Republic of Iraq Ministry of Higher Education and Scientific Research University of Baghdad College of Science

Role of oprD Gene in Biofilm Formation and Imipenem Resistance in Pseudomoanas aeruginosa

A Thesis

Submitted to the College of Science/University of Baghdad

in Partial Fulfillment of the Requirements for the Degree of

Doctor of Philosophy in Biology/Microbiology

By

Hadeel Kareem Musafer

B.Sc in Microbiology/ Al-Mustansiriya University, College of Science 2005

MSc. in Microbiology/ Al-Mustansiriya University, College of Science 2007

Supervised by

Dr. Harith J. Fahad Al-Mathkhury

Assistant professor

November 2013 Muharrem 1434

Committee Certification

We certify that we have read this thesis entitled “Role of oprD Gene in Biofilm Formation and Imipenem Resistance in Pseudomoanas aeruginosa” and as the examination committee examined the student in its content and in our opinion it adequate for award of the doctorate of philosophy in Biology/Microbiology.

Signature Signature Name: Dr. Abdel Kareem Al- Qazaz Name: Dr. Mouruj Abd Alsatar

Scientific Degree: Assistant professor Scientific Degree: Assistant professor Member Member

Date: / / 2013 Date: / / 2013

Signature Signature Name: Dr. Haifa Hadi Hassani Name: Dr. Hanaa Saleem Yossef

Scientific Degree: Professor Scientific Degree: Assistant professor Member Member

Date: / / 2013 Date: / / 2013

Signature Signature Name: Dr. Harith J. F. Al-Mathkhury Name: Dr. Rajwa Hasan Essa

Scientific Degree: Professor Scientific Degree: Professor Member/advisor Chairman

Date: / / 2013 Date: / / 2013 Approved by the deanery of the college of science: Signature: Name: Dr. Saleh Mahdi Ali Scientific Degree: Professor Address: Dean of the College of Science Date: / /2013

Linguistic Certification

I certify that this thesis entitled “Biofilm Formation by Psudomonas aeruginosa in Respect of Imipenem Resistance” was prepared by Hadeel Kareem Musafer, under my linguistic supervision. It was amended to meet the style of the English Language.

Dr. Ayaid Khadem Zgair

Biology Department/ College of Science/ University of Baghdad

/ / 2013

In view of the available recommendations, I forward this thesis for Debate by the examination committee

حمي ن الر� مح �سم هللا الر�

�ن آ�وتوا العمل در�ات (( �ن آمنوا منمك وا�� ا�� �رفع ا�� بما تعملون خبري ))وا��

صدق هللا العظمي

ا�اد� سورة) من ١١آية (

Acknowledgment

I praise and thank Allah for clarifying my way so I could have the aptitude to

accomplish this modest effort.

I gratefully acknowledge dean of college of science and head of department of

Biology/University of Baghdad, to permit me to complete my Ph. D. study.

I would like to express appreciation and deepest thanks to the Iraqi Ministry of

Higher education and scientific research for the financial support to complete my project.

I am grateful to my supervisor Dr. Harith Jabar Fahad Al-Mathkhury for his

guidance, patience and scientific directions.

My deep appreciation to Dr. George A. O’tool, Geisel School of Medicine,

Dartmouth College / USA, for his patience, scientific directions and partially funding my

thesis.

I would like to express my special grateful thanks to Dr. Sherry L. Kuchma,

microbiology and immunology department, Geisel School of Medicine, Dartmouth

College / USA for her kind and scientific assistance during six months.

Special thanks for all members of Microbiology and Immunology department\

Geisel School of Medicine, Dartmouth College/ USA for their assistant.

Also I would like to thank my colleagues in University of Baghdad and Al-

Mustansyria University for their kind help.

Summary Fifty eight Pseudomonas aeruginosa strains evaluated with E test; forty

seven (81.03%), two (3.4٥%), and nine (15.5۲%) strains were susceptible,

intermediate, and resistant to imipenem, respectively. All the resistant and

intermediate susceptible strains, previously isolated from patients with cystic

fibrosis, showed no carbapenemase activity as confirmed by the Hodge test.

The relationship between biofilm formation, imipenem resistance, and

oprD expression were assessed in some imipenem resistant clinical P.

aeruginosa strains (SMC631C, SMC631F, SMC631J, SMC631H,

SMC631K and SMC 4974). All resistant strains showed low oprD

expression and low biofilm values in comparison to the sensitive ones.

The results in this study was revealed that oprD::isphoA/hah resistant

strain developed significantly lower biofilm formation capacity than PAO1

wild type. Moreover, this mutation triggered Imipenem resistance (P < 0.001

by comparison to PAO1 strain).

During this work, an strain with point mutation (SMC631F-ImR) in

oprD gene was obtained. This mutant was resistant to imipenem (MIC> 32

mg/l) and weak biofilm former (OD550= 0.06) compared with the parent

SMC631 biofilm (OD550=0.19).

Expression of poprD::isphoA/hah plasmid in the oprD mutant fully

restores the biofilm defect observed for the oprD mutant. There were no

significant differences (P>0.05) between PAO1 and complemented strain;

nevertheless, significant differences (P<0.05) were noticed between the

complemented strain and the mutant oprD::isphoA/hah with vector.

Furthermore, poprD::isphoA/hah plasmid expression restored

imipenem sensitivity (4.3) to the level of wild type and there were no

significant difference (P>0.05) between them. However, significant

differences were found between the complemented strain and the mutant

oprD::isphoA/hah with empty vector. Similar results were obtained with the

clinical strain SMC631. An SMC631F-ImR/poprD plasmid introduced into

the oprD mutant. Again, expression of SMC631F-ImR / poprD+ in the oprD

mutant fully restores the biofilm defect observed for the oprD mutant

relative to the empty vector as control.

Taking together, these results confirm that the inactivation of oprD is

responsible for the observed defect of biofilm phenotype.

mariner transposon mutagenesis was performed in two clinical strains

comprised the highest biofilm former. Additionally, biofilm deficient strains

were screened by microtiter plate assay, in the mutant derivatives (originated

from SMC576 and SMC214). We mapped four different genes, pilY1, pilW,

pslI and algC. The results revealed that pilY::Mar mutants and pilW::Mar19

mutant showed significantly deficient biofilm formation in comparison to

the parent SMC576, pilY1::Mar represented five independent mutant strains

(five insertion sites in pilY1 gene) and one strain with insertion in pilW gene.

Moreover, mutation of pilY1 and pilW in the SMC576 background lead to

loss of twitching motility.

The swarm phenotypes of SMC576 mutants were shown. The

pilY1::Mar mutants and pilW::Mar19 mutant exhibit a pattern of swarming

motility in comparison with SMC576 (weak swarm, shorter and fewer

tendrils).

The second highest biofilm is formed by SMC214; were mapped two

different genes pilW, pilX I that responsible for biofilm deficient. Those

biofilms formed by the pilX::Mar and pilW::Mar mutants were significantly

lower (P < 0.001) than the biofilm of the SMC214 parent strain.

The pilW::Mar and pilX::Mar mutants exhibit swarming phenotypes

that closely resembled the SMC214 parent strain; while the pilW::Mar and

pilX::Mar showed strong suppressor of twitching motility.

We introduced constructed plasmid, +ppilY1 plasmid into the

pilY1::Mir8 mutant, pilY1:Mir8 expression restored the higher biofilm

formation to the levels comparable to the SMC576. Furthermore, the

expression of +ppilY1 in the pilY1::Mir8 mutant fully restored the swarming

defect observed for the pilY1::Mir8 mutant relative to the vector control.

Regarding twitching motility, the expression of PilY1 was observed to

complement the twitching defect of the pilY1::Mir8 mutant. Collectively,

these results confirmed the inactivation of pilY1 alone which responsible for

the observed suppression of SMC576 mutant phenotypes.

The map of mutants pslI::Mar and algC::Mar showed the differences

in Psl that produced by pslI::Mar and algC::Mar mutants which were highly

deficient biofilm.

List of contents

Page Subject I Summary V List of Contents 1 1. Introduction and literature review 1 1.1. Introduction 3 1.2. Literature review 3 1.2.1. Pseudomonas aeruginosa: general characteristics 4 1.2.2. Pseudomonas aeruginosa and cystic fibrosis 5 1.2.3 Antibiotic resistance in P. aeruginosa 7 1.2.4 Carbapenem resistance in P. aeruginosa 7 1.2.4.1 Carbapenems 8 1.2.4.2 Carbapenemase

10 1.2.4.3 Porin oprD

10 1.2.4.4 Molecular Mechanisms of OprD-Mediated Resistance

11 1.2.5. Biofilm 13 1.2.5.1. Stages of biofilm development

15 1.2.5.2. Roles of extracellular polymeric substances in P. aeruginosa biofilms

19 1.2.5.3. Extracellular DNA 20 1.2.6. Pseudomonas aeruginosa motility on surface 20 1.2.6.1 Swarming motility 22 1.2.6.2 Twitching motility 28 2. Materials and Methods 28 2.1. Materials 28 2.1.1. Apparatuses and Equipment 29 2.1.2. Chemicals and biological materials 31 2.1.3. Culture media 31 2.1.4. Kits

32 2.1.5. Standard strains quality control bacteria 33 2.1.6. Primers

33 2.1.6.1. Primers used in oprD genetic complementation and sequencing

33 2.1.6.2. Quantification real time PCR primers 34 2.1.6.3. Primer used in Arbitrary PCR

34 2.1.6.4. Primers used in pilY1 genetic complementation and sequencing

34 2.1.7. Plasmids and vectors used in this study 35 2.1.8. Buffers and Solutions 35 2.1.8.1. Magnesium sulfate MgSO4 1 M 35 2.1.8.2. Glucose20% 35 2.1.8.3. Lazy Bones Solution 35 2.1.8.4. Sodium Borate (SB) buffer 20X

35 2.1. 8.5. Ethylendiaminetetraacetic Acid (EDTA), 0.5 and 0.05 M

35 2.1. 8.6. Tris buffer (1M) pH 8 35 2.1. 8.7. EDTA (TE) buffer 36 2.1. 8.8. loadeing buffer 6X dye 36 2.1. 8.9. Ethanol (70%) 36 2.1. 8.10. Glycial acetic acid 30% 36 2.1.9.11. Casamino acids 20% (CAA)

2.2. Methods 36 2.2.1. Sterilization 36 2.2.2. Laboratory prepared culture media 36 2.2.2.1. Yeast peptone dextrose (YPD) broth media 37 2.2.2.2. Yeast peptone dextrose (YPD) agar plate 37 2.2.2.3. Lysogeny broth (LB) broth 37 2.2.2.4. Lysogeny broth (LB) agar plates 37 2.2.2.5. Minimal salts medium 5X M63 37 2.2.2.6. Minimal salts medium 5X M8 37 2.2.2.7. Minus uracil medium 38 2.2.2.8. Glycerol for -80ºC 38 2.2.2.9. Stabs 38 2.2.3. McFarland Standard (no. 0.5) Preparation

39 2.2.4. Single Stranded Carrier DNA 39 2.2.5. Preservation of bacterial strains 39 2.2.6. DNA agarose gel electrophoresis 40 2.2.7. Imipenem stock preparation 41 2.2.8. Antibiotic stocks used in this study 41 2.2.9. Biofilm Media 41 2.2.10. Swarming motility media 41 2.2.11. Twitching motility media 41 2.2.12. Standard and clinical strains culture 42 2.2.13. Determination of MIC of Imipenem for strains 42 2.2.13. 1. The E-test method 42 2.2.13. 2. Microdilution method 43 2.2.14. Modified Hodge Test (MHT) 44 2.2.15. Biofilm formation assay 45 2.2.16. Extraction of Genomic DNA 45 2.2.17. Amplification of oprD gene by polymerase chain reaction 46 2.2.18. Sequencing 47 2.2.19. Quantitative reverse transcription-PCR (qRT-PCR) (Kuchma 47 2.2.19.1. Bacterial Harvest 47 2.2.19.2. RNA extraction and cDNA 48 2.2.20. Genetic complementation steps of oprD mutant strain

48 2.2.20.1. Digestion of PMQ72 2.2.20. 2. Yeast transformation

49 2.2.20. 3. Electroporation

50 2.2.21. mariner transposon mutagenesis of the Highest biofilm producers; 576 and 214

50 2.2.21.1. Conjugation and selection for mutants 51 2.2.21.2. Storing/screening the library

2.2.21.3. Screening for Biofilm deficient 2.2.21.4. To store the library

52 2.2.21.5. Mapping Mariner transposons by Arbitrary PCR (ARB PCR)

55 2.2.22. Construction of mutant strains and plasmids 55 2.2.23. Twitching assays 56 2.2.24. Swarming motility

56 2.2.25. Estimation of polysaccharide extracts 56 ۲.3. Statistical analysis 58 3. Results and Discussion 58 3.1. Imipenem susceptibility and carbapenemase detection

59 3.2. Assessing biofilm formation and imipenem resistance in clinical strains

61 3.3. Analysis of Sequencing of oprD gene 65 3.4. Analysis of oprD expression 66 3.5. OprD participates in biofilm formation.

70 3.6. Genes required for biofilm formation in clinical strains are conserved

78 3.7. Biofilm defective mutants of clinical strains SMC576 and SMC214 are sensitive to imipenem.

81 Conclusion 82 Recommendations 83 REFERENCES

chapter one

introduction and literature

review

2. Introduction and literature review 2.1. Introduction

Pseudomonas aeruginosa is an important opportunistic human pathogen

that can cause life-threatening infections, especially in patients with cystic

fibrosis (CF) and individuals with a compromised immune system. This

environmental bacterium is able to survive both in free-swimming planktonic

form and in surface-associated communities known as biofilms. P.

aeruginosa biofilms can be formed on both biotic and abiotic surfaces, thus

likely contributing to this microbe’s ability to cause disease in clinical settings

(Davies et al, 1998; O’Toole et al., 2000).

Although there are several antimicrobial agents that continue to be

effective against P. aeruginosa (i.e., carbapenem, cefepime, ceftazidime,

tobramycin and amikacin), in the last few years this bacterium’s increasing

resistance to antibiotics has been reported (Sanchez-Romero et al, 2007;

Ruiz-Martinez et al, 2011). The emergence and spread of acquired

carbapenem resistance in this species have challenged the success of

therapeutic and control efforts. Therefore, investigation of the molecular

mechanisms leading to resistance is crucial (Riera et al, 2011).

The OprD porin of P. aeruginosa facilitates the uptake across the outer

membrane of basic amino acids, small peptides that contain these amino

acids, and their structural analogue, the antibiotic imipenem. Indeed,

prolonged treatment of patients with P. aeruginosa infections with this

antibiotic leads to imipenem resistant mutants that either lack OprD or

Metallo-β-lactamase (Wolter et al., 2009).

A biofilm is a structured consortium of bacteria embedded in a self-

produced polymer matrix. Bacterial biofilms cause chronic infections

because they show increased tolerance to antibiotics (Høiby et al., 2010).

The goal of the present study was to investigating the link between

imipenem resistance, due to oprD dysfunction, and biofilm formation in

laboratory and clinical isolates of P. aeruginosa, the steps of the study are

listed below:

1. Detecting the Imipenem resistance isolates in P. aeruginosa

associated with cystic fibrosis by E test strip.

2. Investigating the mechanism of imipenem resistance whether it is

related to carbapenemase by Hodge test, or to mutation in oprD gene,

by sequence analysis of oprD gene.

3. Quanatification of Biofilm formation in wild type PAO1 and clinical

isolates.

4. Assessing the expression of oprD gene by quantification reverse

transcription time PCR (qRT-PCR) and compared the expression with

the biofilm values.

5. Genetic complementation of oprD into imipenem resistance isolate

restores imipenem sensitivity and biofilm formation.

6. Explaining why the clinical isolate forms high biofilm by using

transposon mutagenesis with mariner transpose and genetic screening

for the genes responsible for high biofilm formation in clinical isolates

by Arbitrary PCR and sequence analysis for these genes.

7. Perceiving the relationship between biofilm and Twitching test,

polysaccharide synthesis, and swarming motility.

8. Genetic complementation of mutant gene pilY1responsible for high

biofilm.

9. Estimation of polysaccharide production by ELISA test.

1.2 Literature review

1.2.1 Pseudomonas aeruginosa: general characteristics

P. aeruginosa is a gram negative, uniformly stained, straight or slightly

curved rods, measuring 0.5 to 1.0 μm by 1.5 to 5.0 μm in length. They are

aerobic, non-spore forming, motile by one or more polar flagella. They are

either incapable of utilizing carbohydrates as source of energy or degrade

them “oxidatively” rather than fermentative pathway (de Freitas and Luis

Barth, 2002).

P. aeruginosa is a member of the Gamma Proteobacteria class of

bacteria, belonging to the bacterial family Pseudomonadaceae. Since the

revision taxonomy based on conserved macromolecules (e.g. 16S ribosomal

RNA) the family includes only members of the genus Pseudomonas which

are cleaved into eight groups. P. aeruginosa is the type species of its group

(Hall et al., 2004).

Biochemically, they are oxidase and catalase positive, motile, grows

well at 42˚C, P. aeruginosa, utilizes glucose oxidatively, reduces nitrate to

nitrite, Methyl red/Voges Proskauer test is negative, do not decarboxylate

lysine and ornithine, but dihydrolyze agrinine, mannitol not fermented,

produce alkaline slant/alkaline butt with no gas and no H2S in TSI, indole

negative, utilize citrate, do not hydrolyze urea, do not produce phenyl

pyruvic acid, liquefies gelatin, do not hydrolyze aesculin and utilize

acetamide (Trautmann et al., 2008).

The typical Pseudomonas bacterium in nature might be found in a

biofilm, attached to some surface or substrate, or in a planktonic form, as a

unicellular organism, actively swimming by means of its

flagellum. Pseudomonas is one of the most vigorous, fast-swimming

bacteria seen in hay infusions and pond water samples. In its natural

habitat P. aeruginosa is not particularly distinctive as a pseudomonad, but it

does have a combination of physiological traits that are noteworthy and may

relate to its pathogenesis (Bodey et al., 1983).

On nutrient agar, colonies are large and pigmented

pyocyanin/fluorescence and on 5% sheep blood agar, they produce β-

hemolytic, large flat spreading, mucoid, rough, pigmented colonies with

characteristic metallic sheen (high carbon, low nitrogen content). Many

strains may produce a fruity, sweety, musty or grape like odor due to the

presence of 2-aminoacetophenone. On MacConkey agar, they produce non

lactose fermenting colonies with green pigmentation and metallic sheen.

Colonies from respiratory tract infection samples produce large amounts of

alginate, an exopolysaccharide consisting of mannuronic and guluronic acids

which aids in forming mucoid colonies.

Cetrimide agar is a selective and differential medium for the

identification of P. aeruginosa in which Cetrimide acts as detergent which

inhibits most bacteria and enhances the production of two pigments

pyocyanin, pyoverdine. However, about 4% of clinical strains of P.

aeruginosa do not produce pyocyanin (Mackie and MacCartney. 1996).

1.2.2 P. aeruginosa and cystic fibrosis

Cystic fibrosis (CF) is the most common inherited lethal genetic

disorder, Individuals suffering from CF harbor mutations in a gene on the

long arm of chromosome 7 (Riordan et al., 1989). The gene product is the

cystic fibrosis transmembrane conductance regulator (CFTR) which

regulates and facilitates transport of electrolytes across epithelial cell and

other membranes. The mucus in the CF airways is highly viscid, sulphated

and readily forms aggregates (Chace et al., 1985; Welsh and Smith, 1993).

In the CF lung, the viscid mucous cannot be propelled so easily and the

escalator fails, leading to an accumulation of mucus and trapped bacteria

(Bals et al., 1999).

P. aeruginosa is a major pathogen in the CF lung. Chronic

colonization with P. aeruginosa is associated with a more rapid decline in

lung function, especially if the isolate becomes mucoid (Emerson et al.,

2002). Although most patients are initially infected with nonmucoid P.

aeruginosa, it later transitions to a mucoid state (Li et al., 2004). Mucoidy

results from an overproduction of alginate which is thought to play a

protective role in the relatively harsh environment of the CF lung, perhaps

by enhancing the formation of biofilms, The link between CF-derived

mucoid P. aeruginosa isolates and their biofilm lifestyle, has led to the

assumption that alginate is the key secreted polysaccharide in biofilms of

both mucoid and nonmucoid strains (Hentzer et al., 2001).

The studies examining the role of alginate in the initiation or

maturation of biofilms often involved the comparison of mucoid strains

isolated from the CF lung with nonisogenic, nonmucoid strains; these

studies generally compared the ability of these strains to form biofilms and

the antibiotic resistance of established biofilms (Mai et al., 1993).

1.2.3 Antibiotic resistance in P. aeruginosa

P. aeruginosa has become an important and frequent opportunistic

nosocomial pathogen. This organism is characterized by an innate resistance

to multiple classes of antimicrobials, causing difficult-to-treat infections,

which are therefore associated with significant morbidity and mortality

(Obritsch et al., 2004).

Infections by P. aeruginosa are a serious clinical problem, particularly

in immune compromised hosts in hospital settings (Fujitani et al, 2011).

Moreover, the treatment of these infections is often difficult because of the

limited number of effective antimicrobial agents, due to the intrinsic

resistance of P. aeruginosa strains and their different modes of growth

(Khan et al, 2010). This resistance reflects the synergy between the

bacterium’s low outer-membrane permeability, its chromosomally encoded

AmpC β-lactamase, and its broadly specific drug efflux pump (Masuda et al,

2000). Furthermore, P. aeruginosa readily acquires resistance to most

antimicrobials through mutations in its chromosomal genes and through

extrachromosomal elements carrying resistance determinants (Qiu et al,

2009; Livermore and Yang, 1987).

The broad-spectrum resistance of P. aeruginosa is mainly due to a

combination of different factors: (i) low outer membrane permeability

(Nikaido , 1994), (ii) Presence of the inducible AmpC chromosomal ß-

lactamase (Lister et al., 2009), (iii) synergistic action of several multidrug

efflux systems (Poole, 2004), and (iv) prevalence of transferable resistance

determinants, in particular, carbapenemhydrolyzing enzymes (mainly

metallo-ß-lactamases (MBL) (Gutiérrez et al., 2007).

Although there are several antimicrobials (carbapenems, cefepime,

ceftazidime, tobramycin and amikacin) that continue to be effective against

P. aeruginosa, in the last few years the bacterium’s increasing resistance to

many others has been reported (Sanchez-Romero et al, 2007; Ruiz-Martinez

et al, 2011).

