Regulator T cells in murine AIDS - research-repository.uwa ... · Regulator T cells in murine AIDS...
257
Regulator T cells in murine AIDS Andrea Paun BSc. Hons. This thesis is presented for the degree of Doctor of Philosophy of the University of Western Australia School of Biomedical and Chemical Sciences Discipline of Microbiology and Immunology 2005
Transcript of Regulator T cells in murine AIDS - research-repository.uwa ... · Regulator T cells in murine AIDS...
Regulator T cells in murine AIDS
Andrea Paun BSc. Hons.
This thesis is presented for the degree of Doctor of Philosophy of the University
of Western Australia
School of Biomedical and Chemical Sciences
Discipline of Microbiology and Immunology
2005
Declaration
This thesis is submitted as part of the requirement for the degree of Doctor of
Philosophy at the University of Western Australia, and has not been submitted
elsewhere as part of another degree.
The work contained within this thesis is original and has been performed by
myself unless otherwise stated.
Andrea Paun
Supervisors:
Dr. Manfred W. Beilharz
Dr. Leanne M. Sammels
Table of Contents Summary …………………………………………………………………………… ix
Publications associated with this thesis ………………………………………… xi
Acknowledgments ………………………………………………………………… xii
Abbreviations …………………………………………………………………….. xiv
List of Figures …………………………………………………………………….. xvi
List of Tables ……………………………………………………………………… xix
Chapter 1: Literature Review 1.1. Introduction...............................................................................................1
1.2. Regulatory (T ) cellsr .................................................................................2
1.2.1. The history of T cells: suppressor T cellsr ..........................................2
1.2.2. The re-emergence of T cellsr .............................................................3
1.2.3. Naturally occurring CD4 CD25 T cells+ +r .............................................3
1.2.4. Tr1 cells .............................................................................................5
1.2.5. Th3 cells ............................................................................................6
1.2.6. Other (non-CD4+) T cellsr ..................................................................6
1.2.7. Human T cellsr ...................................................................................8
1.3. Generation of T cellsr ...............................................................................9
1.3.1. Thymic development..........................................................................9
1.3.2. Peripheral development ...................................................................11
1.3.3. Induction of Th secondary suppressor cellssupp ...............................11
1.4. Mechanisms of suppression ...................................................................13
1.4.1. Contact-mediated suppression ........................................................15
1.4.2. Cytokines .........................................................................................15
1.5. Phenotypic characteristics......................................................................17
1.5.1. Cell surface markers ........................................................................18
1.5.1.1. CD25 .........................................................................................18
1.5.1.2. CD45RB ....................................................................................19
1.5.1.3. CD62L .......................................................................................20
1.5.1.4. CD69 .........................................................................................20
1.5.1.5. Neuropilin 1 ...............................................................................21
1.5.1.6. Integrins ....................................................................................21
i
1.5.1.7. CD152 (CTLA-4) ………………………………..………………… 22
1.5.1.8. Glucocorticoid-induced tumor necrosis factor receptor
family-related gene (GITR).....................................................................23
1.5.2. Cytokines .........................................................................................24
1.5.2.1. Interleukin-10 (IL-10) .................................................................24
1.5.2.2. Transforming Growth Factor-β (TGF-β) ....................................25
1.5.3. Molecular markers ...........................................................................26
1.5.3.1. Foxp3 ........................................................................................26
1.6. The role of Tr cells in disease.................................................................27
1.6.1. Transplantation tolerance ................................................................27
1.6.2. Cancer .............................................................................................28
1.6.3. Autoimmune disease .......................................................................29
1.6.3.1. Autoimmune disease of the gastrointestinal tract ......................30
1.6.3.2. Allergic asthma..........................................................................31
1.6.4. Infectious disease ............................................................................32
1.6.4.1. Bacterial infection ......................................................................32
1.6.4.1.1. Bortadella pertussis ............................................................32
1.6.4.1.2. Mycobacterium ...................................................................33
1.6.4.1.3. Pneumocystis carinii ...........................................................33
1.6.4.1.4. Vibrio cholera......................................................................34
1.6.4.1.5. Helicobacter........................................................................34
1.6.4.2. Parasitic infections ....................................................................35
1.6.4.2.1. Leishmania major ...............................................................35
1.6.4.2.2. Schistosoma masoni...........................................................36
1.6.4.2.3. Onchocerca vovulus ...........................................................37
1.6.4.3. Fungal infections .......................................................................37
1.6.4.3.1. Candida albicans ................................................................37
1.6.4.4. Viral infections...........................................................................38
1.6.4.4.1. Hepatitis C ..........................................................................38
1.6.4.4.2. Herpes simplex ...................................................................38
1.6.4.4.3. Epstein-Barr virus ...............................................................39
1.6.4.4.4. Friends retrovirus................................................................39
1.6.4.4.5. Feline Immunodeficiency Virus ...........................................40
1.6.4.4.6. HIV/AIDS ............................................................................41
1.7. Murine Acquired Immunodeficiency Syndromes (MAIDS)......................42
ii
1.7.1. Virology: LP-BM5.............................................................................42
1.7.1.1. BM5d.........................................................................................44
1.7.1.2. BM5e.........................................................................................45
1.7.1.3. Mink Cell Focus-inducing virus..................................................45
1.7.1.4. Endogenous Retroviral Sequences ...........................................47
1.7.2. MAIDS as a model for AIDS ............................................................48
1.7.3. Genetic resistance to MAIDS...........................................................50
1.7.4. Mechanisms by which MAIDS triggers an immune response ..........50
1.7.4.1. Superantigen theory ..................................................................51
1.7.4.2. Transformation theory ...............................................................51
1.7.5 The effect of MAIDS on the immune system ....................................52
1.7.5.1. Cells ..........................................................................................52
1.7.5.1.1. CD4+ T cells .......................................................................52
1.7.5.1.2. CD8+ T cells .......................................................................53
1.7.5.1.3. B cells .................................................................................54
1.7.5.1.4. Natural killer (NK) cells .......................................................55
1.7.5.1.5. Macrophages ......................................................................55
1.7.5.2. Cytokines ..................................................................................56
1.8. Treatments for retrovirus-induced immunodeficiency in mice.................57
1.8.1. Antiretroviral agents .........................................................................58
1.8.2. Antineoplastic agents.......................................................................58
1.8.3. Immunomodulation using antineoplastic agents ..............................59
1.8.4. Kinetics of the immune response to viral infection ...........................60
1.9. Conclusions............................................................................................60
Chapter 2: Materials and Methods 2.1. Materials.................................................................................................63
2.1.1. Mice .................................................................................................63
2.1.2. Virus.................................................................................................63
2.1.3. Cell lines ..........................................................................................63
2.1.3.1. Prokaryotic ................................................................................63
2.1.3.2. Eukaryotic .................................................................................63
2.1.4. Antibodies and conjugates:..............................................................64
2.1.5. Peptides...........................................................................................65
2.1.6. Primers and probes..........................................................................65
iii
2.1.7. Tissue culture media........................................................................66
2.1.8. Buffers and Solutions.......................................................................66
2.2. Methods..................................................................................................70
2.2.1. Tissue culture ..................................................................................70
2.2.1.1. Resuscitation of frozen stocks...................................................70
2.2.1.2. Passaging cells .........................................................................70
2.2.1.2.1. Adherent cell lines ..............................................................70
2.2.1.2.2. Non-adherent cell lines .......................................................70
2.2.1.3. Preparation of liquid nitrogen stocks .........................................71
2.2.2. Preparation of LP-BM5 virus stocks.................................................71
2.2.3. Preparation of monoclonal antibodies..............................................71
2.2.3.1. Harvesting of monoclonal antibodies in supernatant .................71
2.2.3.2. Ammonium sulphate precipitation of monoclonal antibodies.....72
2.2.3.2.1. Preparation of dialysis tubing..............................................72
2.2.3.3. Quantitation of purified antibodies .............................................72
2.2.4. Infection with LP-BM5......................................................................73
2.2.4.1. Vinblastine treatment.................................................................73
2.2.4.2. Monoclonal antibody treatment .................................................73
2.2.5. Collection of organs and cells ..........................................................73
2.2.5.1. Collection of organs...................................................................73
2.2.5.2. Collection of blood.....................................................................74
2.2.5.2.1. Collection of plasma ...........................................................74
2.2.5.2.2. Collection of lymphocytes ...................................................74
2.2.6. Preparation of single cell suspensions.............................................74
2.2.6.1. Manual dissociation- Nylon mesh method.................................74
2.2.6.2. Enzyme digestion ......................................................................75
2.2.6.3. Cell counts by trypan blue exclusion .........................................75
2.2.7. Histology ..........................................................................................75
2.2.8. Analysis of cell surface markers ......................................................76
2.2.8.1. FACS staining ...........................................................................76
2.2.9. Cell sorting.......................................................................................76
2.2.9.1. MACS beads sorting .................................................................76
2.2.9.2. FACS sorting.............................................................................76
2.2.9.2.1. Depletion of CD4+ or CD8+ cells........................................76
iv
2.2.9.2.2. Purification of CD4+CD25+/- and CD4+CD25+/- cell subsets
...........................................................................................................77
2.2.10. In vivo cytotoxic T lymphocyte (CTL) assay...................................77
2.2.10.1. Preparation of target cells .......................................................77
2.2.10.1.1. Peptide pulsing .................................................................77
2.2.10.1.2. CFSE labelling ..................................................................78
2.2.10.2. Preparation of putative regulatory T cell populations...............78
2.2.10.3. Injection into hosts...................................................................79
2.2.10.4. Analysis...................................................................................79
2.2.11. Cytokine assays.............................................................................79
2.2.11.1. Intracellular Flow .....................................................................79
2.2.11.1.1. Positive control cells .........................................................80
2.2.11.1.1.1. Positive control cells for IL-2 and IFN-γ (and TNF-α) .80
2.2.11.1.1.2. Positive control cells for IL-4, IL-10 (IL-3, IL-5 and
GM-CSF).........................................................................................80
2.2.11.2. ELISpot ...................................................................................81
2.2.11.3. ELISAs ....................................................................................82
2.2.11.4. IgG2a ELISA ...........................................................................83
2.2.12. Bacterial cells.................................................................................83
2.2.12.1. Preparation of competent cells ................................................83
2.2.12.2. Transformation of bacterial cells by electroporation ................84
2.2.13. Manipulation and analysis of DNA .................................................84
2.2.13.1. Agarose gel electrophoresis of DNA .......................................84
2.2.13.2. Detection of DNA in agarose gels ………………………..…… 84
2.2.13.3. Estimation of size of DNA........................................................85
2.2.13.4. Spectrophotometric quantitation of DNA .................................85
2.2.13.5. Plasmid DNA Miniprep ............................................................85
2.2.13.6. Plasmid DNA Bulk preparation (Maxiprep)..............................87
2.2.13.7. DNA extraction from tissue......................................................88
2.2.13.7.1. Blood ................................................................................88
2.2.13.7.2. Spleen ..............................................................................88
2.2.13.8. Ethanol precipitation of plasmid DNA......................................89
2.2.13.9. Phenol extraction of aqueous DNA solutions ..........................89
2.2.13.10. DNA recovery from agarose gels ..........................................90
2.2.13.11. Restriction Endonuclease digestion of DNA..........................90
v
2.2.14. Polymerase Chain Reaction (PCR)................................................90
2.2.14.1. Primers and probes .................................................................91
2.2.14.2. PCR for detection of BM5d......................................................91
2.2.14.3. Real time PCR (Q-PCR) for detection of BM5d and BM5 .......91
2.2.14.4. DNA standards for real time PCR............................................91
2.2.14.4.1. BM5d and BM5e ...............................................................91
2.2.14.4.2. Foxp3 and HPRT ..............................................................93
2.2.15. Manipulation and analysis of RNA .................................................93
2.2.15.1. Agarose gel electrophoresis of RNA .......................................93
2.2.15.2. Detection of RNA in agarose gels ...........................................93
2.2.15.3. Spectrophotometric quantitation of RNA .................................93
2.2.15.4. RNA extraction from tissue......................................................94
2.2.15.4.1. Plasma..............................................................................94
2.2.15.4.2. Single cell suspensions ....................................................95
2.2.15.4.3. Spleens/organs.................................................................95
2.2.15.4.4. Acid phenol extraction of aqueous RNA ...........................96
2.2.16. Reverse transcriptase PCR (RT PCR)...........................................96
2.2.16.1. RT PCR for detection of BM5d................................................97
2.2.16.2. One step real time RT PCR for detection of BM5d and BM5e 97
2.2.16.3. RNA standards for real time RT PCR ………………………… 98
2.2.16.3.1. Construction of plasmids...................................................98
2.2.16.3.2. Generation of RNA transcripts ........................................100
2.2.16.4. Two step real time RT PCR for detection of Foxp3 and HPRT
.............................................................................................................100
2.2.16.4.1. Reverse Transcription.....................................................102
2.2.16.4.2. Real time PCR................................................................102
2.2.16.4.3. DNA standards for Foxp3 and HPRT..............................102
2.2.17. Data analysis …………………………………………….…………..…… 103
Chapter 3: Tr involvement in the early stages of MAIDS development 3.1 Introduction............................................................................................104
3.2 Results ..................................................................................................106
3.2.1 Early cytokine profiles .....................................................................106
3.2.2 Intracellular flow cytometry .............................................................106
3.2.3 Cytokine levels by intracellular flow cytometry................................107
vi
3.2.4 Enzyme-linked immunospot (ELISpot) assay .................................113
3.2.5 Cytokine levels by ELISpot .............................................................114
3.2.6 Levels of Tr cytokines in serum.......................................................117
3.3 Tr cell associated cell surface markers by flow cytometry.....................120
3.4 Discussion ………………………………………………………………….. 124
Chapter 4: Therapeutic targeting of Tr cells in MAIDS infection 4.1 Introduction............................................................................................128
4.2 Results ..................................................................................................130
4.2.1 Therapeutic effect of a single dose of Vinblastine administered at
different times post infection ....................................................................130
4.2.2 Characterising the day 14 Vb effect ................................................133
4.2.3 Long-term protection from MAIDS development following day 14 pi
Vb therapy ...............................................................................................136
4.2.4 No protection from viral rechallenge following day 14 pi Vb therapy
.................................................................................................................136
4.2.5 Vinblastine treatment targets cycling CD4+ T cells at day 14 post
infection ...................................................................................................139
4.2.6 In vivo depletion of CD4+ T cells at day 14 pi results in protection from
MAIDS development ................................................................................141
4.3 Discussion …………………………………………………………………... 144
Chapter 5: Further characterisation of Tr cell phenotype, development and function
5.1 Introduction............................................................................................149
5.2 Results ..................................................................................................151
5.2.1 In vivo cytotoxic lymphocyte (CTL) assay .......................................151
5.2.2 Foxp3..............................................................................................159
5.2.3 Adoptive transfer of CD4+CD25+ Tr cells.......................................162
5.2.4 Anti-CD25 mAb treatment...............................................................164
5.2.5 Extended in vivo depletion targeting Tr cell surface markers ..........167
5.3 Discussion ………………………………………………………………….. 170
vii
Chapter 6: Quantitating the spread of defective and ecotropic viruses during LP-BM5 infection 6.1 Introduction ...............................................................................................177
6.2 Results ..................................................................................................178
6.2.1 PCR for detection of LP-BM5 DNA .................................................178
6.2.2 Real time PCR for detection of LP-BM5 DNA .................................180
6.1.1.1 Selection of primers..................................................................181
6.1.1.2 Standard curves .......................................................................181
6.2.3 Infected tissues...............................................................................183
6.1.1.3 Peripheral Blood.......................................................................183
6.1.1.4 Spleen ......................................................................................183
6.3 Real time RT PCR.................................................................................187
6.3.1 Standard curve ...............................................................................187
6.3.2 Infected tissue.................................................................................189
6.1.1.5 Peripheral Blood.......................................................................189
6.1.1.6 Spleen ......................................................................................189
6.4 Peripheral blood levels of BM5d DNA and RNA are an accurate reflection
of spleen infection .......................................................................................193
6.5 Effect of Vinblastine or anti-CD4 monoclonal antibody treatment on BM5d
viral levels during LP-BM5 infection ............................................................195
6.5.1 Viral DNA ........................................................................................196
6.5.2 Viral RNA ........................................................................................196
6.5.3 Viral inoculum .................................................................................199
6.6 Discussion .............................................................................................201
Chapter 7: References ……...…………………………………………….……… 208
viii
Summary
In the last ten years regulator T (Tr) cells have re-emerged as an integral part of
the immune system. Research in this field has rapidly demonstrated the role of
these cells in the maintenance of immune homeostasis and their involvement in
disease. Tr cells are generated in the thymus as a normal part of the
developing immune system. Furthermore, antigen-specific Tr cells are induced
in the periphery by a mechanism which is yet to be completely elucidated, but is
likely to involve dendritic cells. Tr cells play an important role in autoimmune
disease, transplantation tolerance, cancer. Most recently Tr cell involvement
has been demonstrated in a growing number of infectious diseases. Tr cell
induction was reported in Friend Virus infection at the commencement of this
study, and subsequent to publication of our findings have also been identified in
FIV and HIV. Murine AIDS (MAIDS) is a fatal chronic retroviral infection
induced in susceptible strains of mice by infection with BM5d, a replication
defective virus, in a viral mixture which is designated LP-BM5. The
manipulation of Tr cells detailed in this thesis and the related publication
represent the first reported therapy utilising targeted removal of Tr cells.
Chapter 1 summarises the literature relevant to this study up to November
2004. Chapter 2 details the materials and methodologies used in this work.
Chapter 3 investigates whether Tr cells are involved in the development of
murine AIDS, particularly in the early stages of infection. The data presented in
this chapter provides evidence of a population of CD4+ Tr cells which express
CD25 on their cell surface and secrete TGF-β, some IL-10 and low levels of IL-4
are induced following infection with LP-BM5. These cells were found to arise by
day 12 post infection (pi) by flow cytometry and immunosuppressive cytokine
expression was found to peak at day 16 pi indicating a role in the early stages
of disease progression.
Chapter 4 investigates the effect of therapeutically targeting these induced Tr
cells using the antimitotic agent Vinblastine during their induction period. The
efficacy of treatment was found to be time dependent and was shown to
ix
abrogate disease progression maximally when given at day 14 pi. Treatment
with anti-CD4 monoclonal antibody was also found to be efficacious at day 14 pi
and confirmed the identity of the Tr cells as being CD4+ T cells. Adoptive
transfer studies demonstrated that the return of these cells to a successfully
treated host results in renewed MAIDS progression, confirming their role in
disease progression.
Chapter 5 presents data further investigating the phenotypic and functional
characteristics of these cells conducted in order to determine whether the Tr
cells which are induced in MAIDS belong to any of the currently defined subsets
of Tr cells. The Tr cell surface markers CTLA-4 and GITR were found to play a
role in the development of disease through the use of specific monoclonal
antibodies. Data is presented demonstrating that the Tr cells induced in vivo
following infection are antigen specific and arise by day 10 pi. The discovery of
Foxp3 as a Tr cell-specific transcription factor was reported in the literature
during the course of this study and was therefore also examined in the MAIDS
model. Foxp3 expression studies, in conjunction with adoptive transfer
experiments indicate that the Tr cells induced in MAIDS develop from naturally
occurring CD4+CD25+Foxp3+ Tr cells. These cells lose CD25 expression as
they become activated whilst maintaining Foxp3 expression and suppressive
function.
Chapter 6 focuses on the effect of therapeutically targeting Tr cells on the virus
itself. This chapter describes the development of quantitative real time PCR
and real time RT PCR assays to measure both the defective and ecotropic virus
in the LP-BM5 retroviral mixture. This study found that whilst Vinblastine and
anti-CD4 monoclonal antibody treatment prevent the development of disease
pathology neither treatment has any direct effect on the virus itself. Viral levels
were found to be the same in both treated and untreated infected mice. These
results indicate that BM5d is unable to cause serious disease without the
induction of immunosuppression by antigen specific Tr cells.
x
Publications associated with this thesis
Beilharz, MW., Sammels, LM., Paun, A., Shaw, K., van Eeden, P., Watson,
MW. and Ashdown, ML. Timed ablation of regulatory CD4+ T cells can prevent
murine AIDS progression. Journal of Immunology 2004; 172(8):4917-4925
Paun, A., Shaw, K., Fisher, S., Sammels, LM., Watson, MW. and Beiharz, MW.
Quantitation of defective and ecotropic viruses during LP-BM5 infection by real
time PCR and RT-PCR. Journal of Virological Methods 2005; 124(1-2):57-63
xi
Acknowledgments
As always happens with such a huge undertaking there are about a million
people who need to be thanked:
First and foremost I would like to thank my supervisors: Dr Manfred Beilharz
and Dr Lee Sammels. Both of you have taught me not only an incredible
amount about science and also about how to think like and be a scientist. For
these valuable lessons, your support and advice over the last few years I
extend my sincere thanks.
Several people have contributed to the work that has been presented in this
thesis, I would like to thank Lee Sammels for the early Vinblastine time course
and extended effect experiments presented in Chapter 4 and her help with other
experiments presented in that chapter when one pair of hands was simply not
enough. Pauline van Eeden and Tom Yong for their help in developing the
PCR and RT PCR presented in Chapter 6. Kath Shaw for her help with
developing and running the real time assays, also in Chapter 6 as well as
Alayne Bennett and Scott Fisher for help with processing samples. Thanks
also, Mark Watson and Scott Fisher for their help in making the standards for
the real time RT PCR.
Thanks to the various people who have donated cell lines, reagents, time and
advice, in particular Kathy Heel and Matt Wikstrom at the flow cytometry unit
who put in hours of time to sort my cells. Simone and Helen from upstairs,
thank you for doing such an excellent job with the mice and also for your
friendship over the years.
I would also like to gratefully acknowledge the financial support of Genetic
Technologies Pty. Ltd. which was provided to both the laboratory and to myself
in the form of a scholarship.
xii
On a more personal note, to the members of the Beilharz empire past and
present, thank you for making the lab a fun, friendly and exciting place to come
to every day. Tracey, Demelza, Erika, Clayton and Scott I don’t think it would
have been anywhere near as much fun without you all. In the last four years I
have made some amazing friends that I know will last well beyond the bounds
of this PhD. Also to all the people in the Microbiology department, thank you for
all the help and support that you have given over the years. Thank you for the
time you have given me, answering all the silly questions and for all the laughs.
Again, there are friends I have made that will be there for life, thank you.
And finally, last but certainly not least, to my family and my friends old and new,
both in Australia and overseas. Thank you for everything that you have done
over the last four years. For the food, help, parties, weddings, weekends away
and all those little bits of sanity that you helped inject into my life to remind that
it wasn’t all just about the work. Thank you for helping me to become a better,
more balanced person.
I used the same quote at the end of my honours thesis and I think now, it
applies even more aptly to a PhD:
Experience is not what happens to you,
it is what you do with what happens to you
- Aldous Huxley
xiii
List of Abbreviations
Ab antibody
AIDS acquired immune deficiency Syndrome
APC allophyocyanin
BM5def BM5 defective virus
BM5eco BM5 ecotropic helper virus
BSA bovine serum albumin
CFSE 5-(and 6) carboxyflourescein diacetate
succinimidyl ester
CTL cytotoxic lymphocyte
DC dendritic cell
ddH2O distilled de-ionized water
D-MEM Dulbecco’s Modified Eagle Medium
DMSO dimethyl sulphoxide
DNA deoxyribonucleic acid
EDTA ethylenediaminetetraacetic acid
ERV(s) endogenous retroviral sequence(s)
FACS fluorescence activated cell sorting
FITC flourescein isothiocyanate
FIV feline immunodeficiency virus
FCS fetal calf serum
g grams
HCV Hepatitis C virus
HIV human immunodeficiency virus
hrs hours
HSV Herpes simplex virus
iDC immature dendritic cell
IFN interferon
Ig Immunoglobulin
IL interleukin
ip intraperitoneal
i.v. intravenous
xiv
L litre
mAb/s monoclonal antibody/ies
MAIDS Murine Acquired Immunodeficiency
Syndrome
MHC major histocompatibility complex
mg/kg body weight milligrams/ kilogram of body weight
µg microgram
µL microliter
min(s) minute(s)
MCF Mink cell focus inducing virus
MuLV(s) Murine Leukemia Virus(es)
NOD non-obese diabetic
NK cell natural killer cell
PCR polymerase chain reaction
PBS phosphate buffered saline
PE phycoerythrin
pi post infection
QR quantum red
RBC red blood cell
RNA ribonucleic acid
rpm revolutions per minute
RT PCR reverse transcriptase polymerase chain
reaction
sec second(s)
SEM standard error of the mean
Strep-HRP streptavidin horse radish peroxidase
Vb Vinblastine
v/v volume/volume
w/v weight/volume
WBC white blood cell(s)
xv
List of Figures Figure 1.1 Generation of Tr cells ………………………………………………. 10
Figure 1.2 The role of DC in sensitizing T cells ……………………………… 12
Figure 1.3 Induction of Thsupp cells by naturally occurring
CD4+CD25+ Tr cells ……………………………………………………………... 14
Figure 1.4 Mechanisms of suppression by Tr cells ………………………….. 16
Figure 1.5 The gross anatomical changes seen in MAIDS
infection of C57BL/6 mice ……………………………………………………… 43
Figure 1.6 Structure of the BM5eco and BM5def viral genomes ………….. 46
Figure 2.1 1 kb DNA ladder ……………………………………………………. 86
Figure 2.2 Circular plasmid maps of pIRES-Exp-BM5d and
pIRES-Exp-BM5e ……………………………………………………………….. 99
Figure 2.3 Schematic of the in vitro transcription for making
RNA transcripts …………………………………………………………... … 101
Figure 3.1. Positive, negative and isotype control samples for
intracellular flow ……………………………………………………………… .. 108
Figure 3.2. Scatter plots of intracellular detection of IL-4
and IL-10 in the spleen ………………………………………………………… 109
Figure 3.3. Tr cytokine production in splenocytes following
LP-BM5 infection using intracellular flow …………………………………….. 111
Figure 3.4 Tr cytokine production by CD4+ T cells using
intracellular flow ……………………………………………………………… 112
Figure 3.5 Tr cytokine production in total splenocytes using ELISpot ……. 115
Figure 3.6 Tr cytokine production by CD4+ T cells using ELISpot ………… 116
Figure 3.7 Serum levels of IL-10 and TGF-β from days 0-21
post LP-BM5 infection ………………………………………………………….. 118
Figure 3.8 Serum levels of IL-4 and IFN-γ from day 0-21
post LP-BM5 infection ………………………………………………………….. 119
Figure 3.9 Expression of Tr cell surface markers on peripheral
blood CD4+ T cells ……………………………………………………………..121
xvi
Figure 3.10 Expression of CD25 and CD69 on splenic CD4+ T cells …...... 123
Figure 4.1 Protection from MAIDS at 10 weeks pi following
day 14 pi Vb therapy …………………………………………………………... 132
Figure 4.2 The effect of day 14 pi Vb treatment on the development
of MAIDS as determined by histopathological examination ………………. 134
Figure 4.3 Comparison of lymphocytes and serum IgG2a levels
in control and treatment groups at 10 weeks post infection ………………. 135
Figure 4.4 Long term effect of day 14 pi Vb treatment on
LP-BM5 infection ……………………………………………………………….. 137
Figure 4.5 Rechallenge with LP-BM5 virus following protective
Vb therapy ………………………………………………………………………. 138
Figure 4.6 Adoptive transfer of splenocytes from LP-BM5 infected
donors to day 14 pi Vb treated recipients ……………………………………. 140
Figure 4.7 In vivo depletion of CD4+ cells at day 14 pi significantly
slows the progression of MAIDS ……………………………………………… 142
Figure 4.8 The protective effect of in vivo CD4 depletion is
time-dependent …………………………………………………………………. 143
Figure 5.1 Histogram plots of the in vivo CTL assay ……………………….. 153
Figure 5.2 Peptide-specific cell lysis at different days post
LP-BM5 infection ……………………………………………………………….. 154
Figure 5.3 Histogram plots of the in vivo CTL assay with putative
Tr cells ………………………………………………………………………….... 156
Figure 5.4 The effect of Tr cells on peptide-specific in vivo cell
lysis at day 10 post LP-BM5 infection ………………………………………... 157
Figure 5.5 ELISpot of CD4+CD25+ and CD4+CD69+ Tr cells at
day 18 post infection …………………………………………………………… 158
Figure 5.6 Foxp3 expression in major lymphocyte subsets
in the spleens of naive mice …………………………………………………… 160
Figure 5.7 Foxp3 levels in Tr cell subsets during LP-BM5 infection ………. 161
Figure 5.8 Adoptive transfer of CD4+CD25+/CD25- into MAIDS
infected mice at day 15 post LP-BM5 infection ……………………………… 163
Figure 5.9 Pre-depletion of CD25 does not affect disease progression ….. 165
xvii
Figure 5.10 Single timed depletion of CD25 does not
affect disease progression …………………………………………………….. 166
Figure 5.11 Extended treatment with mAbs against regulator
cell markers slows MAIDS progression ……………………………………… 169
Figure 6.1 Development of PCR for the detection of BM5d proviral
DNA …………………………………………………………………………….... 179
Figure 6.2 Typical standard curves for the BM5d and BM5e real time PCR …………………………………………………………………… 182
Figure 6.3 Time course of proviral DNA levels in the peripheral
blood of LP-BM5 infected mice ……………………………………………….. 184
Figure 6.4 Comparison of proviral DNA in the spleen at different times post infection ……………………………………………………………………. 185
Figure 6.5 Relationship between spleen weight and BM5d proviral DNA levels ……………………………………………………………... 186
Figure 6.6 Typical standard curves for BM5d and BM5e
real time RT-PCR ………………………………………………………………. 188
Figure 6.7 Comparison of BM5d and BM5e viral RNA in the
peripheral blood of LP-BM5 infected mice …………………………………... 190
Figure 6.8 Comparison of spleen BM5d and BM5e viral load in the
spleen at different times post infection ……………………………………….. 191
Figure 6.9 Relationship between spleen weight and BM5d viral
RNA levels ……………………………………………………………………..... 192
Figure 6.10 Comparison of DNA and RNA levels in blood and spleen at different
times post infection …………………………………………………... 194
Figure 6.11 The effect of day 14 Vb and anti-CD4 treatment on spleen
weight and BM5d viral DNA and RNA levels in peripheral blood ……...….. 197
Figure 6.12 The effect of day 14 pi Vb on spleen weight and BM5d viral
RNA in spleen and peripheral blood at different stages of infection ……… 198
Figure 6.13 Effect of viral inoculum size on disease progression …………. 200
xviii
List of Tables Table 1.1 Characteristics of regulatory T cells ………………………………. 4
Table 1.2 Similarities and differences between MAIDS and AIDS ………… 49
Table 2.1 Eukaryotic cells lines ……………………………………………….. 63
Table 2.2 Antibodies and conjugates …………………………………………. 64
Table 2.3 PCR primers …………………………………………………………. 65
Table 2.4 Probes used for real time PCR …………………………………….. 65
Table 2.5 PCR buffers, cycling conditions, primer and probe
concentrations for the various PCR reaction …………………………………. 92
xix
Chapter 1:
Literature Review
Chapter 1
1.1. Introduction
The concept of cells controlling the immune response of other cells, or
suppressor T cells, was first introduced in the 1970s (Gershon and Kondo,
1970, 1971). Initially hindered by the lack of suitable markers, the field was
revived in the mid-1990s through observations made by Sakaguchi and
colleagues in an autoimmune disease model (Sakaguchi, et al., 1995).
