R:FR < 1.0) were 27% taller than trees grown inside the

FR filter chambers (R:FR > 3.0). Stem taper of clear chamber trees was 16% less than the

FR filter trees. Low R:FR also induced 22% more stem dry weight and 13% greater petiole

length per leaf compared to the FR filter trees. However, other traits, such as leaf number

increment, leaf area, and each dry weight (leaf, petiole and root) showed no significant

differences. The combined dry weight of leaf, stem and petiole was not significantly

different between treatment. This suggests that elongated stem growth was due to enhanced

allocation of resources to stem intemode elongation at the expense of other growth centers,

not the result of increased photosynthesis. This study provides clear evidence that

competition condition (low R:FR) alters tree biomass allocation to stem elongation.

However, this study was performed using the trees in juvenile stage, which might respond

Page 138: Response of plant growth and development to different ...

129

differently at older ages. This phenomenon is common in other physiological processes.

Therefore, further experiments with plants of various ages need to be conducted.

ghost and immutans

The ghost (gh) and immutans (im) variegation mutants of tomato and Arabidopsis

have green- and white-sectored leaves due to the action of a nuclear recessive gene. Sector

formation is sensitive to light and temperature. The white sectors of both mutants

accumulate phytoene, a colorless carotenoid intermediate. IM codes for a chloroplast

homolog of the mitochondrial alternative oxidase (AOX), an inner mitochondrial membrane

protein that serves as a terminal oxidase in the alternative pathway of respiration (Wu et al.,

1999). It has been hypothesized that IM functions as a component of a redox chain

responsible for phytoene desaturase (Wu et al., 1999). Consistent with this hypothesis, IM

was shown to have quinol oxidase activity when expressed in E.coli (Josse et al., 2000). The

primary lesion in the gh variegation mutant has been a matter of intense speculation since its

discovery nearly 50 years ago (Rick et al., 1969). We show that the im and gh phenotypes

arise from mutations in orthologous genes. GH is highly expressed in plastid-types that

accumulate high levels of carotenoids, such as chloroplasts in leaves and chromoplasts in

developing fruit and flowers. This suggests that GH plays an important role in

carotenogenesis. Structural analysis shows that AOX, IM and GH are RNR2 di-iron

carboxylate proteins with perfectly conserved Fe-coordinating ligands that define a quinol-

binding catalytic site. This structural similarity with AOX is also supportive for the

hypothesis that IM and GH are plastid quinol oxidases that act downstream from a quinone

pool to dissipate electrons in both chloroplast and chromoplast membranes. In addition,

Page 139: Response of plant growth and development to different ...

130

phylogenetic analyses provide evidence that AOX, IM and GH are interfacial membrane

proteins.

According to expression and anatomical studies in Arabidopsis, IM has a broad effect

on plant growth and development and is required for the differentiation of multiple plastid

types. Support for this conclusion is provided by IM promoter:GUS fusion and RNA blot

analyses showing that the IM promoter is active and that mRNAs are expressed ubiquitously

in Arabidopsis tissues and organs throughout development. However, IM expression levels

do not necessarily correlate with carotenoid levels, suggesting that IM function may be not

limited to carotenogenesis. Anatomical studies show that the green leaf sectors of im are

thicker than normal due to enlarged mesophyll cells and that palisade cells fail to expand in

the white sectors. These findings raise the possibility that IM is required for the functioning

of a plastid-to-nucleus signaling pathways in which plastids transmit one or more signals to

the nucleus to regulate leaf developmental programming. The green sectors of im have

significantly elevated rates of photosynthesis. These changes may be a part of an adaptive

mechanism to compensate for a lack of photosynthesis in the white leaf sectors. We

conclude that a lack of IM causes morphological and biochemical adaptations in the green

sectors to feed white leaf sectors and to avoid photooxidative damage.

Literature Cited

Ballaré, C.L, A.L. Scopel, R.A. Sanchez, J.J. Casai and C.M. Gharsa. 1987. Early detection

of neighbor plants by phytochrome perception of spectral changes in reflected

sunlight. Plant Cell Environ. 10:551-557.

Page 140: Response of plant growth and development to different ...

131

Ballaré, C L, A.L. Scopel and R.A. Sanchez. 1994. Signaling among neighboring plants

and the development of size inequalities in plant populations. Proc. Natl. Acad. Sci.

USA. 1:10094-10098.

Ballaré, C.L, A.L. Scopel and R.A. Sanchez. 1990. Far-red radiation reflected from adjacent

leaves: an early signal of competition in plant canopy. Science 247:329-332.

Josse, E.M, A.J. Simkin, J. Gaffé, A.M. Labouré, M. Kuntz and P. Carol. 2000. A plastid

terminal oxidase associated with carotenoid desaturation during chromoplast

differentiation. Plant Physiol. 123:1427-1436.

Rick, C M., A.E. Thomson and O. Brauer. 1959. Genetics and development of an unstable

chlorophyll deficiency in Lycopersicon esculentum. Amer J Bot 46: 1-11.

Ritchie, G.A. 1997. Evidence for red:far-red signaling and photomorphogenic growth

response in Douglas-fir (Pseudotsuga menziesii) seedlings. Tree Physiol. 17:161-168.

Smith, H., J.J. Casal and G.M. Jackson. 1990. Reflection signals and the perception by

phytochrome of the proximity of neighboring vegetation. Plant Cell Environ. 13:73-

78.

Smith, H. and G.C. Whitelam. 1997. The shade avoidance syndrome: Multiple responses

mediated by multiple phytochromes. Plant Cell Environ. 20: 840-844.

Wu, D., D.A. Wright, C. Wetzel, D.F. Voytas and S. Rodermel. 1999. The IMMUTANS

variegation locus of Arabidopsis defines a mitochondrial alternative oxidase homolog

that functions during early chloroplast biogenesis. Plant Cell 11: 43-55.

Page 141: Response of plant growth and development to different ...

132

ACKNOWLEDGEMENTS

Many people have contributed to me during my graduate studies at Iowa State

University, and I owe my thanks to all of them. In particular, I would like to thank my major

professors, Drs. Richard B. Hall and Steven R. Rodermel, for their support, patience and

guidance through good times and bad.

My sincere appreciation goes to the members of my committee: Drs. James T.

Colbert, J. Michael Kelly and Loren Stephens for their guidance and critical review of my

thesis.

I also thank Dr. Hall's lab members (Bonnie Green, Assibi Mahama, Sovith Sin,

Ronald Zalesny and Thomas Easley) and Dr. Rodermel's lab members (Carolyn Wetzel,

Meng Chen, Chris Wu, Adam Miller, Dan Stessman, Andrea Mannuell, Aigen Fu, Janson

Barr, Maneesha Aluru, Cody Sandersson and Dan Haake) for their help and encouragement.

Finally, I would like to thank my parents, brothers and sisters for their love and

support during my study.