Carbapenems are good antimicrobial activity against P. aeruginosa but

the emergence and spread of acquired carbapenem resistance in this species

have challenged the success of therapeutic and control efforts. Since

carbapenems, especially imipenen, are widely used in the clinical setting

(Riera et al, 2011), investigation of the molecular mechanisms leading to

resistance is crucial.

1.2.4 Carbapenem resistance in P. aeruginosa

1.2.4.1 Carbapenems

Carbapenems are frequently used to treat P. aeruginosa; however,

resistance to the carbapenems is emerging rapidly (Zavascki et al., 2005).

The introduction of carbapenem into clinical practice represented a great

advancement for the treatment of β-lactam resistant bacteria. Due to their

broad spectrum of activity and stability to hydrolysis by most β-lactamase,

the carbapenems have been the drugs of choice for treatment of infections

caused by penicillin or cephalosporin resistant gram negative bacilli

(Jesudason et al., 2005).

Carbapenems exert their action primarily by inhibiting the

peptidoglycan-assembling transpeptidases (penicillin-binding proteins

[PBP]) located on the outer face of the cytoplasmic membrane. In general,

carbapenems can efficiently cross the outer membrane of the bacterium, as

they are small hydrophilic antibiotics. They enter the cell by passing through

the aqueous channels provided by porin proteins (Huang et al., 1995).

Among the several mutation-mediated resistance mechanisms existing

in P. aeruginosa are those conferring decreased susceptibility or resistance

to carbapenems. These antimicrobial agents are commonly used to treat

infections produced by multiresistant strains of P. aeruginosa, as they are

stable against most clinically relevant ß-lactamases (including broad-

spectrum, extendedspectrum, and AmpC-type enzymes). Although

carbapenems remain effective antibiotics for therapy of infections caused by

multidrug resistance (MDR) P. aeruginosa isolates, development of high

carbapenem resistance rates in P. aeruginosa isolates has been reported

worldwide (Davies et al., 2007).

1.2.4.2 Carbapenemase

Metallo-β-lactamase (MBL) was first detected in 1960, in Bacillus

cereus which was chromosomal in location. Then, first plasmid mediated

MBL isolates was found in P. aeruginosa in 1991 in Japan. Since early

1990s, MBL encoding genes have been reported all over the world in

clinically important pathogens, such as Pseudomonas spp., Acinetobacter

spp., and members of the Enterobacteriaceae family (Picao et al., 2008).

MBL in gram negative bacilli is becoming a therapeutic challenge, as these

enzymes usually possess a broad hydrolysis profile that includes all β-lactam

antibiotics including carbapenems (Galani et al., 2008).

The carbapenemases MBLs are the most feared because of their ability

to hydrolyze virtually all drugs in that class, including the carbapenems

(Walsh et al., 2002). In addition to their resistance to all β-lactams, the

MBL producing strains are frequently resistant to aminoglycosides and

fluoroquinolones, Unlike carbapenem resistance due to several other

mechanisms, the resistance due to MBL and other carbapenemase

production has a potential for rapid dissemination, as it is often plasmid

mediated (Walsh et al., 2005). Consequently, the rapid detection of

carbapenemase production is necessary to initiate effective infection control

measures to prevent their dissemination. Various methods like Modified

Hodge test, EDTA disk synergy (EDS) test (Lee et al., 2001), MBL E-test,

EDTA-based microbiological assay are used for the detection of MBLs,

Nevertheless, detection of genes coding for carbapenem resistance by PCR,

usually give reliable and satisfactory results, but this method is of limited

practical use for daily application in clinical laboratories because of the cost

(Marchiaro et al., 2005).

MBLs spread easily on plasmids and cause nosocomial infections and

outbreaks. Such infections mainly concern patients admitted to Intensive

Care Units with several co-morbidities and a history of prolonged

administration of antibiotics (Maltezou, 2009). Moreover, MBL producing

isolates are also associated with higher morbidity and mortality (Walsh et

al., 2005). Early detection of MBL-producing organisms is crucial to

establish appropriate antimicrobial therapy and to prevent their interhospital

and intrahospital dissemination (Picao et al., 2008).

Class 1 integron-containing P. aeruginosa isolates from Australia and

Uruguay were investigated for the genomic locations of these elements.

Several novel class 1 integrons/transposons were found in at least four

distinct locations in the chromosome, including genomic islands (Martinez

et al., 2012). The transmissible MBLs confer high-level resistance to all

carbapenems and are found worldwide (Walsh et al., 2005). AmpC, the

chromosomal β-lactamase, has been found to have very little activity against

carbapenems but can work in synergy with other resistance mechanisms

(Quale et al., 2006).

In the absence of carbapenem-hydrolyzing enzymes, the mechanism

leading to carbapenem resistance is mostly mediated by OprD loss, which

primarily confers resistance to imipenem but also confers low grade

resistance to meropenem (Köhler et al., 1999; Livermore, 1992).

1.2.4.3 Porin oprD

The main porin for uptake of carbapenems in P. aeruginosa is the outer

membrane protein (OMP) OprD, a specialized porin which has a specific

role in the uptake of positively charged amino acids such as lysine and

glutamate (Huang et al., 1995). Other routes for carbapenem uptake have

been proposed (Pérez et al., 1996), but their actual relevance has not been

consistently proved.

Inactivating mutations in OprD have been documented to confer

resistance to imipenem and to a lesser extent to meropenem and doripenem

(Sanbongi et al., 2009). It is also remarkable that mutations leading to the

upregulation of the MexAB-OprM active efflux system may increase the

resistance to meropenem and doripenem but with no effect on the

susceptibility of P. aeruginosa to imipenem, which is not a substrate for this

system (Köhler et al., 1999).

Porin OprD of P. aeruginosa facilitates the uptake across the outer

membrane of basic amino acids, small peptides that contain these amino

acids, and their structural analogue imipenem. Indeed, prolonged imipenem

treatment of patients with P. aeruginosa infections leads to imipenem

resistant mutants that either lack OprD due to an oprD gene mutation (Lynch

et al., 1987) or have strongly reduced OprD levels due to an nfxC-type

mutation (mexT) which suppresses oprD expression at the same time as

upregulation of the mexEF-oprN multidrug efflux operon (Fukuda et al.,

1995; Kohler et al., 1997).

1.2.4.4 Molecular Mechanisms of OprD-Mediated Resistance

The pathway to OprD-mediated resistance can involve mechanisms that

decrease the transcriptional expression of oprD and/or mutations that disrupt

the translational production of a functional porin for the outer membrane. At

the level of oprD transcription, characterized mechanisms include (i)

disruptions of the oprD promoter, (ii) premature termination of oprD

transcription, (iii) coregulation with mechanisms of trace metal resistance,

(iv) salicylate-mediated reduction, and (v) decreased transcriptional

expression through mechanisms of coregulation with the multidrug efflux

pump encoded by mexEF-oprN. oprD promoter disruptions have occurred as

a result of deletions or insertions within the upstream region of oprD.

Yoneyama and Nakae (1993) reported the association of a large deletion

encompassing the putative promoter and initiation codon that prevented

transcription of oprD.

IS1394 and an ISPa16-like insertion (IS) element have been described

upstream of the oprD coding region for imipenem-resistant isolates of P.

aeruginosa exhibiting decreased oprD expression (Wolter et al., 2008;

Wolter et al., 2009).

El Amin et al. (2005) observed that premature termination of

transcription was occurring in clinical isolate, potentially due to mutations

within the structural gene sequence.

The most complex mechanisms are the transcription of oprD that are

linked to the regulation of expression of the mexEF-oprN efflux pump (Ochs

et al., 1999). These mechanisms of coregulation are, showed the complexity

by which P. aeruginosa is able to regulate expression of resistance

mechanisms and why it is sometimes so difficult to definitively link

phenotypes to changes in one specific mechanism (Wolter et al., 2004;

Evans and Segal, 2007).

1.2.5 Biofilm

Biofilms are surface-attached communities of bacteria embedded in an

extracellular matrix of biopolymeric substances and are involved in many

types of chronic infections (Costerton et al., 1995). Biofilm bacteria are

physiologically distinct from free-swimming bacteria of the same species.

Wild-type, nonmucoid P. aeruginosa biofilm formation proceeds through

distinct developmental steps. After initial attachment of single cells to a

surface, the bacteria move on the surface by twitching motility to form

clumps of cells or microcolonies (O’Toole and Kolter, 1998). Figure 1-1

explains the stages of biofilm formation.

Figure 1-1: Essential steps of bacterial biofilm formation inspect with swarming motility

(http://www.pasteur.fr/recherche/RAR/RAR2006/Ggb-en.html).

Common examples of biofilms include dental plaque, endocarditis, and

slime on river stones. Biofilms are increasingly recognized as contributing to

disease pathogenesis in cystic fibrosis and in other bacterial diseases (Parsek

et al., 2003). Bacteria in a biofilm state exhibit increased resistance to

antibiotics (Prince et al., 2002) and host defense factors (Jesaitis et al.,

2003).

Communal bacteria in a biofilm can survive antibiotic concentrations as

much as 1000-fold higher than the same bacteria in an individual, free-

living, planktonic state (Høiby, 2001). Therefore, clinically attainable

antibiotic concentrations may not adequately clear biofilm infections,

allowing the bacterial population to recover, persist, and spread (Singh et al.,

2000).

P. aeruginosa environmental bacterium is capable of living

planktonically or in surface-associated communities known as biofilms. P.

aeruginosa biofilms can form on a variety of surfaces, including in mucus

plugs of the CF lung and abiotic surfaces, such as contact lenses and

catheters (Davies et al., 1998; O’Toole et al., 2000).

1.2.5.1. Stages of biofilm development

· Attachment

Motile (planktonic) bacteria transform to the sessile form prior to

biofilm formation as they adhere to a favourable surface; such as a medical

device or the host tissue. In some cases initial adhesion of biofilm forming

microorganisms is achieved by means of adhesins located on specialised

organelles such as fimbriae (pili) (Sauer et al, 2002; Lasaro et al, 2009).

· Formation of microcolonies

The cells aggregate as they divide on adhesion to a surface but the

daughter cells multiply outward and upward from the point of attachment to

form cell clusters. The dividing cells produce quorum sensing molecules and

extracellular polymeric substances, or polymer matrix. The matrix houses

the aggregating cells in microcolonies and also attaches the biofilm to the

surface on which it is forme, Microcolonies become larger as the number of

organisms increase and the quantity of polymer matrix produced also

increases (Watnick and Kolter, 1999).

More signalling molecules and polymer matrix are produced by the

organisms within the microcolonies at this stage (Tolker - Neilsen et al,

2000; Malic et al, 2009). The fully mature biofilm structure comprises of

bacterial cells, the polymer matrix, and interstitial water channels that

facilitate the exchange of nutrients and wastes in and out of the biofilm into

the surrounding environment, P. aeruginosa displayed multiple phenotypes

during biofilm development and biofilm cells at dispersion were found to be

similar to the planktonic cells in phenotypic expression (Sauer et al, 2007).

· Detachment and dispersal of biofilm organisms

The biofilm environment is innately regulated and studies have shown

that high population density within a mature biofilm induced programmed

detachment of bacteria from biofilm through the secretion of chemical

substances by the organisms (O'Toole et al, 2000). Studies have shown that

detachment occurs when the organisms respond to chemical substances

secreted by them such as signalling molecules (Stoodley et al, 2005),

proteins and degradative enzymes (Barraud et al, 2006) and oxidative or

nitrosative stress-inducing molecules such as nitric oxide (NO) produced as

a result of metabolic processes within a biofilm (Schlag et al, 2007). It has

also been shown that alginate lyase; a degradative enzyme produced by

biofilm organisms cleaves the polymer matrix into short oligosaccharides.

The cleavage antagonises the attachment characteristics of alginate leading

to increased detachment of biofilm organisms (Barraud et al, 2006).

1.2.5.2 Roles of extracellular polymeric substances in P. aeruginosa

biofilms

Exopolysaccharides are an important component of the microbial

biofilm extracellular matrix, since they contribute to overall biofilm

architecture and to the resistance phenotype of bacteria in biofilms. Several

species have been shown to produce a matrix consisting of

exopolysaccharides, proteins and nucleic acids (Pamp et al., 2007). The

major functions ascribed to the matrix are its role as a structural scaffolding

for biofilm cells and as a protective barrier against some antimicrobials.

Matrix production can dictate pattern formation in biofilms in a number of

ways. In some cases where biofilm populations consist of motile and non-

motile subpopulations, matrix production can facilitate the transition from

surface motility to sessility (Merritt et al., 2007; Kuchma et al., 2007).

The common theme in several species, where motility and matrix

production are inversely regulated by intracellular levels of the signalling

molecule cyclic dimeric guanosine monophosphate (c-di-GMP), Although

the matrix in general is considered to spatially fix the cells in a biofilm,

evidence has been presented that matrix components in some cases can

guide migration of the cells (Barken et al., 2008). Matrix production can also

influence average cell-to-cell distances between members of a biofilm

community. The formation of large, tightly packed aggregates is a feature

sometimes observed in a biofilm population overproducing secreted

components of the biofilm matrix (Stapper et al., 2004).

In P. aeruginosa, three major secreted polysaccharides have been

implicated in pattern formation in biofilms; alginate, Psl, and Pel (Colvin et

al., 2012).

· Alginate

AlgC appears to be crucial for general exopolysaccharide biosynthesis,

not just alginate, as it is also required for precursor synthesis of Psl, as well

as LPS and rhamnolipids (Goldberg et al., 1993; Olvera et al., 1999).

Alginate is composed of the uronic acids, mannuronic acid, and its

epimer, guluronic acid (Govan and, Deretic, 1996). In non-mucoid strains,

alginate does not appear to be an important component of pattern

formation/community structure (Wozniak et al., 2003). In clinical biofilms,

it appears to be produced, where its expression is induced under conditions

of low oxygen tension (Worlitzsch et al., 2002).

In the airways of people suffering from Cystic Fibrosis, P. aeruginosa

is seen to undergo a transition to a mucoid phenotype (Govan and, Deretic,

1996). Mucoidy is characterized by alginate overproduction and its impact

on pattern formation in biofilm communities is great (Stapper et al., 2004).

The chemical environment is key in this regard. Extracellular calcium acts as

a cation bridge between the negatively charged alginate polymers (Sarkisova

et al., 2005). In the absence of calcium, alginate overproduction results in

the production of aggregates of tightly packed bacterial cells in the biofilm.

However, in the presence of low calcium (µM–mM), the secreted alginate

forms a gel. This results in individual cells being suspended within the gel,

increasing the average intercellular distance (Hentzer et al., 2001; Sarkisova

et al., 2005). A functional consequence of alginate overproduction in a

biofilm is increased tolerance to antibiotics such as tobramycin (Hentzer et

al., 2001).

· Psl

The psl gene cluster contains 15 cotranscribed genes (pslA to pslO)

encoding proteins predicted to synthesize the Psl EPS, which is important to

initiate and maintain biofilm structure by providing cell-cell and cell-surface

interactions The pslH- and pslI-encoded proteins exhibit homology to

galactosyltransferases and mannosyltransferases, respectively. That means

the Psl EPS is composed mainly of mannose and galactose and that Psl is

indeed a matrix component of the biofilm (Ma et al., 2007), Overhage and

colleagues (2005) mapped the psl operon promoter 41 bp upstream of the

pslA start codon.

Ma et al. (2007) observed the frame deletions of pslH (strain

WFPA818) and pslI (strain WFPA819). The biofilm formation capacities of

these strains were compared with those of wild-type and psl-deficient strains

in a rapid attachment assay. Loss of either PslH or PslI function results in a

profound attachment defect, similar to that observed with the psl null strain

WFPA800. The attachment defect of WFPA818 and WFPA819 was restored

when a plasmid expressing either pslH (pMA10) or pslI (pMA11) was

introduced into the respective strain; these data indicate that PslH and PslI

are key proteins for Psl EPS synthesis. In a prior transposon mutagenesis

screen, pslH and pslI mutants also exhibited reduced biofilm formation

(Friedman, and Kolter, 2004).

Overproduction of the Psl polysaccharide led to enhanced cell-surface

and intercellular adhesion of P. aeruginosa. This translated into significant

changes in the architecture of the biofilm. Consequently, it was proposed

that Psl has an important role in P. aeruginosa adhesion, which is critical for

initiation and maintenance of the biofilm structure. The ability to form

biofilms in the airways of people suffering from cystic fibrosis is a critical

element of P. aeruginosa pathogenesis. The 15-gene psl operon encodes a

putative polysaccharide that plays an important role in biofilm initiation in

nonmucoid P. aeruginosa strains. Biofilm initiation by a P. aeruginosa

PAO1 strain with disruption of pslA and pslB (ΔpslAB) was severely

compromised, indicating that psl has a role in cell-surface interactions. In

previous study showed the adherence properties of this ΔpslAB mutant

using biotic surfaces (epithelial cells and mucin-coated surfaces) and abiotic

surfaces. Accordingly, psl is required for attachment to a variety of surfaces,

independent of the carbon source (Ma et al., 2006).

The actual structure of Psl is not known, although it is rich in

rhamnose, mannose, and glucose monomers (Ma et al., 2007). The primary

function for Psl in non-mucoid strains is attachment; Strains defective for Psl

production are defective in surface attachment on many different surface

types. However, Psl contributes to maintaining biofilm structure at later

stages in development (Matsukawa and Greenberg, 2004).

Ma et al. (2006) demonstrated that a strain that conditionally produces

Psl formed mature biofilms that eroded away once Psl expression was

disrupted. Psl was seen to preferentially localize to the exterior of

aggregates or microcolonies, forming a shell (Wozniak et al., 2003).

The interesting Psl staining pattern suggests that the polysaccharide

plays a key structural role encasing and ultimately holding together cells in

an aggregate. Like alginate/mucoidy, genetic variants that overproduce Psl

have been observed in CF sputum samples (Haussler et al., 2003). Psl

producing strains produce distinctive colony morphology on solid medium,

called rough, small colony variants (RSCVs). Like mucoidy, the CF airways

select for this phenotype (Smith et al., 2006). RSCVs are characterized by

autoaggregation in liquid culture and hyper-attachment to surfaces (Kirisits

et al., 2005).

Overhage et al. (2005) stated that psl expression was localized to the

centers of microcolonies within biofilms. In addition, Kirisits et al. (2005)

showed that the expression of psl and pel was elevated in variants isolated

from aging P. aeruginosa PAO1 biofilms. It has been suggested that the

mechanistic basis for psl and pel overproduction in these variants, as well as

other autoaggregative variants, involves elevated levels of the c-diGMP. P.

aeruginosa has several loci capable of modulating the c-diGMP level,

including the wsp, LadS, and retS signal transduction systems (Kuchma et

al., 2010).

· Pel

The last major exopolysaccharide produced by P. aeruginosa is Pel.

The pel gene cluster consists of seven genes, which encode the enzymatic

activities required for synthesis of the hydrophobic glucose rich Pel

exopolysaccharide (Friedman and Kolter, 2004). Unlike Psl, Pel does not

appear to play a role in attachment, although it is important in maintaining

mature biofilm structures (Vasseur et al., 2005). Its contribution to the

cellular distribution patterns found in biofilms, and where it is produced in a

biofilm is unclear. However, like Psl, Pel is found to be overproduced in

many RSCVs (Kirisits et al., 2005).

1.2.5.3 Extracellular DNA

Extracellular DNA was shown to be present in high concentrations in

the outer part of the microcolonies in young P. aeruginosa biofilms and

between the stalk-forming and cap-forming subpopulations in mature

glucose grown biofilms (Allesen-Holm et al., 2006). Type IV pili bind with

high affinity to DNA (Aas et al., 2002; van Schaik et al., 2005), and

evidence has been presented that the high concentration of extracellular

DNA on the microcolonies in developing P. aeruginosa biofilms may cause

accumulation of the migrating piliated cells and thereby facilitate formation

of the mushroom caps (Barken et al., 2008).

Production of extracellular DNA during P. aeruginosa biofilm

development has been shown to be dependent on the quorum-sensing system

(Allesen-Holm et al., 2006). Expression of the pqs-genes in developing P.

aeruginosa biofilms was shown to occur specifically in the outer layer of the

stalk forming microcolonies, correlating with the location of the

extracellular DNA (Yang et al., 2007).

1.2.6 P. aeruginosa motility on surface 1.2.6.1 Swarming motility

Swarming motility is operationally defined as a rapid multicellular

bacterial surface movement powered by rotating flagella. Although simple,

accurate, and mechanistically meaningful, the definition does not do justice

to the wide array of phenotypes associated with swarming motility, nor does

it emphasize all that remains unknown about this behavior (Copeland et al.,

2010).

A. Factores important for swarming motility

· Flagella

During swarming, P. aeruginosa retains its polar flagella but

synthesizes an alternative motor specifically required to propel movement on

surfaces and through viscous environments, Thus the expression of

alternative motors is at least one other way to facilitate swarming motility

besides use of peritrichous flagella (Toutain et al., 2005).

· Rafting

Whereas bacteria swim as individuals, swarming bacteria move in side-

by-side cell groups called rafts (Copeland et al., 2010). Raft formation is

dynamic: cells recruited a raft move with the group whereas cells lost from a

raft quickly become non-motile. The dynamism in cell recruitment and loss

suggests that no substance or matrix maintains raft stability save perhaps the

flagella themselves. Indeed, scanning electron microscopy of a swarm of

Proteus mirabilis revealed extensive rafting and perhaps intercellular

bundling of flagella (Jones et al., 2004). As with hyperflagellation, the

reason that swarming motility requires raft formation is at present unclear.

· Surfactant synthesis

Initial characterization of P. aeruginosa implicated rhamnolipids as the

swarming surfactant (Köhler et al., 2000). Di-rhamnolipid is composed of

two rhamnose sugars attached to the complex fatty acid β-hydroxydecanoyl-

β-hydroxydecanoate (HAA) (Caiazza et al., 2005). Subsequent investigation

has shown that the di-rhamnolipid precursors HAA and mono-rhamnolipid

also act as surfactants to promote swarm expansion (Tremblay et al., 2007).

Surfactant production is commonly regulated by quorum sensing

(Ochsner and Reiser, 1995). Surfactants are shared secreted resources and

are only effective at high concentration. Therefore, quorum sensing may

have evolved to regulate surfactant production to ensure that the surfactants

are only made when there are sufficient bacteria present to make surfactants

beneficial (Kato et al., 1999).

The flagellum and the chemotaxis system, consisting of

chemoreceptors and a signal relay system similar to that of E. coli, allow the

bacterium to respond to attractants and repellents (Kato et al., 1999).