Regulatory T (Tr) cells became a field of renewed interest. This resurgent area
of immunology has been the focus of a massive body of research in the last 10
years, resulting in the definition of seminal roles for Tr cells in the maintenance
of tolerance and homeostasis in the immune system as well as malignancies
and autoimmunity. More recently Tr cells have been shown to be involved in
the host immune response to infection by bacteria, viruses, fungi and parasites
(Mills, 2004; Mills and McGuirk, 2004). Tr cells have been described in mice
and are now being characterized in humans, leading to the potential of
manipulating these cells as immunotherapy for various diseases, including the
ever-present specter of HIV/AIDS (Aandahl, et al., 2004; Kinter, et al., 2004;
Weiss, et al., 2004).
Tr cells have a complex role in the immune system; in autoimmune disease and
transplantation the absence of Tr cells results in pathology whereas in cancer
and infectious disease it is the induction of Tr cells that leads to disease
progression (Shimizu, et al., 1999; Sakaguchi, et al., 2001). Interestingly, in
some situations the manipulation of the immune system by infectious agents to
improve survival appears to be of mutual benefit to the host and the pathogen,
allowing the pathogen to establish persistent infection whilst limiting
immunopathology in the host and providing the added benefit of concomitant
immunity against reinfection (Belkaid, et al., 2002; Belkaid, 2003).
This chapter is a review of the literature on regulatory T cells including their
history, generation, function and characterisation with a particular focus on Tr
cells in infectious disease. This chapter will also review the literature pertaining
to the murine AIDS (MAIDS) model as the work undertaken in this PhD will
focus on determining whether Tr cells are involved in the development of
MAIDS.
1
Chapter 1 1.2. Regulatory (Tr) cells
One of the most basic and important features of the immune system is the
ability to discriminate between self and non-self and between antigens which
are delivered in harmful and non-harmful contexts . This allows the immune
system to protect us from many potentially pathogenic organisms whilst
avoiding damaging the body. This concept is known as self tolerance. The
break down of self tolerance, when lymphocytes mount a response against self
tissues results in the development of autoimmune disease (Medzhitov and
Janeway, 2000).
The mechanisms controlling self-reactive T cells can be classified into two
broad groups. The first group are “passive” as they depend on either a
functional absence of autoreactive cells (clonal deletion) or the presence of self-
antigens in a non-immunogenic form (T cell anergy) (Saoudi, et al., 1996). The
second group are referred to as “active” (or dominant) as they prevent the
activation of T cells that have the potential to cause autoimmunity. Active
tolerance is so called because this mechanism involves the active control of
autoreactive T cells by Tr cells (Saoudi, et al., 1996). Tr cells control key
aspects of immunologic tolerance to self antigens, and it is becoming ever more
apparent that many of the antigens recognised by these cells are self antigen
(Sakaguchi, 2000; Antony and Restifo, 2002). Tr cells are essential for the
maintenance of immunological homeostasis (Sakaguchi, 2000) and are able to
suppress both Th1 and Th2 responses although our understanding of this role
is far from complete (Mills, 2004; Mills and McGuirk, 2004).
1.2.1. The history of Tr cells: suppressor T cells
The concept of immunologic suppression that was mediated by cells or
“infectious tolerance” was first introduced in 1970 with the demonstration that
mice could be tolerized to sheep red blood cells and that this tolerance was
transferable to naive mice (Gershon and Kondo, 1970, 1971). Infectious
tolerance was then demonstrated in a number of other models including
transplants, tumor immunology and delayed type hypersensitivity (Chatenoud,
et al., 2001). However the lack of a specific cell surface marker and the
resultant inability to further identify suppressor T cells, their antigen specificity
2
Chapter 1 and their mechanism of action resulted in this field of research grinding to a halt.
The technology required to study these cells was simply not available to
scientists at the time.
1.2.2. The re-emergence of Tr cells
The field of regulatory T cells was revived as a topic of mainstream scientific
research when Sakaguchi and colleagues observed that the transfer of CD4+ T
cells which had been depleted of the CD25+ subset into nu/nu recipients
induced the development of a variety of organ-specific autoimmune diseases in
the majority of recipient mice (Sakaguchi, et al, 1995). The co-transfer of
CD4+CD25+ cells prevented disease development and autoimmune disease
could also be reversed by the later transfer of CD4+CD25+ T cells (Sakaguchi,
et al, 1995). The constitutive expression of CD25 was found on a minor subset
of CD4+ T cells, accounting for 7-10% of CD4+ T cells (Sakaguchi, et al, 1995).
These observations have been the catalyst for the large body of research that
has now been conducted into Tr cells. Several different subtypes of Tr cells
have now been defined and are described in further detail below, the major
features of CD4+ Tr cells and CD8+ Tr cells are summarized in Table 1.1.
1.2.3. Naturally occurring CD4+CD25+ Tr cells
Naturally occurring CD4+CD25+ Tr cells were initially described by Sakaguchi’s
group in 1995 (Sakaguchi, et al, 1995). These cells represent 5-10% of CD4+ T
cells in the peripheral blood of both mice and humans (Maloy and Powrie, 2001;
Sakaguchi, et al, 2001; Shevach, 2001; Groux, 2003; Thompson and Powrie,
2004). These cells were initially identified for their ability to prevent
organ-specific autoimmune disease however they have now been demonstrated
to play a role in gut homeostasis (Singh, et al., 2001), microbial infection (Hori,
et al., 2002; Kullberg, et al., 2002; Hesse, et al., 2004) and transplantation
tolerance (Wood and Sakaguchi, 2003; Wood, et al., 2004). Naturally occurring
CD4+CD25+ Tr cells have been shown to develop in thymus. The day 3
thymectomy of mice results in development of a spectrum of organ-specific
autoimmune disease which can be reversed by the transfer of CD4+CD25+ Tr
3
Chapter 1
Table 1.1 Characteristics of regulatory T cells
CD4+CD25+ Tr1 Th3 CD8+ Tr
Surface phenotype
CD25 + + + +
CD45RBlow + + + +
CTLA-4 +++ + ++ -
GITR +++ ? ? ?
Cytokine secreted
IL-10 +/- +++ + ++
TGF-β +/- + +++ +/-
Differentiation
factor
Foxp3
IL-10, TGF-β IL-10, IFNα TGF-β, IL-4 ?
Foxp3 +++ - ++ ?
Suppression
mechanism
In vitro Cell contact IL-10 TGF-β IL-10, TGF-β
In vivo Cell contact,
IL-10, TGF-β IL-10 TGF-β ?
For cell surface markers and cytokines: + indicates expression, ++ high expression,
+++ very high expression, +/- some expression and – no expression, ? indicates
unknown
4
Chapter 1 cells into these mice early in life (Suri-Payer, et al., 1998). Following thymic
generation they are exported to the periphery where they play a role in
maintaining immunological homeostasis (Salomon, et al., 2000). As well as
expressing high levels of CD25, these cells also express high levels of cell
surface CTLA-4 (Salomon, et al., 2000) and GITR (Shimizu, et al., 2002). While
these cells are believed to mediate suppression by cell-contact dependent
mechanisms they are also able to secrete IL-10 and TGF-β (Groux, 2003).
Certainly, although CD4+CD25+ Tr cells appear to mediate suppression by cell
contact in vitro, there is increasing evidence that cytokines are required in vivo
(Groux, 2003; Thompson and Powrie, 2004). A further marker of naturally
occurring Tr cells is the expression of the transcription factor Foxp3 (see
Chapter 1.5.3.1), which is essential for Tr cell development and function
(Fontenot, et al., 2003; Hori, et al., 2003; Khattri, et al., 2003). As the first of the
recently described Tr cell subsets, naturally occurring CD4+CD25+ Tr cells are
currently the best understood Tr cells and appear to play an important, non-
redundant, role in immune homeostasis.
1.2.4. Tr1 cells
Tr1 cells are antigen-specific Tr cells which have now been described in a
number of in vitro and in vivo settings. The Tr1 subset of Tr cells was initially
generated by culturing T cells from ovalbumin (OVA) -TCR transgenic mice with
OVA in the presence of IL-10. The resulting clones were found to have a
distinct cytokine profile (high IL-10 and IL-5, variable TGF-β and little or no IL-2,
IL-4 and IFN-γ) and to have a poor proliferative capacity (Groux, et al., 1997).
These cells were able to suppress antigen-induced proliferation of CD4+ T cells
and adoptive transfer of Tr1 cells was able to prevent induced colitis in SCID
mice (Groux, et al., 1997). Tr1 cells are able to inhibit Th1 and Th2 responses
via IL-10 dependent mechanisms, and also have been shown to emerge in vivo
following chronic exposure to antigen (Roncarolo, et al., 2001; Sundstedt, et al.,
2003) or in the presence of dendritic cells (Wakkach, et al., 2003). The
development of Tr1 cells has now been described in a number of chronic
bacterial and parasitic diseases (McGuirk, et al., 2002; Satoguina, et al., 2002;
Higgins, et al., 2003; Lavelle, et al., 2004; Mills and McGuirk, 2004; Netea, et
al., 2004) and also in the intestine of normal mice to regulate the immune
5
Chapter 1 response to commensal flora (Cong, et al., 2002). The development of Tr1 cells
has also been shown to be facilitated by pathogen-derived molecules which are
able to elicit IL-10 production from dendritic cells through Toll-like receptor
(TLR) dependent mechanisms (Higgins et al, 2003; Lavelle et al, 2004; Netea et
al, 2004). The large body of evidence for the pathogen induction of Tr1 cells
suggests that these particular Tr cells are involved controlling the immune
response to pathogens following persistent infection.
1.2.5. Th3 cells
Th3 CD4+ Tr cells were first described in studies of the mechanism of oral
tolerance to myelin basic protein (Weiner, 2001). Th3 cells express CD25 and
CTLA-4 but are characterised by their use of TGF-β to mediate their
suppressive effects with little expression of IL-10 (Groux, 2003). Th3 cells have
been identified in the intestinal mucosa of both mice and humans, however the
mechanism of their induction in vivo is still not well understood (Weiner, 2001;
Allez and Mayer, 2004). It has been shown that the feeding of low levels of
antigens results in the generation of T cells which produced IL-10 and TGF-β
and were able to suppress experimental autoimmune encephalitis in mice by a
TGF-β dependent mechanism (Chen, et al., 1994). It is thought that the one of
the major roles of Th3 CD4+ Tr cells is to protect against the development of
uncontrolled inflammation in the gut (Allez and Mayer, 2004). This has been
demonstrated in mice in a number of induced colitis models (Neurath, et al.,
1996; Fuss, et al., 2002; Liu, et al., 2003).
1.2.6. Other (non-CD4+) Tr cells
As well as CD4+ Tr cells which have been the focus of most research in this field
there are also a number of other types of Tr cells including CD8+ Tr cells, NK T
cells and γδ T cells. The following section will provide a brief review of each.
γδ T cells are located at mucosal surfaces and are involved in maintaining
epithelial homeostasis (Allez and Mayer, 2004). They have been demonstrated
to have a protective role in colitis as demonstrated in IL2Rβ -/- mice (Poussier,
et al., 2000) and two other models of colitis (Hoffmann, et al., 2001; Chen, et al.,
6
Chapter 1 2002). A mechanism of action was not proposed in these models. γδ T cells
are also proposed play a role in early pregnancy, with a study showing that the
γδ T cells present in the decidua expressed high levels of IL-10 and TGF-β
mRNA leading to the suggestions that these cells may provide a cytokine milieu
to promote tolerance of the foetus, either directly or by the induction of other Tr
cells (Nagaeva, et al., 2002).
NK T cells are either CD4+ or CD4-CD8- T cells and can be activated upon
recognition of α-galactoceramide in a CD1d restricted manner (Allez and Mayer,
2004). These cells have been shown to mediate the immune response in tumor
immunity, viral infection and also in autoimmune/inflammatory diseases such as
colitis, diabetes and sclerosis (Sumida, et al., 1995; Horwitz, et al., 1997;
Wilson, et al., 1998; Saubermann, et al., 2000). The activation of NK T cells in
a CD1d-restricted manner was found to decrease the severity of induced colitis
(Saubermann, et al., 2000). There is some evidence to suggest that TGF-β
secretion is a mechanism of suppression by NK T cells (Horwitz, et al., 1997).
Different populations of CD8+ Tr cells have been identified in mice and humans
(Allez and Mayer, 2004) and are characterised by the lack of CD28 expression
(Liu, et al., 1998; Filaci, et al., 2001; Filaci and Suciu-Foca, 2002). CD8+ Tr
cells can be isolated from the lamina propria of normal individuals (Allez, et al.,
2002). CD8+ Tr cells are found to primarily suppress CD4+ T cells and prevent
the antigen-stimulated expansion of these cells (Horwitz, et al., 1999), with
TGF-β secretion being one of the mechansims of suppression identified to date
(Miller, et al., 1992; Horwitz, et al., 2003). In vitro-generated CD8+CD28- Tr
cells are MHC class I restricted and inhibit allo-, xeno- and nominal antigen
specific CD4+ T cell responses (Jiang, et al., 1998; Liu et al., 1998). CD8+ Tr
cells can participate in oral tolerance (Miller et al., 1992; Chen, et al., 1995;
Grdic, et al., 1998) and autoimmune disease (Najafian, et al., 2003). A
population of CD8+TrE cells which may play a role in the control of the immune
response to intestinal antigens have also been described in humans (Allez et
al., 2002; Allez and Mayer, 2004).
7
Chapter 1 1.2.7. Human Tr cells
There has been a substantial number of recent publications demonstrating the
presence of CD4+CD25+ Tr cells in humans which have similar properties to Tr
cells in mice. CD4+CD25+ Tr cells have been found in peripheral blood, thymus,
lymph nodes and also in cord blood (Baecher-Allan, et al., 2001; Wing, et al.,
2002; Baecher-Allan, et al., 2003). The general characteristics of murine and
human CD4+CD25+ Tr cells appear to be quite similar, both have the phenotype
of activated or memory cells, however there are significant differences in the
cell surface markers that are expressed. CD25 staining levels on human CD4+
T cells are found to be present at a continuous low level with only 2-4% of cells
being CD25high (Baecher-Allan, et al., 2004a). The co-expression of a number
of cell surface markers has been investigated including the murine Tr markers
CD38, CD69 and CD62L which have not proved useful (Dieckmann, et al.,
2001; Taams, et al., 2001; Wing, et al., 2002). Analysis of the CD45R isoforms
has proven more informative, with CD4+CD25+ Tr cells from adult peripheral
blood and tonsils being mainly CD45RO+CD45RA- and CD45RBlow (Dieckmann,
et al., 2001; Taams, et al., 2001) whilst those isolated from cord blood are
CD45RA+ (Wing, et al., 2002; Wing, et al., 2003). To date, the most reliable
marker for isolating human Tr cells is still the expression of CD25high (Baecher-
Allan, et al., 2004a). New cell surface markers are being identified and
examined for their specificity to Tr cells including neuropilin (Bruder, et al., 2004)
and more recently LAG-3 (Huang, et al., 2004). To date, all studies of human Tr
cells have been conducted in vitro and little progress has been made in
understanding their mechanism/s of action (Baecher-Allan, et al., 2004a). Tr
cells with antigen specificity have now been described in a number of disease
settings including B. pertussis (McGuirk, et al., 2002), Hepatitis C (MacDonald,
et al., 2002) and HIV (Aandahl, et al., 2004; Kinter, et al., 2004; Weiss, et al.,
2004). Tr cell involvement has been shown in cancer (Rosenberg, 2001; Curiel,
et al., 2004) as well as autoimmune disease (Wildin, et al., 2001, 2002; Kriegel,
et al., 2004; Baecher-Allan and Hafler, 2004b). While human Tr cells are not yet
as well understood as their murine counterparts, research is progressing rapidly
in this area.
8
Chapter 1 1.3. Generation of Tr cells
T cells are a functionally heterogenous population and as such, the
mechanisms by which they are generated vary for the different subsets of Tr
cells (illustrated in Figure 1.1).
1.3.1. Thymic development
There is considerable evidence demonstrating that a naturally occurring
CD4+CD25+ Tr cell subset develops in the thymus. Because these Tr cells
already have full suppressive activity this has led to the suggestion that they
develop in the thymus (Jordan, et al., 2001) in a manner that requires high
affinity interactions with self antigen (Seddon and Mason, 2000). CD4+CD25+
cells represent 5-10% of CD4+ thymocytes in mice, humans and rats (Papiernik,
et al., 1998; Itoh, et al., 1999; Stephens and Mason, 2000, 2001b). The
adoptive transfer of CD4+CD25+ was also able to abrogate autoimmune disease
(Itoh, et al., 1999; Stephens and Mason, 2000; Singh, et al., 2001). In addition,
day 3 thymectomy of mice resulted in the spontaneous development of
autoimmune disease which could be reversed by the transfer of CD4+CD25+ Tr
cells (Suri-Payer, et al., 1998). Indeed, the thymus appears to be continuously
producing Tr cells as well as effector T cells (Sakaguchi, 2000). These
CD4+CD25+ Tr cells then move to the peripheral tissues where they function to
prevent the action of self-reactive T cells (Sakaguchi, 2001; Akbar, et al., 2003).
Until recently the signals which caused the differentiation of thymus-derived
naturally occurring CD4+CD25+ Tr cells were unknown. The finding that the
transcription factor Foxp3 was required for the development of these cells has
helped to increase understanding of this mechanism (Fontenot, et al., 2003;
Hori, Nomura and Sakaguchi, 2003; Khattri, et al., 2003). More recently a role
for TGF-β in the induction of Foxp3 has been demonstrated, suggesting that
this cytokine is an important signal in the accumulation of Tr cells (Chen, et al.,
2003; Fantini, et al., 2004) and may also be important in the induction of Tr cells
in the CD25- compartment (Zheng, et al., 2004). The importance of TGF-β in
this mechanism has been demonstrated in vivo in diabetes (Peng, et al., 2004).
9
Chapter 1
CD4+CD8+ precursors
Figure 1.1 Generation of Tr cells There are two locations at which Tr cells are generated; the thymus and in the
periphery. The mechanisms of Tr generation are different at these two sites. Thymic
generation appears to rely of the transcription factor Foxp3 whereas peripheral
development of Tr cells is linked to (immature) dendritic cells (iDC) and the presence of
IL-10 and TGF-β.
MHC II affinity
moderate intermediate
CD4+ CD25+ GITR+ Foxp3+
Natural Tr cells
CD4+ effector cells Induced Tr cells CD4+ CD25-
GITR+ CD4+ CD25- GITR-
high/low/none
Positive selection Tr selection Apoptosis
Antigen
Immunogenic Tolerogenic
T H Y M U S
P E R I P mDC iDC H
IL-10 E R
Suppression Y of immune Suppression
of response
to self immune response
10
Chapter 1 1.3.2. Peripheral development
The development of antigen specific Tr cells (Tr1 and Th3 cells) are thought to
take place in the periphery after contact with the antigen presented by dendritic
cells (DC) that are distinct from the DC that promote Th1/Th2 differentiation
(illustrated in Figure 1.2) (McGuirk and Mills, 2002; Mills, 2004; Mills and
McGuirk, 2004). This is thought to occur in conjunction with the presence of the
cytokines IL-10 and TGF-β (Levings, et al., 2002b; Wakkach, et al., 2003). DC
are professional antigen presenting cells which are specialised in the capture,
processing and presentation of antigen to naive T cells in lymphoid organs
(Banchereau and Steinman, 1998). Different DC are able to induce different Th
responses and the heterogeneity among the DC located in the same lymphoid
tissues provides the obvious potential for the versatility in function (Figure 1.2)
(Groux, 2003). Indeed, studies have found that the activation of DC which
secrete IL-10 can direct naive T cells to the Tr1 subtype (Akbari, et al., 2001;
McGuirk, et al., 2002). While the mechanism is not completely understood,
roles have been described for IL-10 and TGF-β (Levings, et al., 2002b;
Wakkach, et al., 2003) as well as other molecules including Vitamin D3 (Adorini,
et al., 2001; Gregori, et al., 2001a; Gregori, et al., 2001b). Work has also been
conducted towards further identification of the type of DC involved in the
induction of Tr cells (Groux, 2003) and these cells have also been described in
humans (Jonuleit, et al., 2000; Roncarolo, et al., 2001).
1.3.3. Induction of Thsupp secondary suppressor cells
A novel mechanism of Tr cell generation in the periphery has also recently been
proposed; the generation of Thsupp or secondary suppressor T cells by Tr cells.
This model proposes that as well as anergising and suppressing CD4+ T cells,
Tr cells confer suppressive properties to these cells in a cell contact-dependent
manner (Dieckmann, et al., 2002; Jonuleit, et al., 2002; Stassen, et al., 2004a).
These cells have been named Th suppressor cells (Thsupp) and function by
cytokine-dependent mechanisms (Stassen, et al., 2004a). The induced Thsupp
cells are either Tr1-like and suppress by secretion of IL-10 (Dieckmann, et al.,
2002; Stassen, et al., 2004a) or Th3-like and produce TGF-β
11
Chapter 1
Adapted from McGuirk and Mills, 2002
Immature DC
DCr
DC2 DC1
Th2 Th1 Th1 Tr
IL-10 & TGF-β IL-4 IFN-γ
Figure 1.2 The role of DC in sensitizing T cells
Immature dendritic cells (DC) come into contact with pathogen-derived molecules in
the periphery following infection. These cells then mature into DC1 and DC2 cells and
drive the differentiation of CD4+ T cells to Th1 cells (involved in cell mediated immunity
and inflammation) or Th2 cells (involved in humoral immunity). In a third arm, other
pathogen-derived molecules drive the maturation of DCs into DCr which induce Tr
cells. Tr cells act to suppress the Th1 and Th2 immune response through the release
of anti-inflammatory cytokines (IL-10 and TGF-β) or cell-contact.
12
Chapter 1
l., 2004a). In vitro, data for human Tr cells
1.4. Mechanisms of suppression
there are two main mechanisms by
(Jonuleit, et al., 2002; Stassen, et a
shows that the type of Thsupp cells induced can be linked to the expression of
different integrins on the cell surface of CD4+CD25+ Tr cell subsets, with α4β1+ Tr
cells inducing Th3-like cells, whereas α4β7+ Tr cells induce Tr1-like cells (Figure
1.3) (Stassen, et al., 2004a). The authors of these papers suggest that these
findings may potentially reconcile the observation that naturally occurring
CD4+CD25+ Tr cells mediate suppression by cell contact-dependent
mechanisms, whilst the induced Tr1 and Th3 Tr subsets suppress via cell
contact-independent mechanisms (Stassen, et al., 2004a). It may also provide
an explanation for differences in Foxp3 expression in naturally occurring and
antigen-induced Tr cells. However, whilst an extremely interesting proposition,
to date this phenomenon has only been described in vitro for human
CD4+CD25+ Tr cells and has yet to be investigated in mice and in vivo.
It has now become well established that
which Tr cells mediate suppression; secretion of immunosuppressive cytokines
and cell-to-cell contact. The mechanism of action of Tr cells was initially an
area of some confusion, with many contradicting reports as to the roles of
cytokines and cell-contact in mediating suppression. This confusion may have
been due to the extremely rapid expansion of this field of research, together
with the heterogeneity of Tr cells. The method of suppression appears to vary
between subtypes of Tr cells however there is some overlap between the
expression of cell surface markers and the secretion of cytokines which
suggests that the two are not necessarily mutually exclusive (see Figure 1.4).
This appears to be the case for the Tr cells induced by Friend virus (Iwashiro, et
al., 2001), an induced colitis/Leishmania model (Liu, et al., 2003) and in graft
rejection (Kingsley, et al., 2002). Interestingly, Tr cells which secrete
immunosuppressive cytokines but mediate functional suppression by
cytokine-independent mechanisms have also been described (Vieira, et al.,
2004; Weiss, et al., 2004).
13
Chapter 1
tudies have shown that in vitro, human CD4+CD25+ Tr cells from peripheral blood
02;
IL-10
TGF-β
CD4+CD25+
α4β1+
α4β7+
Cell contact with
Tr cell
Figure 1.3 Induction of Thsupp cells by naturally occurring CD4+CD25+ Tr
CD4+ Th cells
Th3-like Thsupp
Tr1-like Thsupp
cells
S
are able to induce CD4+ Th cells to become either Tr1-like or Th3-like suppressor
cells (Thsupp) in a manner that is dependent on the expression of different integrins
on the cell surface. These cells were found to secrete the immunosuppressive
cytokines IL-10 (Tr1) and TGF-β (Th3) to exert cytokine-dependent suppression.
It is suggested that these findings may reconcile the observed differences between
cell-contact dependent suppression mediated by naturally occurring CD4+CD25+ Tr
cells and antigen-induced Tr1 and Th3 cells in both mice and humans. This theory
has yet to be tested in mice and in vivo. (Dieckmann, et al., 2002; Jonuleit, et al., 20
Stassen, et al., 2004a)
14
Chapter 1
.4.1. Contact-mediated suppression
in mechanism by which naturally
occurring CD4 CD25 T cells mediate suppression, at least in an in vitro setting
et a
ontact-mediated suppression and cytokines in the functioning of T
.4.2. Cytokines
ctor cells by the immunosuppressive cytokines IL-10 and
TGF-β have been described as the primary mechanism of action for the
1
Cell-to-cell contact appears to be the ma+ +
r
(Figure 1.4A). The requirement for cell contact has been elegantly shown using
transwell experiments, where it was the physical separation of Tr and effector
cells, not the addition of neutralizing anti-IL-10 or anti-TGF-β antibodies, which
abrogated suppression (Takahashi, et al., 1998; Thornton and Shevach, 1998;
Shevach, 2000, 2001). A role for CTLA-4 has also been described (Chen, et
al., 1998; Read, et al., 2000; Salomon, et al., 2000; Iwashiro, et al., 2001). In
vivo, blockade of the costimulatory molecules GITR (Shimizu, et al., 2002;
McHugh, et al., 2002a; Ji, et al., 2004) and CTLA-4 has also been effective in
abrogating suppression (Leach, et al., 1996; Tivol, et al., 1997; Walunas and
Bluestone, 1998; Sutmuller, et al., 2001; Egen, et al., 2002; Kingsley, Karim,
Bushell and Wood, 2002). In the case of the CD4+CD25+ Tr cells that have
been described in HIV there is in vitro evidence that these cells function by
contact-dependent mechanisms (Kinter, et al., 2004; Weiss, l., 2004).
However, there is also evidence that there may be a more complex interaction
between c r
cells, with a number of situations now described where suppression is reliant on
both (Iwashiro, et al., 2001; Kingsley, et al., 2002; Liu, et al., 2003). Indeed, in
the case of HIV there is evidence that the Tr cells produce IL-10 and TGF-β
even though in vitro suppression is cytokine-independent (Weiss, et al., 2004).
It may indeed be the case that in vivo, Tr cells use a combination of both
mechanisms in order optimally suppress effector cells whilst generating further
regulatory cells (possibly via the generation of Thsupp cells, see Chapter 1.3.1) to
amplify the suppressive signal (Figure 1.4C).
1
Suppression of effe
antigen-induced Tr1 and Th3 Tr cell subsets (Figure 1.4B). Indeed, Th3 cells
are characterised by their production of TGF-β (Weiner, 2001) and Tr1 cells
secrete both IL-10 and TGF-β but are characterised by very high level IL-10
15
Chapter 1
. Cell contact-dependent suppression via CTLA-4 and GITR in non-inflammatory
ctious disease.
Adapted from (Bluestone and Abbas, 2003).
B A C
Tr Th
APC
Tr Th
APC
Contact dependent
Tr
APC
Th
APC
IL-10 TGF-β
Tr Tr
IL-10 TGF-β
Th
APC
Figure 1.4 Mechanisms of suppression by Tr cells A
settings, used by naturally occurring CD4+CD25+ Tr cells.
B. Cytokine-dependent suppression via IL-10 and/or TGF-β secretion, used by Tr1 and
Th3 Tr cells in autoimmune disease, inflammation and infe
C. Induction of secondary Tr cells (Thsupp) by cell-contact dependent mechanisms, and
subsequent cytokine-dependent mechanisms (Chapter 1.3.1, Figure 1.3).
16
Chapter 1
suppressive
ession has been described in the gut
link has been suggested between CTLA-4 and TGF-β
hen, et al., 1998; Sullivan, et al., 2001). These findings are in relation to Th3
hile the goal of finding a single definitive Tr cell marker has not yet been
ic markers that are currently being
Despite variations in these phenotypic
secretion (Groux, et al., 1997; Roncarolo, et al., 2003). The secretion of
cytokines would allow for the wider disbursement of the immuno
signal. The role of IL-10 in Tr cell suppr
(Powrie, et al., 1994a,1994b; Groux, et al., 1997; Asseman, et al., 1999),
tolerance to alloantigens (Hara, et al., 2001; Kingsley, et al., 2002) and
infectious disease (MacDonald, et al., 2002; McGuirk, et al., 2002; Erdman, et
al., 2003). Further to this IL-10 and TGF-β have been shown to act together in
airway eosinophilia (Akbari, et al., 2002; Zuany-Amorim, et al., 2002), cancer
(Seo, et al., 2001) and in colitis (Fuss, et al., 2002; Liu, et al., 2003). TGF-ß
mediated suppression by Tr cells has been described in diabetes (Peng, et al.,
2004). It has also been suggested that suppression may be mediated by cell
surface-bound TGF-β (Nakamura, et al., 2001) although this has been disputed
(Piccirillo, et al., 2002).
As further evidence that contact-dependent and –independent mechanisms are
not mutually exclusive a
(C
Tr cells which appear to rely on both TGF-β and CTLA-4 to exert their
suppressive effects (Prud'homme and Piccirillo, 2000; Chen and Wahl, 2003).
In Friend virus infection Tr cells were found to function by TGF-β and CTLA-4
dependent mechansims (Iwashiro, et al., 2001).
1.5. Phenotypic characteristics
W
achieved, there are a number of phenotyp
used to define this subset of cells.
characteristics all of the Tr cells studied have the common ability to suppress
the effector cells, thereby altering the immune response to an antigen/pathogen.
The expression of particular cell surface markers, the secretion of
immunosuppressive cytokines and expression of a transcription factor have all
been used to help to identify Tr cells in a number of different models and are
discussed in greater detail below.
17
Chapter 1
ell surface markers that have been used by
arious groups investigating Tr cells in a variety of different models. The
is common to the majority of these cell surface
markers is that they are also markers of cell activation or of memory status and
ith the β chain
D122) and γc unit to form the complete IL-2 receptor (Ellery and Nicholls,
ecule is not expressed on naive T cells but is upregulated upon
stimulation of the T cell receptor (TCR) (Szamel, et al., 1998; Ellery and
1.5.1. Cell surface markers
There are a number of different c
v
characteristic, and caveat, that
none are exclusively expressed on Tr cells. Due to the variety of markers that
has been used to identify Tr cells and the homogenous nature of this cell
subset, work is now being undertaken to try and reconcile the cell surface
markers used in one model system with other models. This will help to
establish whether there are distinct subsets or Tr cells active in different models
or whether one subset is active in a number of immunological settings. To date,
the vast majority of Tr cells are CD4+ T cells, and as such the cell surface
markers reviewed below are those expressed on CD4+ Tr cells.
1.5.1.1. CD25
CD25 is the α chain of the IL-2 receptor, which complexes w
(C
2002). This mol
Nicholls, 2002). The cell surface marker CD25 has been shown to be
constitutively expressed by 5-10% of peripheral CD4+ T cells at higher levels
than is observed in activated cells (Sakaguchi, et al., 1995). Studies involving
the transfer of CD25-depleted T cells into athymic nude mice showed that these
animals developed a plethora of organ-specific autoimmune diseases which
could be prevented or reversed by the transfer of CD4+CD25+ T cells into these
animals (Sakaguchi, et al., 1995). These findings were seminal in reviving Tr
cells both as an immunological concept and as an active field of research.
Indeed, CD25 is the marker still used to define the majority of Tr cells and
provides the starting point for determining the involvement of these cells in
many models. The involvement of CD4+CD25+ has now been described in a
number of different settings including cancer (Onizuka, et al., 1999; Shimizu, et
al., 1999; Antony and Restifo, 2002; Jones, et al., 2002; Tawara, et al., 2002;
Chen and Wahl, 2003) and autoimmune disease (Sakaguchi, et al., 1995;
Asano, et al., 1996; Suri-Payer, et al., 1998; Takahashi, et al., 1998; Takahashi,
18
Chapter 1
first defined as a marker of memory T cells in the late 1980s
kbar, et al., 1988; Sanders, et al., 1988), with the isoforms CD45RA and
CD45RO expressed by humans, CD45RB in mice and CD45RC in rats, each of
nd high molecular weight isoform which is produced by
et al., 2000; Furtado, et al., 2001; McHugh, et al., 2001; Sakaguchi, et al., 2001;
Singh, et al., 2001; McHugh and Shevach, 2002b). More recent work has
shown that CD4+C25+ Tr cells also play an important role in a variety of
infectious diseases (Belkaid, et al., 2002; Hesse, et al., 2004; Joshi, et al., 2004;
Mendez, et al., 2004). Perhaps one of the most important aspects of research
into CD25 as a marker of Tr cells is the presence of this marker on a
corresponding population of Tr cells in humans (Chapter 1.2.2.5) (Baecher-
Allan, et al., 2001; Wing, et al., 2002). While certainly not a perfect marker for
all Tr cells, CD25 is still the most useful markers available and treatments
targeting this marker have shown some success (Onizuka, et al., 1999; Jones,
et al., 2002).
1.5.1.2. CD45RB
CD45R was
(A
which has a low a
differential splicing (Trowbridge and Thomas, 1994). Expression of CD45Rhigh
was associated with naive cells whilst CD45Rlow expression was associated
with activated or memory cells (Bell, et al., 1998). This cell surface marker was
initially investigated in the context of inflammatory bowel disease, where it was
found that the transfer of CD4+CD45RBhigh cells induced gut inflammation,
which could be prevented or reversed by the transfer of CD4+CD45RBlow cells
(Powrie, et al., 1994a; Powrie, et al., 1994b). These CD4+CD45RBlow Tr cells
can also be antigen-specific as demonstrated in a transplantation model (Hara,
et al., 2001), allergic airway disease (Zuany-Amorim, et al., 2002) and H.
hepaticus infection (Kullberg, et al., 2002). CD4+CD45RBlow Tr cell-mediated
suppression has been shown to be IL-10 dependent (Asseman, et al., 1999;
Hara, et al., 2001; Singh, et al., 2001; Kingsley, et al., 2002) and there is some
evidence for the involvement of CTLA-4 (Read, et al., 2000; Kingsley, et al.,
2002). CD45RBlow expression has also been shown to correlate well with the
expression of CD25 on Tr cells (Read, et al., 2000; Singh, et al., 2001; Kingsley,
et al., 2003). Indeed, CD45RBlow expression has been demonstrated on Tr1,
Th3 and CD4+CD25+ Tr cells (Groux, 2003). CD38 expression has also been
19
Chapter 1
phocytes to peripheral lymph nodes (Gallatin,
et al., 1983; Siegelman, et al., 1990). CD62L is constitutively expressed on
ll types including T and B cells, neutrophils, eosinophils and
and
ere are many similarities between the mouse and human homologues
(Esplugues, et al., 2003). CD69 is expressed constitutively by platelets, mature
bone marrow myeloid and lymphoid precursors but not on
found to correlate with suppressive activity in conjunction with CD45RB
expression (Read, et al., 1998).
1.5.1.3. CD62L
CD62L, or L-selectin, is a member of the selectin adhesion molecule family and
is required for the homing of lym
many different ce
monocytes (Lewinsohn, et al., 1987; Iwabuchi, et al., 1991). CD62L is rapidly
down regulated from the cell surface upon activation of the cell (Jung, et al.,
1988). The level of CD62L expression is also found to correlate with the
activation state of cells, with naive cells being CD62Lhigh whereas
activated/memory cells are CD62Llow (Sprent and Tough, 1994). CD62L was
described as a marker of Tr cells in the NOD mouse model of diabetes
(Herbelin, et al., 1998; Lepault and Gagnerault, 1998). These cells were shown
to regulate autoreactive effector cells, resulting in reduced disease in cell
transfer experiments (Herbelin, et al., 1998). It was shown that transfer of
CD4+CD62Llow cells was able to delay the onset of diabetes in NOD mice in a
dose dependent, IL-10 independent manner (Lepault and Gagnerault, 2000).
These cells were found to migrate to the pancreas and modify the migration of
infiltrating diabetogenic cells, resulting in a decreased severity of disease
(Lepault and Gagnerault, 2000). More recently, CD62L expression has been
used to differentiate between different subsets of Tr cells. Both
CD4+CD25+CD62L+ and CD62L- cells were found to be anergic, express Foxp3
and inhibit CD4+CD25-CD45RBhigh cell-induced colitis in scid mice however the
CD62L+ cells were found to be more potent suppressors (Fu, et al., 2004).
1.5.1.4. CD69
CD69 is the earliest activation cell surface marker to appear on leukocytes
th
thymocytes and
lymphocytes in peripheral blood (Testi, et al., 1994). Expression of CD69 has
been reported on small subsets of B and T cells in peripheral lymphoid tissues
20
Chapter 1
ilin 1 (Nrp1, also known as BCDA-4) was first described in neurons
here it is involved in axon guidance, as well as in vascular and tumour biology
(Kawakami, et al., 1996; Klagsbrun, et al., 2002). Studies have found that in
volved in mediating the contacts between DCs and T
(Testi, et al., 1994; Esplugues, et al., 2003). CD4+CD69+ Tr cells were found to
be induced following chronic infection with Friend leukemia virus (FV) (Iwashiro,
et al., 2001). Chronically FV-infected mice were found to be unable to reject
several types of immunonogenic tumour that uninfected mice were able to clear.
This suppression of the anti-tumour response was found to be mediated by
CD4+ T cells and could be transferred to naive mice with the transfer of CD4+ T
cells (Iwashiro, et al., 2001). Flow cytometric analysis found that CD4+CD69+ Tr
cells were present in greater numbers following infection. The virus-induced
and naive CD4+CD69+ Tr cells were both found to suppress CD8+ effector T
cells in a TGF-β and CTLA-4 dependent, IL-10 independent manner (Iwashiro,
et al., 2001). It is not clear whether CD69+ CD4 T cells represent a novel
subset of Tr cells or a further subset of CD4+CD25+ Tr cells as the
CD4+CD25+CD69+ T cells were found to be present in both naive and infected
mice.
1.5.1.5. Neuropilin 1
Neurop
w
humans Nrp1 is also in
cells via homophilic interactions and plays an essential role in the initiation of
the primary immune response (Dzionek, et al., 2002; Romeo, et al., 2002;
Tordjman, et al., 2002). Nrp1 was identified as a specific cell surface marker for
CD4+CD25+ Tr cells using microarray global gene expression studies (Bruder, et
al., 2004). Nrp1 was found to be constitutively expressed by CD4+CD25+ Tr
cells independent of their activation status, in contrast to its down regulation
following TCR stimulation of CD4+CD25- cells. The study also went on to show
that CD4+Nrp1high cells expressed high levels of Foxp3 and had suppressive
function in vitro. These results have led to Nrp1 being considered a useful
marker for distinguishing Tr cells from activated non-Tr cell subsets.
21
Chapter 1 .5.1.6. Integrins
e now documented the expression of integrins on the cell
surface of T cells in mice, and more recently, in humans. As well as allowing
.5.1.7. CD152 (CTLA-4)
Cytotoxic T lymphocyte antigen-4 (CTLA-4) is a transmembrane protein which
is predominantly expressed on T cells (Brunet, et al., 1987). The majority of
CTLA-4 is intracellular and is expressed at very low levels on the cell surface of
1
Several studies hav
r
further subdivision of the currently described Tr subsets, integrin expression
may also provide clues as to how Tr cells home to, or remain in, the site of
infection to mediate suppression. Global gene analysis found that αE integrin
was expressed on naturally occurring CD4+CD25+ Tr cells in mice (Gavin, et al.,
2002; Zelenika, et al., 2002; McHugh, et al., 2002a). The only known ligand for
αEβ7 integrin (CD103) is E-cadherin, which is expressed on epithelial cells but
not on the endothelium (Cepek, et al., 1994). In mice the expression of αEβ7
integrin (CD103) was found to comprise approximately 4% of all CD4+ T cells
and 25%of CD4+CD25+ T cells and correlate with the CD25, CTLA-4 and
CD45RBlow expression of CD4+ T cells from lymphoid organs (Lehmann, et al.,
2002). In vitro studies found that CD4+CD25+αEβ7+ cells secreted IL-10 upon
stimulation and were highly suppressive, however suppression was found to be
cell-contact dependent and did not involve either IL-10 or TGF-β (Lehmann, et
al., 2002). An independent study confirms that CD4+CD25+αEβ7+ were more
efficient at suppressing effector cells in vitro (McHugh, et al., 2002a). In vivo
CD4+CD25+αEβ7+ were found to inhibit the development of CD45RBhigh cell
transfer induced colitis in SCID mice (Lehmann, et al., 2002). Human
CD4+CD25+ Tr cells were not found to express CD103, however they could be
divided into two subpopulations based on the expression of either α4β1 or α4β7
integrin (Stassen, et al., 2004a). Both subsets were able to suppress the
proliferation of CD4+ T cells in co-culture experiments and contained substantial
levels of the Tr transcription factor Foxp3 (Stassen, et al., 2004a). The two
subsets were found to differ in the type of secondary suppressor cells that were
induced in vitro, with α4β1+ Tr cells inducing Th3-like, TGF-β secreting Thsup
cells and α4β7+ Tr cells inducing Tr1-like, IL-10 secreting Thsup cells (Stassen, et
al., 2004a).
1
22
Chapter 1
ctivation occurs (Alegre, et al., 1996). CTLA-4
ITR (also known as TNFRSF18) was originally cloned from a murine T cell
hybridoma (Nocentini, et al., 1997). A human homologue has also been cloned
(Gurney, et al., 1999). In mice, GITR was initially found to be expressed in T
cells from lymphoid tissue and its expression was found to be inducible by
resting cells until cellular a
competes with the costimulatory molecule CD28 for two ligands; CD80 and
CD86 which are found on antigen presenting cells (Sansom, 2000). It is
generally accepted that CTLA-4 plays a role in the inhibition of T cell activation
(Walunas and Bluestone, 1998). Blocking CTLA-4 enhances T cell proliferation
and ligation of CTLA-4 with agonistic antibodies results in a suppression of T
cell proliferation (Krummel and Allison, 1995). CTLA-4 knockout mice develop
a fatal lymphoproliferative disease by 3-4 weeks of age due to the infiltration of
polyclonally activated T cells into multiple organs, underscoring the role of
CTLA-4 in maintaining self tolerance (Krummel and Allison, 1995; Tivol, et al.,
1997; Khattri, et al., 1999). CTLA-4 blockade in normal mice was found to
result in the development of autoimmune disease (Takahashi, et al., 2000).
CTLA-4 has been found to be constitutively expressed on CD4+CD25+ Tr cells
in naive mice and in intestinal autoimmune disease (Read, et al., 2000;
Takahashi, et al., 2000). A link has also been suggested between CTLA-4 and
TGF-β (Chen, et al., 1998), however this has proved controversial (Sullivan, et
al., 2001). More recent results have been able to reconcile these findings
somewhat in relation to Th3 Tr cells which appear to rely on both TGF-β and
CTLA-4 to exert their suppressive effects (Prud'homme and Piccirillo, 2000;
Chen and Wahl, 2003). A number of reports indicate that Tr cells in several
models including Friend virus infection (Iwashiro, et al., 2001), intestinal
inflammation (Read, et al., 2000), colitis and leishmania (Liu, et al., 2003)
mediate suppression via TGF-β and CTLA-4 dependent mechanisms. CTLA-4
and IL-10 dependent suppression has been reported in graft rejection (Kingsley,
et al., 2002). Targeting of CTLA-4 has also been used successfully in the
treatment of cancer either in conjunction with anti-CD25 mAb (Sutmuller, et al.,
2001) or alone (Leach, et al., 2002).
1.5.1.8. Glucocorticoid-induced tumor necrosis factor receptor
family-related gene (GITR)
G
23
Chapter 1
fun ule on naive resting T cells however further
okines are able to act in
both a highly localized and a systemic manner and in this way help to direct the
Banyer, et al., 2000). The two key Tr cytokines, IL-10 and
, et al., 1995), B cells (Fiorentino, et al., 1991) and activated
, et al., 1990) and is able to act on a large variety of
activation with various stimuli (Nocentini, et al., 1997). GITR is thought to
ction as a costimulatory molec
studies are required to determine its role and mechanism of action in other cell
types. With regards to Tr cells it was recently found that GITR is predominantly
expressed by CD4+CD25+ T cells and CD4+CD25+CD8- thymocytes in naive
mice (Shimizu, et al., 2002). In vitro and in vivo studies have shown that
stimulation of GITR is able to abrogate CD4+CD25+ T cell mediated suppression
(Shimizu, et al., 2002). Indeed the removal of GITR expressing cells by
treatment with anti-GITR mAb was found to result in the development of organ
specific autoimmune disease (Shimizu, et al., 2002). Interestingly the
enhancement of GITR expression on CD4+CD25- T cells was not found to
confer any suppressive function to these cells, indicating that GITR is not
essential for the development of Tr cells (Shimizu, et al., 2002). GITR has been
found to be expressed on alloantigen-specific CD4+CD25+ Tr cells after
exposure to alloantigen (Zelenika, et al., 2002) and also on naturally occurring
Tr cells (Shimizu, et al., 2002; McHugh, et al., 2002a).
1.5.2. Cytokines
Cytokines are known to play important roles in both innate and adaptive
immunity, regulating the development and extent of the immune response to a
large variety of pathogens. Which cytokines are expressed helps to determine
response. Cytthe types of cells involved in the immune
immune response (
TGF-β, are reviewed below as well as other cytokines that have been shown to
be involved in either the development, maintenance or function or Tr cells.
1.5.2.1. Interleukin-10 (IL-10)
IL-10 is a cytokine with pleiotropic functions, it has both immunostimulatory and
immunoregulatory effects (Wakkach, et al., 2000). In mice IL-10 is secreted by
a wide variety of immune cells including CD4+ T cells (Sher, et al., 1992), CD8+
T cells (Sad
macrophages (O'Garra
24
Chapter 1
000). A viral homologue of IL-10 is encoded
n shown to act on all classes
f immune cells (Letterio and Roberts, 1998; Prud'homme and Piccirillo, 2000).
TGF-β has been shown to be involved in CD4+ T cell development and effector
relik and Flavell, 2002),
lymphoid cells (Wakkach, et al., 2
by the Epstein-Barr virus (EBV) (Moore, et al., 1990) as well as a number of
other human and mammalian viruses (Fickenscher, et al., 2002). The main
function of IL-10 appears to be down regulation of the inflammatory immune
response following infection with a pathogen in order to prevent host pathology
(Levings, et al., 2002b). IL-10 has also been shown to down regulate the
expression of the costimulatory molecules CD80 and CD86 as well as MHC
class II (Moore, et al., 2001). The role of IL-10 in the induction and
maintenance of Tr cells has been reviewed in Chapter 1.3 of this thesis. The
role of IL-10 in Tr cell suppression has been described in a number of different
models including colitis (Powrie, et al., 1994b; Groux, et al., 1997), intestinal
inflammation (Asseman, et al., 1999), tolerance to alloantigens (Hara, et al.,
2001; Kingsley, et al., 2002) and infectious disease (MacDonald, et al., 2002;
McGuirk, et al., 2002; Erdman, et al., 2003; Blanchard, et al., 2004). IL-10 and
TGF-β have been shown to act in concert in a model of airway eosinophilia
(Akbari, et al., 2002; Zuany-Amorim, et al., 2002), cancer (Seo, et al., 2001) and
in colitis (Fuss, et al., 2002; Liu, et al., 2003).
1.5.2.2. Transforming Growth Factor-β (TGF-β)
TGF-β consists of a family of three closely related isoforms; TGF-β 1, 2 and 3
(Letterio and Roberts, 1998; Prud'homme and Piccirillo, 2000). TGF-β1 is
secreted by every leukocyte lineage and has bee
o
function (Heath, et al., 2000; Gorelik, et al., 2002; Go
dendritic cell development and function (Gorelik, et al., 2002), B cell
responsiveness as well as monocyte and macrophage function, NK cells,
neutrophils and myeloid cells (Letterio and Roberts, 1998). The role of TGF-β
in the induction of Tr cells is discussed in Section 1.3 of this chapter. The
secretion of TGF-β is considered a primary characteristic of the Th3 Tr cell
subset which was first described in relation to oral tolerance (Weiner, 2001).
TGF-β is also secreted by some human Tr cells (Levings, et al., 2002a).
However, TGF-β independent Tr cells have also been described demonstrating
that TGF-β is not essential for function of all Tr cell subsets (Piccirillo, et al.,
25
Chapter 1
hich are
xpressed exclusively in Tr cells (or at much higher levels than in other cells)
may allow for better identification of Tr cells and also lead to a better
ells develop.
e T cell function through its ability to
ind DNA and repress transcription. This then results in attenuated activation-
induced cytokine production and proliferation, thereby playing a role in
cale of the response of CD4+ T cells to activation (Schubert, et
2002). It has also been suggested that contact-dependent suppression may be
mediated by cell surface-bound TGF-β (Nakamura, et al., 2001). A somewhat
controversial link has also been suggested between CTLA-4 and TGF-β (Chen,
et al., 1998; Sullivan, et al., 2001). These findings are clarified somewhat in
relation to Th3 Tr cells which appear to rely on both TGF-β and CTLA-4 to exert
their suppressive effects (Prud'homme and Piccirillo, 2000; Chen and Wahl,
2003). TGF-β mediated suppression by Tr cells has been described in cancer
(Seo, et al., 2001), colitis (Liu, et al., 2003), allergic asthma (Zuany-Amorim, et
al., 2002), autoimmune thyroiditis in rats (Seddon and Mason, 1999) and most
recently in diabetes (Peng, et al., 2004). In Friend virus infection Tr cells were
found to function by TGF-β and CTLA-4 dependent mechanisms (Iwashiro, et
al., 2001) and knockout mouse studies have found that TGF-β and CTLA-4
represent distinct mechanisms of suppression (Sullivan, et al., 2001).
1.5.3. Molecular markers
To date, no cell surface marker exclusive to Tr cells has been defined. This,
together with enormous advances in gene analysis technology, has partially
turned the focus of Tr cell research to molecular markers. Genes w
e
understanding of how these c
1.5.3.1. Foxp3
The gene Foxp3 encodes scurfin, a protein that belongs to the forkhead/ winged
helix family of transcriptional regulators (Hori, et al., 2003; O'Garra and Vieira,
2003). Scurfin is able to negatively regulat
b
determining the s
al., 2001). Mutations in or the absence of Foxp3 results in lymphoproliferative
disorders, wasting disease and inflammatory bowel disease (IBD) in mice
(Fontenot, et al., 2003; Khattri, et al., 2003) and immunodysregulation,
polyendocrinopathy, enteropathy, X-linked (IPEX) syndrome in humans (Wildin,
26
Chapter 1
nd infectious disease it is the induction of Tr cells that leads to
isease progression (Shimizu, et al., 1999; Sakaguchi, et al., 2001). Yet there
are also examples of Tr cells in infectious disease providing a protective and
It is this variety of roles that Tr cells
et al., 2001; Wildin, et al., 2002). Recent studies have shown that Foxp3 plays
a crucial role in the development of Tr cells (Fontenot, et al., 2003; Hori, et al.,
2003; Khattri, et al., 2003). It was found that Foxp3 mRNA was predominantly
expressed by CD4+CD25+ naturally occurring Tr cells in the thymus of naive
mice (Hori, et al., 2003). Expression of Foxp3 in CD4+CD25- T cells was found
to confer a Tr-like phenotype to these cells, indicating that Foxp3 is essential for
the development of Tr cells (Chen, et al., 2003; Fontenot, et al., 2003; Hori, et
al., 2003; Khattri, et al., 2003). Indeed Foxp3 expression has been found to
correlate well with suppressive activity when alternative Tr cell surface markers
such as Nrp1 are examined in mice (Bruder, et al., 2004; Zheng, et al., 2004;
Stassen, et al., 2004a) and also in humans (Walker, et al., 2003; Oswald-
Richter, et al., 2004; Weiss, et al., 2004). These findings have resulted in a
greater understanding of the development of Tr cells in both the thymus and
periphery (O'Garra and Vieira, 2003; Sakaguchi, 2003; Hori and Sakaguchi,
2004). However, Foxp3 does not appear to be critical for the development of
some antigen-specific Tr cells which arise in the periphery (Vieira, et al., 2004).
These results suggest that there is a second, Foxp3-independent, pathway
involved in the development of Tr cells which encounter antigens in the
periphery.
1.6. The role of Tr cells in disease
The role of Tr cells in disease is a complex one; in autoimmune disease and
transplantation it is the absence of these cells that results in pathology whereas
in cancer a
d
ultimately beneficial outcome for the host.
play in disease that best reflects their ubiquitous nature, their importance in the
maintenance of homeostasis and the diversity of subsets and physical locations
of this pivotal part of the immune system. The following sections explore the
diverse roles of Tr cell subsets in disease, with a particular emphasis on
infectious disease as this is ultimately the focus of the work presented in this
thesis.
27
Chapter 1
ecific for donor alloantigens which play a crucial role in the induction of
ansplant tolerance. To date, the presence of alloantigen-specific Tr cells + + n demonstrated in vivo in models of both
organ (Hara, et al., 2001; Sakaguchi, et al., 2001; Kingsley, et al., 2002; Trani,
ince then many papers have been published examining the role of Tr
ells in tumour development and the effect that manipulation or removal of
on disease outcome in a number of different tumor models
including melanoma (Shimizu, et al., 2001; Sutmuller, et al., 2001; Jones, et al.,
r
1.6.1. Transplantation tolerance
One of the major problems faced in transplantation is the rejection of the
transplanted organ. Whilst there are many factors important for graft survival
there is an increasing body of data demonstrating that there are CD4+CD25+ Tr
cells sp
tr
which are CD4 CD25 T cells has bee
et al., 2003) and bone marrow transplantation (Sakaguchi, et al., 1995; Cohen,
et al., 2002; Hoffmann, et al., 2002). This suppression appears to be mediated
by CTLA-4 and IL-10 (Kingsley, et al., 2002). The active suppression of donor
reactive cells is emerging as a key mechanism for inducing and maintaining
unresponsiveness to donor alloantigens in a transplantation setting.
Accumulating evidence suggests that manipulation of immunoregulation
through the induction/manipulation of Tr cells and deletion of donor reactive T
cells could provide effective mechanisms to control immune responsiveness
after organ or cell transplantation (Wood and Sakaguchi, 2003; Waldmann, et
al., 2004; Wood, et al., 2004). Therapies will also have to try and prevent the
development of autoimmune disease that may develop due to the depletion of
Tr cells.
1.6.2. Cancer
The involvement of Tr cells , or T suppressor cells as they were then known, in
the development of cancer has been investigated since the mid-1980s (North
and Bursuker, 1984; North, 1985, 1986; North, et al., 1989; North and Awwad,
1990). S
c
these cells has
2002), lymphoma (North and Awwad, 1990), myeloma (Onizuka, et al., 1999),
leukemia (Onizuka, et al., 1999), glioma (Segal, et al., 2002) and sarcoma
models (North and Bursuker, 1984; Onizuka, et al., 1999). It is proposed that
Tr cells down regulate the anti-tumour immune response, allowing cancer
progression. The T cells involved in the B16 melanoma model have been
28
Chapter 1
that immunotherapy to
eat malignant metastatic melanoma results in the development of vitiligo, a
n be
versed by the adoptive transfer of syngeneic CD4+CD25+ cells (Sakaguchi, et
shown to function by IL-10 and TGF-β dependent mechanisms (Seo, et al.,
2001) and IL-10 dependent mechanisms are also involved in a glioma model
(Segal, et al., 2002) suggesting that these cells may be Tr1 or Th3 Tr cells.
However, CTLA-4 may also be important in mediating Tr cell suppression
(Sutmuller, et al., 2001). The research of North and colleagues demonstrated
early on that manipulation of T suppressor cells resulted in remission of the
tumour (North, 1986; North and Awwad, 1990). Further characterization of Tr
cells has allowed the development of more targeted therapies using monoclonal
antibodies. The depletion of Tr cells by treatment with anti-CD25 mAb has been
shown to be effective in retarding or even suppressing tumor growth (Onizuka,
et al., 1999; Jones, et al., 2002; Tawara, et al., 2002). The antibody blockade of
CTLA-4 has also been shown to augment anti-tumour immunity by acting in
synergy with CD25 depletion (Sutmuller, et al., 2001).
The ultimate goal of this research would be to provide an effective and specific
immunotherapy for cancer without all of the serious side effects that result from
current treatments such as chemotherapy and radiation therapy. However, as
with the induction of transplant tolerance one of the side effects of depletion of
Tr cells that must be considered is the development of autoimmune disease
(Antony and Restifo, 2002). It has already been shown
tr
destruction of melanocytes, in people who respond completely to the therapy
(Rosenberg, 2001). This suggests that immunotherapy targeting Tr cells may
have to be used in conjunction with other therapies in order to try and prevent
severe side effects. Research will be required to give a better understanding of
the antigen specificity of these cells, perhaps leading to a tissue specific
disruption of suppression and therefore reducing autoimmune side effects.
1.6.3. Autoimmune disease
Organ-specific autoimmune disease can be induced in naive mice by day 3
thymectomy or the treatment of adult mice with anti-CD25 mAb (Sakaguchi, et
al., 1995; Asano, Toda, Sakaguchi and Sakaguchi, 1996; McHugh, et al., 2001;
Shevach, et al., 2001; McHugh and Shevach, 2002b). This disease ca
re
29
Chapter 1
was through cell contact-dependent, cytokine-
m. It therefore
akes sense that the intestine would have efficient mechanisms for the
establishment of tolerance including the induction of Tr cells (Tsuji, et al., 2003).
e transfer of
al., 2001). It was found that this
independent T cell interactions (McHugh, et al., 2001). It has been proposed
that CD4+ CD25+ T cells recognise organ-specific antigens and are
subsequently recruited to sites of autoimmune damage where they are
activated by their target antigen, and physically interact with auto-reactive
effector cells to suppress the development of autoimmune disease.
Experimental evidence which supports this hypothesis can be found in a
number of animal models. Non-obese diabetic (NOD) mice spontaneously
develop insulitis due to the destruction of islet cells in the pancreas by infiltrating
lymphocytes, particularly CD8+ T cells (Charlton, et al., 1989; Lepault and
Gagnerault, 1998). A population CD4+CD25+ and/or CD62Llow Tr cells have
been shown to help prevent the onset of diabetes in this model in a cytokine-
independent manner (Lepault and Gagnerault, 2000; Chatenoud, et al., 2001; et
al., 2004). In a mouse spontaneous EAE model EAE development was
prevented by the transfer of CD4+ Tr cells from syngeneic mice (Furtado, et al.,
2001). Two further examples, autoimmune disease in the gastrointestinal tract
and allergic asthma are discussed in more detail below.
1.6.3.1. Autoimmune disease of the gastrointestinal tract
The gastrointestinal tract is exposed to many different exogenous antigens
including food and commensal bacteria and is an organ where the maintenance
of peripheral tolerance is paramount to the health of an organis
m
Autoimmune disease can be induced in scid or nude mice by th
CD4+ T cells depleted of CD45RBlow cells from syngeneic (normal BALB/c) mice
(Powrie, et al., 1994a, 1994b; Groux, et al., 1997; Asseman, et al., 1999; Read,
et al., 2000). The resulting pathology can be IBD, colitis or intestinal
inflammation as defined by the various groups utilising this model. All agree
that the pathology can be prevented or reversed by the transfer of
CD4+CD45RBlow cells (Powrie, 1994a, 1994b;Groux, et al., 1997; Asseman, et
al., 1999; Read, et al., 2000; Singh, et al., 2001). Tr1 cells induced by IL-10 ex
vivo were also able to prevent colitis in scid mice (Groux, et al., 1997). The
suppression mediated by these Tr cells was shown to be through the cytokines
30
Chapter 1
3). Initial evidence for regulatory T cells in
sthma and allergy found that TGF-β (Hansen, et al., 2000; Nakao, et al., 2000)
and IL-10 (Stampfli, et al., 1999; Oh, et al., 2002) were able to reduce the
rreactivity, airway inflammation and therefore in the
IL-10 and TGF-β; autoimmune pathology was also reversed by treatment with
recombinant IL-10 (Powrie, et al., 1994b). Treatment with anti-IL-10R mAb or
anti-TGF-β mAb also abrogated the inhibition of colitis and CD45RBlow cells
from IL-10 knockout mice were unable to suppress colitis (Asseman, et al.,
1999). Subsequent studies demonstrated that these CD4+CD45RBlow cells
were also CD25+ (Read, et al., 2000) and that transfer of CD4+CD25- cells into
nude recipients also induced colitis that was prevented by the co-transfer of
CD4+CD25+ T cells (Singh, et al., 2001; Xu, et al., 2003). Interestingly, the
transfer of CD4+CD25- cells into RAG2-/- recipients results in the development
of an autoimmune gastritis which is not mediated by IL-10 (Suri-Payer and
Cantor, 2001). These results demonstrate that Tr cells are involved in
protection against several autoimmune diseases and may act in different ways
in these disease settings. CD4+CD25+ Tr cells specific for bacteria found in the
colon microflora have also been cloned from the colons of mice (Cong, et al.,
2002; Waidmann, et al., 2002) and have been shown to play a role in the
prevention of colitis (Xu, et al., 2003) and colon cancer following H. hepaticus
infection (Erdman, et al., 2003).