Swarmer cells, which are usually elongated and hyperflagellated,

differentiate from vegetative cells probably by sensing the viscosity of the

surface or in response to nutritional signals (Harshey, 1994).

The swarming of the normally polar, monotrichously flagellated

bacterium P. aeruginosa is induced on 0.5 to 0.7% agar when certain amino

acids are provided as the sole source of nitrogen. The swarmer cells of P.

aeruginosa are elongated and can possess two polar flagella. Unlike all other

swarming bacteria, P. aeruginosa also requires type IV pili for this type of

motility.

B. Biofilm and swarming motility inversely regulate by c-diGMP

Cyclic-di-GMP is a ubiquitous second messenger in bacteria, the c-di-

GMP antagonistically controls motility and virulence of single, planktonic

cells on one hand and cell adhesion and persistence of multicellular

communities on the other has spurred interest in this regulatory compound

(Aldridge et al., 2003).

C-di-GMP controls cellular processes associated with the sessile-motile

transition in eubacteria, including exopolysaccharide (EPS) production,

attachment, and motility. Low concentrations of c-di-GMP are associated

with cells that move by virtue of flagellar motors or retracting pili. In

contrast, increasing concentration of c-di-GMP promote the expression of

adhesive matrix components and results in multicellular behavior and

biofilm formation that mean coordinate regulation of these two surface

behaviors depends upon common downstream effectors, such as regulation

of flagellar function and production of the Pel-derived EPS (Lim et al.,

2006).

Although Events during early biofilm formation by P. aeruginosa

PA14 require proper control of flagellar function for the reversible to

irreversible attachment phase, as well as robust production of the Pel EPS

(Caiazza et al., 2007; Merritt et al., 2007). C-di-GMP-mediated regulation

can occur through a variety of mechanisms, including stimulation of

exopolysaccharide (EPS) production, cell surface adhesin expression/

localization, and/or repression of various forms of motility (Newell et al.,

2009). Conversely, reduced levels of c-di-GMP generally lead to stimulate

of motile behaviors concomitant with reduced biofilm formation and hence

promote the switch to a motile lifestyle (Hengge, 2009).

Swarming motility is a flagellum-driven process and therefore the

sensitive to changes in flagellar function (Caiazza et al., 2007; Merritt et al.,

2007). Moreover, strains defective for production of the Pel EPS show

enhanced swarming relative to the wild type (WT), indicating that

production of the polysaccharide negatively impacts on swarming motility in

P. aeruginosa PA14 (Caiazza et al., 2007).

Strains with mutations in the bifA gene in PA14 elevate the levels of c-

di-GMP, and this accumulation is largely dependent upon the cyclase

activities of both SadC and RoeA, the resulting excess c-di-GMP produced

in the bifA mutant leads to hyper-biofilm formation and repression of

swarming motility (Kuchma et al., 2007, Merritt et al., 2010).

Moreover, it was shown that enhanced production of the Pel EPS is

required for the hyper-biofilm-forming phenotype but contributes only

marginally to the swarming defect of the bifA mutant (Kuchma et al., 2007).

Always the question was witch factors are required for repression of

swarming motility when c-di-GMP levels are elevated, (Kuchma et al.,

2010) performed a genetic screen to identify suppressors in the bifA

background that restored the ability to swarm. They identified a role for the

pilY1 gene in c-di-GMP-mediated repression of swarming motility. Strains

with mutations in the pilY1 gene show robust suppression of both the

swarming deficiency as well as the hyper-biofilm-forming phenotype

exhibited by the bifA mutant.

1.2.6.2 Twitching motility

Twitching motility is believed to result from the extension and

retraction of the pilus filament, which propels the cells across a surface.

Pilus synthesis and assembly require at least 40 genes which are located in

several unlinked regions on the chromosome (Hobbs et al., 1993).

It is clear that active extension and retraction of type IV pili is involved

in twitching motility (Skerker and Berg, 2001). These pili are about 6 nm in

diameter and up to 4 µm in length; they are typically found at one or both

cell poles (Bradley, 1972). Radial expansion rates of colonies via twitching

motility can approach 0.3 µm/s (Mattick, 2002), involved in biofilm

formation (O’Toole and Kolter, 1998).

Twiching motility like swarmer cells, rafts or spearhead-like clusters of

aggregated cells in P. aeruginosa have been observed during twitching

motility. Within the rafts, cells are highly aligned in close cell-cell contact.

The rafts move radially outward, following the long axis of the cells. Cells

from one group join into another and form a lattice, many like swarming

bacteria. Such cells at first move end forward toward the other cells until

they touch with their poles and then rapidly snap into an aligned position,

which accounts for the characteristic jerky twitching motion observed with

this form of motility (Mattick, 2002). Although twitching motility is

primarily a social activity, individual cells can show limited movement when

in contact with inert substrates or on agar at low concentrations (Mattick,

2002).

In vitro and in vivo studies show that mutants lacking functional type

IV pili have a significant reduction in colonization, biofilm formation, and

ability to spread (O’Toole and Kolter, 1998; Wozniak and Keyser, 2004).

Control of type IV pili expression and twiching motility is complex.

One system that controls twiching motility is a sensor kinase and a response

regulator pair referred to as FimS/AlgR (Whitchurch et al., 1996).

However, type IV pili are polar organelles that are composed of a

single protein subunit, PilA. PilA is exported out of the cell and polymerized

to form the surface fimbrial strand. Prepilin genes are located in one of the

many v gene clusters and appear to play a role in type IV pili assembly,

export, localization, and maturation and the general efficiency of the type IV

pili machinery (Mattick, 2002). A microarray study revealed that the fimU-

pilVWXY1Y2E prepilin cluster is under the control of algR (Lizewski et al.,

2004).

The pilY1 gene from P. aeruginosa was discovered by Richard Alm

and colleagues at the University of Queensland in 1996, it was identified at

the same time as three other previously uncharacterized genes, pilW, pilX,

and pilY2, all of which were initially implicated in pilus biogenesis. PilY1 is

a large (127 kDa) protein with ~1163 amino acids (value varies between

different strains).

However, mutation of the pilA gene, encoding the major subunit of the

type IV pilus, showed only weak suppression of the bifA swarming and

biofilm defects, indicating that it is loss of PilY1 specifically, and not loss of

pili, that fully suppresses the bifA mutant defects (Kuchma et al. 2010).

PilY1 protein plays two distinct cellular roles: one role promoting pilus

assembly and a second role repressing swarming motility. Also the minor

pilins, PilW and PilX, impact both pilus assembly and swarming motility,

and this subset of pilus assembly proteins functions to allow P. aeruginosa

to coordinately regulate two distinct motility behaviors, swarming and

twitching, when associated with a surface (Kuchma et al., 2012).

Finally Surface induction of PilY1 not only facilitates pilus biogenesis

but also stimulates synthesis of the intracellular signaling molecule, c-di-

GMP, via an interaction with the SadC diguanylate cyclase (figure 1-3).

These data are consistent with the minor pilins, PilX and PilW, also

participating in the modulation of c-di-GMP levels, either in conjunction

with PilY1 or possibly via a separate pathway. Increased synthesis of c-di-

GMP then leads to repression of swarming motility, most likely by

influencing flagellar function as previously proposed (Caiazza et al., 2007).

Elevated c-di-GMP levels also stimulate biofilm formation (Caiazza et al.,

2007; Kuchma et al., 2007; Merritt et al., 2007), allowing P. aeruginosa

cells to coordinately regulate all three of these distinct surface behaviors

(Kuchma et al., 2012).

Figure 1-3: Model for coordinate regulation of surface-based swarming and

twitching motility, surface growth induces expression of pilus assembly proteins,

including PilY1, PilX, and PilA, likely to prepare cells for twitching motility (Kuchma et

al., 2012).

chapter two

materials and methods

2. Materials and Methods

2.1. Materials 2.1.1. Equipment

Apparatuses and equipment used in this study were listed in table 2-1.

Table 2-1: Apparatuses and equipment used in this study

Manufacturing Company/ Origin Equipment Id

Coastar/ USA 96 well flat bottom plate (poly styrene) 1

Coastar/ USA 96 well U bottom plate (Vinyl) 2 Fischer / USA ABI 7500 Fast System 3 Hirayama /Japan Autoclave 4 Hettich /Germany Centrifuge 5 Sanyo/Japan Deep-freezer 6 Canon /Japan Digital camera 7 Fischer /USA Electrical balance 8 Fischer /USA Electroporation unit 9 Fischer / USA Eppendorf tubes 10 Fischer / USA Gel electrophoresis unit 11 IKA /Germany Hot plate with magnetic stirrer 12 Memmert /Germany Incubator 13 Fischer / USA Laminar air flow hood 14 Schleicher and Schuel / USA Membrane filters (0.22µm) 15 Hettich /Germany Microcentrifuge 16 Brand /Germany Micropipette 17 Fischer / USA Microwave 18 Siga / USA Microwave oven 19 Fischer / USA Nanodrop 20 SherWood /USA Oven 21 IKA /Germany PCR Unit 22 Fischer / USA pH meter 23 Fischer / USA Power supply 24 Fischer / USA Refrigerator 25 BBL /USA Screw capped test tubes 26

Table 2-1 continued

2.1.2. Chemicals and biological materials

Chemicals and biological material used in this study are listed in table

2.2.

Table 2-2: Chemical and biological materials

Shimadzu /Japan Spectrophotometer 27 Millipore/ USA Stericup filter unit 28

Manufacturing Company/ Origin Equipment Id

Ultraviolet products institute /USA Ultraviolet light 29

Labcoo /Germany Vortex 30 Memmert /Germany Water bath 31 Fischer / USA Water distillatory 32

Id Chemical and biological materials Company (origin) 1 1 KB plus DNA Ladder Invitrogen/USA 2 5X HF Buffer Ivitrogene / USA 3 Agarose gel Promega /USA 4 Ammonium sulfate (NH4)2SO4 Difco /USA 5 Ampicillin (Ap) Siga/ Aldrich /USA 6 Arabinose Himedia /India 7 Barium chloride (BaCl2. 2H2O ) Difco/USA 8 Boric acid Difco /USA 9 Bromothymol blue dye BDH/UK

10 Carbincillin (CA) Siga-Aldrich /USA 11 Cassamino acid Difco /USA 12 Crystal violet Merck /Germany 13 Dipotassium phosphate (K2HPO4) Siga- Aldrich /USA 14 Disodium phosphate (Na2HPO4.7H2O) Difco /USA 15 DMSO Difco /USA 16 EDTA Difco /USA 17 Ethanol Absolute Merck /Germany

Table 2-2 continued

2.1.3 Culture media

All culture media used for the isolation and identification of bacteria

through this study are listed in table 2- 3.

Table 2-3: Ready to use culture media

18 Gentamicin (Gm) Siga- Aldrich /USA 19 Glacial acetic acid Difco / USA 20 Glucose Difco/ USA 21 Glycerol Siga- Aldrich /USA

Id Chemical and biological materials Company (origin) 22 Imipenem powder 25mg Siga-Aldrich / USA 23 Ladder 1 Kb Promega / USA

24 Lithium acetate Difco / USA 25 Magnesium sulfat (MgSO4) Merck / Germany 26 Monopotassium phosphate (KH2PO4) Difco / USA 27 Nalidixic acid (NA) Siga-Aldrich /USA 28 Nucleotide mix dNTP Roch-Germany /USA 29 Pepton Difco / USA 30 Phusion enzyme Invitrogene /USA 31 Polyethylene glycol Siga /USA 32 Sodium chloride (NaCl) Difco / USA 33 Sodium hydroxide (NaOH ) Difco /USA 34 Sodium phosphate (NaHPO4) Difco / USA 35 Sucrose Fluka-Swizerland/ Germany 36 Sulphuric acid (H2SO4) Difco /USA

37 Syper safe stain Invetrogen / USA 38 Taq polymerase BioLabs / USA

39 Taq polymerase 5U/µl Promega / USA

40 Tri-HCl Difco / USA

41 Tris base Difco / USA 42 Tryptone Difco / USA 43 Yeast extract Biomerieux /France 44 Yeast Nitrogen Base Difco / USA

Id Medium Company(Origion) 1 Cetrimide Agar Base

Difco (USA) 2 MacConkey Agar 3 Muller Hinton Agar 4 Muller Hinton Broth

2.1.4. Kits

All kits used in this study are listed in table 2-4.

Table 2-4: Kits used in the present work ID The kit Company (Origin)

۱ E-test strip kit of Imipenem (from 0.002 to 32 μg/ml)

BioMérieux (France)

۲ Gentra Puregen Yeast/Bactacteria Kit Qiagene (USA)

۳ Phusion enzyme kit, High fidelity DNA polymeraseare.

Invitrogen (USA)

4 QIAquick PCR purification kit. Qiagen (USA) 5 Qiagen Kit for yeast plasmid DNA prep Qiagen (USA)

6 Qiagen Kit for plasmid DNA prep from Bacteria

Qiagen (USA)

7 RNeasy Mini kit for purification total RNA from bacteria

Qiagen (USA)

2.1.5. Standard strains quality control bacteria

All standard strain and quality control bacteria used throughout this

study are listed in table 2-5:

Table 2-5: The standard strains and quality control bacteria used in the present study .

Name Relevant Genotype, description, or sequence Source

Saccharomyces cerevisiae (InvSc1)

MATa/MATα leu2/leu2 trp1-289/trp1-289 ura3-52/ura3-52 his3-Δ1/his3-Δ1

Invitrogen/USA

Escherichia coli S17-1(λpir)

thi pro hsdR-hsdM+ ΔrecA RP4-2::TcMu-Km::Tn7

Simon et al., 1983

DH5α lˉ f80dlacZDM15D (lacZYA-argF) U169 recA1 endA hsdR17(rKˉ mKˉ ) supE44 thi-1 gyrA relA1

Life Technologies/ USA

Table 2-5 continued

Name Relevant Genotype, description, or sequence Source

Pseudomonas aeruginosa PAO1 Wild type Jacobs et

al.,2003

oprD::isphoA/hah PAO1 with isphoA/hah insertion in oprD;Tcʳ

Jacobs et al.,2003

Escherichia coli ATCC 25922/ Sensitive for all antibiotic ATCC/USA

Pseudomonas aeruginosa

ATCC 27853/ Sensitive for all antibiotic ATCC/USA

2.1.6 Primers

2.1.6.1. Primers used in oprD genetic complementation and sequencing

All primers used in oprD complementation and sequencing were

designed according to http://www.idtdna.com website listed in table 2-6.

Table 2-6: oprD gene primer used in Genetic complementation and

sequencing

Primers Name Primer sequence (5′ – 3′) Origin

oprD comp 5′ ttctccatacccgtttttttggggaaggagatatacatATGAAAGTGATGAAGTGGAG

Integrated DNA Technology (IDT)/USA

oprD comp 3′ taatctgtatcaggctgaaaatcttctctcatccgccTCACAGGATCGACAGCGGATAG

oprD seq a-f ATGAAAGTGATGAAGTGGAGC

oprD seq a-r AGGGAGGCGCTGAGGTT

oprD seq b-f AACCTCAGCGCCTCCCT

P730 GCAACTCTCTACTGTTTCTCC

Note: In primer sequences, lowercase letters indicate sequence homology to the cloning vector, uppercase letters indicate a Pseudomonas gene-specific sequence, boldface and lower case letters indicates a His tag sequence.

2.1.6.2. Quantification real time PCR primers

All primer used in oprD complementation and sequencing were

designed according to http://www.idtdna.com website are listed in table 2-9.

Table 2-9: oprD primers used in q RT-PCR

Primer name Primer sequence (5′ – 3′) Origin

oprD-RT Forward CCGCAGGTAGCACTCAGTTCG IDT/USA

oprD-RT Reverse GTAGTTGCGGAGCAGCAGGTC

2.1.6.3. Primer used in Arbitrary PCR

All primers used in Arbitrary PCR are listed in table 2-7.

Table 2-7: Primer used in Arbitrary PCR

Primer name Primer sequence (5′ – 3′) Origin

P235 GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT

IDT/USA

P236 GGCCACGCGTCGACTAGTACNNNNNNNNNNACGCC

P237 GGCCACGCGTCGACTAGTACNNNNNNNNNNAGAG

P238 TATAATGTGTGGAATTGTGAGCGG P239 GGCCACGCGTCGACTAGTAC P240 ACAGGAAACAGGACTCTAGAGG P241 CACCCAGCTTTCTTGTACAC

2.1.6.4. Primers used in pilY1 genetic complementation and sequencing

All primer used in pilY1Genetic complementation and sequencing were

designed according to http://www.idtdna.com web site are listed in table 2-

8.

Table 2-8: pilY1 primers used in Genetic complementation and sequencing

Primer name Primer sequence (5′ – 3′) Origin pilY1 comp 5′ tctccatacccgtttttttgggctagcgaattcgaaggagatataca

tATGAAATCGGTACTCCACCAG

IDT/USA

pilY1His comp 3′ tcttctctcatccgccaaaacagccaagcttgcatgcctTCAgtggtgatggtggtggtgGTTCTTTCCGATGGGGC

pilY1 seq Rev 2 TGAACGGACAGGTACAGATCC

pilY1 seq 3 GGATCTGTACCTGTCCGTTC

pilY1 seq 4 GGCGAGTTTCTCAAGAAGACC

pilY1 seq 5 CTTCCAGGACATCCTCAACCG

pilY1 seq 6 AGCCCAGCGGTAACTACTCC

pilY1 seq 7 CAAGGTCAACCAGGACGATC P730 GCAACTCTCTACTGTTTCTCC

Note: In primer sequences, lowercase letters indicate sequence homology to the cloning vector, uppercase letters indicate a Pseudomonas gene-specific sequence, boldface and lower case letters indicates a His tag sequence.

2.1.7. Plasmids and vectors used in this study

All the plasmids and vector were used in this study were summarized in

table 2-10.

Table 2-10: Plasmids and vectors

Plasmids description, or sequence Origin

pMQ72 Shuttle vector for cloning in yeast and for arabinose-inducible gene expression; GmR

Shanks et al., 2006

PMQ70 Shuttle vector for cloning in yeast and for arabinose-inducible gene expression; ApR

Shanks et al., 2006

pBT20 Vector carrying mariner transposon; ApR GmR * (marker on transposon)

Kulasekara et al., 2005

poprD oprD gene cloned in pMQ72; GmR This study

pPilY1His His-tagged pilY1 gene cloned in pMQ70; ApR This study

*GmR: Gentamicin resistance, ApR: Ampicillin resistance

2.1.8. Buffers and solutions

All buffers and solutions were prepared according to British

Pharmacopeia (2012) unless it is mentioned elsewhere.

2.1.8.1. Magnesium sulfate MgSO4 1 M

MgSO4 (24.65) g was dissolve in ~75 ml distilled water, then brought

up to 100 ml volume and then sterilized with autoclave (15 minutes, 121°C).

2.1.8.2. Glucose 20%

Glucose (200) g was added to one litter of water and then autoclaved

for 5 min at 121°C.

2.1.8.3. Lazy bones solution

Polyethylene glycol (40%) and Lithium acetate (0.1 M), 10mM Tris-

HCL (pH 7.5) and 1mM EDTA were mixed

2.1.8.4. Sodium borate (SB) buffer 20X

This buffer was prepared as follows: 8 g NaOH and 40 g boric acid

were added to 1 liter of distilled water. For routine, SB buffer was diluted to

1X concentration.

2.1. 8.5. Ethylendiaminetetraacetic Acid (EDTA), 0.5 and 0.05 M

This buffer was prepared as follows: 18.61 g EDTA in 100 ml distilled

water to achieve 0.5 M concentration followed by pH adjustment to 8.0 and

sterilization was done by filtration. This solution was used for the

preparation of TE buffer. The 0.5 M EDTA solution was diluted by adding

10 ml of this solution to 90 ml distilled water in order to attain the 0.05 M

EDTA solution.

2.1. 8.6. Tris buffer (1M) pH 8

Tris base (122.2) g was added to one liter of distilled water.

2.1. 8.7. Tri- EDTA (TE) buffer

Tris stock (1 M ) 10 ml was add to 2 ml of 0.5 M of EDTA, final

concentration should be 10mM Tris pH8, 1mM EDTA pH8.

2.1. 8.8. loadeing buffer 6X dye

Mixture of 30% sucrose and 0.25% bromophenol blue was made. The

mixture was completed to 100 ml and autoclaved and then kept at 4°C until

used.

2.1. 8.9. Ethanol (70%)

Absolute ethanol (70 ml) was completed to 100 ml with distilled water.

2.1. 8.10. Glycial acetic acid 30%

Absolute glycial acetic acid (70 ml) was completed to 100 ml with

distilled water.

2.1.9.11. Casamino acids 20% (CAA)

200 g of CAA was added to one litter of water and then autoclaved for

15 min at 121°C.

2.2. Methods

2.2.1. Sterilization

Sterilization was achieved by heating; wet heat sterilization by

autoclave at 121˚C/15 psi for 15 min. One more method used is filtration

using 0.22 μm filter unit. All equipment and materials used in this study

were sterilized through these two methods unless mentioned elsewhere.

2.2.2. Laboratory prepared culture media

2.2.2.1. Yeast peptone dextrose (YPD) broth media

The broth was prepared as follows: 10 g yeast extract, 20 g peptone

and

20 g dextrose were dissolve in 1L of distilled water, pH was adjusted to 7.5.

2.2.2. 2. Yeast peptone dextrose (YPD) agar plate

The agar plate was prepared as follows: 10 g yeast extract, 20 g

peptone, 20 g dextrose and 15 g agar were dissolved in one liter of distilled

water, pH was adjusted to 7.5.

2.2.2. 3. Lysogeny broth (LB) broth

The broth was prepared according to Sambrook and Russell (2001) and

was done as follows: 10 g tryptone, 5 g Yeast extract, 5 g NaCl, these

chemicals were dissolved in 1L of distilled water, the pH was adjusted to 7,

autoclaved, then kept at 4°C until used.

2.2.2. 4. Lysogeny broth (LB) agar plates

The agar plate was prepared according to Sambrook and Russell

(2001). In brief, 10 g tryptone, 5 g Yeast extract, 5 g NaCl, and 15 g Agar

these chemicals were dissolved in 1L of distilled water, pH was adjusted to

7, autoclaved, then poured in petri plates.

2.2.2. 5. Minimal salts medium 5X M63

The minimal media was prepared according to Sambrook and Russell

(2001). Briefly, 60g KH2PO4, 140g K2HPO4 and 40g (NH4) 2SO4, the

reagent were mixed well in 4L of distilled water and autoclaved, pH was

adjusted to 7.