1.6.3.2. Allergic asthma
Tr cells appear to play an important role in the control of asthma and allergy,
however the specific mechanisms and characteristics are still under
investigation (Akbari, et al., 200
a
development of airway hype
regulation of asthma. T cell tolerance that is induced by respiratory exposure to
allergen can inhibit the development of airway hyperreactivity (Akbari, et al.,
2002). It is likely that tolerance and Tr cells are both involved in controlling the
development of asthma and allergy (Akbari, et al., 2003). It appears that Tr1
cells are more involved in respiratory disease as DCs from the respiratory tract
secrete IL-10 which is required for their development (Akbari, et al., 2001;
Weiner, 2001). Antigen-specific IL-10 producing Tr cells were induced by
antigen-exposed DCs via the ICOS-ICOS-ligand pathway. These cells potently
blocked the development of airway hyperreactivity when adoptively transferred
31
Chapter 1
g
emonstrating that Tr cells can be induced by infectious pathogens, particularly
those causing chronic infection. The induction of Tr cells may be either an
protective immune responses on the part of the
al., 2002;
iggins, et al., 2003). CD4+CD25+ Tr1 cells specific for B. pertussis filamentous
ctin were cloned from the mucosal surfaces of
the lungs of infected mice during acute infection (McGuirk, et al., 2002). These
uppressive effects by secreting high levels of
into sensitised mice (Akbari, et al., 2002). Additionally, a population of CD8+ T
cells secreting high levels of IL-4, IL-5 and IL-10 and little IFN-γ were found to
infiltrate the lungs and have a distinct cytokine profile compared to those in the
peripheral blood (Stock, et al., 2004). The depletion of CD8+ cells prior to
immunisation increased allergic airway disease, demonstrating a protective
effect mediated by a population of CD8+ T cells and demonstrate a functional
diversity of CD8+ T cells in induced airway inflammation (Stock, et al., 2004).
1.6.4. Infectious disease
In addition to playing a role in the maintenance of homeostasis in the immune
systems, a growing body of research is providing evidence of the role that Tr
cells play in infectious disease. Evidence has been rapidly emergin
d
evasion strategy to subvert
pathogen or a protective mechanism on the part of the host in order to limit the
pathogen-induced immunopathology that occurs following infection.
1.6.4.1. Bacterial infection
1.6.4.1.1. Bortadella pertussis
Bortadella pertusis is the etiologic agent of whooping cough, a severe
respiratory infection, particularly in young children (McGuirk, et
H
heamaglutinin (FHA) and perta
cells were found to exert their s
IL-10. FHA was found to inhibit IL-12 and stimulate IL-10 production by DCs,
leading to the generation of Tr1 cells from naive T cells (McGuirk, et al., 2002).
Signalling through TLR-4 following the interaction with pathogen-derived
molecules has been shown to be involved in the activation of innate IL-10
production by DCs in response to infection with B. pertussis, leading to the
induction of IL-10 secreting Tr1 cells (Higgins, et al., 2003). The IL-10 from Tr1
cells and innate sources may act to limit the inflammatory pathology that
32
Chapter 1
authors
escribe an allergen-specific CD4+CD45RBlo Tr cell population which mediated
suppression of airway inflammation through IL-10 and TGF-β (Zuany-Amorim,
uction of IL-10 was found in the lungs of these mice
G-2-/- mice resulted in the development of fatal pneumonia
ithin 13 days of transfer (Hori, et al., 2002). In contrast, mice receiving CD25+
cells did not develop pneumonia and CD25+ cells were able to prevent
sease induced by the transfer of CD25- cells.
develops in response to infection, leading to a lack of a protective immune
response and allowing the pathogen to establish a prolonged infection.
1.6.4.1.2. Mycobacterium
Treatment with heat-killed Mycobacterium vaccae in a mouse model of allergic
pulmonary inflammation was found to result a significant reduction in allergic
inflammation (Zuany-Amorim, et al., 2002; Adams, et al., 2004). The
d
et al., 2002). Elevated prod
and analysis of CD11c+ APCs in the lungs found increased levels of IL-10, TGF-
β and IFN-α mRNA. This data has led to the proposal that M. vaccae-induced
CD11c+ APCs have a potential regulatory role at the site of inflammation
(Adams, et al., 2004). M. tuberculosis has been shown to specifically target the
DC-specific C-type lectin (DC-SIGN) to impair DC maturation, inducing
production of IL-10, promoting immunosuppression and possibly contributing to
the survival of the bacterium (Geijtenbeek, et al., 2003). Further to this, T cells
specific for the carboxyl-terminal determinants of rat heat-shock protein 65
escape tolerance induction and are involved in regulation of autoimmune
arthritis in a Lewis rat model of (heat-killed) M. tuberculosis induced polyarthritis
(Durai, et al., 2004).
1.6.4.1.3. Pneumocystis carinii
Pneumocystis carinii is an opportunistic pulmonary pathogen which is able to
cause life-threatening pneumonia. Adoptive transfer of CD4+CD25- cells into
P. carinii infected RA
w
pneumonia development of the di
These CD4+CD25+ Tr cells also suppress the elimination of P. carinii that is
mediated by CD4+CD25- cells and limit the in vivo expansion of CD4+CD25-
cells (Hori, et al., 2002). Further to this, IL-10 was found to down-regulate the
host immune response to P. carinii in wild-type mice, as IL-10-/- mice showed
33
Chapter 1
nd cell lines generated from
D4 T cells of the treated mice included Tr1 cells which secreted high levels of
IL-10 and IL-4 and lower levels of IL-5 with suppressive properties in vitro as
r experiments suggest that cholera toxin induces the
to a reduction in pathogen-induced pathology
which is beneficial to the host (Raghavan, et al., 2003; Blanchard, et al., 2004).
significantly enhanced bacterial clearance kinetics compared to wild-type mice
(Qureshi, et al., 2003). However, this ability was lost when the IL-10-/- mice
were depleted of CD4+ T cells and greater lung injury was observed in these
mice. These data indicate that IL-10 plays a critical role in controlling lung
damage independent of modulating the inflammatory response in the absence
of CD4+T cells (Qureshi, et al., 2003). Taken together these data indicate an
essential role for CD4+CD25+ Tr cells and IL-10 in the control of the
immunopathology induced by P. carinii infection.
1.6.4.1.4. Vibrio cholera
Cholera toxin, a potent enterotoxin produced by Vibrio cholera has been
demonstrated to promote the generation of Tr cells against a co-administered
foreign antigen (Lavelle, et al., 2003). Clones a+C
well as Th2 cells. Furthe
maturation of DCs and, through the induction of IL-10 and selectively affecting
cell surface marker expression on these cells, promotes the induction of a
population of regulatory T cells (Lavelle, et al., 2003). Immunisation with
antigen in the presence of cholera toxin induced a population of antigen-specific
CD4+ T cells which secrete high amounts of IL-10 but not IL-4 (Lavelle, et al.,
2004). These Tr1 cells were shown to inhibit proliferation and IFN-γ production
by Th1 effector cells and this suppression was cell-contact dependent. Cholera
toxin was also found to synergise with LPS to induce the production of IL-10, IL-
6 and IL-1β by immature DC, suggesting that the induction of Tr1 (and Th2)
cells may partly occur via selective modulation of cytokine production and co-
stimulatory molecule expression on DCs following exposure to cholera toxin
(Lavelle, et al., 2004).
1.6.4.1.5. Helicobacter
In mice and humans, CD4+CD25+ Tr cells appear to be involved in the
regulation of the immune response following infection with Helicobacter pylori,
the activation of these cells leads
34
Chapter 1
fection with H. pylori was found to result in an impaired response to bacterial + T cells in infected individuals. This
lack of response could be restored by the addition of IL-2 or by the depletion of
s infection
both CD25
r
r
reduced colitis and a decreased risk of colon
In
antigen in peripheral blood memory CD4
CD4+CD25+(high) cells (Lundgren, et al., 2003). This suppression was shown to
be specific for H. pylori as no change in the response of the same cells to
tetanus toxin was observed. Further to this, in mice it has been shown that the
absence of CD4+CD25+ Tr cells is associated with a loss of regulation that leads
to increased pathology in H. pylori-infected athymic nu/nu mice receiving
transfers of lymph node cell populations (Raghavan, et al., 2003). An IL-10
producing T cell may also act as an immunoregulatory cell following H. pylori
infection a of IL-10-/- mice results in greater inflammation and
spontaneous eradication of bacteria compared to the wild type mice which
develop persistent infection in the stomach with only mild inflammation
(Blanchard, et al., 2004). Interestingly, CD4+CD25+ Tr cells isolated from naive
or infected mice were able to suppress H. pylori specific effector cells in vitro,
however Tr cells from vaccinated mice were found to have lesser potency
(Raghavan, et al., 2004). These findings suggest that Tr cells may be an
important mechanism explaining the occurrence of autoimmune gastritis that
occurs after immunisation of mice against H. pylori (Raghavan, et al., 2004).
In the case of H. hepaticus it was found that + and CD25-CD45RBlow
cells were able to suppress bacteria-induced colitis in T cell-restored Rag-/- mice
(Kullberg, et al., 2002). These cells were antigen-specific and induced by
infection, as Tr cells from H. hepaticus-infected mice were more efficient in
mediating suppression (Kullberg, et al., 2002). A study examining the role of T
cells in H. hepaticus-induced colon cancer found that mice dosed with T cells
after infection had significantly
cancer (Erdman, et al., 2003). The same study also found that treatment with Tr
cells following the development of cancer decreased the severity of colitis and
cancer in recipient mice by an IL-10 dependent mechanism, although treatment
was not found to result in complete tumor regression (Erdman, et al., 2003).
35
Chapter 1
eishmania is an obligate intracellular protozoan parasite of mammals, and the
volvement of Tr cells in this model has been well studied (Belkaid, 2003).
After infection with L. major, the majority of inbred mouse strains go on to
lesions that leave the animal immune to re-
organisms in the lesion
(Belkaid, et al., 2002; Belkaid, 2003). CD4+CD25+ T cells appear to be an
CD25
ion. Additionally
1.6.4.2. Parasitic infections
1.6.4.2.1. Leishmania major
L
in
develop spontaneously resolving
infection due to the persistence of a small number of
r
intrinsic part of the infection process of this pathogen. During infection with L.
major, CD4+CD25+ (CTLA-4+CD45RBlow) T cells are found to accumulate in the
dermis at the site of infection, and these cells are able to suppress proliferation
of lesion-derived CD4+CD25- cells. Studies in IL-10-/- mice showed that
suppression occurred by both IL-10 dependent and independent mechanisms
(Belkaid, et al., 2002). Clearance of the pathogen (sterilising immunity) can be
achieved in IL-10-/- mice or in mice treated with anti-IL-10R mAb however this
also results in the loss of immunity to reinfection (concomitant immunity)
(Belkaid, et al., 2002). In the BALB/c strain of inbred mice, which develop
progressive lesions and no concomitant immunity, CD4+ + Tr cells have
been shown to down-regulate the level of IL-4 mRNA in the early immune
response to L. major infection, and thereby modulating the severity of disease
(Aseffa, et al., 2002). These findings were corroborated in an independent
study which also went on to demonstrate that these CD4+CD25+ Tr cells
suppress the differentiation and function of both Th1 and Th2 cells in vivo in
leishmaniasis (Xu, et al., 2003). Further to this, studies examining reactivation
of persistent leishmaniasis also show a role for CD4+CD25+ Tr cells in this
aspect of disease. While efficient parasite clearance is demonstrable at the
secondary site following reinfection, disease reactivation is observed at the
primary site of infection together with an increase in the number CD4+CD25+
cells at the site (Mendez, et al., 2004). Depletion with anti-CD25 mAb at the
time of reinfection resulted in both the prevention of reactivation and a more
efficient clearance of pathogens at the secondary site of infect ,
the transfer of Tr cells from infected mice into chronically infected mice was
sufficient to reactivate disease (Mendez, et al., 2004). Taken together these
results demonstrate that CD4+CD25+ Tr cells are crucial for establishment of the
36
Chapter 1
+CD25+ cells which secrete IL-10 in response
infection (Hesse, et al., 2004). These cells were isolated from the egg-
induced granulomas in the liver and were shown to have suppressive activity in
nd study found that these CD4+CD25+ T cells
ocerca vovulus. This helminthic parasite results in a
hronic infection as called river blindness or onchocerciasis (Satoguina, et al.,
2002). These cells were found to be TCR specific for the pathogen, producing
riable amounts of IL-5 and little IL-2 and IL-4.
r tively regulate the Th1 antifungal
mune response are generated in mice infected with C. albicans (Montagnoli,
et al., 2002). The generation of these cells was found to be dependent on
equilibrium between host and parasite that is beneficial for both, and that
following the establishment of persistent infection Tr cells are involved in
disease reactivation.
1.6.4.2.2. Schistosoma masoni
Infection with Schistosoma mansoni (schistosomaisis) was found to result in the
generation of a population of CD4
to
vitro (Hesse, et al., 2004). A seco
were also Foxp3+ (McKee and Pearce, 2004). It is proposed that these induced
Tr cells cooperate with effector cells to produce IL-10 in order to reduce host
morbidity and prolong survival following infection, potentially by affecting DCs,
resulting in Th2 polarisation of the host immune response (Hesse, et al.,
2004;McKee, et al.,2004).
1.6.4.2.3. Onchocerca vovulus
Cells which have characteristics of Tr1 cells have been isolated from human
patients infected with Onch
c
substantial amounts of IL-10 , va
Elevated expression of CTLA-4 was found on the cell surface and these cells
were able to inhibit other T cells in co-culture. A role has been proposed for
these cells in establishing a host/parasite balance allowing for the development
of chronic infection (Satoguina, et al., 2002).
1.6.4.3. Fungal infections
1.6.4.3.1. Candida albicans
CD4+CD25+ T cells which are able to nega
im
37
Chapter 1
ls were not generated in B7-2 or CD28 deficient
mice. The Tr cells were also found to be induced by a population ofIL-10
ctivated DCs. The adoptive transfer of IL-10
virus (HCV) results in chronic infection in
cted patients despite the development of HCV
specific cellular and humoral immune responses (Brady, et al., 2003). The
learance or persistence of HCV infection remain
poorly understood. Studies of a cohort of women chronically infected with HCV
s found that there was a circulating population of IL-10
response to acute infection with Herpes simplex virus (HSV) infection (Suvas, et
B7/CD28 expression as Tr cel
producing Candida hyphae-a
producing DC or CD4+CD25+ Tr cells into susceptible knockout mice restored
resistance to reinfection (Montagnoli, et al., 2002). This suggests that Tr cells
are involved in reducing pathogen-induced immunopathology in the host whilst
allowing fungal persistence with the benefit of concomitant immunity. This
interpretation is reinforced by a study in TLR2-/- mice which found that TLR2
suppresses immunity against C. albicans through the induction of IL-10 and Tr
cells (Netea, et al., 2004). The lower numbers of Tr cells and the lack of IL-10
production in these mice resulted in animals having improved resistance to
infection (Netea, et al., 2004).
1.6.4.4. Viral infections
1.6.4.4.1. Hepatitis C
Infection with the Hepatitis C
approximately 80% of infe
factors which determine c
for more than 20 year
secreting Tr1 cells (MacDonald, et al., 2002). These cells were found to
recognize the same epitopes of the HCV core protein as circulating Th1 effector
cells. Further to this, the viral protein NS4 was found to stimulate IL-10
production from monocytes, resulting in the suppression of the protective Th1
immune response (Brady, et al., 2003). These results suggest that the
immunosuppression of the Th1 immune response mediated by virus-specific
Tr1 cells is involved in the generation of chronic HCV infection through the
production of IL-10.
1.6.4.4.2. Herpes simplex
CD4+CD25+ have been found to control the magnitude of the CD8+ T cell
38
Chapter 1
CTL response against an immunodominant HSV peptide
s measured using an in vivo CTL assay. HSV infection was found to result in
enhanced T cell function to both viral and unrelated antigens and this may have
application of Tr cell manipulation for vaccine
his
rotein were able to induce high levels of IL-10 secretion from CD4+ T cells
collected from EBV-seropositive patients. This Tr1 characteristic IL-10
T cell proliferation and IFN-γ secretion induced
of susceptible
al., 2003). Pre-depletion of these cells with anti-CD25 mAb resulted in a
significantly enhanced
a
r
future implications for the
development (Suvas, et al., 2003). Further to this, CD4+CD25+ Tr cells were
found to control the severity of viral inflammatory lesions in HSV-induced
corneal lesions (Suvas, et al., 2004). Mice depleted of Tr cells prior to infection
developed lesions of significantly greater severity, and transfer of primed CD4+
T cells in infected scid mice resulted in modulated lesion expression (Suvas, et
al., 2004). The Tr cells isolated from these ocular lesions expressed IL-10 and
were able to inhibit antiviral immunity and impair the expression of molecules
required for T cell migration to the ocular lesion in vitro (Suvas, et al., 2004).
1.6.4.4.3. Epstein-Barr virus
Epstein-Barr virus (EBV) is a human gammaherpesvirus which is carried as a
latent infection in the B cells of >90% of adults and is associated with several
malignancies including Hodgkin’s disease (Marshall, et al., 2003). Purified
latent membrane protein 1 (LMP1) or the immunodominant peptides of t
p
secretion was able to suppress
by mitogen and antigen. Additionally, EBV also encodes a viral IL-10
homologue (vIL-10) which may be involved early in skewing the immune
response against the virus. This directing of the immune response toward
suppression is likely to play an important role in maintaining latency and the
development of EBV-associated tumours (Marshall, et al., 2003).
1.6.4.4.4. Friend retrovirus
Friend retrovirus (FV) is an oncogenic complex of two murine leukemia viruses;
a replication competent virus (Friend murine leukemia helper virus or F-MuLV)
and a replication defective virus (spleen cell focus-forming virus) which is the
proximal agent of disease (Hasenkrug, et al., 1998). Infection
39
Chapter 1 trains of mice results in acute infection, leading to the rapid development of
splenomegaly. Strains able to resolve this acute infection go on to develop
presence of a strong anti-viral response with
+ T cells from infected cats were unresponsive to mitogenic
timulation, did not produce IL-2 and were able to significantly suppress the
proliferative response and IL-2 production of stimulated CD4+CD25- T cells.
served in CD4+CD25+ T cells from
uninfected cats (Vahlenkamp, et al., 2004). These FIV-activated, anergic
s
chronic infection despite the
approximately 5% of mice going on to develop erythroleukemia (Hasenkrug and
Chesebro, 1997). Protective immune responses were found to require CD4+ (T
helper) and CD8+ (CTL) T cells as well as B cells for an antibody response
(Hasenkrug and Chesebro, 1997; Dittmer, et al., 1998; Hasenkrug, A. G. 1998;
Super, et al., 1998; Dittmer, et al., 1999; Hasenkrug and Dittmer, 2000).
Indeed, CD4+ T cells have been demonstrated to be critical for controlling both
viral replication and spread in chronically infected mice, with depletion of CD4+
T cells resulting in viral reactivation and the subsequent development of
erythroleukemia (Hasenkrug, et al., 1998). Chronic FV infection was found to
result in the expansion of a population of CD4+CD69+ Tr cells (Iwashiro, et al.,
2001). This functionally suppressive population was found in both naive and
infected mice and was able to suppress effector cells in vitro in a CTLA-4 and
TGF-β dependent manner. The same Tr cells in chronically infected mice were
found to impair the CD8+-mediated rejection of immunogenic tumours (Iwashiro,
et al., 2001). Further work has demonstrated that despite the generation of
virus-specific CD8+ T cells, their effector function is suppressed by a population
of CD4+ Tr cells (Dittmer, et al., 2004). This suppressive function was found to
be independent of the expression of CD25 on the cell surface. Suppression
was ameliorated by treatment with anti-GITR mAb, resulting in increased IFN-γ
production by transferred CD8+ T cells and a reduction in viral load (Dittmer, et
al., 2004).
1.6.4.4.5. Feline Immunodeficiency Virus
Feline immunodeficiency virus (FIV) is a cat model of HIV/AIDS. Infection with
FIV did not appear to affect the percentage of CD4+ expressing CD25 in either
the peripheral blood or the lymph nodes (Vahlenkamp, et al., 2004).
CD4+CD25
s
This in vitro suppressive ability was not ob
40
Chapter 1
(Aandahl, et al., 2004). A second study
xamined CD4+CD25+ T cells in the peripheral blood of HIV-infected patients
receiving highly active antiretroviral therapy (HAART). This study found that the
l blood CD4+CD25+ T cells had a memory phenotype,
immunosuppressive CD4+CD25+CTLA-4+B7+ Tr-like cells are suggested to play
a role in the progressive loss of T cell immune function which is characteristic of
FIV infection. Interestingly, while both CD4+CD25+ and CD25- cells are
susceptible to FIV infection, it is only CD4+CD25+ cells which produce infectious
virions when cultured with IL-2 (Joshi, et al., 2004). This suggests that
CD4+CD25+ cells provide a reservoir of productive viral infection due to their
ability to replicate FIV effectively in the presence of IL-2. These cells remain
unresponsive to apoptotic signalling and therefore allows for the production of
more virions (Joshi, et al., 2004).
1.6.4.4.6. HIV/AIDS
Very recently several studies have been published detailing CD4+CD25+ Tr cells
in the peripheral blood of HIV+ individuals. CD4+CD25+ Tr cells from the
peripheral blood of HIV+ patients in the first year of infection who had not
received any anti-viral therapy were shown to control the T cell response to both
HIV and CMV antigens in vitro
e
majority of periphera
constitutively expressed Foxp3, were anergic to stimulation with antigen and
suppressed the proliferation of CD4+ T cells to HIV, CMV and tuberculin
antigens (Weiss, et al., 2004). These CD4+CD25+ T cells also expressed IL-10
and TGF-β in response to stimulation with HIV p24 peptide stimulation,
indicating the generation of antigen specific Tr cells, however suppression was
not found to be cytokine dependent (Weiss, et al., 2004). CD4+CD25+ Tr cells
isolated from the blood of asymptomatic HIV+ patients were able to significantly
suppress the in vitro cellular proliferation and cytokine production of CD4+ and
CD8+ T cells in response to HIV antigens/peptides in a cell contact dependent,
IL-10 and TGF-β independent manner (Kinter, et al., 2004). No difference in
Foxp3 expression was found between CD4+CD25+ T cells from HIV+ and HIV-
individuals (Kinter, et al., 2004). Interestingly, individuals with greater in vitro
HIV-specific Tr cells were found to have lower viral loads and greater CD4:CD8
T cell ratios, leading the authors to speculate that CD4+CD25+ Tr cells may
contribute to the reduction of the HIV-specific immune response in the early
41
Chapter 1
iginally described by Duplan and
aterjet in 1962 (Latarjet and Duplan, 1962). The disease caused by this viral
mixture exhibits many characteristics that are similar to those observed in
nd
stages of HIV infection (Kinter, et al., 2004). An additional study has found that
Tr cells isolated from healthy individuals are highly susceptible to infection with
HIV, resulting in production of infectious virions and cytotoxic effects to the cells
leading to cell death (Oswald-Richter, et al., 2004). Human CD4+CD25+/hi Tr
cells were also found to express CCR5, an HIV-co-receptor molecule.
Expression of Foxp3 in activated CD4+ T cells resulted in the conversion of
these cells to a regulatory phenotype and a greater susceptibility of these cells
to HIV infection. The same study found that HIV-infected individuals also had
greatly decreased levels of Foxp3-expressing CD25+ Tr cells, although
contamination with highly activated CD4+ T cells may be a factor affecting these
results (Oswald-Richter, et al., 2004). Taken together the results of these
studies indicate that infection with HIV may result in the generation of a
population of HIV-specific Tr cells. These cells appear to be highly susceptible
to infection with HIV and their loss through the cytotoxic effect of viral replication
may result in gradual loss of this population. This would in turn remove
suppression on other T cells, leading to T cell hyperactivation, and may
therefore contribute to disease progression.
1.7. Murine Acquired Immunodeficiency Syndromes (MAIDS)
Murine AIDS is a uniformly fatal immunodeficiency induced in susceptible
strains of mice, such as C57BL/6J, by a unique mixture of murine leukaemia
viruses present in a retroviral mixture recovered from a radiation-induced
lymphoma of C57BL/6 mice (Chattopadhyay, et al., 1991; Morse, et al., 1992).
This mixture, designated LP-BM5, was or
L
human AIDS (Jolicoeur, 1991). Infected mice exhibit splenomegaly a
lymphadenopathy, polyclonal activation and proliferation of B and T cells,
hypergammaglobulinaemia and impaired B and T cell response to antigen and
mitogen (Figure 1.5). As a consequence of these effects infected animals
become susceptible to oportunistic infection and may later develop fatal B cell
lymphoma (Klinken, et al., 1988; Morse, et al., 1992). However, the main
cause of death in MAIDS is respiratory failure due to mediastinal lymph node
enlargement (Mosier, et al., 1985).
42
Chapter 1
Normal mouse
MAIDS mouse
Lymph
nodes
Spleen
Figure 1.5 The gross anatomical changes seen in MAIDS infection of C57BL/6 mice. The mouse on the right is not infected with MAIDS and normal lymph node and spleen sizes are
shown. In comparison, the MAIDS infected mouse (left) exhibits very obvious enlargement of
both spleen (splenomegaly) and lymph nodes (lymphadenopathy).
43
Chapter 1
.
hese are a replication competent B-tropic ecotropic virus (BM5e), a mink cell
cus-inducing (MCF) virus and a replication defective virus (BM5dl) which is
e etiologic agent of MAIDS and is required for disease induction (Aziz, et
l.,1989; Lee, et al.,1995). The ecotropic helper viruses present in the viral mix
virus. BM5eco uses MCAT, a cationic
mino acid transporter, as a receptor, while MCF uses the Ram1 receptor, a
sodium-dependent phosphate symporter (Miller and Miller, 1994). The
of replication, meaning that it is able to insert itself into the
NA of the infected cell (Jolicoeur, 2001). In order to replicate BM5d requires a
full-length replication competent helper virus. There is high homology between
regions of the defective and ecotropic gag genes (Aziz, et al.,
1.7.1. Virology: LP-BM5
The LP-BM5 virus mixture contains three type C mammalian retroviruses
T
fo
th
a
determine the tropism of the defective
a
ubiquitous cellular distributions for these receptors allows for the infection of
many cell types as BM5def virions can have tropism for either receptor due to
the envelope receptors provided by the replication competent viruses (Miller
and Miller, 1994).
1.7.1.1. BM5d
The defective virus (BM5d) has a 4.8kb genome encoding a full size gag gene
and heavily deleted pol and env genes (Figure 1.6) (Aziz, et al., 1989). BM5d is
a replication defective virus (Lee, et al., 1995) with large deletions in the pol and
env genes (Jolicoeur, 1991). Therefore it does not encode any of the enzymes
that are required for replication and packaging of the virus. BM5d is only
capable of one cycle
D
the p10 and p30
1989) with greater divergence in the carboxy-terminal portion of p15 and
throughout p12 (Morse, et al., 1992). A single open reading frame was found to
code for a 60kDa protein, designated Pr60gag, which is highly resistant to
proteolysis (Jolicoeur, 1991; Morse, et al., 1992) and must be intact for disease
to develop (Huang, et al., 1995). Pr60gag is processed post-transactionally; it is
myristilated, an uncommon form of protein modification consisting of the
attachment of myristic acid (a 14-carbon saturated fatty acid) to the N-terminal
glycine of the protein (Huang and Jolicoeur, 1994) and then phosphorylated on
p12 before being attached to the cell membrane (Jolicoeur, 1991; Morse, et al.,
1992). It has been found that myristilation is required to induce disease and
44
Chapter 1
lonal expansion
n with MCF was
und to further accelerate this process (Lee, et al., 1995). It was also found
that infection with BM5e virus alone is not sufficient to induce MAIDS pathology,
ice not developing significant lymphoproliferation or any
expansion of target cells as myristilation mutants were found to interact less
tightly with the plasma membrane and were unable to induce disease (Huang
and Jolicoeur, 1994; Jolicoeur, 2001). It is thought that the myristilation of
Pr60gag allows interaction with other membrane-bound molecules resulting in
the proliferation of target cells and possibly the ability to initiate immune
dysfunction (Huang and Jolicoeur, 1994).
The pathogenicity of the defective virus is linked to the gag protein. Through
the engineering of constructs it has been shown that both the p15 and p12
regions of the genome are necessary for pathogenicity and disease induction
(Pozsgay, et al., 1993a; Kubo, et al., 1994). It is also these regions that have
the greatest sequence divergence to the ecotropic helper virus. Replacement
of the p12 and p15 sequences with those from the ecotropic virus resulted in
the loss of pathogenicity, confirming their importance in establishment of
infection (Pozsgay, et al., 1993a). Finally, the defective virus has been found to
act as an insertional mutagen, thereby contributing to the oligoc
of B cells. Two proviral integration sites have been identified; Dis-1, which
maps to chromosome 2 and corresponds to Spfi 1 and the protein product PU.1
(a transcription factor in the Ets oncogene family), and Dis-2 which has been
mapped to chromosome 11 of the mouse genome (Huang, et al., 1995). This is
supported by the finding that BM5def is expressed in MAIDS associated
tumours (Chattopadhyay, et al., 1991; Pozsgay, et al., 1993a).
1.7.1.2. BM5e
The ecotropic virus (LP-BM5e) is a B cell-tropic full-length 8.8kb replication
competent virus (Figure 2) (Chattopadhyay, et al., 1991). It encodes a 65kDa
protein, designated Pr65gag, which is cleaved to form the various proteins
encoded by gag as well as having complete pol and env genes (Morse, et al.,
1992). Co-infection with the ecotropic virus accelerates the progression of
disease compared to the defective virus alone and superinfectio
fo
with infected m
histopatholoigal changes (Chattopadhyay, et al., 1991).
45
Chapter 1
he pic virus, BM5eco, is replication competent and contains all of the genes necessary
r replicati packaging. The BM5eco virus is non-pathogenic. The genome of the
plication d ve virus contains a ct gag gene, the p12 and p15 region have significant
quence diverge c sequence. The pol and env genes have been heavily
eleted. Ad , 1993a).
Pr60 gag
p15 p12 p30 p10
BM5d
KEY LTR
gag env
pol
Partial env sequeces
Partial pol sequences
Pr65 gag
.1.1. BM5e 1.1
Figure 1.6 Structure of the BM5eco and BM5def viral genomes.
T ecotro
fo on and
re efecti n inta
se nce from the ecotropi
apted from (Pozsgay, et al.d
46
Chapter 1
ay expand the BM5d-susceptible cell
opulation, enhance the spread of ecotropic virus or act as a helper with
iffering cell tropism (Morse, et al., 1992).
es
. Many ERVs contain stop codons
ithin the reading frames or are truncating, resulting in a lack of expression as
viral particles (Rasmussen, 1997). The significance of these sequences is still
may play a role in disease
1.7.1.3. Mink Cell Focus-inducing virus
MCF virus is not required for the induction of MAIDS but is able to accelerate
disease progression when present. Superinfection with BM5e, BM5d and MCF
resulted in accelerated lymphoproliferation and increased ecotropic virus titres
(Chattopadhyay, et al., 1991). MCF m
p
d
1.7.1.4. Endogenous Retroviral Sequenc
MuLV sequences are scattered throughout the murine genome as endogenous
retroviral sequences (ERVs) (Chattopadhyay, et al., 1980). ERVs are present
in the genomes of most vertebrates and are probably remnants of previous
retroviral infection which are inherited in a classic Mendelian fashion
(Rasmussen, 1997; Walchner, et al., 1997). ERVs contribute to up to 1% of
total genomic DNA (Walchner, et al., 1997)
w
uncertain although there is evidence that they
development in several animal species (Rasmussen, 1997). There are several
types of interactions that can occur between ERVs and exogenous retroviruses.
These include interactions of benefit to the host such as receptor interference,
preventing an exogenous infection and interactions which may be detrimental to
the host such as phenotype mixing and recombination between ERVs and an
exogenous virus and even immunological self-tolerance (Rasmussen, 1997).
There is some evidence that the occurrence of identical or related endogenous
epitopes results in the restricted ability to raise an immune response against the
infecting exogenous virus in the Friend virus model (Miyazawa and Fujisawa,
1994). There are two suggested mechanisms by which ERVS may trigger
autoimmune disease in humans; expression of ERV proteins which share
homology with cellular proteins; and the activation or destruction of cellular
genes as a result of viral insertion into the genome (Walchner, et al., 1997).
There has also been some investigation into a possible link between ERVs and
the development of the systemic autoimmune disease including multiple
sclerosis (MS) in humans (Rasmussen and Clausen, 1997; Perron, et al.,
47
Chapter 1
ood model system as the immunology and the
enetic background of this animal have been well defined. Several features of
the MAIDS model make it appealing to work with. Firstly, LP-BM5 is not easily
d there is no risk of transmission to
2001). Two ERVs with a potential role in MS have been described, ERV3
(Rasmussen and Clausen, 1997) and the HERV-W family of ERVs, copies of
which coincide with proposed MS susceptibility loci in the human genome
(Perron, et al., 2001). Further investigation is needed to substantiate the role of
ERVs in autoimmune disease, perhaps providing an avenue for the
development of new treatments.
1.7.2. MAIDS as a model for AIDS
The aim of an animal AIDS model is to mimic as many features of the human
disease as possible as no single animal model mimics AIDS in all respects
(Mosier, 1986). MAIDS is not a perfect model for AIDS and significant
differences exist between the viruses causing the two diseases. Despite these
differences MAIDS is still considered a good model for the early stages of AIDS
(Mosier, 1986). The mouse is a g
g
transmitted between test animals an
humans. The disease features are highly reproducible with clear immunological
abnormalities manifesting by 6 weeks post infection. Death occurs within 8 to
24 weeks with 100% mortality. The size and cost efficiency of the model also
allow statistical significance to be achieved. The mechanisms of genetic
resistance to MAIDS can also be studied as most inbred strains of mice are
resistant to infection (Mosier, 1996). The causative agents of disease are both
retroviruses and thus share a similar lifecycle. There are also similarities in the
disease symptoms including lymphadenopathy, hypergammaglobulinemia, and
enhanced susceptibility to infection, although this is a much greater problem in
AIDS than in MAIDS. There are also effects on the immune system, including a
loss in T-cell function prior to an increase in T-cell numbers (Morse, et al.,
1992). In addition there is a switch in the T cell population and cytokine
production that favours the expansion of the Th2 population (Morelli, et al.,
1994). The major similarities and differences between of MAIDS and AIDS are
summarised in Table 1.2.
48
Chapter 1
cells
• Increased proliferation • Impaired response to mitogen and soluble antigen
cells • B cell lymphoma
Lymphoproliferation Decreased NK cell function and responsiveness
opportunistic infection
ifferences
Outcom• ell function
on of cell mediated immunity - Kaposi’s sarcoma - Neurodegenerative disease
Cells a
AIDS – T cells, macrophages Progressive CD4+ T cell depletion
us •
Table 1.2 Similarities and differences between MAIDS and AIDS. There are sufficient similarities in the cellular effects of the MAIDS and AIDS viruses to
indicate that MAIDS is a suitable model for AIDS induced immunodeficiency. This table
also highlights the differences that exist between the two viruses. Adapted from Morse
et al. (1992) and Wyatt and Sodroski (1998).
Similarities T
• Impaired CD4+ function and impaired help for B cells B cells
• Polyclonal activation, differentiation and immunoglobulin secretion leading to hypergammaglobulinaemia
• Impaired response to normal T
Other ••• Enhanced susceptibility to
D
es of infection MAIDS – Progressive loss of CD4+ T c
- CNS defects rarely seen • AIDS – suppressi
cffe ted
• MAIDS – T cells, B cells, NK cells, macrophages CD4+ T cell function is abolished
•
Virus type • MAIDS – Type C murine leukemia vir
AIDS - Lentivirus
49
Chapter 1 1.7.3.
Inbred tr their susceptibility to MAIDS. These
variations th ease. Susceptible mice
sease w thin 4 to 6 weeks of infection, whereas moderately
suscep le mice disp t mice remain
iseas free. A large panel of inbr
etermine the genetic factors mediating resistance (Hartley, et al., 1989;
Makino, et al., 1990). Three loci associated with MAIDS resistance have been
o categories: MHC loci and non-MHC
fective virus (Makino, et al., 1990). The H-2
aplotypes b, f, j, k, p, q, r and s are associated with susceptibility to MAIDS,
Genetic resistance to MAIDS
s ains of mice vary greatly in
include e time of onset and severity of dis
develop di i
tib lay a longer latency period. Resistan
d e ed mice has been examined to try and
d
identified. These can be classed into tw
loci. The non-MHC loci are Fv-1 and Rmcf which regulate the replication of the
ecotropic and MCF virus respectively (Morse, et al., 1992; Gilmore, 1997).
These loci are thought to restrict the replication of helper virus, thereby limiting
the spread of defective virus (Pozsgay, et al., 1993b). A mouse with the
genotype Fv-1n/n is susceptible to infection with an N-tropic virus but resistant to
B-tropic viruses, the converse being true for Fv-1b/b mice. Mice which are
heterozygous at the Fv-1 locus (i.e. Fv-1n/b) are susceptible to infection by NB-
tropic virus (Morse, et al., 1992).
Resistance to MAIDS has also been mapped to the D region of the MHC H-2
gene (Makino, et al., 1990; Jolicoeur, 1997), an MHC Class I locus (Morse, et
al., 1992). The genes of the MHC H-2 locus are known to influence the immune
response to viral antigen and are likely to affect the progression of MAIDS as
the disease is dependent on the interaction of infected B cells with T cells. The
affect of the H-2 gene appears to relate to the ability to induce a CD8+ T-cell
response to the Pr60gag of the de
h
while the d haplotype, and possibly a, are associated with resistance (Makino,
et al., 1990; Morse, et al., 1992). The mechanism of resistance is still poorly
understood, although CD8+ T cells have been shown to play a role (Green, et
al., 1994; Green, 1999).
1.7.4. Mechanisms by which MAIDS triggers an immune response
There are currently two theories to explain the pathogenesis of MAIDS; the
‘superantigen’ theory (Hugin, et al., 1991) and the ‘transformation’ theory
50
Chapter 1
at the expression of the defective virus Pr60gag is
ssential for the development for disease (Morse, et al., 1992).
stinct set of Vβ
hains, resulting in the expansion of only those T cell subsets with the
his is the Vβ5 chain (Kanagawa, et al., 1992;
ovides an explanation for the rapid
G
s stimulation is not exclusive to Vβ5+ cells and disease did not progress when
liferative phase of the cycle is suggested to be
(Jolicoeur, 1991). These two competing models are not mutually exclusive and
may eventually prove to be somewhat complementary. Importantly, both
models do not dispute th
e
1.7.4.1. Superantigen theory
This model proposes that Pr60gag behaves as a superantigen (SAG). SAGs are
molecules which interact directly with the MHC Class II molecules of antigen
presenting cells, particularly B cells in the case of MAIDS. The unprocessed
molecule then interacts with the Vβ chain of the T cell receptor (Kanagawa, et
al., 1992). It is important to note that SAG will engage a di
c
appropriate Vβ chain, in MAIDS t
Huang and Jolicoeur, 1994). This model pr
activation of T cells, as well as the ability of a small number of infected cells
expressing defective virus to induce full blown MAIDS (Hugin, et al., 1991).
This theory has also been contradicted by the findings of several investigators.
For example, it was found that stimulation of T cells is polyclonal in the early
stages of MAIDS and not restricted to the Vβ5+ T cells (Doyon, et al., 1996;
Yee, et al., 1997a; Yee, et al., 1997b). It was also found that unmyristilated
Pr60gag mutants were capable of complexing with B cell MHC Class II
molecules and the TCR but were unable to induce disease (Huang and
Jolicoeur, 1994). These findings indicate that Pr60gag is not a conventional SA
a
the protein was mutated.
1.7.4.2. Transformation theory
This model postulates that MAIDS infection results in a paraneoplastic
syndrome as a result of the proliferation of the infected B target cells (Jolicoeur,
1991). The virus is proposed to act as a transforming agent in the infected B
cells, and it is the proliferation of these that results in the development of
paraneoplasia. The pro
51
Chapter 1 ependent on factors produced by other cell types, notably CD4+ T cells which,
together with B cells, are required for disease progression (Huang and
ansformed cells are thought to interact with
.7.5.1. Cells
MAIDS is associated with the impairment of the responsiveness of B and T cells
en B and T cells are
1.7.5.1.1. CD4+ T cells + T cells are required for the development of MAIDS in infected
be antigen-specific as both CD4+ T cells and MHC Class II expression are
required (Giese, et al., 1994).
d
Jolicoeur, 1994). The proliferating tr
other cells of the immune system. This interaction could be direct interruption
with other cell types or via the production of specific factors that are detrimental
to the immune system, resulting in immunodeficiency (Huang and Jolicoeur,
1994).
1.7.5. The effect of MAIDS on the immune system
Infection with MAIDS causes massive alterations in immune function of
susceptible mice. These complex changes affect all components of the immune
system including cells and cytokines (Morse, et al., 1992).
1
to both antigenic and mitogenic stimuli. Interaction betwe
necessary for disease development as well as the expression of BM5d viral
proteins by B cells and macrophages (Morse, et al., 1992; Giese, et al., 1994).
Functional CD4
mice (Mosier, et al., 1987). T cell-deficient nude mice exhibit high viral titres but
do not develop MAIDS. Reconstitution of infected nude mice with T cells
resulted in disease development indicating the need for T cell interaction for
immunodeficiency to develop (Giese, et al., 1994). These interactions appear
to
High levels of CD4+ proliferation and cytokine production are evident within 1
week of infection and continue throughout the course of the disease. By 6
weeks pi, most CD4+ T cells express an activated phenotype: increased CD44,
CD11a, CD54 and CD49 expression and decreased expression of CD45RB and
Mel-14 surface markers (Morse, et al., 1992). By week 6 post infection,
52
Chapter 1
ain viable but become unresponsive to stimuli
och, et al., 1994). Interestingly, a minor population of CD4+ Thy-1- cells,
fective TCR signalling. However, due to the increased rate of cell
ivision in MAIDS, apoptosis does not result in CD4+ cell depletion (Cohen, et
e ability to respond to mitogen is conserved until late in infection
orse, et al., 1992).
CD8+ cells have also been shown to mediate resistance to LP-BM5 in resistant
chwarz and Green, 1994; Green, 1999) and in the
, 1996). Depletion of CD8+ cells in the resistant A/J
profound functional deficits become obvious as anergy increases. Both
memory and naive T cells rem
(K
normally 1-2% of total CD4+ cells, expand progressively in response to BM5def
infection, eventually making up 30-50% of the CD4 population (Donaldson, et
al., 1994). These cells were found to contain integrated virus and were capable
of transferring MAIDS to uninfected C57BL/6 and xid mice (Donaldson, et al.,
1994).
Study of MAIDS-induced T cell anergy has shown that cells from infected mice
were unable to proliferate in response to antigen (Cerny, et al., 1990b). This
phenomenon was found to be due to uncoupling of the T-cell receptor (TCR)
complex from the phosphotidylinositol hydrolysis pathway. This resulted in
anergy and inability to proliferate amongst CD4+ T cells (Fitzpatrick, et al.,
1996). It has also been shown that CD4+ cells display apoptosis associated
with de
d
al., 1993).
1.7.5.1.2. CD8+ T cells
As MAIDS progresses the percentage of CD8+ cells decreases significantly in
both the spleen and the lymph nodes of infected mice, despite an overall
increase in the number of cells in these organs. The ability of CD8+ cells to
respond to altered alloantigen becomes abnormal from week 8 post infection
although th
(M
mice (Green, Crassi, S
offspring of infected mice (Pavlovitch, et al., 1996). It has been shown that
naive CD8+ T cells respond to a peptide encoded in the p12 gag region. The
response appears to be MHC Class I restricted (Yee, et al., 1997a). The
subsequent depletion of this population of cells using monoclonal antibodies
resulted in the development of MAIDS, suggesting that CD8+ cells assist in viral
clearance (Pavlovitch, et al.
53
Chapter 1
, 1994). The necessity for B cells for
evelopment of MAIDS has been demonstrated experimentally, through the
generation of B cell depleted mice by treatment with anti-IgM from birth (Cerny,
by the generation of B cell deficient mice by knockout of the
(Morse, et al., 1992) with
erum levels of IgM, IgG1, IgG2a, IgG2b, IgG3 and IgA peaking at 8 to 12
strain also resulted in the development of MAIDS (Makino, et al., 1992). It has
been found that CD8+ T cells contribute to MAIDS resistance by
perforin-dependent functions, but that this is of lesser importance than other
resistance mechanisms (Tang, et al., 1997). The role of CD8+ cells appears to
be the elimination of BMd-infected cells as well as limiting the spread of the
helper viruses (Makino, et al., 1992).
1.7.5.1.3. B cells
Mature B cells have been identified as the primary target of BM5d virus and are
the predominant proliferative population to be affected (Kim, et al., 1994; Morse,
et al., 1995). The B cell population has also been found to be essential for the
efficient infection and expression of the defective virus in other cell types such
as T cells and macrophages (Kim, et al.
d
et al., 1990b) and
transmembrane exon of the IgM gene (Kim, et al., 1994). Both types of mice
failed to develop MAIDS (Cerny, et al., 1990b; Kim, et al., 1994). Reconstitution
with normal B cells resulted in MAIDS development in IgM depleted mice (Kim,
et al., 1994). Further research has suggested that a deficiency in CD5+ B cells
to be the reason that xid mice display a prolonged latency in MAIDS
development (Hitoshi, et al., 1993; Tang, et al., 1995).
There are also major changes in both the structure and function of B cells that
occur during the course of MAIDS infection. Early activation and proliferation of
B cells can be detected within 1 week of infection (Morse, et al., 1992).
Activation was found to be polyclonal in nature as B cells of many different
antigen specificities were activated simultaneously (Klinman and Morse, 1989).
The affected B cells differentiate to plasma cells and excess secretion of
immunoglobulins results in hypergammaglobulinaemia
s
weeks post-infection (Makino, et al., 1995). The development of B cell
abnormalities is described as a dynamic process and can be grouped into three
‘nondiscrete’ stages: polyclonal activation, hypergammaglobulinaemia and
54
Chapter 1
e continuing increase of NK1.1+
ells. The cause of this functional impairment remains undetermined (Morse, et
al., 1992).
greater than the level found in T cells (Kim, et al., 1994). Cytokine
xpression is also altered, with loss of the ability to produce IFN-α and IFN-β
following in vivo stimulation with Newcastle disease virus, although the ability to
s retained (Morse, et al., 1992). Increased levels of
generalised immunosuppression (Klinman and Morse, 1989). B cell
responsiveness to T-helper cells is decreased as is the expression of cell
surface markers such as CD45R (B220), ThB and Ig (Morse, et al., 1992). After
about 8 weeks of infection, oligoclonal expansion of B cells can be observed,
resulting in an inability of the infected animal to mount a specific immune
response (Klinman and Morse, 1989). Malignant transformation of some
oligoclonally expanding B cells results in the development of lymphoma in the
later stages of infection (Makino, et al., 1995).
1.7.5.1.4. Natural killer (NK) cells
It has been found that infection with BM5def induced an increase in the number
of NK cells in the spleen and lymph nodes from 4 weeks post-infection with LP-
BM5. This was measured using the functional NK cell marker, NK1.1 (Makino,
et al., 1993). The ability of NK cells to kill target cells was also drastically
impaired at 9 weeks post-infection despite th
c
1.7.5.1.5. Macrophages
The effect of LP-BM5 virus infection on macrophages is not well studied. The
frequency of cells expressing the Mac-1 activation marker was found to
increase progressively in the spleen and lymph nodes of infected animals.
Macrophages were found to demonstrate a level of BM5def viral RNA similar to
B cells and
e
produce IFN-γ mRNA wa
IL-1 and IL-6 mRNA were found in isolated peritoneal macrophages following
mitogenic stimulation (Cheung, et al., 1991). These cytokines are believed to
contribute to B cell activation and proliferation and may play a role in the
progression of MAIDS.
55
Chapter 1
e modulation (Morelli, et al., 1994). Many studies have
ttempted to determine whether this apparent alteration in the cytokine profile of
ibility/resistance to MAIDS. Despite + T cell dichotomy in MAIDS
he role of IL-4, a B cell regulator (Huang, et al., 1993), also remains
, 1994; Morse, et al.,
997).
1.7.5.2. Cytokines
One of the abnormalities induced in MAIDS is aberrant cytokine production. It
has been suggested that aside from genetic factors, another of the mechanisms
underlying resistance/susceptibility to MAIDS operates at the level of specific T
helper (Th) cell activation following infection with LP-BM5 and that cytokines
play a role in this immun
a
infected mice may account for the suscept
intensive research, the role of the shift in CD4
remains unclear (Akarid, et al., 1995). Knockout mouse studies in particular
indicate that the high level of expression observed for Th2 cytokines (IL-4,
IL-10) appears to be an epiphenomenon of infection rather than a driving force
of the disease (Giese, et al., 1995; Morawetz, et al., 1998).
Initially, the response to LP-BM5 infection appears to be either Th0 or a
combined Th1/Th2 response when the cytokine profile is examined (Morelli, et
al., 1994). However, several studies report that at 2 weeks post infection, the
production of Th1 cytokines appears to decrease and Th2 cytokine levels
increase (Gazzinelli, et al., 1992; Sher, et al., 1992; Huang, et al., 1993; Morelli,
et al., 1994; Wang, et al., 1994; Morawetz, et al., 1998).
T
unresolved. Reports vary as to changes in the level of IL-4 production
(Gazzinelli, et al., 1992; Huang, et al., 1993; Akarid, et al., 1995). IL-4 knockout
studies have also produced contradicting results regarding the requirement of
IL-4 for MAIDS development (Kanagawa, et al., 1993; Morawetz, et al., 1998).
Changes in the levels of other cytokines, both Th1 and Th2 have been reported,
again at differing levels (Uehara, et al., 1994; Wang, et al.
1
IFN-γ has been reported to play a central role in disease development (Uehara,
et al., 1994). Depletion of IFN-γ was shown to delay disease progression
(Wang, et al., 1994; Morse, et al., 1997), yet conversely, treatment with IL-12,
which increases IFN-γ levels, was found to lead to resistance to MAIDS
56
Chapter 1
e of IFN-γ at low levels appears to stimulate B cell proliferation resulting
enhanced disease progression, whereas high level IFN-γ expression is able
ociated with MAIDS is cytokine
duced through the ability of treatment with cyclosporin A, a cytokine inhibitor,
ts as well as combination
erapies. Antineoplastic agents such as cyclophosphamide have also been
investigated.
(Gazzinelli, et al., 1992; Morse, et al., 1997). It has been suggested that the
presenc
in
to slow disease progression (Gazzinelli, et al., 1994; Giese, et al., 1995). The
ability to produce IFN-α/β in the early response to LP-BM5 infection may also
contribute to MAIDS resistance (Heng, et al., 1996). Interestingly, mice
transgenic for IL-15, which is crucial for the development and maintenance of
both NK and memory CD8+ T cells were found to exhibit severely retarded
disease development (Umemura, et al., 2002). This complements earlier
results published by the same group showing that mice with advanced disease
had impaired of IL-15 (Umemura, et al., 2002) and has led to the suggestion
that the reduction in this important signal for CD8+ T cells may play a role in
disease susceptibility. This work underlines the complexity of the MAIDS model
as well as demonstrating that there is some functional link between aberrant
cytokine production and both susceptibility to disease and the changes in
immune cells that are observed after infection.
An important factor to consider is that the methods used to date analyse the
capacity of cells to produce cytokines in response to infection only measure
which cytokines are being produced, be it at the mRNA or protein level, and not
which cells are producing them (Torbett and Mosier, 1994). Despite the lack of
clarity surrounding the role of cytokines in MAIDS, it has been clearly
established that some of the pathogenicity ass
in
to prevent disease progression (Cerny, et al., 1991).
1.8. Treatments for retrovirus-induced immunodeficiency in
mice
Many agents are being investigated as a possible means of effectively treating
MAIDS, principally to test new combinations of drugs for potential use as
treatments in AIDS. These include antiretroviral agen
th
57
Chapter 1
The use of MAIDS as a model for testing antiretroviral therapies with the hope
s of administration. These agents include AZT, glutathione
SH), dideoxycytidine (DDC), dideoxycytidine 5’-triphosphate (DDCTP),
didanosine, dideoxyinosine, flurabidine, IFNα, ribavirin, and the nucleotide
thoxyethyl) adenine (PMEA) and (R)-9-(2-
ineoplastic agents,
yclophosphamide, 5-aza-2’deoxycytidine and arabinosylcytosine in mice
injected with helper-free BM5def virus (Simard and Jolicoeur, 1991).
1.8.1. Antiretroviral agents
of applying these treatments to HIV/AIDS was begun in 1989 (Gangemi, et al.,
1989) and continued in 1990 with the testing of 3'-Azido-3'-deoxythymidine
(AZT) (Ohnota, et al., 1990). The model has since been used to test a variety
of different antiretroviral agents both alone and in combination by a number of
different route
(G
analogues 9-(2-phosphonylme
phopshonylmethoxypropyl) adenine (PMPA) and a combination of
cyclophosphamide and whole body irradiation (Klinman, et al., 1992; Magnani,
et al., 1992; Rossi, et al., 1993; Brandi, et al., 1995; Brandi, et al., 1995;
Fraternale, et al., 1996; Harvie, et al., 1996; Magnani, et al., 1998; Suruga, et
al., 1998; Fraternale, et al., 1999; Fraternale, et al., 2000; Fraternale, et al.,
2001; Fraternale, et al., 2002; Casabianca, et al., 2003). Treatment with all of
these agents using various regimes and combinations have been to result in
moderate to significant reductions in MAIDS symptoms including splenomegaly,
lymphadenopathy, hypergammaglobulinemia, T and B cell responses to
stimulation and levels of BM5d nucleic acid (Klinman, et al., 1992; Magnani, et
al., 1992; Rossi, et al., 1993; Brandi, et al., 1995; Brandi, et al., 1995;
Fraternale, et al., 1996; Harvie, et al., 1996; Magnani, et al., 1998; Suruga, et
al., 1998; Fraternale, et al., 1999; Fraternale, et al., 2000; Fraternale, et al.,
2001; Fraternale, et al., 2002; Casabianca, et al., 2003).
1.8.2. Antineoplastic agents
The transformation theory of MAIDS pathogenesis suggests that infection with
BM5def causes a paraneoplasia, the disease developing due to the expansion
of infected target cells (Joliceour, 1991). It was therefore suggested that the
ablation of these cells with antineoplastic agents should prevent the
development and/or progression of disease (Simard and Jolicoeur, 1991). This
theory was tested using three different ant
c
58
Chapter 1
an immunosuppressant, was found to most
astic agents
tumour. Vinblastine was given at
different days after tumour inoculation and the effect on tumour growth was
e when given at
Cyclophosphamide, paradoxically
effectively treat mice, with all parameters investigated returning to control levels.
These results indicate that target cell expansion is responsible for the
appearance of disease. It was not investigated whether mice went on to
develop disease after treatment was ceased.
Combination therapies with antiretrovirals and antineoplastics have also been
tested in MAIDS infected mice. Combination of fludarabine, an antineoplastic
and lymphocytic agent, and AZT was found to result in viral clearance and no
disease progression (Fraternale, et al., 2000). AZT acts to protect uninfected
cells, while fludarabine eliminates all infected cells thus eliminating viral
reservoirs preventing a viral rebound (Fraternale, et al., 2000).
1.8.3. Immunomodulation using antineopl
The concept of modulating the immune system to enhance the immune
response has been explored in murine lymphoma models (North and Awwad,
1990). It was hypothesised that the immune response to certain immunogenic
tumours fails to develop sufficiently because it is down-regulated by suppressor
T cells (North and Awwad, 1990). North suggested that a single timed dose of
the anti-mitotic vinblastine would be able to selectively eliminate these cells and
allow the immune response to clear the
measured. Vinblastine treatment was shown to be most effectiv
Day 13 or 15 post tumour inoculation. Tumours in mice at this time point
underwent complete regression (North and Awwad, 1990). Further
investigation showed that vinblastine had very little direct anti-tumour action and
that CD8+ T cells mediated tumour clearance (North and Awwad, 1990).
Treatment at Days 4 or 6 and 13 or 15 was thought to be effective as these are
the time points when the suppressor cell populations were postulated to be
expanding. The suppressor T cell population was subsequently shown to be
CD4+ (L3T4+) T cells (North and Awwad, 1990). The consequences of
removing the replicating suppressor cell population is postulated to release
memory and effector cells from suppression, allowing them to give rise to an
59
Chapter 1
virus (Hasenkrug and Dittmer, 2000).
However, there is a lack of knowledge regarding the types of immune response
and Dittmer,
ction requires CD4+ T helper
ell, CD8+ cytotoxic T cells and a neutralising antibody response (Hasenkrug,
augmented secondary immune response that is adequate to result in tumour
regression (North and Awwad, 1990).
1.8.4. Kinetics of the immune response to viral infection
The kinetics of the immune response to viral infection have been investigated
and characterised. Components of the immune system become activated and
proliferate sequentially in an effort to eradicate the virus and virus-infected cells
(Hasenkrug and Dittmer, 2000). The cytotoxic T lymphocytes function as a
critical part of the cellular response and B cells are activated to differentiate and
produce neutralising antibody to the
that are required for protection from retroviral infection (Hasenkrug
2000). This is also the case in LP-BM5 infection.
Recent work has been done on another murine leukemia virus, the Friend Virus
(FV) to investigate the immune response to retroviral infection. The kinetics of
the immune response to FV infection have been characterised in high recovery
(resistant) strains (Hasenkrug and Dittmer, 2000). However this has not been
done in low recovery (sensitive) mouse strains, which would more accurately
reflect the immune response in mice that are susceptible to LP-BM5 infection.
Research has shown that recovery from FV infe
c
Brooks and Dittmer, 1998). This indicates that both the cellular and humoral
arms of the immune response are necessary for protection and recovery from
infection (Hasenkrug and Chesebro, 1997). CD4+ T cells provide help for both
the CTL (CD8+ T cell) and B cell responses (Hasenkrug and Chesebro, 1997;
Hasenkrug and Dittmer, 2000). The antibody response is important in
controlling viremia. In the case of MAIDS, the kinetics of the immune response
is proposed to be similar to that evoked by FV infection.
1.9. Conclusions
It is clear from the preceding review of the literature that the Tr cells are one of
the most rapidly expanding areas of research in immunology. Studies have
shown that they are a ubiquitous component of the immune system and are
60
Chapter 1
the removal of these
ells resulting in autoimmune disease. However, it is also becoming apparent
that the activities of Tr cells may not necessarily be of benefit to the host. An
cer, where Tr cells recognising (self) antigens on tumour
fferent subtypes of
r cells exist. The hunt for a universal Tr cell surface marker is still continuing,
important for both the maintenance of a normal immune system and the
response to infection. Their importance is underlined by
c
example of this is can
cells prevent the immune system from clearing the tumour, resulting in disease.
Likewise, these cells can also be manipulated by pathogens, leading to chronic
infection rather than clearance. However Tr cells do not always play a role of
benefit only to the pathogen in infection. Studies examining leischmaniasis
have found that Tr cells play an important role in establishing a mutually
beneficial balance between the pathogen and the host. The pathogen is
protected from the immune system and the host is not damaged by the immune
response to the pathogen as well as having the added benefit of concomitant
immunity to reinfection (Belkaid, et al., 2002; Belkaid, 2003).
While the field of Tr cells is now advancing rapidly, the pace of research has left
a number of questions unanswered. The origin of Tr cells has been investigated
and it is well accepted that naturally occurring Tr cells develop in the thymus,
however the mechanism of induction of antigen-induced Tr cells remains an
area that is not fully understood. Much of the work done in different models has
utilised a range of different cell surface markers and work is only now beginning
to try and reconcile these findings to determine how many di
T
with microarrays providing new markers for investigation including neuropilin
and LAG-3. It is not yet clear whether the goal of finding a universal marker will
ever be achieved. Even the molecular marker Foxp3, which is essential for
naturally occurring Tr cells, has already been shown to not be required for the
generation of some peripheral antigen-specific Tr cells. While this field does still
appear to contain more questions than answers, significant progress has been
made in a relatively short period of time, the field only being revived in 1995.
The work described within this thesis examines the role of Tr cells in the
progression of a murine retroviral infection, murine AIDS. Murine AIDS
(MAIDS) presents an interesting model as it is induced by BM5d, a replication
defective retrovirus belonging to the murine leukaemia virus family, in
61
Chapter 1
pe
r BM5d pathogenicity has been found to be present in the murine genome
erapies and vaccines for a number of
iseases that have so far eluded attempts to provide adequate treatments or
conjunction with helper viruses to accelerate disease progression. The murine
genome contains numerous endogenous retroviral sequences including murine
leukaemia viruses like BM5d. Indeed, a homologue of p12gag, a critical epito
fo
(Pozsgay, et al., 1993a; Casabianca and Magnani, 1994). This provided the
opportunity to study Tr cells, if induced, in a setting where the antigen specificity
can potentially be relatively easily examined. Indeed, it was found that Tr cells
are induced by infection with BM5d and the work has progressed to further
characterise these cells and to examine the effect that the manipulation of these
cells can have on disease progression.