2.2.2. 6 Minimal salts medium 5X M8

The minimal media was prepared according to the following method:

64 g of Na2HPO4.7H2O (or 30 g NaHPO4), 15 g KH2PO4 and 2.5 g of

NaCl, were dissolved in four liters of distilled water and autoclaved, pH was

adjusted to 7.

2.2.2. 7 Minus uracil medium

Synthetic medium was prepared by dissolving Yeast Nitrogen Base 6.7

g, 0.76 g supplement mixture minus uracil (CSM-URA), 15g Dextrose, 20 g

Agar and 0.77 g of DoB or DoBA were dissolved in one liter of distilled

water. Afterward, the mixture was autoclave at 121 °C for 15 min.

2.2.2. 8. Glycerol for -80ºC

LB powder no agar ( 20) g was added to 800 ml distilled water and

200 ml glycerol (100%) and mix well.

2.2.2. 9. Stabs

nutrient broth (2.4) g, 3 g agar and 15 g thymine were mixed and

melted in a microwave. Later, 2 ml was added to vial by syringe and

needle, caps were left loosely and autoclaved. Thereafter, caps were

tightened when it became cool.

2.2.3. McFarland standard (no. 0.5) preparation

The 0.5 McFarland standard was prepared in accordance with the

British Society for Antimicrobial Chemotherapy (Vandepitte et al. 2003), by

adding 0.۰٥ ml of 0.048 M barium chloride (1.17% w/v BaCl2. 2H2O) to

99.۹5 ml of 0.18 M sulphuric acid (1% w/v H2SO4) with constant stirring.

The suspension was distributed to five glass tubes of the same size and

volume as those used in growing the broth cultures, the absorbance was

measured in a spectrophotometer at a wavelength of 625 nm and the

acceptable absorbance range for the standard is 0.08-0.13. Afterward, each

tube was thoroughly mixed on a vortex mixer to ensure that it is even. These

turbidity standard tubes were sealed tightly to prevent loss by evaporation.

Stored protected from light at room temperature. Before use, the tubes were

vigorously agitated by hand. It was used for the turbidity standardization for

antibiotic susceptibility test.

2.2.4. Single Stranded Carrier DNA

Single stranded carrier DNA prepared in accordance with (Burke et al.,

2000), high-molecular weight DNA (Deoxyribonucleic acid sodium salt type

III from Salmon testes; sigma), TE buffer (pH 8.0) (10 mM Tris-Hcl pH 8.0,

1mM EDTA).

· DNA (200) mg was weighed and placed into 100 µl TE buffer. This

mixture was mixed vigorously on a magnetic stirrer for 2-3 hours or until

fully dissolve.

· the DNA was aliqouted and stored at -20ºC

· Prior to use, the DNA was boiled an aliquot in water bath for 10 minutes

and quickly placed in ice.

2.2.5. Preservation of bacterial strains

Two methods were used for the preservation of bacterial strains:

A) Glycerol method: A loopful of overnight growth pure culture was added

to LB broth and incubated at 37 ºC. After 18 hr., 0.5 ml of culture was

added to 0.5 ml Glycerol (Vandepitte et al., 2003).

B) The strains of bacteria were subcultured in stabs, kept in cool incubator

4-8 °C and resubcultured every 3 months in a new slant.

2.2.6. DNA agarose gel electrophoresis

Standard method of the (Sambrook and Russell, 2001) was

followed to prepare horizontal agarose gel electrophoresis for genomic

DNA, plasmid and PCR product:

· Agarose at concentrations of 1% was prepared for PCR product for

plasmid and chromosomal DNA electrophoresis. Agarose was dissolve

in 100 ml of 1X SB buffer and solubilized by heating with stirring .The

agarose was left to cool at 60°C before adding Syper safe stain and

poured into the taped plate.

· A comb was placed near one edge of the gel.

· Syper safe was added with the pouring of the agarose

· The gel was left to harden until it became opaque; gently the comb and

tape were removed.

· SB (1X) buffer was poured into gel tank and the slab was placed

horizontally in electrophoresis tank.

· About 2µl of loading buffer was applied to each 5 ml of plasmid, the well

was fill with the mixture.

The power supply was set, 1kp molecular ladder served as marker. Five

microliters of the DNA ladder were mixed with one microliter of blue 6X

loading dye and subjected to electrophoresis in single lane. After

electrophoresis, the gel was exposed to UV using UV transilliuminator and

then photographed.

2.2.7. Imipenem stock preparation

The potency of Imipenem contains is 1000 µg per mg (Wiegand et al.,

2007). The stock solutions were prepared using the formula:

1000 ×V×C W=

P Where P = potency given by the manufacturer (µg/mg), V =volume

required (ml), C = final concentration of solution (multiples of 1000)

(mg/L), and W = weight of antibiotic (mg) to be dissolved in volume V

(mL).

Further stock solutions were prepared from the initial 10 000 mg/L

solution: 1 ml of 10 000 mg/L solution was added to 9 ml diluent = 1000

mg/L, 100 µl of 10 000 mg/L solution was added to 9.9 ml diluent = 100

mg/L.

2.2.8. Antibiotic stocks used in this study

Antibiotic stocks used in this study represent 1000X. Gentamicin

(GM), Nalidixic acid (NA), Ampicillin (Ap) and Carbincillin (CA) were

prepare in concentration of 10, 20, 150, 50 mg/ml respectively, distilled

water represent diluent.

2.2.9. Biofilm Media

M63 (minimal salts medium, 200 ml) 5X was supplemented with 1 M

MgSO4 (1 ml ), 20% glucose ( 10 ml) and 20% CAA ( 25 ml), all the

reagents were mixed and autoclaved at 121 °C for 15 min and then stored at

room temperature 25±2 ºC.

2.2.10. Swarming motility media

M8 (minimal salts medium 200 ml) 5X was supplemented with 1 M

MgSO4 (1 ml), 20% glucose (10 ml) and 20% CAA (25 ml), afterward, they

were mixed and solidified with agar (0.5% final concentration), finally they

were autoclaved at 121 °C for 15 min and stored at room temperature 25±2

ºC.

2.2.11. Twitching motility media

5X M63 (200 ml) was supplemented with 1 M MgSO4 (1 ml), 20%

glucose (10 ml) and 20% CAA (25 ml), thereafter they were mixed and

solidified with agar (1.5% final concentration) , finally they were autoclaved

at 121 °C for 15 min and stored at room temperature 25±2 ºC.

2.2.12. Standard and clinical strains culture

Clinical strains and E. coli DH5α and S17-1 λpir strains carrying the

plasmid pBt20 were routinely cultured on lysogeny broth (LB) medium,

which was solidified with 1.5% agar when necessary. Gentamicin (Gm) was

used at from 25 to 50 µg/ml for P. aeruginosa and at 10 µg/ml for E. coli.

Carbincillin (CA) was used at 50 µg/ml and 10 µg/ml for E. coli. Nalidixic

acid (NA) at 20 µg/ml for E. coli.

Saccharomyces cerevisiae strain InvSc1, used for plasmid construction

via in vivo homologous recombination, was grown with yeast extract-

peptone-dextrose (1% Bacto yeast extract, 2% Bacto peptone, and 2%

dextrose) (Shanks etal., 2006). Selections with InvSc1 were performed using

synthetic defined agar-uracil.

2.2.13. Determination of MIC of Imipenem for strains

2.2.13. 1. The E-test method

All strains of P. aeruginosa were subjected to determine minimum

inhibitory concentrations (MICs) against Imipenem. The E-test method has

been used for MIC determination according to the manufacturer’s

instructions. In brief, bacterial suspensions were prepared from fresh

colonies and the concentration has been adjusted to 1.5 to 2 ×108 cfu/ml

McFarland turbidity. Each strain was inoculated by streaking the bacteria all

over a Mueller Hinton agar (MHA) plate. An E-test strip of Imipenem (from

0.002 to 32 μg/ml) was placed on the surface of cultured media, after

overnight incubation at 37°C, MIC has been determined and the sensitive,

intermediate and resistant phenotypes were tested according to Clinical and

Laboratory Standards Institute (CLSI, 2013). MIC was also determined by

microdilution on microtiter plates to check the similarity of results.

Escherichia coli ATCC 25922 was used as quality control strains for E test.

2.2.13. 2. Microdilution method

The minimum inhibitory concentration (MIC) of P. aeruginosa strains

was determined, using the twofold serial microdilution method (Wiegand et

al., 2007) and using Muller Hinton broth (MHB). A serial dilutions ranging

from 0.5-32 μg/ml for Imipenem were prepared in microtiter plate wells.

Bacterial culture of 1.5 to 2 ×108 cell/ml was prepared using MHB and 1.5

to 2 ×108 cfu/ml McFarland’s standard tube, 10 μl of bacterial culture was

added to each microtiter plate well. The MIC values were taken as the

lowest concentration of the antibiotic in the well that showed no turbidity

after 24 hours of incubation at 37°C. The turbidity of the wells in the

microtiter plate was interpreted as visible growth of the microorganisms, P.

aeruginosa ATCC 27853 was used as quality control strains for

microdilution assay.

Microdilution assay was used to confirm the results of E test in regard

to the resistance strains.

2.2.14. Modified Hodge Test (MHT)

Modified Hodge test is a phenotypic method for detection of

carbapenemases (Anderson et al., 2007; Noyal et al., 2009).

0.5 McFarland dilution of the E. coli ATCC 25922 was prepared in 5

ml of saline. 1:10 dilution was prepared by adding 0.5 ml of overnight

culture to 4.5 ml of saline. Thereafter, a lawn of the 1:10 dilution of E. coli

ATCC 25922 was streaked to a Mueller Hinton agar. Afterward, 10 µg

Imipenem susceptibility disc was placed in the center of the test area. In a

straight line, the test organism was streaked from the edge of the disc to the

edge of the plate. Up to four organisms can be tested on the same plate with

one drug, and then the plate was incubated overnight at 37ºC in ambient air

for 16–24 hours. After incubation period, the plate was examined for a

clover leaf-type indentation at the intersection of the test organism and the E.

coli 25922, within the zone of inhibition of the carbapenem susceptibility

disk. MHT Positive test has a clover leaf-like indentation of the E. coli

25922 growing along the test organism growth streak within the disk

diffusion zone. MHT Negative test has no growth of the E. coli 25922 along

the test organism growth streak within the disc diffusion.

2.2.15. Biofilm formation assay

Biofilm formation in 96-well microtiter plates was assayed and

quantified as previously described by Caiazza and O’Toole (2004). All

biofilm assays were performed using M63 minimal medium supplemented

with glucose, MgSO4, and CAA.

Strains were grown overnight (~16 hours) in LB broth at 37°C, the 96-

well plate(s) were prepared for the assay (label strains). Each strain

suspension was diluted (1:50) into an aliquot of the Biofilm media and

mixed well by swirling and pipetting up and down. The wells were

inoculated (at least 4 wells per strain) of the 96-well plate (100 µl/well) from

the strain mixture using a multi-channel pipet. The 96-well plate was

covered with a lid and placed in the warm room (37°C) for up to 24 hours.

After the incubation period, the wells were shaken out to remove the

unattached bacteria and then were rinsed twice in the water container and

shaken out the excess water by tapping plate on paper towels. Subsequently,

125 µl of Crystal violate (CV) stain (at 0.1% concentration) was added to

each well and the control un-inoculated well, and then the plate was let sit to

10-15 min. The excess stain was shaken out into the waste container and the

plate was rinsed twice. The plate was taped on paper towels to dry.

In order to quantify the biofilms, 125 µl of 30% glacial acetic acid was

added to biofilm wells and to the control well (no bacterial cells, just stained

with crystal violet). This step was done with multichannel pipette. Plates

were allowed to sit at room temp for at least 15 minutes. Later, the

solubilized crystal violet was pipetted up and down gently to evenly mix just

prior to transferring 100 µl from each well to a 96-well flat-bottomed plate

(non-sterile). Finally, the plate was read by a spectrophotometer at an

absorbance of 550 nm.

2.2.16. Extraction of genomic DNA

Extraction of Genomic DNA was accomplished using the Gentra

Puregen Yeast/Bacteria Kit. Phusion enzyme was used to amplify oprD gene

to reduce the chance that errors will be introduced during the PCR reaction

(since we are specifically looking for mutations that have arisen by growth

in the presence of imipenem). The purity was checked by Nanodrop at OD

260/280.

2.2.17. Amplification of oprD gene by polymerase chain reaction

technique (PCR)

The PCR technique was employed for amplifying whole oprD gene in

P. aeruginosa strains. Mastermix reaction and reaction conditions are

summarized in table 2-11 and table 2-12, respectively.

Table 2-11: Mastermix reaction for single reaction

Reagents Volume (µl)

5X HF Buffer* 10

dNTP mix (10 mM) 1

DMSO 1.5

For Primer (25 µM) 1

Rev Primer (25 µM) 1 Template Genomic DNA 1 Phusion enzyme (U/ 50 µl) 0.5

Distilled water 34 *High Fidelity (HF) buffer was used that comes with Phusion enzyme kit, the

primers were listed in table 2-6

Table 2-12: The reaction conditions of PCR

Annealing temperature was determined by adding 3°C to lowest Tm of

primer pair, extension times was determined, (1 kb ) was added in each 30

second (when using complex templates like genomic DNA), the primers

were used in oprD amplification are listed in table 2-6.

Stage Temperature (time) Initial denaturation 98°C (1min)

Denaturation 98°C (10sec) 30 cycles Annealing 69°C (30sec)

Extension 72°C (40sec) Final extension 72°C (10min)

Hold 4°C

2.2.18. Sequencing

After PCR, gel was run if the band of expected size was seen, then

Qiagen PCR clean-up kit was used to clean up the PCR product for the

reactions of sequencing. The mix of reaction summarized in table 2-13.

Table 2-13: The sequence reaction mix

Reagent Volume(µl) PCR product 1 µl

Primer (100 µM) 1 µl Distelled water 18 µl

total volume 20 µl The primers were listed in table 2-6

After reaction, samples were sent to the Core Facility in Dartmouth

College. Sequence analysis was performed according to www.ncbi.org

using, Gene construction kit software and finch TV. The results DNA

sequences were aligned to the PAO1 oprD genomic sequence using the

NCBI BLAST.

2.2.19. Quantitative reverse transcription-PCR (qRT-PCR) (Kuchma et

al., 2005)

The qRT-PCR was used for measuring the oprD expression in clinical

strains

2.2.19.1. Bacterial Harvest

Bacterial suspension were diluted from LB-grown overnight cultures

1:100 into M63 minimal medium (2.2.2.5) and grown for 8 hours to an

optical density of 0.4 at 600 nm (OD600) (Normalized to a volume of 10 ml).

Samples were span down in a centrifuge (37°C at 5000 rpm for 2 minutes).

Thereafter, supernatant was discarded and the tubes were placed in a dry ice

ethanol bath for 10 minutes. The tubes were stored in -80°C freezer, until

use.

2.2.19.2. RNA extraction and cDNA

RNA preparation by Qiagen Rneasy Kit, RNA was run in 1% gel to

assess purity. RNA was quantified by Nanodrop at OD 260/280. 2 to 3 µg of

RNA was taken to make cDNA using the Invitrogen Superscript III cDNA

Kit. Primers were designed according to http://www.idtdna.com. The 96

well plates were set with appropriate number of strains three replica for each

one. 2 µl of 1000 pmol/µl cDNA (read by Nanodrop) was added for each

well and 82.5 µl of Syper green mix to that tube, negative control was

prepared as well. When loading is completed the pressure sensitive sealing

film was added on the plate. The real time plate was sent to core facility

Quantitative reverse transcription-PCR (qRT-PCR) was performed using an

ABI 7500 Fast System and analyzed using ABI Fast System software

version 1.4.

Expression levels were quantified in picograms of input cDNA using a

standard curve method for absolute quantification, and these values were

normalized to rplU expression. Results shown are based on the average from

two independent experiments with three replicates per sample. The primers

used were listed in table 2-9.

2.2.20. Genetic complementation steps of oprD mutant strain

2.2.20. 1. Digestion of PMQ72

PMQ72 was purified from E. coli and 20 µl PMQ72 was digested with

enzyme Sac1 for overnight at 37ºC. Plasmids for complementation and

overexpression were generated using vectors via homologous recombination

in yeast. PMQ72 vector was used for the complementation of oprD mutant

(shanks et al., 2006).

The poprD complementation constructs was generated by PCR

amplification using the high-fidelity DNA polymerase.

2.2.20. 2. Yeast transformation (Burke et al., 2000)

S. cerevisiae (InvSc1) was grown in YPD overnight. After that, couple

of large colonies were picked up with a sterile toothpick and transferred to 5

ml LB broth and incubated for overnight. Then 0.5 ml from overnight

culture was applied in 1.5 ml microfuge tube and spun down pellet at 10000

rpm for 10 second. To the pellet, 0.5 ml of lazy bones solution, 20 µl of

carrier DNA (salmon sperm DNA), 20 µl PCR product and of 5 µl vector

were mixed and then vortexed hard for 1 minute. The mixture was

incubated overnight to 4 days at room temperature (after 1- 4 days the

plasmid efficiency goes down in the yeast). The mixture was exposed to heat

shock for 10-12 minutes at 42ºC. Cell was pelleted, optimally was washed

with T.E., as PEG inhibits growth, and cultured onto selective media. At the

end of the incubation period (5-7 days), the growth was harvested by

spreader from plate and the suspension was taken for plasmid preparation.

Qiagene kit was used for DNA plasmid prep from yeast. Then amount of

plasmid was transferred into E. coli to amplify the plasmid.

2.2.20. 3. Electroporation (Oldenburg et al., 1997)

A. Preparation of E.coli DH5α

A liter of LB was inoculated with 1/100 of fresh overnight E.coli

DH5α, cells grown with vigorous shaking to OD 600 of 0.5 at 1 hour. The

culture was chilled on ice for 15 to 30 min, and then centrifuged in cold

centrifuge at 4000X g for 15 min. Successively, the pellets was resuspended

in a total of 1litter cold water and centrifuged as before, and then the pellet

was resuspended in 0.5 L cold water and centrifuged. The pellet was

resuspended in 10% glycerol and centrifuged. The pellet was resuspended in

a final volume of 2 to 3 ml in 10% glycerol. The cells were aliquoted and

frozen on dry ice. Finally the cell was storaged at -80ºC; the cells are good

for at least six months.

B. Electroporation of E. coli

The cells were thawed at room temperature and placed on ice, 40 µl of

cells was mixed with 1 µl to 2 µl of DNA in low ionic strength buffer and

put in pre-chilled cuvette. The cells were let to sit on ice for a minute.

Thereafter, the gene pulser apparatus was set at 25 µF and 2.5 KV, the

cuvette was put in the slide and the slid was push into the chamber, the

pulsing was once pulsed (time constant should be 4.5 to 5 sec), 500 µl was

added after pulsing immediately of LB and the cells were resuspended.

Subsequently, the cells was transferred to appendroff tube and incubated at

37ºC for 1 hr, the cells were plated on selective media by spreader.

QIAprep Spin Miniprep kit was used for plasmid preparation from E.

coli and run on agarose gel to confirm the presence of the expected band.

Then the sequence analysis was achieved to ensure there is no mutation in

interesting gene that may happen during PCR cycle.

C. Electroporation of P. aeruginosa

From overnight culture, 1 ml of cell were spun to pellet (maximum

speed, 1min), the supernatant was remove and resuspended in 1 ml of 300

mM sucrose, the cell was spun to pellet, the supernatant was removed and

this wash was repeated in sucrose two more times. After the finally spin, the

supernatant was remove carefully and the cells was resuspended in 80 µl of

300mM sucrose, the( DNA no more than 1.5) was pipetted onto the side of

electroporation cuvette to allow cell mixture to go in to the well of the

cuvette (no bubbles), electroporate using the E. coli setting (the putton was

push for the time constant setting so you can see the puls time), immediately,

0.5 ml of LB was added to recover the cells and transfered to fresh

microfuge tube, the cells was recovered at the 37ºC on the wheel for 1.5 – 2

hours, 10 µl of the mixture plus 50 µl was plated on the appropriate selective

media. After that, the phenotypic restoration was screened.

2.2.21. mariner transposon mutagenesis of the highest biofilm producers;

576 and 214 (Kulasekara et al., 2005)

2.2.21.1. Conjugation and selection of mutants

The donor strain E. coli S-17 l pir (strain carrying the plasmid pBT20 –

carries Mariner transposon) and the recipient P. aeruginosa were grown for

overnight with appropriate antibiotic selection (antibiotic markers were

ampicillin marker on plasmid backbone – ampicillin was used for growth of

E. coli; gentamicin marker on Mariner was used for P. aeruginosa). The

transposon carries an outward-directed Ptac promoter so Tn insertions can

lead to overexpression of downstream genes. 1 ml of each fresh strain

overnight culture was pelleted. Enough samples were included to set up

single plating of each strain as negative controls for the conjugations, i.e.

another 1 ml of each P. aeruginosa and E. coli (that was using for the

conjugation) strain was spun.

Each strain was washed twice by resuspending in 1 ml of fresh LB and

pelleted. Then cells were resuspended in a final volume of 100 µl, the

suspensions of each strain were mixed in a tube and 60 µl of this mixture

was spotted onto 2 sterile LB plates (without antibiotics), additional plates

were plated for conjugation were spots to scale this up if necessary. The

conjugation was allowed to proceed for at least 1 hour at 30°C (up to 3

hours). Afterward, the cells were recovered from plate by scraping up the

pellet with a sterile stick and resuspended in a small volume of LB in a 1.5

ml microfuge tube. The cells were vortexed to break up clumps. The

aliquots (10, 20 and 40 µl) of the conjugation mixture were plated to test for

appropriate yield of colonies onto selective LB agar plates (Gentamicin to

select for Mariner; include nalidixic acid to select against E. coli. The

plating was spreaded evenly over entire plate with a sterile glass spreader;

the conjugation plate was stored at 4°C until results of initial plating are

evaluated.

Gentamicin was used to select against P. aeruginosa 25 µg/ml (2.5X),

Nalidixic Acid was used to select against the E. coli strain 20 µg/ml (1X).

The plates were incubated at 37°C overnight, then additional time at room

temperature.

2.2.21.2. Storing/screening the library

The library plates (96-well dishes) were filled with sterile LB plus

antibiotic (Gm), 100 µl per well was added for each well except control

wells for (576 and 214) comparison control wells (e.g. A1, A2) were filled

with LB alone. Colonies were picked into wells using sterile toothpicks, with

taking care to maintain a consistent inoculums, the control strains were pick

into appropriate wells, the plates were allowed to grow at 37°C 12-18 hours.