Reviews to date have pointed to the fact that the involvement of Tr cells in so
many different facets of immunology, from cancer to infectious disease to
autoimmune disease, leads to the tantalising opportunity of using these cells as
a therapeutic target. Whilst care must be taken in how this is done and a better
understanding of Tr cell induction following infection is required, the
manipulation of Tr cells or the dendritic cells involved in their induction provide
science with the opportunity to develop th
d
cures. This is particularly relevant for chronic viral infections including
HIV/AIDS and Hepatitis C. With appropriate care and research, Tr cells may yet
provide the most effective means of treating these types of infections. Finally,
the ubiquitous presence of Tr cells suggests that a major revision of
immunology textbooks is now required.
62
Chapter 2:
Materials and Methods
Chapter 2
63
2.1. Materials
2.1.1. Mice
Specific pathogen free female C57BL/6J mice aged 6-8 weeks obtained from
the Animal Resource Centre, Murdoch, Western Australia and housed in
minimal disease conditions in the L Block animal facility (QE II Medical Centre,
WA).
2.1.2. Virus
The LP-BM5 retroviral mixture was obtained from the culture supernatant of
SC1-G6 cells which are chronically infected with MAIDS defective, ecotropic
and mink cell focus-inducing virus (Mosier, et al., 1985).
2.1.3. Cell lines
2.1.3.1. Prokaryotic
E. coli JM101 were used for the transformations described in Section 2.2.12.
2.1.3.2. Eukaryotic
Table 2.1 Eukaryotic cell lines
Cell line Description/mAb production Reference
SC1 a Parent line of SC1-G6 (Mosier, Yetter and Morse, 1985)
SC1-G6 a Produces LP-BM5 (Mosier, Yetter and Morse, 1985)
YTS169 b anti-CD8 mAb
YTS191 b anti-CD4 mAb (Cobbold, et al., 1984)
DTA-1 c anti-GITR mAb (Shimizu, et al., 2002)
PC61 d anti-CD25 mAb (Lowenthal, et al., 1985)
9H10 e anti-CTLA-4 mAb (Krummel and Allison, 1995)
a Donated by Dr. P. Price, Royal Perth Hospital, WA, Australia b Donated by Dr. A. Scalzo, Lions Eye Institute, WA, Australia c Donated by Professor S. Sakaguchi, Institute for Frontier Medical Sciences, Kyoto, Japan d Donated by Professor J. Allison, University of California, Berkley, CA, USA e Donated by Dr. D. Cooper, Clinical Cell Culture C3, WA, Australia
Chapter 2
64
2.1.4. Antibodies and conjugates:
Table 2.2 Antibodies and conjugates
Antibody Conjugate Clone Supplier
CD4 APC RM4-5
CD8a PE 53-6.7
PE 7D4 CD25
FITC 3C7
CD38 Biotin 90
Biotin RA3-6B2 CD45R/B220
FITC RA3-6B2
CD69 PE H1.2F3
CD152 (CTLA-4) PE UC10-4F10-11
PE 11B11
Purified 11B11 IL-4
Biotin BVD6-24G2
Purified JES5-2A5
PE JES5-16E3 IL-10
Biotin JES5-16E3
Purified A75-2.1 TGF-β
Biotin A75-3.1
IFN-γ PE XMG1.2
IgG1 PE A85-1
IgG2b PE 27-35
Pharmingen,
BD Biosciences,
CA, USA
IgG2a Purified Biorad, USA
Horse radish
peroxidase Pharmingen
Quantum Red Streptavidin
FITC
Sigma-Aldrich,
MO, USA
Chapter 2
65
2.1.5. Peptides
P12-10 peptide (TENLPNLPPL) was manufactured by Proteomics International
Perth Australia. Purified peptide was resuspended at 5mg/ml in injection quality
water and stored at -20˚C until use.
2.1.6. Primers and probes
Table 2.3 PCR Primers Forward primers are designated by 1 and reverse primers are designated by 2.
Primer Sequence (5’-3’) Reference and Genbank accession number
BM5d1a CCTTTATCGACACTTCCCTT
BM5d2 a CCGCCTCTTCTTAACTGGTC
(Ogata, et al.,
1993)
BM5e1 a CCAATGTGTCCATGTCATTT
BM5e2 a CTTTCTCTCTCTGCTCATCGC (Cook, et al., 2003)
Foxp3-1 a b CCCAGGAAAGACAGCAACCTT
Foxp3-2 a b TTCTCACAACCAGGCCACTTG
HPRT-1 a b TGAAGAGCTACTGTAATGATCAGTCAAC
HPRT-2 a b AGCAAGCTTGCAACCTTAACCA
(Hori, et al., 2003)
Foxp3: NM_054039
HPRT: NM_013556
a Manufactured by Proligo, CO, USA b Primers were designed to span an intron/exon boundary therefore annealing specifically to cDNA and eliminating amplification from contaminating genomic DNA
Table 2.4 Probes used for real time PCR
Probe Sequence (5’-3’) and labels Reference
Foxp3 a FAM-ATCCTACCCACTGCTGGCAAATGGAGTC-
TAMRA
HPRT b VIC-TGCTTTCCCTGGTTAAGCAGTACAGCCC-
TAMRA
(Hori,
Nomura
and
Sakaguchi,
2003)
a Manufactured by Proligo, CO, USA b Manufactured by ABI, Applied Biosystems, CA, USA.
Chapter 2
66
2.1.7. Tissue culture media
RPMI 1640 (Gibco BRL, USA): YTS169 and YTS191 cell lines. Media was
supplemented with 2mM L-glutamine, antibiotic solution and 5% FCS for culture
or 10% FCS for resuscitation of cells.
Dulbeccos’s Modified Eagle Media (D-MEM) (Gibco BRL, USA): SC1 and SC1-
G6 cell lines. Media was supplemented with 2mM L-glutamine, antibiotic
solution and 5% FCS for culture or 10% FCS for resuscitation of cells.
Protein free CD Hybridoma medium (Gibco BRL, USA): 9H10, DTA-1 and PC61
hybridoma cell lines The media was supplemented with 2mM L-glutamine and
antibiotic solution.
2.1.8. Buffers and Solutions
Ammonium Sulphate Dissolve 761g Ammonium sulphate (BDH
(Saturated) Chemicals, Vic, Australia) in 1L dH2O
Antibiotic solution 1x ampule benzyl penicillin (CSL, Australia)
(for tissue culture) 5 x ampule gentamicin (Deltawest, Australia)
Make up to 100ml with ddH2O, filter sterilise and
store at -20˚C. Add 5ml to 500ml media to give
60µg/ml penicillin and 40µg/ml gentamicin final
concentration.
10mM CaCl2 Dissolve 1.47g CaCl2 (BDH Chemicals) in
100ml ddH2O. Autoclave.
5mM CFSE 2.75mg CFSE (Molecular probes, OR, USA)
1ml DMSO (BDH Chemicals)
Aliquot in 20µl volumes and store at -20°C
Chapter 2
67
Carb/bicarb Coating 1.59g (19mM) Na2CO3 (BDH Chemicals)
Buffer 2.55g (15mM) NaHCO3 (BDH Chemicals)
Make up to 900ml with ddH2O, pH to 9.6
Make up to 1L with ddH2O. Store at 4˚C
DNase I Dissolve 23mg DNase I (Sigma-Aldrich) in
1ml ddH2O and 1.3ml CaCl2. Filter sterilize
(0.2µm filter), aliquot and store at -20˚C
0.5M EDTA pH8.0 Dissolve 93.05g EDTA (Na2EDTA.2H2O, BDH
Chemicals) in 500ml ddH2O. Adjust pH to 8.0.
Autoclave.
FACS Wash Dissolve 0.0352g sodium azide (Ajax Chemicals,
Australia) in 100ml PBS
Autoclave and add 5ml FCS prior to use
5x Formalin Buffer 32.65g (230mM) Na2HPO4 (BDH Chemicals)
24.82g (180mM) NaH2PO4.H2O (BDH Chemicals)
1000ml dH2O
Freezing Media 90% v/v FCS (Gibco BRL)
10% v/v DMSO (BDH Chemicals)
LB medium 10g Bactotryptone (Difco, MI, USA)
5g Bactoyeast extract (Difco, MI, USA)
10g NaCL (BDH)
Dissolve in 900ml ddH2O
Adjust pH to 7.0 with 5M NaOH
Make up to ILwith ddH2O
Autoclave
L-glutamine (200mM) Dissolve 15g L-glutamine (Sigma-Aldrich) in 500ml
ddH2O . Filter sterilize, store as 5ml aliquots at -20°C
5ml added to 500ml media (2mM final)
Chapter 2
68
Liberase Blendzyme 3 In the laminar flow cabinet, reconstitute 7mg (28
Units) Liberase Blendzyme 3 (Roche, IN, USA) in
2ml injection quality water (manufacturer). Place on
ice for 30min, swirling every 2-3min to dissolve.
Filter sterilize (0.2µm filter, Pall Gelman), aliquot and
store at -20˚C until use.
Loading Dye (6x) 18% w/v Ficoll-400 (Pharmacia Biotech, Uppsala,
Sweden)
0.18% w/v bromophenol blue (IBI, USA)
0.18% w/v xylene cyanol (BDH Chemicals)
60 mM EDTA pH 8.0
MACS Wash Buffer 0.744g EDTA (2mM)
5g BSA (0.5%w/v)
1L ddH2O
Stir to dissolve, autoclave and store at 4˚C
10% Neutral Buffered 100ml 5x Formalin Buffer
Formalin 50ml Formaldehyde
400ml autoclaved dH2O
Phosphate Buffered Dissolve 1 tablet Phosphate buffered saline (Oxoid,
Saline (PBS) Hampshire, England) in 100ml ddH2O
Autoclave
0.05% (v/v)PBS-Tween Add 100µl Tween 20 (Sigma) to 200ml PBS
Red Cell Lysis Buffer 0.83% Ammonium chloride in ddH2O
2.059g Tris (Gibco BRL) dissolved in 100ml dH2O,
pH 7.65. Add 9 volumes ammonium chloride to 1
volume Tris, mix, adjust pH to 7.2. Filter sterilize
(0.2µm filter, Pall Gelman)
Chapter 2
69
10x Tris Borate (TBE) 108g Tris base (Gibco BRL)
Electrophoresis buffer 55g Boric acid (BDH Chemicals)
40ml 0.5M EDTA (pH8.0)
Make up to 1L with ddH2O. Dilute 1:10 with ddH2O
to make 1x TBE prior to use.
Trypan Blue 0.1g Trypan Blue
100ml PBS
Filter sterilise using 0.2µm filter (Pall Gelman)
Trypsin 50g Trypsin
9.95L Ultra High Quality H2O
Stir at 4˚C for several hours
Spin at 4˚C at high speed
Filter supernatant and aliquot in 5ml lots
Add 1 aliquot to 100ml PBS for use
2YT medium 16g Bactotryptone (Difco, MI, USA)
10g Bactoyeast extract (Difco, MI, USA)
5g NaCL (BDH)
Dissolve in 900ml ddH2O
Adjust pH to 7.0 with 5M NaOH
Make up to IL with ddH2O
Autoclave
Chapter 2
70
2.2. Methods
2.2.1. Tissue culture
All tissue culture was conducted using aseptic technique in a laminar flow
cabinet.
2.2.1.1. Resuscitation of frozen stocks
Cells were retrieved from liquid nitrogen storage, thawed rapidly at 37˚C and
transferred into a 15ml centrifuge tube and 5ml of the appropriate pre-warmed
growth media was added drop-wise. The cells were centrifuged for 5 minutes at
1000rpm. The supernatant was removed and cells resuspended in 20ml of
warm media and transferred to a tissue culture flask (Nunclon, Denmark) and
incubated at 37°C in a 5% CO2 incubator until confluent.
2.2.1.2. Passaging cells
Cells were grown in 80cm2 (Nunclon) or 225cm2 (BD Falcon) tissue culture
flasks containing growth media at 37°C and 5% CO2.
2.2.1.2.1. Adherent cell lines
Adherent SC1-G6 cells were passaged when small flasks reached 80-90%
confluence in order to obtain several large flasks for viral harvest. Passage was
performed as follows: growth media was removed and the cell monolayer
washed with 5ml PBS. The PBS was removed and 5ml of 5% (w/v) Trypsin-
PBS was added to the flask for 30 seconds and then removed. The flasks were
incubated at 37°C for 1 minute or until the adherent cells dislodged by tapping.
The cells were then resuspended in 10ml of growth media, 3ml was added to
2-3 large flasks and 30ml growth media added and incubated at 37˚C, 5%CO2.
2.2.1.2.2. Non-adherent cell lines
YTS169, YTS191, 9H10, DTA-1 and PC61 cells do not require trypsin for
passage. Cell suspensions were grown to confluence (2-3 days) and 2ml was
transferred to 18ml fresh growth media.
Chapter 2
71
2.2.1.3. Preparation of liquid nitrogen stocks
Cells were grown in an 80cm2 tissue culture flasks until splitting was required.
The growth media was removed and cells washed with 10ml of PBS. The PBS
was removed and 5ml of 5% Trypsin-PBS was added for 30 seconds and then
removed. The flasks were incubated at 37°C for 1 minute or until the adherent
cells dislodged by tapping. The cells were resuspended in 10ml of growth
media and transferred to a 15ml centrifuge tube. Cells were pelleted by
centrifuging at 1000 rpm for 5 minutes. The supernatant was then removed and
cells resuspended in 3ml of freezing media. Cells were stored as 1ml aliquots
in cryovials (Nunclon) at -80°C overnight before transfer to liquid nitrogen.
2.2.2. Preparation of LP-BM5 virus stocks
LP-BM5 virus stocks were obtained from the tissue culture supernatant of
SC1-G6 cells grown at 37ºC and 5% CO2 in DMEM (Gibco BRL, see Section
2.1.5). Cells were grown in 225cm2 flasks until 60-70% confluent at which point
the media was removed and replaced with 20ml of fresh media to just cover the
cell monolayer. The supernatant was collected following over night incubation
at 37˚C and pooled. The supernatant was centrifuged at 1500rpm for 5 minutes
to remove cellular debris and then stored at -80˚C or in 1ml aliquots. Stocks
were assayed for their ability to induce MAIDS in adult C57BL/6J mice as
measured by at least a 3-fold increase in spleen weight at 10 weeks pi.
2.2.3. Preparation of monoclonal antibodies
2.2.3.1. Harvesting of monoclonal antibodies in supernatant
This was performed at the same time as cell passaging. The growth media was
removed from the cells and transferred to 50ml centrifuge tubes. This was then
centrifuged at 1000 rpm for 5 minutes to pellet cells and debris present in the
media. The supernatant containing the antibody was then transferred to fresh
tubes and either stored at 4°C for ammonium sulphate precipitation of
antibodies (for 9H10, DTA-1 and PC61) or stored at -80°C for later use
(YTS169 or YTS191).
Chapter 2
72
2.2.3.2. Ammonium sulphate precipitation of monoclonal antibodies
Antibodies from all cell lines used were purified from the growth media using
ammonium sulphate precipitation. Tissue culture supernatant was centrifuged
at 3000 rpm for 30 minutes to remove any cellular debris. The supernatant was
transferred to a 1L beaker containing a stirring bar and placed on a magnetic
stirrer. While the antibody solution was being stirred gently, an equal volume of
saturated ammonium sulphate was added slowly. When the addition was
complete, the mixture was stirred for 6 hours or overnight at 4°C. The mixture
was then centrifuged at 3000rpm for 30min to pellet the precipitated antibody.
The supernatant was removed and discarded and the pellet drained well. The
pellet was resuspended in 0.1 volumes of the starting volume of tissue culture
supernatant in PBS being careful to avoid frothing and bubbles. The antibody
solution was then transferred to dialysis tubing and dialysed against three
changes of PBS overnight at 4°C. The antibody solution was then removed
from the tubing and centrifuged to remove any remaining debris. The purified
protein was then quantified (Section 2.2.3.3), aliquoted and stored in solution at
-20°C until required.
2.2.3.2.1. Preparation of dialysis tubing
Lengths of dialysis tubing were boiled in 2% (w/v) NaHCO3 1M EDTA pH 8.0 for
10 minutes. The tubing was then rinsed in ddH2O and autoclaved in 1mM
EDTA and stored until required. Tubing was rinsed in ddH2O immediately prior
to use.
2.2.3.3. Quantitation of purified antibodies
The concentration of the purified antibodies was determined using a
spectrophotometer. The absorbance of neat and 1/10 dilutions of the antibody
was read against a PBS control at 280nm. The concentration was then
calculated using the following ratio: A280 for 1mg/ml IgG as 1.35.
Chapter 2
73
2.2.4. Infection with LP-BM5
Whenever virus was required, an unopened vial was removed from -80˚C
storage, transported on ice and thawed rapidly by hand warming. Inoculation of
mice was performed within 20 minutes of thawing the virus. Mice received an
intraperitoneal injection of 100µl of the LP-BM5 unless stated otherwise. Mice
were allowed to progress to 10 weeks post infection unless otherwise stated.
2.2.4.1. Vinblastine treatment
Mice were treated with Vinblastine (10mg/ml) (Mayne Pharmaceuticals,
Melbourne, Australia) by intraperitoneal injection. Mice were weighed and
received a single dose of 6mg/kg body weight on the appropriate day post
infection. Mice received 6µl/g body weight so a 20g mouse would receive 120µl
of Vinblastine.
2.2.4.2. Monoclonal antibody treatment
Mice received monoclonal antibody against various cell surface markers in PBS
by intraperitoneal injection on the appropriate days post infection. The amount
of antibody received is described for each experiment in the appropriate
chapter.
2.2.5. Collection of organs and cells
2.2.5.1. Collection of organs
Mice were euthanased by cervical dislocation and the organs of interest
dissected out. For organ weights or preparation of single cell suspensions
organs were collected into tubes containing RPMI and kept on ice. Spleens
were weighed on digital scales to three decimal places. For nucleic acid
analysis organs were snap frozen in liquid nitrogen prior to storage at -80˚C for
later DNA or RNA extraction.
Chapter 2
74
2.2.5.2. Collection of blood
Blood was collected by two methods depending on the amount needed. For
small volumes of blood, tail vein bleeds were used to collect 50-100µl of whole
blood. For larger volumes blood was collected by heart puncture of
anaesthetised mice, after which mice were euthanased. The blood was
transferred to an EDTA-coated tube (Microtainer Brand, BD Biosciences, USA)
to prevent clotting.
2.2.5.2.1. Collection of plasma
Plasma was separated by centrifuging the blood samples at 8000 rpm for 10
minutes. The plasma was then transferred to a clean tube and stored at -20˚C
(for ELISA or DNA extraction) or -80˚C (for RNA extraction) until required.
2.2.5.2.2. Collection of lymphocytes
Whole blood (100-500µl) or cell pellets left following plasma collection were
resuspended in equal volumes of 3mM EDTA and 2% Dextran T-500 and
incubated at 37°C for 15-30 minutes to sediment red blood cells. The clear
upper layer, which contains the lymphocytes, was transferred to a fresh tube.
Lymphocytes were collected by centrifugation at 6000rpm for 1 min and the
supernatant removed. The cell pellet was resuspended in 1ml red cell lysis
buffer for 5min at room temperature with shaking to lyse any residual red blood
cells. Cells were then centrifuged and washed twice in PBS.
2.2.6. Preparation of single cell suspensions
2.2.6.1. Manual dissociation- Nylon mesh method
A single cell suspension was prepared by pushing the spleen (or lymph node)
through a spoon sieve using the plunger of a 2ml syringe. Cells were then
transferred to a 15ml centrifuge tube and centrifuged at 1000 rpm for 5 minutes.
The supernatant was removed and the cells resuspended in 5ml of red cell lysis
buffer and incubated for 5 minutes at room temperature with shaking. The lysis
buffer was then neutralised by the addition of 10ml RPMI under-laid with 1ml of
FCS. The cells were centrifuged at 1000 rpm for 5 minutes and the supernatant
Chapter 2
75
removed. Cells were then washed twice with RPMI and resuspended in a final
volume of 1ml RPMI, PBS or MACS buffer as appropriate for counting.
2.2.6.2. Enzyme digestion
This method was utilized when a better yield of cells was required, such as for
the in vivo CTL assay or for cell sorting for Treg cells. Spleens were collected
into tubes containing 0.5ml RPMI on ice. This was done in the laminar flow
cabinet when cells were needed to be kept sterile for later injection. Spleens
were then finely minced with sterile scissors. 13.5µl DNase I (250kU) and
12.5µl Liberase Blendzyme 3 (0.175U) were added to each spleen and
incubated for 40min at room temperature with constant mixing. 75µl of 0.1M
EDTA (pH7.2) was then added to each spleen and incubated for 5min at room
temperature with mixing. The resulting solution was filtered through mesh into a
new tube to remove any clumps of undigested cells; multiple spleens can be
pooled at this point if required. The cells were pelleted by centrifugation at
1000rpm for 5min if in a 15ml centrifuge tube or 6000rpm for 1 min if in a 1.5ml
eppendorf. The supernatant was removed and resuspended in Red Cell Lysis
buffer, and incubated for 5min at room temperature with shaking. The buffer
was neutralised by adding an equal volume of RPMI and then centrifuged. The
supernatant was removed and the cell pellet resuspended in 1ml RPMI, PBS or
MACS buffer as appropriate for counting.
2.2.6.3. Cell counts by trypan blue exclusion
Cells were diluted 1/10 in trypan blue (0.4%w/v) and counted in a Neubauer
chamber (Hawksley, England) using a light microscope. Only viable cells were
counted, cells that stained blue were excluded. Cell numbers were calculated
using the equation: Cells/ml = cell count x 25 x 10 (dilution factor) x 104
2.2.7. Histology
Spleens were harvested as described in Section 3.4.1 and fixed in neutral
buffered formalin. Sections of 5 µm thickness were cut and stained with
haematoxylin and eosin. Samples were analysed by light microscopy.
Chapter 2
76
2.2.8. Analysis of cell surface markers
2.2.8.1. FACS staining
Single cell suspensions were resuspended at 1x107 cells/ml and 100µl (1x106)
transferred to a fresh tube. Cells were centrifuged at 6000 rpm for 1 minute,
supernatants removed and the cells resuspended in 50µl of antibody solution
(all antibodies diluted 1/100) and incubated at 4˚C for 20 minutes. Samples
were flooded with 150µl of FACS Wash and centrifuged at 6000 rpm for 1
minute. Cells were then washed once in 100µl FACS Wash. If stained with
biotin-conjugated antibody, cells were resuspended in Streptavidin Quantum
Red (diluted 1/4) or FITC (diluted 1/100) for 30 min at 4°C, washed twice and
then resuspended in 0.5ml FACS Wash for acquisition. Cell populations were
acquired on a FACS Calibur and analysed using CellQuest software.
2.2.9. Cell sorting
2.2.9.1. MACS beads sorting
All cell sorting was conducted on single cell suspensions prepared as described
in Sections 2.2.5.1 and 2.2.5.3.2 and counted (Section 2.2.5.4). Various
combinations of MACS microbeads were used for cell sorting. The populations
required were collected by both positive and negative selection. All microbeads
were used according to manufacturer’s instructions.
2.2.9.2. FACS sorting
All cell sorting was conducted on single cell suspensions prepared as described
in Sections 2.2.5.1 and 2.2.5.3.2.
2.2.9.2.1. Depletion of CD4+ or CD8+ cells
To deplete total lymphocytes of CD4+ or CD8+ T cells, single cell suspensions
were stained with either CD4-APC or CD8-PE (1/100) for 20 minutes at 4˚C.
Cells were then washed twice with PBS and resuspended at 2x106 cells/ml and
filtered through a nylon mesh prior to sorting to remove any debris and clumps.
Cells were then sorted using a FACS Vantage cell sorter to remove CD4 or
CD8 cells from the sample, cells were found to be >98% pure. Tubes
Chapter 2
77
containing the CD4 or CD8 depleted cells were pooled, washed and counted.
Cells were resuspended in a final volume of 100µl per mouse in PBS for
intravenous transfer. Cells were transported on ice and were injected within 30
minutes of sorting.
2.2.9.2.2. Purification of CD4+CD25+/- and CD4+CD25+/- cell subsets
CD4+ T cells were purified from total lymphocytes using MACS beads
purification. Cells were incubated with 10µl of anti-CD4 microbeads (Miltenyi
Biotech) and 90µl of MACS buffer for every 107 cells for 20min at 4˚C in a 50ml
centrifuge tube (Falcon). Cells were then washed twice by flooding the tube
with MACS buffer and centrifuging at 1500rpm for 5min. Cells were then
stained with anti-CD25-FITC or anti-CD69-PE in MACS buffer for 15min at 4˚C.
Cells were washed twice, resuspended in 1ml MACS buffer and counted by
trypan blue exclusion. Cells were resuspended at 2x106 cells/ml and filtered
through a fine nylon mesh to remove any clumps before being sorted using the
FACS Vantage (Becton Dickinson). Both the positive and negative populations
were collected for further use. Analysis showed a purity of >98% for all
populations.
2.2.10. In vivo cytotoxic T lymphocyte (CTL) assay
In vivo CTL assays were used to detect the presence of LP-BM5 specific CTL in
LP-BM5 infected mice at various time points.
2.2.10.1. Preparation of target cells
Target cells were prepared using the lymph nodes and splenocytes of
syngeneic naïve mice. Single cell suspensions were prepared as described in
Sections 2.2.5.1 and 2.2.5.3.2 and counted (Section 2.2.5.4).
2.2.10.1.1. Peptide pulsing
The single cell suspension was resuspended in 2ml of media (RPMI 1640
supplemented with 5% FCS, antibiotics, L-glutamine, 2-ME and non-essential
amino acids) and split into two equal populations. To one of the tubes, 50µg/ml
final concentration of p12-10 (TENLPNLPPL) peptide was added. Cells were
Chapter 2
78
incubated for 90min at 37˚C, 5%CO2. Cells were then washed twice and
resuspended in 900µl media.
2.2.10.1.2. CFSE labelling
Cells were differentially labelled with log fold dilutions of 5,6-carboxyflouescein
succinimidyl ester (CFSE). A one in ten (1:10) dilution of stock CFSE (5mM)
was made of which 100µl was added to the peptide pulsed cells. A further 1:10
dilution was made of the remainder and 100µl of this was added to the control
(unpulsed) cells. Tubes were mixed thoroughly and incubated at room
temperature for 10min. Cells were then washed four times in media with an
FCS underlay. Cells were counted and resuspended at a final concentration of
1x108 cells/ml.
2.2.10.2. Preparation of putative regulatory T cell populations
Spleens were harvested from mice at day 18 post LP-BM5 infection, prepared
as single cell suspensions (Sections 2.2.5.1 and 2.2.5.3.2) and counted
(Section 2.2.5.4). CD4+ T cells were isolated using the MACS CD4 T cell
isolation Kit (Miltenyi Biotec) following manufacturer’s instructions. This kit
allows separation of CD4+ T cells by labelling all other cells with magnetic
beads and then passing them over a magnetised column. The unlabelled CD4+
cells flow through the column whilst all other cells are retained. The CD4+ cells
were collected, washed twice and resuspended in 1ml MACS buffer for counting
by trypan blue exclusion. Cells were then stained with either anti-CD25-FITC or
anti-CD69-PE in MACS buffer and incubated for 15min at 4˚C. Cells were
washed twice and then resuspended in 10µl anti-FITC or anti-PE beads and
90µl MACS buffer per 107 cells and incubated at 4˚C for 15min. Cells were
washed twice and then passed over a prepared column. The
CD4+CD25+/CD4+CD69+ cells were retained in the column whilst the
CD4+CD25-/CD4+CD69- were in the flow-through. To collect the retained
double positive cells, columns were removed from the magnet and cells were
flushed through with MACS buffer and a plunger. Cells were then washed twice,
counted and resuspended at 2x107 cells/ml in PBS.
Chapter 2
79
2.2.10.3. Injection into hosts
Recipient mice received target cells at day 0 (naïve mice), day 10 or day 20
post LP-BM5 infection. Recipients receiving Tr cells in combination with target
cells were injected on day 10 post infection. Cells were injected in a volume of
200µl via the lateral tail vein. All mice received 1x107 CFSEhigh peptide pulsed
target cells, 1x107 CFSElow control cells. Mice also given Treg cells received
2x106 cells in addition to the target cells.
2.2.10.4. Analysis
24 hours after adoptive transfer of target cells (with or without Tr cells), spleens
and inguinal lymph nodes were harvested from each recipient mouse and
prepared as an individual single cell suspension (Section 2.2.5.3.1). Red blood
cells were lysed, samples were then washed twice in FACS Wash and
resuspended in 1ml. 100µl was transferred into FACS tubes (Falcon, Becton
Dickinson, NJ, USA) and 900µl FACS Wash added to each tube. Samples
were then analysed on the FACSCalibur using CellQuest software (both Becton
Dickinson).
2.2.11. Cytokine assays
2.2.11.1. Intracellular Flow
Cells are prepared as a single cell suspension as described in Sections 2.2.5.1
and 2.2.5.3.1. Cells were resuspended in 1ml FACS Wash and a 50µl aliquot
was transferred to a fresh tube. Cells were stained for the cell surface markers
of interest for 20min at 4˚C in FACS Wash. At the end of the incubation period
cells were washed twice in FACS Wash and the supernatant removed after the
final centrifugation. Cells were then resuspended in 500µl Cytofix/Cytoperm
(Pharmingen) and incubated at 4˚C for 20min, centrifuged and resuspended in
100µl 1x PermWash buffer (Pharmingen). Cells were then stained for the
cytokines of interest (IL-4, IL-10 or TGF-β) or with isotype control antibody for
30min at 4˚C. In the case of TGF-β streptavidin-QR secondary was used, also
for 30min on ice. Cells were washed three times in FACS Wash and
resuspended in 500µl FACS Wash for acquisition.
Chapter 2
80
2.2.11.1.1. Positive control cells
Positive control cells were made using the following protocols. For use during
an assay the cells were thawed, washed twice to remove DMSO and then
handled the same way as fixed fresh splenocytes (Section 2.2.8.1). Cells were
checked by flow cytometry for cytokine expression following preparation.
2.2.11.1.1.1. Positive control cells for IL-2 and IFN-γ (and TNF-α)
This method is adapted from that described in Current Protocols in Immunology,
Unit 6.24: Detection of Intracellular Cytokines by Flow Cytometry, contributed by
C. Prussin and P. J. Openshaw (1998) 6.24.3-6.24.4. All handling of cells was
done using aseptic technique in a laminar flow cabinet.
Single cell suspensions were prepared (Sections 2.2.5.1 and 2.2.5.3.1) and
cells resuspended at a concentration of 4x106 cells/ml in pre-warmed RPMI with
10% FCS and plated out at 0.5ml/well in a 24 well plate (Nunclon). Pre-warmed
media was supplemented with the following to make a stimulation media: for
every 5ml of media 1µl of 10mM ionomycin (5mg/0.67ml in DMSO) and 1µl of
200µg/ml phorbol myristate acetate (PMA, in 100% ethanol) (all Sigma-Aldrich).