When substantial uniform growth has been achieved, plates can be screened

right away or stored for later screening.

2.2.21.3. Screening for biofilm deficient

Frog (multipronged device) was used to transfer samples from 96-

well sterile plate into wells of 96-well biofilm plate filled with appropriate

media and incubate for desired time at 37ºC.

2.2.21.4. To store the library

100 µl of sterile 20% glycerol was added to the library (to give final of

10%) to all of the wells, and mixed carefully. Thereafter, the plates were

frozen at -80°C with 2 layers of protection (e.g. parafilm or aluminum foil,

Ziploc bag).

2.2.21.5. Mapping Mariner transposons by Arbitrary PCR (ARB PCR)

Mapping of Mariner transposon was done according to Caetano-

Anolles, (1993) and O’Toole and Kolter (1998), when mutants strains were

isolated and confirmed, the arbitrary PCR was used to identify the insertion

point of the transposon in gene.

In arbitrary PCR there are 2 rounds. Before round1, 5 µl of the

genomic template was extracted by the Gentra kit (2.1.4) and then was

digested with 5 µl of EcoR1 enzyme for overnight at 37ºC. Then use 5µl of

that as template for round 1, the mastermix reaction and ARB PCR program

condition for round 1 are summarized in table 2-14 and table 2-15,

respectively.

Table 2-14: The mastermix reaction for ARB PCR round 1

Table 2-15: PCR1 program for round 1 – The annealing temperature was very low.

*-1 °C for each cycle

The PCR product was cleaned up using Qiagen kit and eluted with 50

µl distilled water.

In regard to round 2, the mastermix reaction and ARB PCR program

conditions are summarized in table 2-16 and table 2-17, respectively.

Reagent Volume P235 (1µg/µl) 1µl P236 (1µg/µl) 1 µl P237 (1µg/µl) 1 µl P238 (1µg/µl) 1 µl Taq Buf. 10X 5 µl dNTP mix (10mM each) 2 µl MgCl2 (50mM) 0.5 µl DMSO 2.5 µl H2O 30 µl Taq DNA polymerase (U/ 50 µl) 1 µl Digested gDNA 5 µl Total Volume 50µl

Stage Temperature (time) Temperature (time) Initial denaturation 94°C (2min) 94°C (2min)

Denaturation 94°C (30sec) 5 cycles

94°C (30sec) 25 cycles Annealing 42°C (30sec)* 65°C (30sec)

Extension 72°C (3min) 72°C (3min) Hold None 4°C (∞) 1cycle

Table 2-16: The mastermix reaction for ARB PCR round 2

Table 2-17: PCR1 program for round 2 –Annealing Temperature was

increased

An agarose gel was run to check the PCR. Several bands were seen,

PCR product sample was purified using the Qiagen kit and eluted in 40µl

distilled water.

The primer P241 was used for sequencing. PCR products were

sequenced at the Molecular Biology and Proteomics Core at Dartmouth

Reagent Volume P239 (1µg/µl) 1 µl P240 (1µg/µl) 1 µl Taq Buf. 10X 5 µl dNTP mix (10mM each) 2 µl MgCl2 (50mM) 1 µl DMSO 2.5 µl H2O 35.5 µl TaqDNA polymerase (U/ 50 µl) 1 µl PCR 1produt 1 µl Total Vol. 50µl

Stage Temperature (time) Initial denaturation 94°C (2min)

Denaturation 94°C (30sec) 30 cycles Annealing 57°C (30sec)

Extension 72°C (3min) Final extension 72°C (5min)

Hold 4°C(∞)

College. The resulting DNA sequences were aligned to genomic sequence

using the NCBI BLAST program, the primers was used in ARB PCR are

listed in Table (2-7)

2.2.22. Construction of mutant strains and plasmids

PMQ70 was purified from E. coli and digest 20 µl with 4 µl of enzyme

Sac1 for overnight in 37 ºC. Then use 5 µl of was used as template. PMQ70

vector was used for complementation of PilY1 mutant (shanks et al, 2006),

pPilY1 complementation construct was generated by PCR amplification of

pilY1 gene using the high-fidelity Phusion DNA polymerase. The reaction

conditions for the amplification pilY1 gene are sumerized in table 2-18.

Table 2-18: The condition reaction for amplification pilY1 gene

The primers that used for the pilY1 amplification are listed in table 2-

18.

2.2.23. Twitching assays

Twitch motility plates consisted of M63 medium supplemented with

MgSO4, 20% glucose and 20% CAA and solidified with 1.5% agar. Twitch

Stage Temperature (time) Initial denaturation 98°C (30min)

Denaturation 98°C (10sec) 30 cycles Annealing 72°C (20sec)

Extension 72°C (2min) Final extension 72°C (10min)

Hold 4°C(∞)

assays were performed as previously reported (Whitchurch, 1990; O’Toole

& Kolter 1998). Briefly, cells were stab inoculated with a toothpick through

a thin (approximately 3 mm) LB agar layer to the bottom of the Petri dish.

After overnight growth at 37ºC, the zone of twitching motility between the

agar and Petri dish interface was visualized by staining with crystal violet.

2.2.24. Swarming motility

Swarm motility plates were comprised of M8 medium supplemented

with MgSO4, 20% glucose, and 20% CAA and solidified with 0.5% agar.

Swarming assays were performed as previously reported (Köhler et al.,

2000). Agar was allowed to cool slightly and then was poured thick plate

approximately 25 ml/ plate; these plates were set at room temperature for

few hours. For testing individual strains, 2 µl of grown overnight cultures

was inoculated onto the surface of the swarm plates and incubated for 16 h

at 37°C. Wild type was included as apositive control.

2.2.25. Estimation of polysaccharide extracts

We quantified Psl production via ELISA with some modifications from

an existing protocol (Honko et al., 2006). Flat-bottom 96-well MaxiSorp

plates (Nunc) were coated in triplicate overnight at 4°C with 100 µl /well.

Plate was washed thrice with PBS plus 0.1% Tween-20 for 3 minutes each

and tapped to mix block plate with 300µL/well of PBS plus 1% Bovine

serum albumin (BSA), 60 min at 4°C.

Primary antibody diluted in PBS plus 0.1% BSA was added for 1-2 hr

at room temp (or 4°C). Thereafter, Horseradish peroxidase (HRP)-conjugate

secondary antibody diluted in PBS plus 0.1% BSA was added. 1:5,000

dilutions from reconstituted stock were made and finally the plate was

incubated for 1 hr at room temp or 4°C. Subsequently, plate was washed and

100 µl/well TMB SureBlue development reagent to half of the plate at a

time was added as well. 100 µl /well 0.2 N H2SO4 was added to terminate

development in the hood. Measurement was achieved at 450 nm.

3.3. Statistical analysis

The data were analyzed by GraphPad Prism software was originally

designed for experimental biologists in medical schools and drug companies,

which was applied for the comparison among different values when the

enumerative data are qualitative using ANOVA One way Analysis

(http://www.graphpad.com). P<0.05 was considered as significant

difference.

chapter three

results and discussion

3. Results and Discussion

3.1. Imipenem susceptibility and carbapenemase detection

Among fifty eight P. aeruginosa strains evaluated with E test, forty

seven (81.03%) strains were susceptible, two (3.4٥%) strains were

intermediate, and nine (15.5۲%) strains were resistant to imipenem.

All these 9 strains were previously isolated from patients with cystic

fibrosis. No carbapenemase activity was found among the intermediate and

resistant strains, as it is confirmed by the Hodge test. A positive strain

develop a ‘cloverleaf shaped’ zone of inhibition due to carbapenemase

production. The strains showed negative results (undistorted zone of

inhibition) as it is depicted in figure 3-1. These results suggested that the

imipenem resistance is due to oprD malfunction rather than carbapenemase.

Carbapenems are not prone to inactivation by extended spectrum ß-

lactamases and penetrate across the outer membrane of P. aeruginosa

through a porin OprD, which allows selective penetration of basic amino

acids, small peptides containing these amino acids, and carbapenems, their

structural analogs. Prolonged treatment of P. aeruginosa-infected patients

with imipenem has often allowed for the emergence of imipenem-resistant

mutants. These resistant strains have either lost OprD or have strongly

reduced OprD levels due to a nfxC type of quinolone-resistant mutation

(mexT) which represses oprD expression and activates the mexEF-oprN

multidrug efflux operon (Yoneyama and Nakae, 1993). Ochs et al. (1999)

reported the possible mechanisms by which resistance to imipenem emerged

in 17 imipenem-resistant P. aeruginosa clinical strains, related to the loss of

OprD was the predominant reason of imipenem resistance, OprD loss was

caused by a chromosomal oprD mutation.

In the present work, five imipenem resistant variants (SMC631C, F, H,

J, K) were originated from SMC631strain that grew as discrete colonies in

the zone of inhibition at 32 µg/ml while performing an MIC assay with an

imipenem E Test strip, upon retesting in a microdilution assay. These

mutants were confirmed to be resistant to imipenem (MIC > 8 µg/l).

Figure 3-1: Modified Hodge test, the negative strain shows an undistorted zone of

inhibition by p. aeruginosa.

3.2. Assessing biofilm formation and imipenem resistance in clinical

strains

To explore the relationship between biofilm formation and imipenem

resistance, these phenotypes were assessed for an imipenem sensitive

clinical strain SMC631, a number of imipenem resistant variants of

SMC631, and several additional P. aeruginosa clinical strains. As shown in

table 3-1, all these variants were tested for their ability to form a biofilm and

compared to the parent SMC631.

Table 3-1: Biofilm and imipenem resistance phenotypes of clinical

strains

Strains Imipenem MIC (µg/ml)a Biofilm (A550 ± SDb)

SMC4973 0.5 0.96 ± 0.0509

SMC576 1 0.84 ± 0. 2305

SMC4972 1 0.77 ± 0.0257

SMC631 1.5 0.19 ± 0.0226

PAO1 4 0.88 ± 0.0134

SMC214 4 0.70 ± 0.1634

SMC4979 4 0.53 ± 0.0626

SMC631C 16 0.12 ± 0.0153

SMC631F 16 0.06 ± 0.0161

SMC631H 16 0.10 ± 0.0188

SMC631J 16 0.11 ± 0.0151

SMC5810 23 0.02 ± 0.0121

SMC631K 24 0.12 ± 0.0344

SMC5811 24 0.01 ± 0.0325

SMC4974 32 0.04 ± 0.0051 aSensitive (≤2 µg/ml), intermediate (4 =µg/ml) or resistant (≥8 µg/ml). bLSD= standard deviation. LSD= 0.13, P= 1.755 *10-18.

Markedly, an inverse relationship (r= -0.83) was found between biofilm

formation and imipenem resistance in P. aeruginosa. The imipenem resistant

strains SMC4974, SMC5810, and SMC5811 showed significantly low (P <

0.01) biofilm formation compared to the imipenem sensitive or intermediate

P. aeruginosa clinical strains SMC576, SMC214, SMC4972, SMC4973, and

SMC4979, which all formed relatively robust biofilms (Table 3-1).

Noticeably, table 3-1 demonstrates nonuniformity in clinical strains

biofilm results. Even though the imipenem sensitive SMC631 has low

biofilm value (0.19 ± 0.0226) in comparison to its spouses of MIC category

≤ 4 µg/ml (SMC576, SMC214, SMC4972, SMC4973, and SMC4979), all its

imipenem resistance variants (SMC631C, SMC631H, SMC631F and

SMC631J) formed low biofilm by comparison to the parent SMC631. These

data confirmed the possibility of an inverse relationship between biofilm

formation and P. aeruginosa imipenem resistance.

3.3. Analysis of Sequencing of oprD gene

Loss of oprD is one of the most important mechanisms of resistance to

imipenem in P. aeruginosa. Multiple studies have evaluated the importance

of oprD mutation in clinical strains of P. aeruginosa resistant to

carbapenems.

Always authors demonstrated a correlation between the levels of

expression of oprD and the degrees of susceptibility to imipenem (Dib et al.,

1995; Ocampo-Sosa et al., 2012; Lee et al., 2012).

The relationship between oprD mutation type and imipenem

susceptibility profiles in imipenem-susceptible ,intermediate, and resistance

clinical strains of P. aeruginosa was investigated. The impact of oprD

mutations in 19 clinical strains, 11 were metallo-ß-lactamase- negative P.

aeruginosa and 8 sensitive for imipenem was analyzed (Table 3-2).

Selection of the strains was based on their imipenem susceptibility

profiles, including organisms with a broad range of susceptibility:

susceptible (MICs ≤ 2 µg/ml), intermediately susceptible (MIC = 4 µg/ml)

or resistance (MICs ≥ 8 µg/ml) to imipenem. The evaluation of the

mutations found in oprD of clinical strains was compared with the analysis

of the oprD of PAO1.

Sequencing of the entire oprD gene regions (Appendix A) permitted

analysis of the mutation in oprD gene in such strains. Most of the strains

presented point mutations consisting of single nucleotide insertion or

nucleotide deletion in positions −167 and −177, respectively (relative to the

ATG start codon). Such mutations were observed in both susceptible and

resistant strains; therefore, it considered the involvement in decreased

imipenem susceptibility not relevant. It is likely there is another passage for

the imipenem or this mutation does not affect the OprD function as a porin.

Wolter et al. (2009) suggested that carbapenems can enter through an

alternative route. These data highlight the complex interactions of resistance

mechanisms in P. aeruginosa and their roles in drug susceptibility.

Patterns of mutations found in oprD (Tables 3-2) were assembled into

three groups: group I showed full length comprising PAO1, SMC 4963,

SMC 4972, SMC 4986 and clinical strains (SMC 631, SMC 631 K, SMC

4974). Witch were included several oprD allelic variants, due to amino acid

substitutions. Group II substitution of a nucleotide in the oprD gene resulted

in a premature termination of translation whereas the last pattern group III

comprises those oprD genes harboring a frameshift mutation due to

nucleotide insertions or deletions. Group II and group III called deficient

types, as their mutations resulted in loss of oprD porin (Ocampo-Sosa et al.,

2012).

Following the usual pattern, most of the oprD full-length type strains

were susceptible strains. Several oprD allelic variants compared to PAO1

oprD were found (Table 3- 2). The most frequent amino acid substitutions

were T103S, K115T, and F170L, found in the parent SMC631 susceptible

strains and the five resistance derivatives of 631 (SMC631C, F, H, J, K) and

SMC4974 resistance strains, oprD variants showing these amino acid

substitutions, were described before in clinical strains of P. aeruginosa (El

Amin et al., 2005; Gutiérrez et al., 2007; Rodríguez-Martínez et al., 2009;

Ocampo-Sosa et al., 2012). Other frequently found amino acid substitutions

are shown in (Table 3-2); some of them were previously described in strains

with different susceptibility profiles to imipenem (El Amin et al., 2005).

The OprD “deficient types” included one strain, SMC631F, showing an

earlier termination of translation due to premature stop codons.

Most strains have frameshift mutations caused by nucleotide insertions

or deletions in the oprD structural gene. The nt 152Gnt 153 mutation in SMC631

H, SMC 631J and SMC631C in variants strains from clinical strain

SMC631.

The remaining mutations (D 43 E, nt 167Gnt 168, nt 177ΔC) were found in

susceptible, intermediately susceptible and resistance (Table 3-2).

The majority of mutations found within this oprD type consisted of

single nucleotide insertions at different positions in the oprD gene. The

insertion of a G at 167 the most frequent mutation, observed in susceptible

and resistance strains and intermediately susceptible. Most of the strains

harboring these mutations remained susceptible to imipenem (Table 3-2).

3.4. Analysis of oprD expression

The relationship between biofilm formation, imipenem resistance, and

oprD expression (Appendix B) was assessed in some imipenem resistant

clinical strains (SMC631C, SMC631F, SMC631J, SMC631H, SMC631K

and SMC 4974). As it is illustrated in table 3-3, all resistant strains showed

low oprD expression and low biofilm values as comparison with the

sensitive strains. Remarkably, the correlation coefficient (r=0.5) appreciates

the possibility of a direct relationship between oprD expression and biofilm

formation.

Table 3-2: Different oprD mutation types found in clinical strains of P.

aeruginosa shown different Imipenem susceptibility.

Name of strain Imipenem MIC (µg/ml)*

mutation(s)

Type of mutation

PAO1 2 None Full-length Wild type SMC 631 1.5 T 103 S, K 115 T, F 170 L

Amino acid substitutions SMC 631 K 24 T103 S, K 115 T, F 170 L

SMC 4974 32 T 103 S, K 115 T, F 170 L

SMC 631 F 16 T103 S, K 115 T, F 170 L, W 417 opa Amino acid substitutions Premature stop codon

SMC 631 H 16 T103 S, K 115 T, nt 152Gnt 153 Amino acid substitutions, Frame shift mutations due to

insertions SMC 631 J 16 T 103 S, K 115 T, nt 152Gnt 53

SMC 631 C 16 T 103 S, K 115 T, nt 152Gnt 153

SMC 5810

23

nt 167Gnt 168 , S 56 K, G 57 V, nt 177ΔC, I 210 V, E 230 K, S 240 T,

N 262 T, A 267 S, A 280 G, K 295 Q , Q 300 E, R 310 G, V 359 L Amino acid substitutions,

Frame shift mutations due to insertions and deletions

SMC 5811 24

D 43 N, nt 167Gnt 168, S 56 K, G 57 V, nt 177ΔC, nt 567ΔC, E 102 Q,

I 210 V, E 230 K, S 240 T, N 262 T, A 267 S, A 280 G, K 295 Q, Q 300 E, R

310 G , V 359 L

SMC 4980 32 nt 167Gnt 168, nt 177ΔC, nt861ΔG Frame shift mutations due to insertions and deletions

SMC 4963 1 None Full-length type SMC 4972 1 None

SMC 4986 1 None SMC 4970 0.5 D 43 E, nt 167Gnt 168, nt 177ΔC

Amino acid substitutions, Frame shift mutations due to

insertions and deletions,

SMC 4973 0.5 D 43 E, nt 167Gnt 168, nt 177ΔC SMC 4966 0.5 D 43 E, nt 167Gnt 168, nt 177ΔC SMC 4964 0.75 D 43 E, nt 167Gnt 168, nt 177ΔC SMC 4979 4 D 43 E, nt 167Gnt 168, nt 177ΔC

* Sensitive (≤ 2 µg/ml), intermediate (4 µg/ml) or resistant (≥ 8 µg/ml) The imipenem sensitive or intermediate P. aeruginosa clinical strains

(SMC576, SMC4972, SMC4973, and SMC4979) formed relatively robust

biofilms; however, the oprD expression in SMC576 and SMC4972 was

high. Such finding is compatible with our theory (there is an inverse

correlation between oprD expression in respect to imipenem resistance and

biofilm formation). Decrease in oprD expression that appeared to be relevant

was also detected in imipenem-susceptible and intermediate susceptible in

two strains SMC4973, SMC4979 respectively, indicated these low

expressions of oprD related to other mechanism. Less commonly there is a

mutation or deletions within mexT convert inactive MexT into an active

form. Somehow mutations occur in mexS located upstream of mexT, lead to

accumulate various metabolites that serve as effector molecules for MexT,

which, in turn or in both cases, the expression of mexEF-oprN occurs at high

level, alongside with a decline in the expression of oprD which is inadequate

to elaborate quantities of OprD in the outer membrane sufficient for normal

cellular function (Fukuda et al., 1995; Köhler et al., 1997).

Wolter et al. (2009) also showed down-regulation in the production of

the carbapenem channel OprD despite carbapenem hypersusceptibility.

These strains had decreased expression of the mexAB–oprM pump involved

with intrinsic antibiotic resistance but overexpressed the mexCD–oprJ and

mexEF–oprN efflux systems normally associated with acquired resistance.

Once again this might means there are other routes for carbapenems

entrance.

It can be concluded that oprD inactivating mutations in clinical strains

of P. aeruginosa are not restricted only to imipenem-resistant strains but are

also found in strains with imipenem MICs ≤ 2 µg/ml during sequence

analysis, and from oprD expression experiment we appreciated may be there

is a link between oprD gene and biofilm formation.

Table 3-3: correlation between oprD expression and biofilm

formation of P. aeruginosa strains.

Imipenem susceptibility Name of strains oprD expression values

± SDb Biofilm values (A550 ±

SD)

Resistance

SMC631 C 0.060 ± 0.034 0.12 ± 0.0153

SMC 631F 0.136 ± 0.007 0.06 ± 0.0161 SMC 631J 0.066 ± 0.003 0.10 ± 0.0188 SMC 631H 0.063 ± 0.028 0.11 ± 0.0151 SMC 631K 0.101 ± 0.033 0.12 ± 0.0344 SMC 4974 0.015 ± 0.004 0.04 ± 0.0051

Sensitive SMC 4972 0.202 ± 0.094 0.77 ± 0.0257

SMC 4973 0.072 ± 0.007 0.96 ± 0.0509 SMC 576 1.231 ± 0.227 0.84 ± 0.2305

Intermediate SMC 4979 0.079 ± 0.014 0.53 ± 0.0626

aSensitive (≤ 2 µg/ml), intermediate (4 µg/ml) or resistant (≥ 8 µg/ml). bSD= standard deviation.

There is little literature available that correlates mechanisms of

planktonic antimicrobial resistance and biofilm production. Dheepa et al.

(2011) indicated the resistance to antibiotics such as ceftazidime, cefepime

and pipercillin in Acinetobacter baumannii was comparatively higher among

biofilm producers than non-biofilm producers. Similarly, Rao et al. (2008)

and Ibrahim et al. (2012) investigated clinical strains of A. baumannii, that

had a significant of biofilm associated with multiple drug resistance. These

data indicate the possibility that there may be an under-appreciated link

between planktonic resistance mechanisms and biofilm formation.

3.5. OprD participates in biofilm formation.

In the present study the critical role of OprD in imipenem resistance

well-established, the defected in the oprD gene that may display an altered

biofilm phenotype using the 96 well microtiter assay. To test this hypothesis,

the ability of an oprD transposon mutant was investigated for biofilm and

compared to the PAO1 strain. Results revealed that oprD mutant showed a

significant reduction in biofilm formation compared to P. aeruginosa PAO1

(Figure 3-2A). The biofilm formation defect of the oprD mutant was

complemented by introducing a wild-type copy of the oprD gene on

plasmid, but the vector control (pMQ72) was not able to rescue this defect

(Figure 3-2A).

To confirm the role of oprD mutant with imipenem resistance, we

performed an E-test assay on the strains described in figure 3-2A. The oprD

transposon mutant and the mutant carrying the vector control (pMQ72)

showed significantly higher resistance to imipenem compared to the parental

P. aeruginosa PAO1 and the oprD mutant complemented with a plasmid

carrying the wild-type copy of this gene (Figure 3-2B).