Of this stimulation media, 0.5ml was added to each well to give a final
concentration of 20ng/ml PMA and 1µM. Cells were incubated for 30min at
37˚C and 5%CO2. At this point 1µl/well of GolgiPlug (Pharmingen) was added
and the cells incubated for a further 4.5hrs. Cells were then transferred to 1.5ml
eppendorfs and centrifuged to pellet the cells and the media removed. Cells
resuspended in 4% paraformaldehyde and vortexed periodically for 15min at
room temperature to fix the cells. Cells were then centrifuged to remove the
paraformaldehyde and resuspended at 2.5x106 cells/ml in freezing media. Cells
were then aliquoted and stored at -80˚C until use.
2.2.11.1.1.2. Positive control cells for IL-4, IL-10 (IL-3, IL-5 and GM-CSF)
This protocol has been adapted from Pharmingen’s Cytokine/Chemokine
Manual. All handling of cells was done using aseptic technique in a laminar
flow cabinet. A 12 well plate was coated over night at 4˚C with 25µg/ml anti-
CD3 (Pharmingen) and 2µg/ml anti-CD28 (Pharmingen) in carb/bicarb coating
buffer. The plate was washed twice with PBS before use. Whole splenocytes
Chapter 2
81
in single cell suspension (Sections 2.2.5.1 and 2.2.5.3.1) were resuspended at
a concentration of 4x106 cells/ml in RPMI containing 5% FCS, L-glutamine and
antibiotics. The media was further supplemented with 10ng/ml recombinant
mouse (rm) IL-2 (R&D Systems) and 50ng/ml rmIL-4 (R&D Systems). Cells
were plated out at 2ml per well and incubated for 2 days at 37˚C, 5%CO2. Cells
were then centrifuged to pellet, the media removed and replaced with fresh
media containing the same concentrations of cytokines and plated out into a
fresh 12 well plate (with no plate bound antibody). Cells were then incubated
for a further 3 days at 37˚C, 5% CO2. Cells were centrifuged to pellet, counted
by trypan blue exclusion and resuspended at 4x106 cells/ml. Cells were then
restimulated with 5ng/ml PMA and 500ng/ml ionomycin in media containing
1µl/ml GolgiPlug for 5 hrs by plating 2ml/well into a fresh 12 well plate at 37˚C,
5% CO2. Cells were then transferred to 1.5ml eppendorfs and centrifuged to
pellet the cells and the media removed. Cells were resuspended in 4%
paraformaldehyde and vortexed periodically for 15min at room temperature to
fix the cells. Cells were then centrifuged to remove the paraformaldehyde and
resuspended at 4x106 cells/ml in freezing media. Cells were then aliquoted and
stored at -80˚C until use.
2.2.11.2. ELISpot
Cells were stored for ELISpot after preparation of single cell suspensions
(Sections 2.2.5.1 and 2.2.5.3.1) by freezing at -80˚C in freezing media. When
all samples had been collected cell were defrosted, washed twice in media to
remove any DMSO and counted by trypan blue exclusion. ELISPots for the
detection of IL-4 and IL-10 were initially conducted using kits (R&D Systems)
following manufacturer’s instructions. The assay is very similar to the method
used for later assays described below.
Later assays for the detection of IL-4, IL-10 and TGF-β were conducted using
the following method. Wells were coated with 100µl/ well of 15µg/ml coating
antibody in carb/bicarb coating buffer in nitrocellulose 96 well plates (Millipore
MAIP S4510) and incubated overnight at 4° C. Plates were washed six times
with 200µl/well sterile PBS. Wells were blocked for 2hrs at 37˚C with 200µl
Chapter 2
82
culture media (RPMI containing 5% FCS, L-glutamine, antibiotics and 2-ME).
After removal of the media 100µl of cells resuspended in culture media at the
desired concentration were incubated covered at 37° C, 5% CO2 overnight.
Cells were then washed off with 200µl PBS per well and wells washed a further
5 times. Biotinylated secondary mAb for the cytokine of interest was diluted
1/1000 in sterile PBS and 100µl added per well and the plate incubated for 2hrs
at room temperature. Wells were washed 5 times with 200µl 0.05%
PBS-Tween. Plates were then incubated with 100µl of Streptavidin-HRP
(diluted 1/1000 in sterile PBS) for 1hr at room temperature. Wells were washed
5 times with 200µl 0.05% PBS-Tween and 100µl AEC substrate (BioGenex, CA,
USA) added per well and allowed to develop for 10-15min. The reaction was
then stopped by washing the plate thoroughly with tap water and the plate left to
dry for a minimum of 24 hours before counting. Spots were counted using a
stereomicroscope or ELISpot plate reader (AID ELISpot Reader System with
AID v2.9 software).
2.2.11.3. ELISAs
ELISA for measurement of serum IL-10 (Quantikine Murine IL-10, R&D
Systems), TGF-β (TGF-β1 Emax Immunoassay System, Promega) and IFN-γ
(Mouse IFN-γ ELISA Kit, Pierce Endogen) were conducted using kits following
the manufacturer’s instructions. Plates were read at a wavelength of 450nm
using a SpectroMax microtitre plate reader.
The IL-4 ELISA was conducted as follows: a 96 well plate (Maxisorp, Nunc) was
coated with 100µl/well of 1µg/ml coating Ab (purified anti-IL-4, Table 2.2) in
carb/bicarb coating buffer and incubated overnight at 4˚C. The coating antibody
was removed and wells washed 3 times with 200µl PBS. Wells were blocked
with 100µl/well 1% (w/v) BSA (JRH Bioscience, KS, USA) in PBS for 1hr at
37˚C and then washed 3 times with 200µl 0.05% (v/v) Tween 20 in PBS.
Samples (diluted in PBS) and standards (recombinant IL-4, Pharmingen) were
added and incubated for 2hrs at room temperature and then washed 3 times
with PBS-Tween. 100µl/well detection aB (anti-IL-4-biotin, Table 2.2) diluted
1/1000 in PBS was added to each well and incubated for 1hr at room
temperature. Wells were then washed 5 times with PBS-Tween before adding
Chapter 2
83
100µl/well Streptavidin-HRP diluted1/1000 in PBS and incubated for 1hr at
room temperature. Wells were then washed 5 times with PBS-Tween and the
substrate (TBST) added. The plate was then developed for 10-15 min at room
temperature. The reaction was stopped with 2% oxalic acid and plates were
read at 420nm using a SpectroMax microtitre plate reader.
2.2.11.4. IgG2a ELISA
This ELISA was conducted using the BioRad Mouse typer Isotyping panel
(Biorad). Briefly, 96 well plates (BD) were incubated for 1hr at room
temperature with 100µl of serum samples (diluted 1/500 in Tris-HCl, pH8.5) per
well. Plates were washed 3 times with 200µl per well ELISA wash solution 1
and blocked with 300µl ELISA block buffer for 30min at room temperature.
Plates were washed with 200µl per well ELISA wash solution 2 and tapped dry,
this solution is used for all subsequent washes. Undiluted anti-mouse IgG2a
was added at 100µl per well and incubated at room temperature for 1hr. The
plate was then washed five times and 100µl per well HRP-conjugated detection
mAb (1/3000 in 0.05% (v/v) PBS-Tween) added and the plate incubated for 1hr
at room temperature. The plate was then washed four times and 100µl
peroxidase substrate (Biorad) added. The colour reaction was developed for
30mins and stopped using ELISA colour stop solution. Plates were read at
415nm using a SpectroMax microtitre plate reader.
2.2.12. Bacterial cells
2.2.12.1. Preparation of competent cells
E. coli XL1 Blue were grown in 25ml 2YT media for 16hrs at 37˚C with shaking.
This culture was inoculated into 550ml of 2YT containing 75µg/ml tetracycline
and incubated, with shaking, at 37˚C until the culture reached an optical density
of 0.5 at 600nm (approximately 4hrs) measured using a Varian UV/Visible
spectrophotometer (model DMS70, Varian, USA). Bacterial cells were pelleted
by centrifugation at 4000x g for 15min. The supernatant was removed and cells
resuspended in 1L of 4˚C dH2O and recentrifuged. This wash step was
repeated using 500ml dH2O. The resultant bacterial cell pellet was
Chapter 2
84
resuspended in 20ml 10% (v/v) glycerol in PBS, recentrifuged as above and the
pellet resuspended in 3ml cold 50% (v/v) glycerol in PBS. Cells were dispensed
into 40µl aliquots, frozen and stored at -80˚C.
2.2.12.2. Transformation of bacterial cells by electroporation
A 40µl aliquot of electrocompetent cells was thawed on ice and mixed with 2µl
of plasmid DNA. This was transferred to a 0.1cm gap electroporation cuvette
(BioRad). Electroporation was carried out at 25µF, 1.25kV and 200Ω in a
BioRad Gene Pulser II Electroporation System. Time constants remained
between 4 and 5 milliseconds. Immediately after electroporation 1ml of SOC
medium, prewarmed to 37˚C, was added to the cells, followed by incubation for
1hr at 37˚C with shaking. Aliquots (200µl) of this culture were plated out onto
2YT plates containing 20µg/ml Ampicillin and incubated at 37˚C.
2.2.13. Manipulation and analysis of DNA
2.2.13.1. Agarose gel electrophoresis of DNA
Unless stated otherwise electrophoresis of DNA was performed using 0.8%
agarose (BioRad, USA) in 1xTris-borate electrophoresis buffer (TBE) containing
1µl/50ml of ethidium bromide (10mg/ml, Sigma). Samples were prepared by
the addition of one sixth (1/6) the volume of 6 x loading dye to each sample
prior to loading. Electrophoresis was performed at room temperature at 90 V
for 1 hour or until the bromophenol blue dye front was approximately 1-2 cm
from the end of the gel unless stated otherwise.
2.2.13.2. Detection of DNA in agarose gels
DNA was visualized by UV transilluminator at 302nm. Photographic images
were taken using a Polaroid camera with a 23A red filter and Polaroid 667 film
(8.5 x 10.8cm). The film was exposed for 1-2 sec and allowed to develop for
30sec at room temperature.
Chapter 2
85
2.2.13.3. Estimation of size of DNA
Sizes of DNA fragments were estimated from their relative mobility compared to
standard size markers (Figure 2.1). The DNA size standard is a 1 kb DNA
ladder (Invitrogen or Gibco BRL) of which 1µg was loaded onto the gel.
2.2.13.4. Spectrophotometric quantitation of DNA
The amount and purity of DNA present in an aqueous solution was determined
by spectrophotometric measurement of the absorbance at 260nm (A260) and
280nm (A280). Samples of DNA solutions were diluted to a volume of 500µl in
H2O and the absorbance measured. Water was used as a reference blank. An
absorbance of 1.0 at 260nm is equivalent to a concentration of 50µg/ml of
double stranded DNA (Sambrook et al., 1989). The amount of DNA present in a
sample was calculated as follows:
Concentration of DNA (µg/ml) = dilution factor x 50 x A260
An assessment of the purity of DNA samples was obtained by the measurement
of the A260: A280 ratio which is usually >1.8 for pure DNA.
2.2.13.5. Plasmid DNA Miniprep
A single culture of transformed cells was picked and inoculated into 5ml LB
media containing 20µg/ml Ampilcillin and grown overnight at 37˚C with shaking.
Bacterial cells were pelleted by centrifugation in a 2ml eppendorf tube at 10000
rpm in a microfuge and the supernatant removed, this process was repeated
until the entire 5ml culture was pelleted in the tube. Plasmid DNA was then
extracted using the MoBio UltraClean 6 minute Mini Plasmid Prep Kit. The cell
pellet was resuspended in 50µl of Solution 1 (50mM Tris Cl pH8.0, 10mM
EDTA, 100µg/ml RNase A), pulse vortexed for 1min and 100µl of Solution 2
(200mM NaOH, 1% (w/v) SDS) added. The tube was mixed by a single
inversion and 325µl of Solution 3 (3M potassium acetate, pH5.5) added and the
tube inverted once to mix. The solution was centrifuged at 10000 rpm for 1min
and the supernatant transferred to a spin filter and centrifuged at 10000 rpm for
Chapter 2
86
Figure 2.1 1kb DNA ladder Agarose gel electrophoresis of 1kb DNA ladder (Invitrogen or Gibco BRL) run on a 1% agarose gel (with ethidium bromide) at 90V for 1 hour. DNA is visualized using a UV transilluminator. Sizes of all fragments are indicated. Image adapted from Invitrogen product sheet for 1kb DNA ladder.
Chapter 2
87
30sec. The liquid in the collection tube was discarded, 300µl of Solution 4
(provided wash buffer containing Tris and NaCl) added to the spin filter was
centrifuged for 30sec at 10000 rpm. The liquid in the collection tube was
discarded and 50µl of ddH2O added to the middle of the spin filter membrane.
The spin filter was then centrifuged for 30sec at 10000rpm to elute the plasmid
DNA off the membrane. Plasmid DNA was quantitated by spectrophotometry
and used immediately or stored at -20˚C until use.
2.2.13.6. Plasmid DNA Bulk preparation (Maxiprep)
A single culture of transformed cells was picked and inoculated into 2.5ml LB
media containing 20µg/ml Ampilcillin and grown overnight at 37˚C with shaking.
0.5ml of this culture was then transferred into 250ml 2YT media containing
20µg/ml Ampicillin and grown for 16hrs at 37˚C. Cells were centrifuged
5000rpm for 15min at 4˚C (Beckman J220 refrigerated centrifuge). The DNA
preparation was conducted using a Qiagen Plasmid DNA Maxiprep Kit. Briefly,
the supernatant was removed and the cell pellet resuspended in 10ml of Buffer
P1 (50mM Tris Cl pH8.0, 10mM EDTA, 100µg/ml RNase A) in a 50ml tube
(Falcon), 10ml of Buffer P2 (200mM NaOH, 1% (w/v) SDS) added and the tube
mixed by inversion and incubated at room temperature for 5min. Then 10ml
cold Buffer P3 (3M potassium acetate, pH5.5) was added to the lysate, mixed
by inversion and the resultant solution loaded onto a prepared QIAfilter
cartridge (with a capped outlet nozzle) and incubated on the column for 10min
at room temperature. Following this the cell lysate was gently expelled through
the QIAfilter cartridge with a plunger and combined with 2.5ml Buffer ER
(endotoxin removal buffer) and incubated on ice for 30min. This lysate was
then applied to an equilibrated QIAGEN-tip and allowed to enter the resin by
gravity. The column was then washed twice with 30ml QC buffer (1M NaCl,
50mM MOPS pH 7.0, 15% isopropanol (v/v), 0.15% Triton X-100 (v/v)) and
plasmid DNA was eluted with 15ml Buffer QN (1.6M NaCl, 50mM MOPS pH
7.0, 15% isopropanol (v/v)). Plasmid DNA was precipitated by adding 10.5ml
(0.7 volumes) room temperature isopropanol, the solution mixed and
centrifuged at 5000x g for 60min at 4˚C in 50ml centrifuge tubes. The
supernatant was carefully decanted and the pellet washed by resuspending in
5ml 70% ethanol and recentrifuged for 10min. Supernatant was carefully
Chapter 2
88
decanted and the pellet air-dried for 5-10min before being dissolved in 0.5ml TE
(10mM Tris Cl pH8.0, 1mM EDTA). Plasmid DNA was quantitated by
spectrophotometry and used immediately or stored at -20˚C until use.
2.2.13.7. DNA extraction from tissue
2.2.13.7.1. Blood
DNA was extracted from whole blood or blood cell pellets (following separation
of plasma) using the QIAamp DNA Blood Mini Kit (Qiagen, Valencia, CA). In a
1.5ml eppendorf tube 50µl of whole fresh anti-coagulated blood was combined
with 20µl Protease, 150µl PBS and 200µl of buffer AL and mixed by pulse
vortexing for 15sec. Samples were then incubated for 10min at 56˚C. Tubes
were centrifuged briefly and mixed with 200µl absolute ethanol by pulse
vortexing for 15sec and briefly centrifuged. This mixture was then applied to a
spin column and centrifuged at 10000 rpm for 1min in a microfuge. The spin
column was then transferred to a fresh collection tube and washed twice with
500µl of AW1. The spin column was then transferred to a fresh collection tube
and centrifuged at 14000 rpm for 3min. Columns were then transferred to a
new 1.5ml microfuge tubes and 50µl of AE buffer (10 mM TrisHCl, 0.5mM
EDTA, pH9.0) added to the spin column and incubated for 5min at room
temperature before being eluted by spinning at 10000 rpm for 1min. DNA was
stored at -20˚C until used.
2.2.13.7.2. Spleen
DNA was extracted from 10mg of frozen spleen with the QIAamp DNA Blood
Mini Kit (Qiagen) following the manufacturer’s protocol for tissue DNA
extraction. Samples were minced in 180µl ATL buffer (Qiagen) in a sterile petri
dish (Selby Biolab, USA) using a sterile scalpel blade (Size 23, Swann-Morton,
Sheffield, England) and transferred to an eppendorfs tube. 20µl of Proteinase K
(conc, Qiagen) was added and the sample was vortexed and incubated at 56˚C
for 90min until lysed with occasional mixing. Samples were then treated with
4µl RNase A (100mg/ml, Qiagen) for 2min at room temperature. Buffer AL
(200µl) was added and mixed in by pulse vortexing for 15sec. Samples were
Chapter 2
89
then incubated for 10min at 70˚C. Tubes were centrifuged briefly and mixed
with 200µl absolute ethanol by pulse vortexing for 15sec and briefly centrifuged.
This mixture was then applied to a spin column and centrifuged at 10000 rpm
for 1min in a microfuge. The spin column was then transferred to a fresh
collection tube and washed with 500µl of AW1. The spin column was then
transferred to a fresh collection tube and centrifuged at 14000 rpm for 3min.
Columns were then transferred to a new 1.5ml eppendorf and 50µl of AE buffer
(10 mM TrisHCl, 0.5mM EDTA, pH9.0) added to the spin column and incubated
for 5min at room temperature before being eluted by spinning at 10000 rpm for
1min. DNA was stored at -20˚C until used. Following this the extraction
protocol is the same as in Section 2.2.13.7.1. Samples were eluted in 50µl of
AE buffer and stored at -20˚C.
2.2.13.8. Ethanol precipitation of plasmid DNA
One-tenth volume of 3M sodium acetate (pH5.2) was added to aqueous DNA
solutions. Ice cold absolute ethanol (2.5 volumes) was added and the solution
mixed by inversion. DNA was precipitated at -20˚C for a minimum of 1hr, then
recovered by centrifugation at 12000 rpm for 15min at 4˚C in a bench microfuge
and washed twice with 1ml 70% ethanol. DNA pellets were air-dried and
resuspended in the appropriate buffer or sterile ddH2O.
2.2.13.9. Phenol extraction of aqueous DNA solutions
Aqueous DNA-containing solutions were combined with an equal volume of
phenol:chloroform:isoamyl alchohol (25:24:1) (BDH Chemicals) in a 1.5ml
eppendorfs tube and vortexed thoroughly. Tubes were spun at 12000 rpm for
3min and the upper, aqueous, layer removed and transferred to a clean
eppendorfs tube. The aqueous layer was combined with 2 volumes of cold
(-20˚C) absolute ethanol and incubated at -20˚C overnight. Tubes were
centrifuged at 12000 rpm for 30min at 4˚C, washed with 1ml 70% ethanol and
centrifuged at 12000rpm for 3min to pellet DNA. The DNA pellet was
resuspended in 10µl RNase-free TE (10mM Tris Cl, pH8.0, 1mM EDTA) for use
in the transcription reaction.
Chapter 2
90
2.2.13.10. DNA recovery from agarose gels
DNA was purified using the QIAEX II Gel extraction kit (Qiagen) on agarose gel
containing the DNA of interest. For the recovery of a specific band from bulk
DNA digestion the DNA band of interest was excised with a scalpel blade using
UV transillumination to visualize the bands. The gel slice was weighed in a
1.5ml eppendorf tube and resuspended in the 300µl Buffer QX1 for every
100mg of gel and 30µl QIAEX II was added. Tubes were incubated at 50˚C for
10min to solubilise the agarose with vortexing every 2min. Tubes were
centrifuged for 30sec at top speed in a bench microfuge and the supernatant
carefully removed. The pellet was washed once with 500µl QX1 and twice with
500µl buffer PE by resuspending the pellet and then centrifuging at top speed
for 30sec. The pellet was then air-dried until white (10-30min) and resuspended
in 30µl ddH2O by vortexing and incubated at room temperature for 5min to
dissolve DNA. Tubes were then centrifuged at top speed for 30sec and the
supernatant (purified DNA) transferred to a clean tube and used immediately or
stored at -20˚C until use.
2.2.13.11. Restriction Endonuclease digestion of DNA
Enzymes were stored at -20˚C as recommended by the manufacturer and were
used with the digestion buffers (10x concentrates) supplied. A typical reaction
contained 10 units of enzyme for every 1µg of plasmid DNA in a minimal
volume of 10x the volume of enzyme used. Reactions were incubated for 1hr at
37˚C. Digestions were analysed by agarose gel electrophoresis.
2.2.14. Polymerase Chain Reaction (PCR)
All PCR reactions were conducted in a 50µl reaction volume. PCR reactions
were performed using a PTC 100 thermocycler (MJ Research Inc, USA). All
real time PCR reactions were performed using a GeneAmp 5700 sequence
detector (Applied Biosystems). Reactions for real time PCR were run using
0.2ml optical tubes with optical lids (both Applied Biosystems) designed for use
with the GeneAmp 5700. Specific cycling conditions and reaction mixtures for
standard and real time PCR reactions are described in the sections below.
Chapter 2
91
2.2.14.1. Primers and probes
The primers and probes listed in Tables 2.3 and 2.4 were made up in ddH2O
and stored at -20˚C in 10µl aliquots. Fresh aliquots were used for each assay
to avoid freeze-thawing.
2.2.14.2. PCR for detection of BM5d
PCR amplification of integrated proviral BM5d DNA sequences was performed
using the amount of template DNA, primers and cycling conditions described in
Table 2.5. Samples were then analysed by agarose gel electrophoresis as
described in Section 2.2.13.1 and 2.2.13.2.
2.2.14.3. Real time PCR (Q-PCR) for detection of BM5d and BM5
Real time PCR reactions for the amplification of integrated proviral BM5d and
BM5e sequences were performed using the amount of template DNA, primers
and cycling conditions described in Table 2.5. Standard curves of plasmid DNA
were used to quantitate the amount of BM5d or BM5e in each sample. The
standard curves consist of 10-fold serial dilutions from 1x10-10 to 1x10-17 g/µl for
BM5d and 1x10-9 to 1x10-16 g/µl for BM5e. Melting temperature analysis was
also run with each PCR to ensure the specificity of products.
2.2.14.4. DNA standards for real time PCR
2.2.14.4.1. BM5d and BM5e
The plasmids LS-1 (constructed by Dr. L. Sammels) containing the BM5d
genome and pBM5e (provided by Prof. P. Pitha-Rowe) containing the BM5e
genome were chosen for use as standards for real time PCR. Plasmids were
purified as described in Section 2.2.13.6 and linearised by digestion with Bam
HI in buffer E (BM5e) and Eco RI in buffer H (BM5d) as described in Section
2.2.13.11 before being analysed by agarose gel electrophoresis (Section
2.2.13.1) and quantitated (Section 2.2.13.4). The concentration of linear
plasmid was adjusted to 1ng/µl (10-9g/µl) with ddH2O and aliquots stored
at -20˚C until use.
Chapter 2
92
Table 2.5 PCR buffers, cycling conditions, primer and probe concentrations for the various PCR reactions All PCR reactions use HotStarTaq (Qiagen), which requires the enzyme to be activated by the inclusion of a hot start step. PCR for the detection of BM5d and BM5e includes a step of 95˚C for 15min, followed by the cycles described in the table and then a final elongation step of 72˚C for 10min. PCR for the detection of Foxp3 and HPRT requires a hot start step of 95˚C for 10min.
PCR Qiagen PCR buffer
No. of cycles
Template DNA volume Denaturation Annealing Extension Primer
concentration
BM5d HotStarTaq PCR Master Mix
30 1µl 95˚C, 30s 58˚C, 30s 72˚C, 60s 0.1µM
Real time
PCR Qiagen PCR
buffer No. of cycles
Template DNA volume Denaturation Annealing Extension Primer
concentration Probe
concentration
BM5d SYBRGreen PCR Master Mix
40 5µl 95˚C, 30s 58˚C, 30s 72˚C, 60s
BM5e SYBRGreen PCR Master Mix
40 5µl 95˚C, 30s 58˚C, 30s 72˚C, 60s
Foxp3 SYBRGreen PCR Master Mix
40 5µl 95˚C, 30s 58˚C, 30s 72˚C, 60s 0.4µM 0.2µM
HPRT SYBRGreen PCR Master Mix
40 5µl 95˚C, 30s 58˚C, 30s 72˚C, 60s 0.4µM 0.2µM
Chapter 2
93
2.2.14.4.2. Foxp3 and HPRT
DNA standards for Foxp3 and HPRT were generated by amplification of Foxp3
and HPRT sequences from the cDNA generated from CD4+CD25+ T cells as
described in Section 2.2.16.4.1 and 2.2.16.4.2. The resulting products were
analysed by agarose gel electrophoresis (as described in Section 2.2.13.1) on a
2% agarose gel, run at 90V for 40min. The PCR product bands were then cut
out of the gel and purified (Section 2.2.13.9) before being quantitated (Section
2.2.9.1). Standards were adjusted to a concentration of 1ng/µl (10-9g/µl) and
stored at -20˚C in aliquots until use.
2.2.15. Manipulation and analysis of RNA
2.2.15.1. Agarose gel electrophoresis of RNA
Electrophoresis of RNA was performed using 0.8% agarose (BioRad, USA) in
1xTris-borate electrophoresis buffer (TBE) made with DEPC treated H2O
containing 1µl/50ml of ethidium bromide (10mg/ml, Sigma). Samples were
prepared by the addition of one sixth (1/6) the volume of 6 x loading dye to each
sample prior to loading. Electrophoresis was performed at room temperature at
90 V for 1 hour or until the bromophenol blue dye front was approximately 1-2
cm from the end of the gel unless stated otherwise.
2.2.15.2. Detection of RNA in agarose gels
DNA was visualized by UV transilluminator at 302nm. Photographic images
were taken using a Polaroid camera with a 23A red filter and Polaroid 667 film
(8.5 x 10.8cm). The film was exposed for 1-2 sec and allowed to develop for
30sec at room temperature.
2.2.15.3. Spectrophotometric quantitation of RNA
The amount and purity of RNA present in an aqueous solution was determined
by spectrophotometric measurement of the absorbance at 260nm (A260) and
Chapter 2
94
280nm (A280). Samples of RNA solutions were diluted to a volume of 500µl in
H2O and the absorbance measured. Water or TE buffer was used as a
reference blank. An absorbance of 1.0 at 260nm is equivalent to a
concentration of 40µg/ml of RNA. The amount of DNA present in a sample was
calculated as follows:
Concentration of DNA (µg/ml) = dilution factor x 40 x A260
An assessment of the purity of DNA samples was obtained by the measurement
of the A260: A280 ratio which is usually >1.9 for pure RNA.
2.2.15.4. RNA extraction from tissue
2.2.15.4.1. Plasma
Total RNA was extracted from 30µl of plasma per sample using the Qiagen
Viral RNA Mini Kit (Qiagen) incorporating an on-column DNase incubation. A
30µl volume of plasma was mixed with 250µl AVL buffer containing carrier RNA
by pulse vortexing for 15sec and then incubated at room temperature for 10min.
Tubes were spun briefly to collect all liquid in the bottom of the tube. Absolute
ethanol (250µl) was then added and samples mixed by pulse vortexing for
15sec. This mixture was applied to the provided spin column and centrifuged at
10000 rpm for 1 min in a bench microfuge. The column was then transferred to
a new 2ml collection tube. Buffer AW1 (300µl) was applied to each column and
columns were centrifuged. DNase I incubation mixture was made up (10µl
provided DNase I stock and 70µl RDD buffer) and 80µl added directly onto
membrane and incubated for 15min at room temperature. Following this 300µl
buffer AW1 was added and the column centrifuged and transferred to a fresh
collection tube. Buffer AW2 (500µl) was applied to the column and centrifuged
at 14000 rpm for 30sec. Samples were eluted in 60µl of Buffer AVE (RNase-
free H2O containing 0.04% sodium azide) by centrifuging for 1min at 10000 rpm
and stored at -20˚C.
Chapter 2
95
2.2.15.4.2. Single cell suspensions
Cells were prepared as a single cell suspension as in Sections 2.2.5.1 and
2.2.5.3.2. Following sorting (Section 2.2.6.3.2) cells were centrifuged and the
supernatant carefully removed. The cell pellet was resuspended in 350µl Buffer
RLT (Qiagen) and mixed well. If samples were not being extracted immediately
they were stored at -80˚C and thawed immediately prior to extraction. Lysed
cells were transferred onto a QiaShredder spin column (Qiagen) and
centrifuged for 2min at maximum speed to homogenise cells. The lysate was
then extracted using the RNA Blood Mini Kit (Qiagen) incorporating an on-
column DNase incubation. An equal volume (350µl) of cold 70% ethanol (in
DEPC-H2O) was added to the lysate and mixed well by pipetting and the entire
column transferred onto a QIAamp spin column and centrifuged for 15sec at
10000 rpm. The column was transferred to a new collection tube and 350µl
buffer RW1 applied to the column and centrifuged for 15sec at 10000 rpm.
DNase I incubation mixture was made up (10µl provided DNase I stock and
70µl RDD buffer) and 80µl added directly onto membrane and incubated for
15min at room temperature. Following this 350µl buffer RW1 was added and
the column centrifuged and transferred to a fresh collection tube. The column
was then washed twice with buffer RPE (500µl) and centrifuged at 10000 rpm
for 15sec. Samples were eluted in 10µl RNase-free H2O per 5x105 total cells,
with a minimum volume of 30µl used. Samples were stored at -80˚C.
2.2.15.4.3. Spleens/organs
Total tissue RNA was extracted using Ultraspec reagent (Applied Biosystems,
Foster City, CA). For this method, 10-50mg of tissue was minced while still
frozen in 1ml Ultraspec in a sterile petri dish using a sterile scalpel blade.
Samples were then transferred to 1.5ml eppendorfs and extracted by standard
phenol chloroform extraction. Briefly, samples were vortexed and stood on ice
for 5min. 200µl chloroform (BDH) was added, the samples vortexed vigorously
for 30 seconds and stood on ice for a further 5min. Samples were then
centrifuged at 12000rpm for 15min at 4˚C. The upper aqueous phase
containing the RNA was transferred to a fresh tube without disturbing the
interface and an equal volume of cold isopropanol (BDH) added. Samples were
Chapter 2
96
vortexed vigorously for 30sec and then stood on ice for 10min before being
centrifuged at 12000rpm for 10min at 4˚C. The supernatant was carefully
removed and the pellet washed twice with 1ml ice cold 70% ethanol in DEPC-
H2O by vortexing for 30sec and then centrifuging at 12000rpm for 5min at 4˚C.