To evaluate whether these phenotypes might be observed in a clinical

strain as well as the PAO1 laboratory strain, we investigated the biofilm

formation and imipenem resistance phenotypes of a clinical strain of P.

aeruginosa isolated from the sputum of a cystic fibrosis patient. Non-mucoid

strain, designated SMC631, could form a biofilm in the 96 well microtiter

plate and was sensitive to imipenem (Table 3-1).

Figure 3-2: OprD participates in biofilm formation as well as imipenem resistance.

(A) Quantification of biofilm formation for the indicated strains, including P. aeruginosa

PAO1, the oprD::IsphoA/hah transposon mutant and the oprD mutant complemented

with the vector control (pMQ72) or a plasmid carrying a wild-type copy of oprD

(poprD+). In this and all figures, each strain was tested in four wells per experiment.

Error bars represent standard deviations of means from three separate experiments.

Statistical analysis was performed using ANOVA with Tukey’s post-test comparison. ns,

not significantly different; **, P < 0.01, compared to P. aeruginosa PAO1. (B) Imipenem

susceptibility was investigated by Etest strips for the same strains described in panel A.

Error bars represent standard deviations of averages from three independent experiments.

Statistical analysis was performed using ANOVA with Tukey’s post-test comparison. ns,

not significantly different; ***, P<0.001, compared to P. aeruginosa PAO1. (C)

Quantification of biofilm formation for the indicated strains, as described in panel A. The

strains tested are the P. aeruginosa imipenem-sensitive clinical strain SMC631, its

imipenem-resistant derivative SMC631F-ImR (oprD), which carries a premature stop

codon mutation in the oprD gene, SMC631F-ImR carrying the vector control (pMQ72)

and SMC631F-ImR carrying a wild-type copy of oprD (poprD+ ). Error bars represent

520 standard deviations of the averages of three experiments with four replicates per

experiment. Data were analyzed by ANOVA with Tukey’s post-test comparison. ns, not

significantly different; **, P < 0.01, compared to SMC631. (D) Imipenem susceptibility

was investigated by Etest strips for the same strains described in panel C, as outlined for

the studies performed in panel B. Error bars represent standard deviations of averages

from three independent experiments with four wells per experiment. Data were analyzed

by ANOVA with Tukey’s post-test comparison. ***,P<0.001, compared to SMC631.

Several imipenem resistant (ImR) variants of the SMC631 strain were

isolated, sequencing of the oprD gene in one of these resistant strains (631F-

ImR), mutation in the oprD gene of the clinical strain SMC631 reduced

biofilm formation (Table 3-1), and this phenotype could be complemented

by introducing a plasmid carrying the wild-type oprD gene of strain P.

aeruginosa PAO1, but not the corresponding vector control (Figure 3-2C).

Interestingly, the imipenem-resistant variant of SMC631 could not be

complemented for its antibiotic resistance phenotype by introduction of a

plasmid carrying the wild-type oprD gene (Figure 3-2D), indicating either

the possibility of a second mutation in this strain, or alternatively, that

providing the oprD gene in multicopy in this strain cannot rescue imipenem

sensitivity.

Taken together, these data indicate that loss of OprD function in a lab

strain and clinical strain results in a reduction in biofilm formation compared

to the parental strain.

3.6. Genes required for biofilm formation in clinical strains are

conserved

To find out the reciprocal relationship between biofilm formation and

imipenem resistance, and to understand whether there might be a

mechanistic link between these processes beyond the role described for

OprD above, the factors that required for biofilm formation in two clinical

strains were identified. These clinical strains of P. aeruginosa (SMC576 and

SMC214) were isolated from the sputum of CF patients, displayed robust

biofilm formation, were imipenem sensitive (MIC ≤ 2 µg/ml) and

intermediate (MIC = 4 µg/ml), respectively, and could be effectively

mutagenized via Mariner transposon mutagenesis. A number of the other

clinical strains were also tested, but they either did not form reproducible

biofilms in the 96 well plate assay in the large-scale screening conditions (4

strains) or the strains showed high level gentamicin resistance, which is the

selectable marker on the Mariner transposon (3 strains). This study had

focused on strains SMC576 and SMC214.

We screened in approximately 1,500 Mariner transposon mutants in the

SMC576 strain for reduction biofilm formation using the microtiter plate

assay. Accordingly, several biofilm formation-defective strains were

isolated and these mutations were mapped (Appendix C) to seven different

genes, with several of these genes being hit more than once. Mutations

mapped to the pilY1, pilW, algC, pslI, cupA2, pilA and pilO genes, all of

which have documented roles in biofilm formation (Friedman and Kolter,

2004a; Li et al., 2007; Kuchma et al., 2012; Zegans et al., 2012 ). We further

characterized the pilY1, pilW, algC and pslI mutants in the studies below

(Figure 3-3A,B).

As expected based on the previous studies (Kuchma et al., 2012), the

single pilW::Mar19 and five independent pilY::Mar mutants isolated

showed increase swarming motility and loss of twitching motility, in

addition to a significant reduction in biofilm formation compared with the

parental strain, SMC576 (Figure 3-3B,C). Additionally, we identified as

biofilm-defective strain with a mutation in algC, this gene contributes in the

biosynthesis of LPS (Goldberg et al., 1993; Olvera et al., 1999) and alginate,

as well as pslI – both of them required for the synthesis of the Psl

polysaccharide (Davies et al., 1993; Davies & Geesey, 1995; Friedman and

Kolter, 2004b; Zegans et al., 2012).

To confirm a role of the pilY1 gene in biofilm formation by strain

SMC576, we performed complementation studies. Mutating pilY1 gene in

the SMC576 background resulted increase swarming phenotype, which

could be complemented by the introduction of a plasmid carrying a wild-

type copy of the pilY1 gene, but not by the vector control (pMQ70, Figure 3-

3D). Similarly, the twitching (Figure 3-3D) and biofilm formation (Figure

3-3D,E) defect of the pilY1 mutant could be complemented by the

introduction of a plasmid carrying a wild-type copy of the pilY1 gene, but

not by the vector control (pMQ70).

Figure 3-3: Identification of biofilm-deficient mutants in the clinical strain

SMC576. (A) Schematic diagram of the pilY1, pilX and pilW genomic loci of P.

aeruginosa PAO1. (www.pseudomonas.com). The transposon insertion sites are

indicated by inverted triangles above the genes. The dark gray triangles indicate

insertions in strain SMC576 and the light gray triangles indicate insertions in strain

SMC214. The numbers above each inverted triangle indicate the nucleotide after which

the transposon is inserted. (B) Representative swarming (top), twitching (middle) and

biofilm (bottom) phenotypes of SMC576 and selected transposon mutants. (C)

Quantification of crystal violet stained biofilms for the indicated strains. Error bars

represent standard deviations of the averages of four experiments with four replicates per

experiment. Data were analyzed by ANOVA with Tukey’s post-test comparison. ns, not

significantly different; ***, P < 0.001 compared to the WT. (D) Representative swarming

(top), twitching (middle) and biofilm (bottom) assays for SMC576, the pilY1::Mar8

mutant of SMC576 and the pilY1::Mar8 mutant carrying either the vector alone (pMQ70)

or the vector encoding a wild-type, His-tagged variant of PilY1 (ppilY1), as indicated at

the bottom of panel E. (E) Quantification of crystal violet-stained biofilms for the

indicated strains, as described in detail . Error bars represent standard deviations of the

averages of four independent experiments with four replicates per experiment. Data were

analyzed by ANOVA with Tukey’s post-test comparison. ns, not significantly different;

***, P < 0.001 compared to the SMC576.

All previous reports showed product of the algC gene is involved in

LPS synthesis, rhamnolipid and alginate production (Goldberg et al., 1993;

Olvera et al., 1999). EPS matrix may play an important role in establishing a

sustainable biofilm. It was postulated that the expression of alginate genes

critical to biofilm formation by P. aeruginosa because expression of algC is

high in the mucoid strain (Davies et al., 1993; Davies & Geesey, 1995). Also

LPS has been demonstrated to affect attachment of bacteria to a surface

(Razatos et al., 1998).

Furthermore, rhamnolipids involved in swarming motility, swarming

occurs when cells move across a hydrated, viscous semisolid surface

(Toutain et al., 2004). According to result, inactivation of the algC gene

could reflect inactivation of many pathways.

Moreover, as expected based on a recent report (Zegans et al., 2012),

the algC mutant shows a reduced production of Psl polysaccharide as judged

of ELISA after using an antibody specific for this polysaccharide (Figure 3-

4). The strain carrying a mutation in pslI shows no obvious swarming or

twitching defect (Figure 3-3B,C).

Figure 3-4: Quantification of Psl production by ELISA for the indicated strains. The

A450 value, a relative measure of Psl production as described in the materials and

methods, is plotted on the Y-axis, and the strains tested are indicated on the x axis.

Clinical strain SMC576 and three transposon mutants are shown. P. aeruginosa PAO1

(PAO1) serves as a Psl-producing positive control, and P. aeruginosa PA14 (PA14)

serves as a control for a strain lacking Psl. Data were analyzed by ANOVA with Tukey’s

post-test comparison. ns, not significantly different; ***, P < 0.001 compared to the

SMC576.

We were able to quantify Psl production by pslI::Mar and algC::Mar

mutants using an ELISA assay, in which Psl-specific antiserum was used to

detect Psl in polysaccharide production on Nunc MaxiSorp plates. The

mutant’s measurement compared with 576 and PAO1 as positive control and

PA14 as negative control and pilY:Mar8 to check whether is there a role of

pilY1gene in Psl production (Figure 3-4).

Similar to quantification of biofilm formation the ELISA revealed that

pslI genes and algC gene are essential for Psl production. Mapped of

Mutants pslI::Mar and algC::Mar showed the differences in Psl produced

by these two pslI::Mar and algC::Mar mutants and showed highly deficient

biofilm.

The pslI production in mutants were highly significant un compared

with 576, PAO1.This provides genetic evidence indicate the pslI and algC

genes are required for Psl synthesis and biofilm phenotype. Finally, as

expected, the strain carrying a mutation in the pilY1:Mar8 gene showed no

difference in Psl production compared to the parent strain SMC576. That

indicates this gene not participate in Psl polysaccharide production.

To extend our findings of the second clinical strain, we screened

~1,500 Mariner transposon mutants of SMC214, another a mucoid, CF strain

of P. aeruginosa. Similar to SMC576, we identified biofilm-defective

mutants that mapped to the pilX and pilW genes (Figure 3-5). These

mutations, as expected, also rendered the strains unable to twitch (Figure 3-

5).

Thus SMC214 and SMC576 require conserved known genes to play a

role in biofilm formation in laboratory strains.

The clinical strain (214) included the pilW::Mar and pilX::Mar

mutants, shown biofilm deficient, quantification of Biofilm formation

indicates that biofilms formed by the pilX::Mar and pilW::Mar mutants

were significantly different from the biofilm of the 214 parent strain (Figure

3-3D fourth row).

Figure 3-5: Identification of biofilm-deficient mutants in the clinical strain SMC214.

(A) Representative twitching (top) and biofilm (bottom) assay phenotypes of clinical

strain SMC214 and selected transposon mutants. All assays are performed as described in

the materials and methods. The location of the insertion site is indicated in panel B. (B)

Quantification of crystal violet-stained biofilms for the indicated strains. Error bars

represent standard deviations of the averages of four experiments with four replicates per

experiment. ANOVA following Tukey’s post-test comparison. *, P < 0.05; **, P < 0.01,

compared to SMC214.

The pilW::Mar and pilX::Mar mutants exhibit swarming phenotypes

that closely resemble the 214 parent strain, it is (just a small circular zone)

due to the correlation of high poly saccharide of the strain 214 with high c-

di-GMP that suppress of swarming motility (kuchma et al, 2007)

Nevertheless, this polysaccharides remained at high level even after pilW

and pilX mutation (Figure 3-3 D first row), while the pilW::Mar and

pilX::Mar showed strong suppressor of twitching motility (Figure 3-3 D

second row).

3.7. Clinical strains SMC576 and SMC214 with biofilm defective

mutants and sensitive to imipenem.

Based on the finding loss of oprD resulted loss of biofilm formation

and increased resistance to imipenem. We hypothesized that there a general

link between loss of biofilm formation and increased resistance to this

antibiotic might be there. Therefore, we used the E-test method to determine

imipenem resistance profiles for the biofilm-defective mutants isolated in

both the SMC576 and SMC214 strains. In all cases, none of biofilm-

deficient mutants isolated showed imipenem resistance (MIC≥4µg/ml),

suggesting that there is no general link between loss of biofilm formation

and increase resistance to Imipenem.

Here we show that OprD. Plays a major role in acquired resistance to

imipenem also participates in biofilm formation. Loss of OprD function

blocks entry of imipenem into the cell and resulted in resistance to this drug

(Wolter et al., 2004). It appears that one trade-off for acquiring resistance to

this antibiotic via loss of OprD may be a compromised ability to form a

biofilm, at least on one model abiotic substratum.

In the current study, we utilized an oprD transposon mutant of P.

aeruginosa PAO1 and a clinical strain (SMC631) with a mutation premature

stop mutation in oprD, to establish this link between increased imipenem

resistance and loss of biofilm formation. This finding prompted us to look

more broadly at the relationship between imipenem resistance/sensitivity and

biofilm formation. Thus, we examined both in vitro-selected imipenem

resistant variants of the sensitive clinical strain SMC631, as well as additional

clinical strains of P. aeruginosa isolated from CF patients. As shown in

Table 3-2, the trend of low biofilm formation correlating with high imipenem

resistance appeared to be maintained (and vice versa), raising the question of

whether loss of biofilm formation in general might confer imipenem

resistance.

To test this idea, we selected two imipenem sensitive clinical strains

which formed robust biofilms (SMC576 and SMC214). Mariner mutagenesis

was used to identified multiple biofilm-deficient strains. Moreover,

combination of complementation studies, phenotypic tests and biochemical

were used to confirm the apparent defects in these strains (Figures 3-2 to 3-4).

Biofilm-deficient strains with mutations in genes known were isolated to

study biofilm formation based on studies of the P. aeruginosa PAO1 and

PA14 lab strains, including mutations in factors required for pili biogenesis

and function (pilA, pilO, pilY1, pilW, pilX) (Alm et al., 1996; Alm et al.,

1996; Bohn et al., 2009; Giltner et al., 2010; Kuchma et al.,2012; ) and

exopolysaccharide production (pslI, algC) (Friedman and Kolter, 2004;

Davies et al., 1993; Davies & Geesey, 1995; Zegans et al., 2012). While,

these findings may not be surprised. But they are useful as they extend

findings from laboratory strains to clinically relevant strains. Importantly,

none of the biofilm-deficient mutants showed imipenem resistance (MIC ≥16

µg/ml), thus arguing against a general link between these two phenotypes.

conclusions and

recommendations

Conclusion

1. OprD plays a major role in acquired resistance to imipenem also participates in biofilm formation. Loss of OprD function, which blocks entry of imipenem into the cell and that ultimately, creates resistance to this drug. It appears that one trade-off for acquiring resistance to this antibiotic via loss of OprD may be a compromised ability to form a biofilm, at least on one model abiotic substratum.

2. An inverse relationship observed between biofilm formation in P. aeruginosa and imipenem resistance, likely due to the participation of OprD in both of these processes showed by oprD expression.

3. Loss of oprD function in a lab strains and clinical strains results in a reduction in biofilm formation as compared to the parental strain.

4. Both imipenem sensitive clinical strains formed robust biofilm (SMC576 and SMC214). Multiple biofilm deficient strains were identifying by using Mariner mutagenesis. Combination of complementation studies, phenotypic tests and biochemical studies were applied to confirm the apparent defects in these strains.

5. The biofilm-deficient strains with mutations in genes known to be involved in biofilm formation based on studies of the P. aeruginosa PAO1 and PA14 lab strains, including mutations in factors required for pili biogenesis and function (pilA, pilO, pilY1, pilW, pilX) exopolysaccharide production (pslI, algC). While a role for these genes in biofilm formation may not be surprised. But they are useful in clearing their extend findings from laboratory strains to clinically relevant isolates.

6. Importantly, none of the biofilm-deficient mutants showed imipenem resistance (MIC ≥8 µg/ml), thus arguing against a general link between these two phenotypes.

Recommendations

1. Identifying the other mechanisms participate in low expression of oprD and their relationship with biofilm formation.

2. Performing the clean deletion of oprD gene in wild type PAO1; thereafter, assessing the biofilm formation.

3. Detecting the role of other outer membrane protein (Efflux pump) in biofilm formation.

4. Studying the role of oprD gene in the biofilm formation by electron

microscopy and confocal laser scanning. 5. Assessing the role of oprD gene in the motility of P. aeruginosa.

6. Screening the role of oprD and pilY1in ecological isolates.

7. Signifying the complete role of pilX and pilW gene in high biofilm

formation in clinical isolate

Appendix A

Agarose gel electrophoresis of amplified oprD gene of P. aeruginosa.

Appendix B

The expression of oprD gene of P. aeruginosa isolates

Name R1 R2 R3 Average Sdev

631 C 0.023247 0.090408 0.06682 0.060158 0.034073

631F 0.140358 0.140728 0.128333 0.136473 0.007052

631H 0.068792 0.061939 0.068712 0.066481 0.003934

631J 0.096998 0.047719 0.04612 0.063612 0.028924

631K 0.069529 0.136932 0.099053 0.101838 0.033788

4974 0.020989 0.013981 0.012189 0.01572 0.00465

4972 0.311376 0.14058 0.155613 0.202523 0.094569

4973 0.080846 0.065342 0.070353 0.072181 0.007912

4979 0.092996 0.064274 0.082453 0.079908 0.014529

576 1.328168 1.394309 0.97086 9.897779 0.227799

Appendix C Agarose gel electrophoresis of un known genes of P.

aeruginosa by Arbitrary PCR Run 1.

Agarose gel electrophoresis of un known genes of P. aeruginosa by Arbitrary PCR Run 2

references

· Aas, F. E., Wolfgang, M., Frye, S., Dunham, S., Lovold, C. and Koomey,

M. (2002). Competence for natural transformation in Neisseria gonorrhoeae: components of DNA binding and uptake linked to type IV pilus expression. Mol. Microbiol. 46:749-760.

· Aldridge, P., Paul, R., Goymer, P., Rainey, P. and Jenal, U. (2003). Role of the GGDEF regulator PleD in polar development of Caulobacter crescentus. Mol. Microbiol. 47:1695– 708

· Allesen-Holm, M., Barken, K. B., Yang, L., Klausen, M., Webb, J. S., Kjelleberg, S., Molin, S., Givskov, M. and Tolker-Nielsen, T. (2006). A characterization of DNA release in Pseudomonas aeruginosa cultures and biofilms. Mol. Microbiol. 59:1114-1128.

· Alm, R. A., Hallinan, J. P., Watson, A. A. and Mattick, J. S. (1996). Fimbrial biogenesis genes of Pseudomonas aeruginosa: pilW and pilX increase the similarity of type 4 fimbriae to the GSP protein-secretion systems and pilY1 encodes a gonococcal PilC homologue. Mol. Microbiol. 22:161–173.

· Alm, R. A., Mattick, J. S. (1996). Identification of two genes with prepilin-like leader sequences involved in type 4 fimbrial biogenesis in Pseudomonas aeruginosa. J. Bacteriol. 178:3809 –3817.

· Anderson, K., Lonsway, D. R., Rasheed, J. K., Biddle, J., Jensen, B., McDougal, L. K., Carey, R. B. , Thompson , A. , Stocker, S. , Limbago, B. and Patel , J. B. (2007). Evaluation of Methods to Identify the Klebsiella pneumoniae Carbapenemase in Enterobacteriaceae. J. Clin. Microbiol.45:2723.

· Bals, R., Weiner, D. J. and Wilson, J. M. (1999). The innate immune system in cystic fibrosis lung disease. J. Clin. Invest. 103: 303–7

· Barken, K. B., Pamp, S. J., Yang, L., Gjermansen, M., Bertrand, J. J., Klausen, M., Givskov, M., Whitchurch, C. B., Engel, J. N. and Tolker- Nielsen, T. (2008). Roles of type IV pili, flagellum-mediated motility and extracellular DNA in the formation of mature multicellular structures in Pseudomonas aeruginosa biofilms. Environ. Microbiol. 10:2331-2343.

· Barken, K.B., Pamp, S.J., Yang, L., Gjermansen, M., Bertrand, J.J., Klausen, M., Givskov, M., Whitchurch, C.B., Engel, J.N. and Tolker-

Nielsen, T. (2008). Roles of type IV pili, flagellum-mediated motility and extracellular DNA in the formation of mature multicellular structures in Pseudomonas aeruginosa biofilms. Environ. Microbiol. 10:2331-2343.

· Barraud, N., Hassett, D. J., Hwang, S., Rice, R. A., Kjelleberg, S. and Webb, J. S. (2006). Involvement of nitric oxide in biofilm dispersal of Pseudomonas aeruginosa. J. Bacteriol. 188(21): 7344 - 7353.

· Bodey, G. P., Bolivar, R., Fainstein V. and Ladeja L. (1983). Infections caused by Pseudomonas aeruginosa. Rev. Infect. Dis. 5:279–313.

· Bohn, Y. S., Brandes, G., Rakhimova, E., Horatzek, S., Salunkhe, P., Munder, A., van Barneveld, A., Jordan, D., Bredenbruch, F., Haussler, S., Riedel, K., Eberl, L., Jensen, P. O., Bjarnsholt, T., Moser, C., Hoiby, N., Tummler, B. and Wiehlmann, L. (2009). Multiple roles of Pseudomonas aeruginosa TBCF10839 PilY1 in motility, transport and infection. Mol Microbiol. 71: 730- 747. doi: 10.1111/j.1365-2958.2008.06559.x 50.

· Bradley, D. E. (1972). Shortening of Pseudomonas aeruginosa pili after RNAphageadsorption. J. Gen. Microbiol. 72: 303–19.

· British Pharmacopoeia (BP). (2012). Medicin and Healthcare products Regulatory Agency (MHRA). London SW1W 9SZ.

· Burke, D., Dawson, D., and Stearns, T. (2000). Methods in Yeast Genetics. A Cold Spring Harbor laboratory course manual. In, ed., Cold Spring Harbor laboratory Press, New York.

· Caetano-Anolles, G. (1993). Amplifying DNA with arbitrary oligonucleotide primers. PCR Methods Appl. 3:85–92.

· Caiazza, N. C. and O’Toole, G. A. (2004). SadB is required for the transition from reversible to irreversible attachment during biofilm formation by Pseudomonas aeruginosa PA14. J. Bacteriol. 186:4476–4485.

· Caiazza, N. C., Merritt, J. H., Brothers, K. M. and O’Toole, G. A. (2007). Inverse regulation of biofilm formation and swarming motility by Pseudomonas aeruginosa PA14. J. Bacteriol. 189:3603–3612.

· Caiazza, N. C., Shanks, R. M. and O'Toole, G. A. (2005). Rhamnolipids modulate swarming patterns of Pseudomonas aeruginosa. J. Bacteriol. 187:7351–7361.

· Chace, K. V., Flux, M. and Sachdev, G. P. (1985) Comparison of physicochemical properties of purified mucus glycoproteins isolated from

respiratory secretions of cystic fibrosis and asthmatic patients. Biochem. 24: 7334–41

· CLSI (2013) Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Third Informational Supplement. CLSI document M100-S23. Clinical and Laboratory Standards Institute, Wayne, PA

· Colvin, K. M., Irie, Y., Tart, C. S., Urbano, R., Whitney, J. C., Ryder, C., Howell, P. L., Wozniak, D. J., Parsek, M. R. (2012). The Pel and Psl polysaccharides provide Pseudomonas aeruginosa structural redundancy within the biofilm matrix. Environ. Microbiol. 14(8):1913-28.

· Copeland, M. F., Flickinger, S. T., Tuson, H. H. and Weibel, D. B. (2010). Studying the dynamics of flagella in multicellular communities of Escherichia coli by using biarsenical dyes. Appl. Environ. Microbiol. 76:1241–1250.

· Costerton, J. W., Lewandowski, Z., Caldwell, D. E., Korber, D. R. and Lappin-Scott, H. M. (1995). Microbial biofilms. Annual Review of Microbiology; 49:711 - 45.

· Davies, D. G., Chakrabarty, A. M. and Geesey, G. G. (1993). Exopolysaccharide production in biofilms: substratum activation of alginate gene expression by Pseudomonas aeruginosa. Appl. Environ. Microbiol. 59:1181–1186.

· Davies, D. G., Geesey and G. G. (1995). Regulation of the alginate biosynthesis gene algC in Pseudomonas aeruginosa during biofilm development in continuous culture. Appl. Environ. Microbiol. 61: 860–867.

· Davies, D. J., Parsek, M. R., Pearson, J. P., Iglewski, B. H., Costerton, J. W. and Greenberg, E. P. (1998). The involvement of cell to cell signals in the development of a bacterial biofilm. Science 280:295–298.

· Davies, T. A., Marie Queenan, A., Morrow, B. J., Shang, W., Amsler K, He W., Lynch, A. S., Pillar, C. and Flamm, R. K. (2011). Longitudinal survey of carbapenem resistance and resistance mechanisms in Enterobacteriaceae and non-fermenters from the USA in 2007–09. J Antimicrob. Chemother. 66:2298–307.

· de Freitas, A. L. P. and Barth, A. L.(2002). Antibiotic resistance and molecular typing of Pseudomonas aeruginosa: Focus on Imipenem. J. Braz. Chem. Soc.6(1):1-7.

· Dheepa, M., Rashme, V. L. and Appalaraju, B. (2011). Comparision of biofilm production and multiple drug resistance in clinical isolates of Acinetobacter baumanii from a tertiary care hospital in South India. Int J Pharm Biomed Sci. 2: 103-107.

· Dib, C., Trias, D. C. and Jarlier, V. (1995). Lack of additive effect between mechanisms of resistance to carbapenems and other beta-lactam agents in Pseudomonas aeruginosa. Eur. J. Clin. Microbiol. Infect. Dis. 14:979 –986.

· El Amin, N., Giske, C. G., Jalal, S., Keijser, B., Kronvall, G. and Wretlind, B. (2005). Carbapenem resistance mechanisms in Pseudomonas aeruginosa: alterations of porin OprD and efflux proteins do not fully explain resistance patterns observe in clinical isolates. APMIS. 113:187–196.

· Emerson, J., Rosenfeld, M., McNamara, S., Ramsey, B. and Gibson, R. L. (2002). Pseudomonas aeruginosa and other predictors of mortality and morbidity in young children with cystic fibrosis. Pediatr Pulmonol. 34:91-100.

· Evans, J. C., and Segal, H. (2007). A novel insertion sequence, ISPA26, in oprD of Pseudomonas aeruginosa is associated with carbapenem resistance. Antimicrob. Agents Chemother. 51:3776–3777.

· Friedman, L. and Kolter, R. (2004). Two genetic loci produce distinct carbohydrate-rich structural components of the Pseudomonas aerguinosa biofilm matrix. J. Bacteriol. 186:4457-4465.

· Friedman, L. and Kolter, R. (2004). Genes involved in matrix formation of Pseudomonas aeruginosa PA14 biofilms. Mol. Microbiol. 51:675–690.

· Friedman, L. and Kolter, R. (2004). Two genetic loci produce distinct carbohydrate- rich structural components of the Pseudomonas aeruginosa biofilm matrix. J. Bacteriol. 186:4457–4465.

· Fujitani, S., Sun, H.Y., Yu, V.L. and Weingarten, J.A. (2011). Pneumonia due to Pseudomonas aeruginosa. Part I: epidemiology, clinical diagnosis, and source. Chest. 139:909-919.

· Fukuda, H., Hosaka, M., Iyobe, S., Gotoh, N., Nishino, T., Hirai, K. (1995). nfxC-type quinolone resistance in a clinical isolate of Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 39:790–792.

· Galani, I., Rekatsina, P. D., Hatzaki, D., Plachouras, D., Souli, M. and Giamarellou, H. (2008). Evaluation of different laboratory tests for the detection of metallo-ßlactamase production in Enterobacteriaceae. J. Antimicrob. Chemother. 61:548-53.

· Giltner, C. L., Habash, M., Burrows, L. L. (2010). Pseudomonas aeruginosa minor pilins are incorporated into type IV pili. J. Mol. Biol 398: 444-461. doi: 10.1016/j.jmb.2010.03.028.

· Goldberg, J. B., Hatano, K. and Pier, G. B. (1993). Synthesis of lipopolysaccharide O side chains by Pseudomonas aeruginosa PAO1 requires the enzyme phosphomannomutase. J. Bacteriol. 175:1605–1611.

· Goldberg, J. B., Hatano, K. and Pier, G. B. (1993). Synthesis of lipopolysaccharide O side chains by Pseudomonas aeruginosa PAO1 requires the enzyme phosphomannomutase. J. Bacteriol. 175:1605–1611.

· Govan, J. R. and V. Deretic. (1996). Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol. Rev. 60:539–574.

· Gutiérrez, O., Juan, C., Cercenado, E., Navarro, F., Bouza, E., Coll, P., Pérez, J. L. and Oliver, A. (2007). Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa isolates from Spanish hospitals. Antimicrob. Agents Chemother. 51:4329–4335.

· Gutiérrez, O., Juan, C., Cercenado, E., Navarro, F., Bouza, E., Coll, P., Pérez, J. L. and Oliver, A. (2007). Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa isolates from Spanish hospitals. Antimicrob. Agents Chemother. 51:4329–4335.

· Hall, J., Hodgson, G. and Kerr, K.G.(2004). Provision of safe potable water for immunocompromised patients in hospital. J. Hosp. Infect. 58:155-158.

· Harshey, R. M. (1994). Bees aren’t the only ones: swarming in gram-negative bacteria. Mol. Microbiol. 13:389–394.

· Haussler, S., Ziegler, I., Lottel, A., Gotz, F. v., Rohde, M., Wehmhohner, D., Saravanamuthu, S., Tummler, B. and Steinmetz, I. (2003). Highly adherent small-colony variants of Pseudomonas aeruginosa in cystic fibrosis lung infection. J. Med. Microbiol. 52:295-301.

· Hengge, R. (2009). Principles of c-di-GMP signalling in bacteria. Nat. Rev. Microbiol. 7:263–273.

· Hentzer, M., Teitzel, G. M., Balzer, G. J., Heydorn, A., Molin, S., Givskov, M. and Parsek, M. R. (2000). Alginate over-production affects Pseudomonas aeruginosa biofilm structure and function. J. Bacteriol. 183:5395-5401.

· Hentzer, M., Teitzel, G. M., Balzer, G. J., Heydorn, A., Molin, S., Givskov, M., Parsek, M. R. (2001). Alginate over-production affects Pseudomonas aeruginosa biofilm structure and function. J. Bacteriol. 183:5395-5401.

· Hobbs, J. R., Stickel, M., Martin P, and Edwards, D. (1993). Interpretation as Abduction. Artificial Intelligence Center SRI International. 63: 69-142.

· Høiby, N. (2000). Prospects for the prevention and control of pseudomonal infection in children with cystic fibrosis. Paediatr. Drugs. 2:451-63.

· Høiby, N., Bjarnsholt, T., Givskov, M., Molin, S. and Ciofu, O. (2010). Antibiotic resistance of bacterial biofilms. Int. J. Antimicrob gents. 35(4):322-32. doi: 10.1016.

· Honko, A. N., Sriranganathan, N., Lees, C. J. and Mizel, S. B. (2006). Flagellin Is an Effective Adjuvant for Immunization against Lethal Respiratory Challenge with Yersinia pestis. Infect Immun.74:1113–1120.

· Huang, H., Jeanteur, D., Pattus, F. and Hancock R. E. (1995). Membrane topology and site-specific mutagenesis of Pseudomonas aeruginosa porin OprD. Mol. Microbiol. 16:931–941.

· Huang, H., Jeanteur, D., Pattus, F. and Hancock, R. E. (1995). Membrane topology and site-specific mutagenesis of Pseudomonas aeruginosa porin OprD. Mol. Microbiol. 16:931–941.

· Ibrahim, N. H., Somily, A. M., Bassyouni, R. H. and El-Aabedien, A. Z. (2012). Comparative study 484 assessing the effect of Tigecycline and Moxifloxacin in prevention of Acinetobacter baumannii biofilm. Life Sci. 9: 1016-1024.

· Jacobs, M. A, Alwood, A., Thaipisuttikul, I., Spencer, D., Haugen, E., Ernst, S., Will, O., Kaul, R., Raymond, C., Levy, R., Chun-Rong, L., Guenthner, D., Bovee, D., Olson, M. V. and Manoil, C. (2003)

Comprehensive transposon mutant library of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. 100: 14339–14344.

· Jacobs, M. A., Alwood, A., Thaipisuttikul, I., Spencer, D., Haugen, E., Ernst, S., Will, O., Kaul, R., Raymond, C., Levy, R., Chun-Rong, L., Guenthner, D., Bovee, D., Olson, M. V. and Manoil, C. (2003). Comprehensive transposon mutant library of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. U S A 100: 14339-14344.

· Jesaitis, A. J., Franklin, M. J., Berglund, D., Sasaki, M., Lord, C. I., Bleazard, J. B., Duffy, J. E., Beyenal, H. and Lewandowski, Z. (2003). Compromised host defense on Pseudomonas aeruginosa biofilms: characterization of neutrophil and biofilm interactions. J. Immunol. 171:4329-39.

· Jesudason, M. V., Kandathil, A. J. and Balaji, V. (2005). Comparison of two methods to detect carbapenemase and metallo-β-lactamase production in clinical isolates. Indian J. Med. Res.121:780-3.

· Jones, B. V., Young, R., Mahenthiralingam, E. and Stickler, D. J. (2004). Ultrastructure of Proteus mirabilis swarmer cell rafts and role of swarming in catheter-associated urinary tract infection. Infect. Immun. 72:3941–3950.

· Kato, J., Nakamura, T., Kuroda, A. and Ohtake, H. (1999). Cloning and characterization of chemotaxis genes in Pseudomonas aeruginosa. Biosci. Biotechnol. Biochem. 63:155–161.

· Khan, W., Bernier, S. P., Kuchma, S. L., Hammond, J. H., Hasan, F. and O’Toole, G. A. (2010). Aminoglycoside resistance of Pseudomonas aeruginosa biofilms modulated by extracellular polysaccharide. Int. Microbiol. 13:207-212.

· Kirisits, M. J., Prost, L., Starkey, M., Parsek, M. R. (2005). Characterization of colony morphology variants isolated from Pseudomonas aeruginosa biofilms. Appl. Environ. Microbiol. 71:4809-4821.

· Köhler, T., Curty, L. K., Barja, F., Van Delden, C. and Pechère, J. C. (2000). Swarming of Pseudomonas aeruginosa is dependent on cell-to-cell signaling and requires flagella and pili. J. Bacteriol. 182:5990– 5996.

· Köhler, T., Michéa-Hamzehpour, M., Epp, S. F. and Pechère, J. C. (1999). Carbapenem activities against Pseudomonas aeruginosa: respective

contributions of OprD and efflux systems. Antimicrob. Agents Chemother. 43:424–427.

· Köhler, T., Michéa-Hamzehpour, M., Epp, S. F. and Pechère, J. C. (1999). Carbapenem activities against Pseudomonas aeruginosa: respective contributions of OprD and efflux systems. Antimicrob. Agents Chemother. 43:424–427.

· Köhler, T., Michéa-Hamzehpour, M., Henze, U., Gotoh, N., Curty, L. K. Pechère, J. C. (1997). Characterization of MexE-MexF-OprN, a positively regulated multidrug efflux system of Pseudomonas aeruginosa. Mol. Microbiol. 23: 345-354.

· Kuchma, S. L., Ballok, A. E., Merritt, J. H., Hammond, J. H., Lu, W., Rabinowitz, J. D. and O'Toole, G. A. (2010). Cyclic-di-GMP-mediated repression of swarming motility by Pseudomonas aeruginosa: the pilY1 gene and its impact on surface-associated behaviors. J. Bacteriol. 192:2950 –2964

· Kuchma, S. L., Brothers, K. M. and Merritt, J. H., Liberati, N. T., Ausubel, F. M. and O’Toole, G. A. (2007). BifA,a cyclic-Di-GMP phosphodiesterase, inversely regulates biofilm formation and swarming motility by Pseudomonas aeruginosa PA14. J. Bacteriol. 189:8165-8178.

· Kuchma, S. L., Connolly, J. P. & O’Toole, G. A. (2005). A threecomponent regulatory system regulates biofilm maturation and type III secretion in Pseudomonas aeruginosa. J. Bacteriol. 187: 1441–1454.

· Kuchma, S. L., Griffin, E. F. and O'Toole, G. A. (2012). Swarming Motility Participate in the Negative Regulation of Minor Pilins of the Type IV Pilus System. J. Bacteriol. 194: 5388-5403.

· Kuchma, S. L., Griffin, E. F. and O'Toole, G. A. (2012). Swarming Motility Participate in the Negative Regulation of Minor Pilins of the Type IV Pilus System. J. Bacteriol. 194: 5388-5403.

· Kulasekara, H. D., Ventre, I., Kulasekara, B. R., Lazdunski, A., Filloux, A. and Lory, S. (2005). A novel two-component system controls the expression of Pseudomonas aeruginosa fimbrial cup genes. Mol. Microbiol. 55:368–380.

· Lasaro, M. A., Salinger, N., Zhang, J., Wang Y., Zhong, Z., Goulian, M, Zhu, J. (2009). F1C fimbriae play an important role in biofilm formation and intestinal colonization by the Escherichia coli commensal strain Nissle 1917. Appl. Environ. Microbiol. 75(1): 246-251.

· Lee, J. and Soo, K. K. (2012). OprD mutations and inactivation, expression of efflux pumps and AmpC, and metallo-_-lactamases in carbapenem-resistant Pseudomonas aeruginosa isolates from South Korea. Int. J. Antimicrob. Agents. 40:168– 172.

· Lee, K., Chong, Y., Shin, H. B., Kim, Y. A., Yong, D. and Yum, J. H. (2001). Modifi ed Hodge and EDTA - disk synergy tests to screen metallo-β-lactamase-producing strains of Pseudomonas and Acinetobacter species. Clin Microbiol Infect. 7: 88-91

· Li, Y., Hao, G., Galvani, C. D., Meng, Y., De La Fuente, L., Hoch, H. C, and Burr, T. J. (2007). Type I and type IV pili of Xylella fastidiosa affect twitching motility, biofilm formation and cell–cell aggregation. Microbiol. 153: 719–726.

· Li, Z., Kosorok, M. R., Farrell, P. M., Laxova, A., West, S. E, Green, C. G., Collins, J., Rock, M. J. and Splaingard, M. L. (2005). Longitudinal development of mucoid Pseudomonas aeruginosa infection and lung disease progression in children with cystic fibrosis. JAMA. 293:581-8.

· Lim, B., Beyhan, S., Meir, J. and Yildiz, F. H. (2006). Cyclic-diGMP signal transduction systems in Vibrio cholerae: modulation of rugosity and biofilm formation. Mol. Microbiol. 60:331–48.

· Lister, P. D, Wolter, D. J. and Hanson, N. D. (2009). Antibacterial-resistant Pseudomonas aeruginosa: clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clin. Microbiol. Rev. 22:582– 616.

· Livermore, D. M. (1992). Interplay of impermeability and chromosomal β- lactamase activity in imipenem-resistant Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 36:2046-2048.

· Livermore, D. M. and Yang, Y. J. (1987). β-Lactamase lability and inducer power of newer β-lactam antibiotics in relation to their activity against β-lactamase- inducibility mutants of Pseudomonas aeruginosa. J. Infect. Dis. 155:775-782.

· Lizewski, S. E., Schurr, J. R., Jackson, D. W., Frisk, A., Carterson, A. J., and Schurr, M. J. (2004). Identification of AlgR-regulated genes in Pseudomonas aeruginosa by use of microarray analysis. J. Bacteriol. 186:5672–5684.

· Lynch, M. J., Drusano, G. L. and Mobley, H. L. (1987). Emergence of resistance to imipenem in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 31:1892–1896.

· Ma, L., JacksonKD, Landry, R. M., Parsek, M. R. and Wozniak, D. J. (2006). Analysis of Pseudomonas aeruginosa conditional psl variants reveals roles for the psl polysaccharide in adhesion and maintaining biofilm structure postattachment. J. Bacteriol. 188:8213-8221.

· Ma, L., Lu, H., Sprinkle, A., Parsek, M. R., Wozniak, D. J. (2007). Pseudomonas aeruginosa Psl is a galactose- and mannose-rich exopolysaccharide. J. Bacteriol. 189:8353-8356.

· Mah, T. F. and O’Toole, G. A. (2001). Mechanisms of biofilm resistance to antimicrobial agents. Trends. Microbiol. 9:34-39.

· Mai, G. T., Seow, W. K., Pier, G. B., McCormack, J. G. and Thong, Y. H. (1993). Infect. Immun. 61: 559–564.

· Malic, S., Hill, K. E., Hayes, A., Percival, S. L., Thomas, D. W. and Williams, D. W. (2009). Detection and identification of specific bacteria in wound biofilms using peptide nucleic acid fluorescent in situ hybridization (PNA FISH). Microbiol. 155: 2603 – 2611.

· Maltezou, H. C. (2009). Metallo-beta-lactamases in Gram-negative bacteria: introducing the era of pan-resistance?. Int. J. Antimicrob. Agents. 33(5): 1-7.

· Marchiaro, P., Mussi, M. A., Ballerini, V., Pasteran, F., Viale, A. M., Vila A. J. and Limansky A. S. (2005). Sensitive EDTA-based microbiological assays for detection of metallo-β-lactamases in nonfermentative gram-negative bacteria. J. Clin. Microbiol. 43: 5648-52.

· Martinez, E., Marquez, C., Ingold, A., Merlino, J., Djordjevic, S. P., Stokes, H. b. and Chowdhurya, P. R. (2012). Diverse Mobilized Class 1 Integrons Are Common in the Chromosomes of Pathogenic Pseudomonas aeruginosa Clinical Isolates. Antimicrob. Agents Chemother. 56(4):2169-2170.

· Masuda, N., Sakagawa, E., Ohya, S., Gotoh, N., Tsujimoto, H., Nishino, T. (2000). Contribution of the MexX-MexY-OprM Efflux System to Intrinsic Resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 44(9): 2242–2246.

· Matsukawa, M. and Greenberg, E. P. (2004). Putative exopolysaccharide synthesis genes influence Pseudomonas aeruginosa biofilm development. J. Bacteriol. 186:4449-4456.

· Mattick, J. S. (2002). Type IV pili and twitching motility. Annu. Rev. Microbiol. 56:289–314.

· Merritt, J. H., Ha, D., Cowlesb, K. N., Luc, W., Moralesa, D. K., Rabinowitzc, J., Gitaib, Z. and O’Toole, G. A. (2010). Specific control of Pseudomonas aeruginosa surface- associated behaviors by two c-di-GMP diguanylate cyclases. mBio. 1:4 00183-10.

· Merritt, J. H., Brothers, K. M., Kuchma, S. L. and O’Toole, G. A. (2007). SadC reciprocally influences biofilm formation and swarming motility via modulation of exopolysaccharide production and flagellar function. J. Bacteriol. 189:8154-8164.

· Newell, P. D., Monds, R. D. and O’Toole, G. A. (2009). LapD is a bis-(3,5)-cyclic dimeric GMP-binding protein that regulates surface attachment by Pseudomonas fluorescens Pf0-1. Proc. Natl. Acad. Sci. 106:3461–3466

· Nikaido, H. (1994). Prevention of drug access to bacterial targets: permeability barriers and active efflux. Sci. 264:382–388.

· Noyal ,M.J.C., Menezes, G.A., Harish, B.N., Sujatha, S. and Parija, S.C.. (2009). Simple screening tests for detection of carbapenemases in clinical isolates of nonfermentative Gram-negative bacteria. Indian J. Med. Res. 129: 707-712.

· O’Toole, G. A. and Kolter, R. (1998). Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30:295–304.

· O’Toole, G. A., and Kolter, R. (1998). Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30:295–304.

· O’Toole, G., Kaplan, H. B. and Kolter, R. (2000). Biofilm formation as microbial development. Annu. Rev. Microbiol. 54:49–79.

· Obritsch, M.D., Fish, D.N., MacLaren, R. and Jung, R. (2004). National surveillance of antimicrobial resistance in Pseudomonas aeruginosa isolates obtained from Intensive Care Unit Patients from 1993 to 2002. Antimicrob. Agents Chemother. 48: 4606-4610.

· Ocampo-Sosa, A. A., Cabot, G., Rodríguez, C., Roman, E, Tubau, F., Macia M. D., Moya, B., Zamorano, L., Suárez, C, Peña, C. and Domínguez, M. A. (2012). Alterations of OprD in Carbapenem-Intermediate and –Susceptible Strains of Pseudomonas aeruginosa Isolated from Patients with Bacteremia in a Spanish Multicenter Study. Antimicrob. Agents Chemother. 56(4):1703.

· Ochs, M. M., McCusker, M. P., Bains, M. and Hancock, R. E. (1999). Negative regulation of the Pseudomonas aeruginosa outer membrane porin OprD selective for imipenem and basic amino acids. Antimicrob. Agents Chemother. 43:1085–1090.

· Ochsner, U.A. and Reiser, J., Autoinducer-mediated regulation of rhamnolipid biosurfactant synthesis in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. 92:6424–6428.

· Oldenburg, K. R., Vo, K. T., Michaelis, S. and Paddon, C. (1997). Recombination-mediated PCR-directed plasmid construction in vivo in yeast. Nucleic Acids Res. 25(2): 451–452.

· Olvera, C., Goldberg, J. B., Sanchez, R. and Soberon-Chavez, G. (1999). The Pseudomonas aeruginosa algC gene product participates in rhamnolipid biosynthesis. FEMS. Microbiol. Lett. 179:85–90.

· Olvera, C., Goldberg, J. B., Sanchez, R. and Soberon-Chavez, G. (1999). The Pseudomonas aeruginosa algC gene product participates in rhamnolipid biosynthesis. FEMS. Microbiol. Lett. 179:85–90.

· Overhage, J., Schemionek, M., Webb, J. S., and Rehm, B. H. A. (2005). Expression of the psl operon in Pseudomonas aeruginosa PAO1 biofilms: PslA performs an essential function in biofilm formation. Appl. Environ. Microbiol. 71:4407–4413.

· Pamp, S. J., Gjermansen, M. and Tolker-Nielsen, T. (2007). The biofilm matrix—a sticky framework. In Bacterial Biofilm Formation and Adaptation. BioSci. 37-69.

· Parsek, M. R. and Singh, P. K. (2003). Bacterial biofilms: an emerging link to disease pathogenesis. Annu. Rev. Microbiol. 57:677-701.

· Pérez, F. J., Gimeno, C., Navarro, D. and García-de-Lomas, J. (1996). Meropenem permeation through the outer membrane of Pseudomonas aeruginosa can involve pathways other than the OprD porin channel. Chemother. 42: 210–214.

· Picao, R. C., Andrade, S. S., Nicoletti, A. G., Campana, E. H., Moraes, G. C., Mendes, R. E. and Gales, A. C. (2008). Metallo-ß-Lactamase Detection: Comparative Evaluation of Double Disk Synergy versus Combined Disk Tests for IMP-, GIM-, SIM-, SPM-, or VIM Producing Isolates. J. Clin. Microbiol. 46(6):2028-37.

· Poole, K. (2004). Efflux-mediated multiresistance in Gram-negative bacteria. Clin. Microbiol. Infect. 10:12–26.

· Prince, A. S. (2002). Biofilms, antimicrobial resistance, and airway infection. N Engl. J. Med. 347:1110-1.

· Qiu, G., Liu, B., Bu, J. and Chen, C. (2009). Expanding Domain Sentiment Lexicon through Double Propagation. In Proceedings of IJCAI. 1199-1204.

· Qiu, X., Kulasekara, B. R. and Lory, S. (2009). Role of horizontal gene transfer in the evolution of Pseudomonas aeruginosa virulence. Genome. Dyn. 6:126-139.

· Quale, J., Bratu, S., Gupta, J. and Landman, D. (2006). Interplay of efflux system, ampC, and oprD expression in carbapenem resistance of Pseudomonas aeruginosa clinical isolates. Antimicrob. Agents Chemother. 50:1633–41.

· Rao, R. S., Karthika, R. U., Singh, S. P., Shashikala, P., Kanungo, R., Jayachandran, S. and Prashanth, K. (2008). Correlation between biofilm production and multiple drug resistance in imipenem resistant clinical isolates of Acinetobacter baumannii. Indian J. Med. Microbiol. 26: 333-337.

· Razatos, A., Ong, Y.-L., Sharma, M. M., Georgiou, G. (1998). Molecular determinants of bacterial adhesion monitored by atomic force microscopy. Proc. Natl. Acad. Sci. USA. 95: 11059–11064.

· Riera, E., Cabot, G., Mulet, X., Garcia-Castillo, M., Del Campo, R., Juan, C., Canton, R. and Oliver, A. (2011). Pseudomonas aeruginosa carbapenem resistance mechanisms in Spain: impact on the activity of imipenem, meropenem and doripenem. J. Antimicrob. Chemother. 66(9):2022-7.

· Riordan, J. R., Rommens, J. M., Kerem, B., Alon, N., Rozmahel, R., Grzelczak, Z., Zielenski, J., Lok, S., Plavsic, N. and Chou, J.L. (1989). Identification of the cystic fibrosis gene and characterization of complementary DNA. Sci. 245: 1066–73.

· Rodríguez-Martínez, J. M., Poirel, L. and Nordmann, P. (2009). Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 53:4783– 4788.

· Ruiz-Martinez, L., Lopez-Jimenez, L., Fuste, E., Vinuesa, T., Martinez, J. P. and Vinas, M. (2011). Class I integrons in environmental and clinical Pseudomonas aeruginosa. Int. J. Antimicrob. Agents. 38(5):398-402.

· Sambrook and Russell, (2001). Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor Laboratory Press. ISBN 978-0-87969-577-4.

· Sanbongi, Y., Shimizu, A., Suzuki, T., Nagaso, H., Ida, T., Maebashi, K., Gotoh, N. (2009). Classification of OprD sequence and correlation with antimicrobial activity of carbapenem agents in Pseudomonas aeruginosa clinical isolates collected in Japan. Microbiol. Immunol. 53:361–367.

· Sanchez-Romero, I., Cercenado, E., Cuevas, O., Garcia-Escribano, N., Garcia-Martinez, J. and Bouza, E. (2007). Evolution of the antimicrobial resistance of Pseudomonas aeruginosa in Spain: Second National Study (2003). Rev. Esp. Quimioter. 20:222-229.

· Sarkisova, S., Patrauchan, M. A., Berglund, D., Nivens, D. E. and Franklin, M. J. (2005). Calcium-induced virulence factors associated with the extracellular matrix of mucoid Pseudomonas aeruginosa biofilms. J. Bacteriol. 187:4327-4337.

· Sauer, K., Camper, A. K., Ehrlich, G. D., Costerton, J. W. and Davies, D. G. (2002). Pseudomonas aeruginosa displays multiple phenotypes during development as a biofilm. J. of Bacteriol. 184(4): 1140 - 1154.

· Sauer, K., Rickard, A. H. and Davies, D. G. (2007). Biofilms and biocomplexity. Microbe. 2(7): 347-353.

· Schlag, S., Nerz, C., Birkenstock, T.A., Altenberend F. and Götz F. (2007). Inhibition of Staphylococcal biofilm formation by nitrite. J. Bacteriol. 189(21): 7911-7919.

· Shanks, R. M., Caiazza, N. C., Hinsa, S. M., Toutain, C. M. and O’Toole, G. A. (2006). Saccharomyces cerevisiae-based molecular tool kit for manipulation of genes from gram-negative bacteria. Appl. Environ. Microbiol. 72:5027– 5036.

· Shanks, R. M., Caiazza, N. C., Hinsa, S. M., Toutain, C. M. and O'Toole, G. A. (2006). Saccharomyces cerevisiae-based molecular tool kit for manipulation of genes from gram-negative bacteria. App. Environ. Microbial. 72: 5027-5036.

· Simon, R., Priefer, U. and Pühler, A. (1983). A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Nat. Biotechnol. 1:784 –791.

· Singh, P. K., Schaefer, A. L., Parsek, M. R., Moninger, T. O., Welsh, M. J. and Greenberg, E. P. (2000). Quorum-sensing signals indicate that cystic fibrosis lungs are infected with bacterial biofilms. Nature 407, 762–764.

· Skerker, J. M., Berg, H. C. (2001). Direct observation of extension and retraction of type IV pili. Proc. Natl. Acad. Sci. 98:6901–4.

· Smith, E. E., Buckley, D. G., Wu, Z., Saenphimmachak, C., Hoffman, L. R., D’Argenio, D. A., Miller, S. I., Ramsey, B. W, Speert, D. P., Moskowitz, S. M., Burns, J. L., Kaul, R. and Olson M. V. (2006). Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proc. Natl. Acad. Sci. 103:8487-8492.

· Stapper, A. P., Narasimhan, G., Ohman, D. E., Barakat, J., Hentzer, M., Molin, S., Kharazmi, A., Høiby, N. and Mathee, K. (2004). Alginate production affects Pseudomonas aeruginosa biofilm development and architecture, but is not essential for biofilm formation. J. Med. Microbiol. 53:679-690.

· Stoodley, P., Purevdorj-Gage, B. and Costerton, J. W. (2005). Clinical significance of seeding dispersal in biofilms: a response. Microbiol. 151(11): 3453.

· Tolker-Nielsen, T., Brinch, U. C., Ragas, P. C., Andersen, J. B., Jacobsen, C. S. and Molin, S. (2000). Development and Dynamics of Pseudomonas sp. Biofilms. J. Bacteriol. 182(22): 6482 - 6489.

· Toutain, C. M., Zegans, M. E. and O'Toole, G. A. (2005). Evidence for two flagellar stators and their role in the motility of Pseudomonas aeruginosa. J. Bacteriol.187:771–777.

· Trautmann, M., Halder, S., Hoegel, J., Royer, H. and Haller, M.(2008). Point-of-use filtration reduces endemic Pseudomonas aeruginosa infections on a surgical intensive care unit. Am. J. Inf. Cont. 36:421-429.

· Tremblay, J., Richardson, A.P., Lepine, F. and Déziel, E. (2007). Self-produced extracellular stimuli modulate the Pseudomonas aeruginosa swarming motility behavior. Environ. Microbiol. 9:2622–2630.

· Trias, J. and Nikaido, H. (1990). Outer membrane protein D2 catalyzes facilitated diffusion of carbapenems and penems through the outer membrane of Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 34:52–57.

· Trias, J. and Nikaido, H. (1990). Protein D2 channel of the Pseudomonas aeruginosa outer membrane has a binding site for basic amino acids and peptides. J. Biol. Chem. 265: 15680–15684.

· Van Schaik, E. J., Giltner, C. L., Audette, G. F., Keizer, D. W., Bautista, D. L., Slupsky, C. M., Sykes, B. D. and Irvin, R. T. (2005). DNA binding: a novel function of Pseudomonas aeruginosa type IV pili. J. Bacteriol. 187:1455-1464.

· Vandepitte, J. Verhaegen, J. Engbaek, K. Rohner, P. Piot, P. Heuck, C. C. Second edition (2003). Basic laboratory procedures in clinical bacteriology World Health Organization Geneva.

· Vandepitte, J., Verhaegen, J., Engbaek, K. Rohner, P. Piot, P. and Heuck, C. C. Second edition (2003). Basic laboratory procedures in clinical bacteriology World Health Organization Geneva.

· Vasseur, P., Vallet-Gely, I., Soscia, C., Genin, S., Filloux, A. (2005). The pel genes of the Pseudomonas aeruginosa PAK strain are involved at early and late stages of biofilm formation. Microbiol. 151:985-997.

· Walsh, T. R., Bolmstrom, A., Qwarnstrom, A. and Gales, A. (2002). Evaluation of a new Etest for detecting metallo-β-lactamases in routine clinical testing. J. Clin. Microbiol. 40: 2755-9.

· Walsh, T. R., Toleman, M. A., Poirel, L. and Nordmann, P. (2005). Metallo-β-lactamases, the quiet before the storm?. Clin Microbiol Rev. 18:306-25.

· Watnick, P. I. and Kolter, R. (1999). Steps in the development of a Vibrio cholerae El Tor biofilm. Mol.Microbiol. 34(3): 586 - 595.

· Welsh, M. J. and Smith, A. E. (1993). Molecular mechanisms of CFTR chloride channel dysfunction in cystic fibrosis. Cell. 73: 71251-1254.

· Whitchurch, C. B., Engel, J. N. and Tolker- Nielsen, T. (2008). Roles of type IV pili, flagellum-mediated motility and extracellular DNA in the

formation of mature multicellular structures in Pseudomonas aeruginosa biofilms. Environ. Microbiol.10:2331-2343.

· Whitchurch, C. B., Hobbs, M., Livingston, S. P., Krishnapillai, V. and Mattick, J.S. (1990). Characterization of a Pseudomonas aeruginosa twitching motility gene and evidence for a specialized protein export system widespread in eubacteria. Gene. 101: 33-44.

· Wiegand, I., Hilpert, K. and Hancock, R. E. (2008). Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nature protocol. 3:163-175.

· Wiegand, I., Hilpert, K., Hancock, R.E. (2008). Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc. 3: 163-175. doi: 10.1038/nprot.2007.521.

· Wolter, D. J., Acquazzino, D., Goering, R. V., Sammut, P., Khalaf, N. and Hanson, N. D. (2008). Emergence of carbapenem resistance in Pseudomonas aeruginosa isolates from a patient with cystic fibrosis in the absence of carbapenem therapy. Clin. Infect. Dis. 46:137–141.

· Wolter, D. J., Hanson, N. D. and Lister, P. D. (2004). Insertional inactivation of oprD in clinical isolates of Pseudomonas aeruginosa leading to carbapenem resistance. FEMS. Microbiol. Lett. 236:137–143.

· Wolter, D. J., Khalaf, N., Robledo, I. E., Vazquez,G. J., Sante, M. I., Aquino , E. E., Goering, R. V. and Hanson, N. D. (2009). Surveillance of carbapenem- resistant Pseudomonas aeruginosa isolates from Puerto Rican medical center hospitals: dissemination of KPC and IMP-18 beta-lactamases. Antimicrob. Agents Chemother. 53:1660–1664.

· Worlitzsch, D., Tarran, R., Ulrich, M., Schwab, U., Cekici, A., Meyer, K., Birrer, P., Bellon, G., Berger,J., and Weiss, T. (2000). Effectsof reducedmucus oxygen concentration in airway Pseudomonas infections of cystic fibrosis patients. J. Clin. Invest. 109:317-325.

· Wozniak, D. J., Wyckoff, T. J. O., Starkey, M., Keyser, R., Azadi, P. O’Toole, G. A. and Parsek, M. R. (2003). Alginate is not a significant component of the extracellular polysaccharide matrix of PA14 and PAO1 Pseudomonas aeruginosa biofilms. Proc. Natl. Acad. Sci. 100:7907-7912.

· Yang, L., Barken, K. B., Skindersoe, M. E., Christensen, A. B., Givskov, M. and Tolker-Nielsen, T. (2007). Effects of iron on DNA release and

biofilm development by Pseudomonas aeruginosa. Microbiol. 153:1318-1328.

· Yoneyama, H. and Nakae, T. (1993). Mechanism of efficient elimination of protein D2 in outer membrane of imipenem-resistant Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 37:2385–2390.

· Zavascki, A. P., Gaspareto, P. B., Martins, A. F., Gonçalves, A. L. and Barth A. L. (2005). Outbreak of carbapenem-resistant Pseudomonas aeruginosa producing SPM-1 metallo-B-lactamase in a teaching hospital in southern Brazil. J. Antimicrob. Chemother. 56:1148–1151.

· Zegans, M. E., Wozniak, D., Griffin. E., Toutain-Kidd, C. M., Hammond, J. H., Garfoot, A. and Lamd, J. S. (2012). Pseudomonas aeruginosa Exopolysaccharide Psl Promotes Resistance to the Biofilm Inhibitor Polysorbate 80. Antimicrob. Agents Chemother. 56: 4112–4122.

الخالصة

من عزلة وخمسون ثمانية Pseudomonas aeruginosa بوساطة االميبينيم لمضاد مقاومتها وتقييم عزلها تم حساسة، كانت العزالت هذه من٪) ۱٥.٥۲( وتسعة ،٪)۳.٤٥( اثنان ،٪)۸۱.۰۳( وأربعون سبعة ؛ E test اختبار

والتي ، جميعها المقاومة و الحساسية متوسطة العزالت تبد ولم. التتابع على لإلميبينيم، ومقاومة الحساسية، متوسطةهودج اختبار أكده ما نحو على الكاربابينيميز النزيم فعالية اية الكيسي، التليف من يعانون مرضى من سابقا عزلت

.

جين عن والتعبير اإلميبينيم، ومقاومة الحياتي، الغشاء تكوين بين العالقة قيمت oprD سالالت بعض في P. aeruginosa لإلميبينيم المقاومة السريرية (SMC631C و SMC631F و SMC631J و SMC631H و SMC631K وSMC 4974 ) . لجين منخفضا تعبيرا جميعها المقاومة العزالت أظهرت oprD منخفضة وقيما

الحساسة العزالت مع بالموازنه الحياتي للغشاء .

المقاومة العزلة أن الحالية الدراسة نتائج كشفت oprD :: isphoA /hah الغشاء تكوين على قدرة اظهرت قد الطبيعي النمط ساللة من معنويا اقل الحياتي PAO1. لإلميبينيم مقاومة الطفرة هذه اثارت ذلك من اكثر (P<0.001

ساللة مع بالمقارنة ( PAO1.

نقطية بطفرة طافرة عزلة على الحصول تم العمل هذا أثناء (SMC631F-IMr) جين في oprD الى الطفرة هذه ادت االميبينيم مقاومة (MIC=32 mg/l) ضعيف حياتي غشاء وتكوين (OD550=0.06) االصل العزلة مع مقارنة

SMC631 (OD550=0.19) .

البالزميدي التعبير poprD::isphoA/hah يلحظ لم اذ الحياتي، للغشاء كامل استرجاع الى ادى الطافرة العزلة فيمعنوي فرق أي P>0.05)) العزلة بين PAO1 معنوي فرق لوحظ بينما، جينيا المكملة والعزلة (P<0.05) بين

الطافرة والعزلة جينيا المكملة العزلة oprD::isphoA/hah فارغ بالزميد على الحاوية .

البالزميد تعبير تقدم، ما الى اضافة poprD::isphoA/hah االميبينيم حساسية استرجاع الى ادى (MIC=4 ) الى لدى الحساسية مستوى PAO1 معنوية فروق اية بدون ، (P>0.05) العزلة بين معنوي فرق هنالك بينما. بينهم

فارغ بالزميد على الحاوية الطافرة والعزلة جينيا المكملة oprD::isphoA/hah . النتائج نفس على الحصول تمالعزلة مع SMC631 البالزميد اضفنا حيث SMC631F-Imr/poprD الى البالزميد تعبير وادى الطافرة للعزلة

فارغ بالزميد على الحاوية العزلة ومع االصل العزلة مع موازنة الحياتي للغشاء كامل استرجاع .

جين فعالية عدم ان تثبت سوية النتائج هذه oprD الحياتي الغشاء تكوي نقصان عن المسؤول هو .

السريريتان العزلتان عرضت SMC576, SMC214)) الى حياتي غشاء العلى المكونتان mariner transposon mutagenesis بوساطة عنها التحري بعد الحياتي الغشاء لتكوين فاقدة عزالت على الحصول تم و

مختلفة جينات اربعة على الحصول تم الجينات فحص بعد و الدقيقة المعايرة طبق طريقة pilY1, pilW, pslI and algC الطافرتين العزلتين من كل اظهرت. الحياتي الغشاء نقصان عن مسؤولة pilY::Mar و pilW::Mar19

االصل مع مقارنة الحياتي الغشاء بتكوين معنويا انخفاضا SMC576. مثل pilY1::Mar طافرة عزالت خمسة انحشار نتيجة مستقلة transposon جين في مختلفة مواقع خمسة في pilY1 للجين فقط واحدة عزلة هناك حين في

pilW. الجينين في الطفرات ان عن فضال pilY1 وpilW االرتعاشية الحركة فقدان الى ادت .

لطافرات العج ظاهرة اما SMC576 من كل اظهرت فقد pilY1::Mar و pilW::Mar19 عن مختلفا نمطا SMC576 وقليلة قصيرة اذرع ذو و ضعيفا كان فقد .

حياتي غشاء ألعلى المكونة الثانية للعزلة بالنسبة اما ((SMC214 هما الجينات من اثنين فحص تم فقد ؛ pilW, pilX في كان والذي الحياتي الغشاء قيمة نقصان عن المسؤولة pilX::Mar و pilW::Mar معنويا اقل (P < االصل العزلة من (0.001 SMC214.

الطافرتان العزلتان أظهرت pilW::Mar و pilX::Mar لالصل تماما مشابهة عج ظاهرة SMC214 , بينما االرتعاشية للحركة عاليا تثبيطا العزلتين كلتا اظهرت .

البالزميد وضع تم +ppilY1 الطافرة العزلة في pilY1::Mir8 تكوين الى الطافرة العزلة هذه داخل تعبيره ادى ، منها الطافرة االصل العزلة بمستوى عاليا حياتيا غشاء SMC576 . كلي استرجاع الى ادى البالزميد تعبير ان كما

السيطرة الناقل مع بالموازنة للعج .

جين تعبير ان لوحظ االرتعاشية، الحركة pilY1 الطافرة في النقص تمم قد pilY1::Mir8. النتائج هذه توضح جين فعالية عدم بأجمعها pilY1 الحصول تم التي الطافرة العزالت في السابقة الظواهر تثبيط عن المسؤولة هي

الساللة من عليها SMC576 .

جين ان االليزا فحص بين الحياتي، الغشاء لتكوين الكمي القياس مع تماهيا pslI جين و algC في اساسيان جينان انتاج فحص عند .psl انتاج psl الطافرتين العزلتين في pslI::Mar و algC::Mar ، في تباينا هناك كانت psl

الحياتي الغشاء بتكوين عال نقصان الى ادى التباين وهذا االصل الساللة ومن منهما المنتج .

جمهورية العراق التعليم العالي والبحث العلميوزارة

جامعة بغداد

كلية العلوم

Pseudomonas aeruginosa في مقاومة االميبينيم و تكوين الغشاء الحياتي في بكتريا oprDدور جين

مقدمة الى

كلية العلوم/جامعة بغداد

وهي جزء من متطلبات نيل درجة دكتوراه فلسفة علوم

في علوم الحياة/احياء مجهرية

من

هديل كريم مسافر

۲۰۰٥بكالوريوس احياء مجهرية/كلية العلوم/الجامعة المستنصرية

۲۰۰۷ماجستير احياء مجهرية/كلية العلوم/ الجامعة المستنصرية

بأشراف

أ.م.د. حارث جبار فهد المذخوري

۱٤۳٤ محرم ۲۰۱۳ الثاني تشرين