The supernatant was removed using a sterile pipette, leaving approximately
10µl in the tube. Pellets were then dried using a SpeedVac Plus (SC110A,
Savant, NY, USA) by spinning on the low setting for 2 min periods until all
supernatant had evaporated. RNA was resuspended in 10µl DEPC-H2O/ 1mg
of tissue using filter tips and stored at -80°C.
2.2.15.4.4. Acid phenol extraction of aqueous RNA
Acidic phenol (saturated with 0.1M citrate, pH4.3) was mixed with an equal
volume of chloroform:isoamyl alcohol (24:1) (BDH Chemicals) to make 25:24:1
solution. Aqueous RNA solutions were combined with an equal volume of the
acidic phenol:chloroform:isoamyl alcohol, vortexed for 1min to combine and
centrifuged for 2min at 12000 rpm. The upper, aqueous, layer was transferred
to a clean 1.5ml eppendorf tube and 1 volume chloroform:isoamyl alcohol
added. This solution was vortexed for 1min and then recentrifuged. The upper,
aqueous, phase was transferred to a fresh tube and 0.5 volumes 7.5M
ammonium acetate (57.8g in 100ml DEPC-H2O) and 2.5 volumes of cold
absolute ethanol added. Samples were incubated at -70˚C for at least 30 min
and then centrifuged at 12000 rpm for 15min at 4˚C. Supernatants were
carefully removed and the pellets washed with 1ml 70% ethanol (in DEPC-H2O).
Pellets were air-dried and resuspended in 20µl TE, quantitated (Section
2.2.13.4) and stored at -20˚C.
2.2.16. Reverse transcriptase PCR (RT PCR)
All RT PCR reactions were conducted in a 50µl reaction volume. All standard
RT PCR reactions were performed using a PTC 100 thermocycler (MJ
Research Inc, USA). All real time RT PCR reactions were performed using a
GeneAmp 5700 sequence detector (Applied Biosystems). Reactions for real
time RT-PCR were run using 0.2ml optical tubes with optical lids (both Applied
Chapter 2
97
Biosystems) designed for use with the GeneAmp 5700. Specific cycling
conditions and reaction mixtures for standard and real time RT-PCR reactions
are described in the sections below.
2.2.16.1. RT PCR for detection of BM5d
RT PCR was performed on viral RNA extracted from serum or tissue as
described in Section 2.2.15.4 using the Qiagen One Step RT-PCR kit using the
following reaction mixture:
Volume Final concentration 5 x Qiagen One step RT-PCR
buffer 10µl 1x PCR buffer 1.5mM MgCl2
RT PCR enzyme mix 2µl dNTPs (10mM of each dNTP) 2µl 400µM
BM5d1 1µl 28pM BM5d2 1µl 28pM
Target DNA Serum 30µl Tissue 1µl Up to 1µg of genomic DNA
ddH20 Serum 4µl Tissue 35µl
Total reaction volume 50µl
RT PCR cycling conditions for BM5d used the following cycling conditions: 50˚C
for 30min reverse transcription, 95˚C for 15min (hot start) followed by 30 cycles
of 95˚C for 60sec, 55˚C for 60sec and 72˚C for 60sec and a final extension of
72˚C for 10min. Samples were then analysed by agarose gel electrophoresis
as described in Section 2.2.12.1 and 2.2.12.2.
2.2.16.2. One step real time RT PCR for detection of BM5d and BM5e
Real time RT PCR was performed as a one step RT PCR by amplifying 5µl total
RNA with the SYBR Green RT PCR Kit (Qiagen) on a GeneAmp 5700
sequence detector (Applied Biosystems). Reactions were conducted using the
following reaction mixture:
Chapter 2
98
Volume Final concentration 2 x Qiagen SYBR Green
RT PCR Master mix 25µl 1x PCR buffer 1.5mM MgCl2
BM5d1 or BM5e1 1µl 0.4µM BM5d2 or BM5e2 1µl 0.4µM
Target DNA 5µl Plasmid – up to 1ng Genomic DNA – up to 1µg
ddH20 17µl Total reaction volume 50µl
Real time RT PCR was performed as a one step RT PCR by amplifying 5µl total
RNA using a GeneAmp 5700 sequence detector (Applied Biosystems). BM5d
and BM5e RT PCR cycling conditions consisted of a 50˚C for 30min reverse
transcription, 95˚C for 15min (hot start) followed by 40 cycles of 95˚C for 30s,
58˚C for 30s and 72˚C for 60s. Standard curves of BM5d or BM5e RNA were
used to quantitate the amount of Foxp3 BM5d or BM5e in each sample.
Standard curves consist of 10-fold serial dilutions from 7x10-11 to 7x10-18 g/µl for
BM5d and 8x10-12 to 8x10-18 g/µl for BM5e. Melting temperature analysis was
also run with each PCR to ensure the specificity of products.
2.2.16.3. RNA standards for real time RT PCR
2.2.16.3.1. Construction of plasmids
Plasmids used for generation of RNA standards for the real time RT-PCR
quantitation of BM5d and BM5e were constructed by Dr M. Watson (Royal
Perth Hospital, WA, Australia) in the following way: the gag regions from BM5d
and BM5e were amplified by high fidelity PCR using Att modified primers for
Gateway cloning (Invitrogen, Life Technologies, Gaithersburg, MD). These
PCR products were inserted into pDONR201 (Invitrogen) followed by
sequencing to identify clones without error, and designated pENT-LS1 (BM5d)
and pENT-5e. The gag fragments were then inserted into pIRES-neo
(Clontech, BD Biosciences), that had been modified into a Gateway destination
vector (Invitrogen), using a Gateway LR reaction (Invitrogen), giving the
plasmids pEXP-IRES-BM5d and pEXP-IRES-5e (shown in Figure 2.2). The
Chapter 2
99
Figure 2.2 Circular plasmid maps of pIRES-Exp-BM5d and pIRES-Exp-BM5e The plasmids pIRES-Exp-BM5d (A) and pIRES-Exp-BM5e (B) were constructed by Dr. M. Watson using the strategy described in Section 2.2.16.3.1. Transformed cells were selected by growth on media containing ampicillin. The T7 promoter site is indicated in relation to the BM5d and BM5e viral inserts.
T7 promoter
B
T7 promoter
A
Chapter 2
100
plasmids were then transformed in bacterial cells (Section 2.2.12) and the
inserts checked by miniprep (Section 2.2.13.5) and digestion with Hind III
(Section 2.2.13.11) to ensure that they were of the correct size
2.2.16.3.2. Generation of RNA transcripts
These plasmids contain a T7 promoter to enable in vitro transcription and an
ampicillin resistance gene as a selectable marker (Figure 2.2). Recombinant
vector DNA was prepared in bulk (Section 2.2.13.6), concentrated by ethanol
precipitation (Section 2.2.13.8) and 20µg of plasmid DNA linearised by digestion
with Bam HI for 2hrs at 37˚C (Section 2.2.13.11). A small aliquot was analysed
by agarose gel electrophoresis to ensure digestion had gone to completion
(Sections 2.2.13.1 and 2.2.13.2) and the DNA purified by phenol extraction
(Section2.2.13.9). RNA transcripts were generated using the T7 Riboprobe
System (Promega, Madison, WI). A schematic of this process is shown in
Figure 2.3. Linearised template DNA is incubated with T7 RNA polymerase (10
units/µg template DNA), transcription buffer, 100mM DTT, rNTPs and a
recombinant RNasin ribonuclease inhibitor (all provided in kit) for 1hr at 37˚C.
Following this the DNA template was removed by incubation with RQ1
RNase-free DNase (1 unit/µg DNA template) and incubated at 37˚C for 15min.
Small amounts of the RNA transcripts were analysed by agarose gel
electrophoresis (Section 2.2.15.1 and 2.2.15.2) before and after DNase
treatment to ensure that all DNA was removed. The RNA was then purified by
acidic phenol extraction (Section 2.2.15.4.4). Pellets were air-dried and
resuspended in 20µl TE, quantitated (Section 2.2.13.4), adjusted to 0.7ng/µl
(7x10-10g/µl), aliquoted and stored at -20˚C.
2.2.16.4. Two step real time RT PCR for detection of Foxp3 and
HPRT
A two-step RT PCR developed by Hori and colleagues (Hori et al., 2003) was
used for the analysis of Foxp3 and HPRT (hypoxanthine-guanine
phosphoribosyl-transferase) mRNA levels in lymphocytes.
Chapter 2
101
Figure 2.3 Schematic of the in vitro T7 transcription for making RNA transcripts The pIRES-Exp-BM5d and -BM5e were linearised with Bam HI and the T7 Riboprobe in vitro transcription system (Promega) was used to generate RNA transcripts. Template DNA was then removed by digestion with DNase. RNA transcripts were then quantitated and stored at -20˚C
pIRES-Exp-BM5d or BM5e
BM5d or BM5e
T7
Digest plasmid with BamHI to
linearise DNA
T7
Add RNA systhesis components
and incubate
RNA transcripts
Remove DNA template with DNase
Purified RNA
transcripts
Chapter 2
102
2.2.16.4.1. Reverse Transcription
The RNA was reverse transcribed using a GeneAmp 2400 PCR System (Perkin
Elmer). For each sample 10µl total RNA was incubated at 65˚C for 5min with
500ng oligo(dT)12-18 primer (Invitrogen) and 10mM dNTPs (to give 0.5mM final
concentration). Samples were then left on ice for at least 1min before the
addition of 200U Superscript III reverse transcriptase (all Invitrogen), 0.1MDTT,
1xFirst Strand buffer, 40U RNase Inhibitor (Promega) and RNase-free H2O
(Qiagen) to give a final volume of 20µl. Samples were then incubated at 50˚C
for 60min and the 70˚C for 15min to heat inactivate the reverse transcriptase.
The cDNA was then stored on ice for immediate use or at -20˚C.
2.2.16.4.2. Real time PCR
Foxp3 and HPRT mRNA levels were quantified by real time PCR using the
cycling conditions, primers, probe and template DNA amounts described in
Table 2.5. Standard curves of cDNA from C57BL/6J CD4+CD25+ were used to
quantitate the amount of Foxp3 and HPRT cDNA in each sample. The
normalized value for Foxp3 mRNA expression in each sample was calculated
using the following equation:
[Quantity of Foxp3 / Quantity of HPRT] x100
Real time PCR products were run on a 2% agarose gel (in TBE) at 90V for
40min to determine that the products were of the correct size.
2.2.16.4.3. DNA standards for Foxp3 and HPRT
DNA standards for Foxp3 and HPRT were generated by amplification of Foxp3
and HPRT sequences from the cDNA generated from CD4+CD25+ T cells as
described in Section 2.2.10.4.3. The resulting products were analysed by
agarose gel electrophoresis (as described in Section 2.2.9.3) on a 2% agarose
gel, run at 90V for 40min. The PCR product bands were then cut out of the gel
and purified using a MoBio PCR Ultraclean kit (Section 2.2.13.9), quantitated
Chapter 2
103
(Section 2.2.9.1), adjusted to a concentration of 1ng/µl (10-9g/µl) and stored
at -20˚C in aliquots until use.
2.2.17. Data analysis
Analysis of the data was carried out using Microsoft Excel to produce mean
values and associated standard errors. Analyses of data for statistical
difference between control and treatment groups were performed using the
student T-test (two-tailed, assuming unequal variance of the means), a p=0.05
was considered to be statistically significant. Where multiple comparisons were
made the Minitab program was used to conduct a Dunnett’s t test at both the 95
and 99% confidence intervals. Graphs were constructed using the Microsoft
Excel or GraphPad Prism programs.
Chapter 3
Tr involvement in the early stages of MAIDS development
Chapter 3
3.1 Introduction
Murine AIDS has long been studied as a model of retrovirally-induced
immunodeficiency with the hope that this would shed light on mechanisms used
by HIV in humans. MAIDS is a chronic infection that results in progressive
immunodeficiency of the infected animals. The symptoms of infection have
raised questions about how a replication defective virus is able to induce such
profound disease, which has led to the proposal of different mechanisms (see
Chapter 1.7.4). This study was initiated to investigate whether regulatory T (Tr)
cells play a role in the establishment and progression of this chronic retroviral
infection. This information could ultimately be used in the development of new
treatments and vaccine strategies for chronic retroviral infections, in particular
HIV/AIDS.
Tr cells have recently emerged as a population of cells which play an important
role in maintaining the balance of the immune system in a number of different
settings. Tr cells have been shown to be involved in autoimmunity (Powrie, et
al., 1994a; Powrie, et al., 1994b; Sakaguchi, et al., 1995; Suri-Payer, et al.,
1998; Suri-Payer, et al., 1999; Stephens and Mason, 2000; Suri-Payer and
Cantor, 2001), tumour immunity (Onizuka, et al., 1999; Sakaguchi, et al., 2001;
Sutmuller, et al., 2001), transplantation and self tolerance (Sakaguchi, et al.,
2001).
Tr cells have now also been described in a variety of different infectious
diseases. These include parasitic diseases such as onchocerciasis (Satoguina,
et al., 2002) and leishmaniasis (Belkaid, et al., 2002) and bacterial infections
such as Bortadella pertussis (McGuirk, et al., 2002) and tuberculosis
(Geijtenbeek, et al., 2003). Tr cells have also been described in chronic viral
infections such as hepatitis C (MacDonald, et al., 2002), HIV/AIDS (Aandahl, et
al., 2004) and Friend virus (Iwashiro, et al., 2001). These pathogen-
induced/specific Tr cells have been shown to suppress effectors by IL-10
(MacDonald, et al., 2002; McGuirk, et al., 2002; Satoguina, et al., 2002) and/or
TGF-β dependent mechanisms (Iwashiro, et al., 2001). The involvement of Tr
cells in this growing catalogue of infectious diseases suggests their involvement
104
Chapter 3
in many other infections, including MAIDS, may yet be shown. Of particular
relevance to this study is the induction of Tr cells by the Friend virus which, like
LP-BM5, is also a Type C murine leukaemia virus. The induction of Tr cells in
this model lends considerable strength to the notion that Tr cells may also be
involved in MAIDS. The studies that have been conducted in the Friend virus
model and other viral infectious diseases provide a good starting point for the
identification of a Tr cell population in MAIDS. In the Friend virus model the Tr
cells were shown to be CD4+CD69+ T cells which function by CTLA-4 and TGF-
β dependent mechanisms (Iwashiro, et al., 2001). In addition there are
currently three well-defined subsets of CD4+ Tr cells (CD4+CD25+, Tr1 and Th3)
all of which are known to co-express CD25 on the cell surface and exert their
function either through cell-to-cell contact or by the secretion of IL-10 and/or
TGF-β (McGuirk and Mills, 2002).
IL-10 is a pleiotropic cytokine, the principle function of which appears to be
regulation of the immune response following infection by a pathogen (Wakkach,
et al., 2000; Akdis and Blaser, 2001; Levings, et al., 2002b). IL-10 is able to
suppress the production of many cytokines as well as co-stimulatory molecules
Akdis, 2001 #122;Levings, 2002b #364. TGF-β1 is a cytokine that has a
number of diverse functions, including immunosuppression. It can be produced
by, and also act upon, a large number of different cell types (Letterio and
Roberts, 1998; Chin, et al., 2004). Both IL-10 and TGF-β have been shown to
be important in the induction and function of Tr cells (Levings, et al., 2002a;
McGuirk and Mills, 2002; Levings, et al., 2002b).
This chapter focuses on whether there are changes in the expression levels of
Tr associated cell surface markers, such as CD25 and CD69, on CD4+ T cells
and in the production of the Tr associated cytokine IL-10 and TGF-β by these
cells in the early stages of MAIDS infection. These data are indicative of a Tr
involvement in MAIDS. Aspects of this work have been published in the Journal
of Immunology (Beilharz, Sammels, Paun et al., 2004) and are under revision
for publication in the Journal of Interferon and Cytokine Research (Paun and
Beilharz, 2005).
105
Chapter 3
3.2 Results
3.2.1 Early cytokine profiles
The contribution of cytokines to the development and progression of MAIDS has
remained difficult to resolve due to the conflicting results that have been
observed by a number of different groups (Morse, et al., 1992; Morawetz, et al.,
1998). It is generally observed that there is an early burst of both Th1 and Th2
cytokines (IFN-γ, IL-2, IL-10 and IL-4) followed by a shift to a Th2 pattern after 2
weeks pi. with decreasing expression of IFN-γ and IL-2 and a corresponding
increase in IL-10 and IL-4 as disease progresses (Cheung, et al., 1991; Morse,
et al., 1992; Uehara, et al., 1994; Akarid, et al., 1995; Morawetz, et al., 1998).
However IL-10 knock out mice do not have abnormal disease progression
(Morawetz, et al., 1998) and treatment with anti-IL-10 mAb also has no effect on
disease (Uehara, et al., 1994). The same results have been observed for IL-4
(Morawetz, et al., 1994; Morawetz, et al., 1998). TGF-β has only been
examined in the context of hematopoiesis in stromal cell lines established from
the bone marrow of uninfected and LP-BM5 infected mice and was shown to be
expressed by infected but not by uninfected cell lines (Tse, et al., 1994;
Gallicchio, et al., 1996).
The results presented in this section describe the production of cytokines in the
21 days following infection. This time period was chosen as the suppressive
activity of Tr cells would presumably occur after the CTL response to LP-BM5
has been initiated by infection. The levels of the IL-10, IL-4, TGF-β and IFN-γ
were examined in the context of Tr cell induction and function at both a systemic
and a cellular level. This approach has involved the development of two
techniques not previously employed in the laboratory; intracellular flow
cytometry and ELISpot. ELISA was used to determine systemic levels of all
four cytokines.
3.2.2 Intracellular flow cytometry
Intracellular flow cytometry is a technique that enables the detection of
cytokines that are contained within the cell using fluorochrome-conjugated
monoclonal antibodies. One of the major advantages of this technique is that
106
Chapter 3
cells can be labelled for cell surface markers and cytokines of interest at the
same time allowing the identification of a specific population within an
unseparated sample of cells. The cells are fixed with paraformaldehyde to
stabilise the cell membrane which is subsequently permeabilised with the
detergent saponin. This permeabilisation is crucial for allowing the anti-cytokine
mAbs access to the intracellular compartments. The technique is rapid and
gives quantitative results that are easily analysed on a flow cytometer.
For the analysis of cytokine production in MAIDS the assay was adapted to be
directly ex vivo, meaning that samples were collected and fixed immediately
after the preparation of a single cell suspension. A restimulation step was not
included in the process, allowing the examination of cytokines that were being
produced as a direct response to LP-BM5 infection.
A significant part of the development of this assay was the generation of
appropriate controls, which were run each time the assay was conducted.
Positive control cells that had been stimulated to produce high levels of cytokine
were used to ensure that effective staining was taking place. The generation of
these controls is described in Section 2.2.11.1.1. In addition, negative controls
were also used to ensure that there was no autofluorescence being interpreted
as cytokine positive events. Isotype control antibodies were also utilised to
ensure that samples were staining specifically and are subtracted from any
cytokine positive event obtained. Examples of each of the controls used for the
assay are shown in Figure 3.1.
3.2.3 Cytokine levels by intracellular flow cytometry
This assay was then applied to a time course of MAIDS infections, where
spleens from uninfected controls (day 0) and infected mice at days 4, 8, 12, 16
and 20 pi were collected and prepared as single cell suspensions (section
2.2.5.1 and 2.2.6.1). These cells were then stained for combinations of CD4,
IL-10 and IL-4 as described above and in Section 2.2.11.1. An example of the
level of staining observed at different times post infection is shown in Figure 3.2
as dot plots of IL-4 or IL-10 plotted against CD4 expression at days 0 and 16 pi.
107
Chapter 3
100 101 102 10 3 PC
10 4100
101
102
103
104
Ig
G
1
D 0.79 0.13
2.61 96.5
CD4 A
100 101 102 103 104
CD4 APC
100
101
102
103
104
IL-1
0 PE
22.7 0
077.3
A
Figure 3.1. Positive, negative and isotype control samples for intracellular flow Positive control samples were prepared as described in Section 2.11.1.1. All samples were collected from the spleen and stained as described in Section 2.2.5.1 and 2.2.6.1. All data is presented as dot plots showing 100% of white blood cells analysed. A. IL-10 positive control cells stained with anti-IL-10 PE, B. IL-4 positive control cells stained with anti-IL-4 PE, C. Negative control stained with non-fluorochrome conjugated mAb, the plot is representative of the results seen for both anti-IL-4 and anti-IL-10, D. splenocytes stained with anti-IgG1 PE isotype control antibody, E. splenocytes stained with anti-IgG2b isotype control antibody.
100 101 102 103 104
CD4 APC
100
101
102
103
104
IL-4
PE
B 410E 5.02 0.046
094.9100 101 102 10 3
0.61
98 0.9
0.3
IgG2b 410
310
C
D
4
210
110
010
10 0 10 1 PC 10 2 103 10
0
0
99.5 0.52
0.022
3 4
2 1
CD4-A
1C 0
10
P 10
10
104
108
Chapter 3
10 0 10 1 10 2 10 3 104
CD4 APC
10 0
10 1
10 2
10 3
10 4
IL-4
PE
12 0.64
10.976.5
10 0 10 1 10 2 10 3 104
CD4 APC
10 0
10 1
10 2
10 3
10 4
IL-1
0 P
E
10.7 0.81
13.475.1
10 0 10 1 10 2 10 3 104
CD4 APC
10 0
10 1
10 2
10 3
10 4
IL-1
0 P
E
0.98 0.41
18.580.2
10 0 10 1 10 2 10 3 104
CD4 APC
10 0
10 1
10 2
10 3
10 4
IL-4
PE
1.17 0.21
17.880.8
C D
A B
Figure 3.2. Scatter plots of intracellular detection of IL-4 and IL-10 in the spleen All spleen samples were prepared as described in Section 2.2.5.1, 2.2.6.1 and 2.2.11.1. Data is presented as dot plots showing 100% of the white blood cells obtained with CD4 being shown on the X axis and the cytokine of interest shown on the Y axis. Samples were stained with CD4 APC and IL-10 PE (A) uninfected mouse and (B) day 16 pi mouse or CD4 APC and IL-4 PE (C) uninfected mouse and (D) day 16 pi mouse. Plots are representative of the data obtained from 3 mice per time point. A clear increase in the expression of IL-10 and IL-4 by CD4+ T cells and non-CD4 cells can be seen in the day 16 pi samples in comparison with the uninfected samples.
109
Chapter 3
This study found that in the total spleen samples there was little intracellular
IL-10 or IL-4 present at days 0 and 4 pi and there was no specific staining
observed over the level of the isotype control antibodies (Figure 3.3). IL-10
levels were found to increase from day 8 onwards, with a statistically significant
peak at day 16 pi before decreasing by day 20 pi. IL-4 levels followed a similar
pattern of expression, however the increase was smaller than that observed for
IL-10 and the levels of IL-4 did not fall as sharply by day 20 pi.
Cytokine expression by CD4+ T cells was also examined to determine the
proportion of cells expressing the cytokines characteristic of Tr cells: high IL-10
and/or TGF-β and low IL-4. A small number of CD4+ T cells were found to
express IL-10 at day 0 and day 4 pi, followed by a large increase at day 8 and a
peak in expression at day 16 pi (Figure 3.4A) when examined as a proportion of
total splenocytes. While the data indicate a trough in IL-10 expression at day
12 pi, the significance of these findings can not be confirmed as samples from
day 10 and 14 were not analysed as a part of this study. The peak was also
found to correspond to a ten-fold increase in the number of IL-10+ CD4+ T cells
in the spleen, from 0.67% at day 0 to 6.44% of CD4+ T cells at day 16 pi. This
was followed by a return to the levels observed at day 0 at day 20 pi. The
intracellular expression of IL-4 by CD4+ T cells followed a similar pattern to that
observed for IL-10 (Figure 3.4B) when examined as a proportion of total
splenocytes. However, only a 5-fold increase in the proportion of IL-4+CD4+ T
cells was seen at day 16 pi, with expression increasing from 0.55% at day 0 to
2.52% of CD4+ T cells at day 16 pi.
In addition the intracellular levels of TGF-β in CD4+ T cells at days 0, 8, 16 and
20 pi were examined in an independent experiment. This experiment found that
there was an increase in the percentage CD4+ T cells that are secreting TGF-β,
peaking at day 16 pi (Figure 3.4C), as a proportion of total splenocytes. The
proportion of CD4+ T cells expressing intracellular TGF-β was found to increase
from 3.5% at day 0 to 4.82% of CD4+ T cells at day 16 pi, an ~30% increase in
the number of TGF-β+ CD4+ T cells in the spleen following LP-BM5 infection
which was not found to be of statistical significance.
110
Chapter 3
0 4 8 12 16 200
1
2
3
4
5
6
7
8 IL-10IL-4
days pi
% c
ytok
ine
post
ive
cells
***
***
Figure 3.3. Tr cytokine production in splenocytes following LP-BM5 infection using intracellular flow Intracellular flow cytometry was performed on total splenocytes of mice at days 0, 4, 8, 12, 16 and 20 pi. Cells were prepared and stained as described in Section 2.2.5.1, 2.2.6.1 and 2.2.11.1 for the expression of IL-4 or IL-10. Isotype control antibodies were also used and isotype control stained cells were subtracted from cytokine positive cells to account for non-specific staining. Statistical analysis found that the peaks in IL-10 and IL-4 expression at the day 16 pi time point were found to statistically significant compared to day 0 baseline expression. Data is shown as the mean ±SEM for n=3 mice per group. *** p>0.01
111
Chapter 3
0 4 8 12 16 200.0
0.2
0.4
0.6
0.8
1.0A
days pi
% IL
-10+ C
D4+ T
cel
ls o
f tot
al
0 4 8 12 16 200.00
0.25
0.50
0.75
1.00B
days pi
% IL
-4+ C
D4+ T
cel
ls o
f tot
al
0 4 8 12 16 200.0
0.2
0.4
0.6
0.8
1.0C
days pi
% T
GF-β+ C
D4+ c
ells
of t
otal
***
*
Figure 3.4 Tr cytokine production by CD4+ T cells using intracellular flow Intracellular flow cytometry was performed on total splenocytes for A and B, and purified CD4+ T cells for C. Cells were then stained for a combination of CD4 and either IL-4, IL-10 or TGF-β. All data is shown as the percentage of CD4+ cytokine+ cells for IL-10 (A), IL-4 (B) and TGF-β (C). Peaks at day 16 were found to be statistically significant for IL-10 and IL-4, but not for TGF-β (p=0.1) compared to the day 0 baseline. For A and B, data is shown as the mean ±SEM of n=3 mice per group. For C, data is shown as the mean ±SEM of pooled cells from n=3 mice that have been run in duplicate. * p>0.05, *** p>0.01
112
Chapter 3
3.2.4 Enzyme-linked immunospot (ELISpot) assay
Whilst intracellular flow is a powerful tool for the analysis of cytokine producing
cells, the assay only provides a measure of which cells contain the cytokine of
interest internally, which may not reflect what is actually being secreted by the
cell. ELISpot is a technique that is based on the same principle as a
quantitative sandwich ELISA assay. This technique involves the use of a PVDF
(polyvinylidene diflouride) membrane backed microplate that is pre-coated with
monoclonal antibody specific for the cytokine of interest. A pre-counted number
of cells are then incubated in the plate overnight either with or without stimulus.
As the cells are not moving during this incubation period, any cytokine that is
secreted is captured by the membrane-bound mAb in the immediate vicinity of
the cell. The cells are then washed off the plate the following day and the
bound cytokine is detected using a secondary mAb and then a coloured
substrate. This results in the appearance of coloured spots in the areas where
cytokine has been secreted, with each spot being equivalent to one cytokine
secreting cell. These spots can then be counted, making the technique
quantitative.
Initial studies conducted on whole splenocytes used plates pre-coated against
IL-4 and IL-10 that were provided as part of a kit by R&D Systems. Subsequent
samples were run using the method described in Section 2.2.11.2. Matched
pairs of mAbs specific for IL-4, IL-10 and TGF-β were used for the coating of
plates and the subsequent detection of the cytokine. Recombinant cytokine
was used as a positive control to ensure that the assay was working correctly.
Spots were then counted using a stereomicroscope or using an ELISpot plate
reader. All of the ELISpot studies presented in this chapter were conducted
without further stimulation of the cells following isolation in order to determine
the cytokine response generated in vivo during infection.
113
Chapter 3
3.2.5 Cytokine levels by ELISpot
This assay was applied to analyse the secretion of IL-4 and IL-10 by
splenocytes over a time course of days 0, 4, 8, 12, 16 and 20 days post
LP-BM5 infection. Splenocytes were collected as described in Section 2.2.5.1
and 2.2.6.1 and were stored at -80˚C until all samples were collected before
being thawed, counted and incubated for the detection of cytokine secretion
with no further restimulation before detection and analysis.
The secretion of IL-10 by splenocytes was not found to increase significantly
from days 0 to 8 pi, following which a large increase in IL-10 secreting cells was
observed at day 12 pi (Figure 3.5A). LP-BM5-induced IL-10 secretion by
splenocytes was found to peak at day 16 pi and then drop dramatically at day
20 pi to below the levels observed at day 0. In contrast the number of
splenocytes secreting IL-4 was found to be much lower, and whilst increasing
steadily in number to peak at day 16 pi, the overall increase was found to be
much smaller than observed for IL-10 (Figure 3.5A The production of TGF-β by
total splenocytes following LP-BM5 infection was also found to peak at day 16
pi, at which point there was a 2-fold increase in the number of splenocytes
secreting TGF-β (Figure 3.5B). By day 20 pi the number of CD4+ T cells
secreting TGF-β was found to return to the levels observed at day 0.
Intracellular flow had shown that there was an increased population of CD4+ T
cells that had intracellular IL-10 and TGF-β 16 days after infection with LP-BM5.
In order to determine whether these cytokines were also being secreted,
splenocytes from day 0 and day 16 pi mice were sorted using MACS beads to
collect CD4+ T cells. These two time points were chosen as day 0 provided a
baseline and the peak of cytokine expression had been observed at day 16 pi.
The ELISpot performed on CD4+ T cells found no difference in the number of
cells secreting IL-10 at days 0 and 16 pi (Figure 3.6), a result in direct contrast
with the 10-fold increase observed in the intracellular flow. The ELISpot also
demonstrates that the majority of the cells secreting IL-10 in the 3 weeks post
LP-BM5 infection are not CD4+ T cells as there is a large difference in the
number of IL-10 secreting cells observed in Figures 3.5 and 3.6. In contrast,
114
Chapter 3
0 4 8 12 16 200
500
1000
1500
2000
2500 IL-10IL-4
days post infection
spot
s/2x
105 c
ells
A
0 8 16 200
100
200
300
400
500
600
700B
days post infection
spot
s/2x
105 c
ells
***
*
Figure 3.5 Tr cytokine production in total splenocytes using ELISpot Total splenocytes were collected from mice at days 0, 4, 8, 12, 16 and 20 post LP-BM5 infection and the secretion of IL-4 (A), IL-10 (A) and TGF-β (B) were measured by ELISpot without any further restimulation. Peaks at day 16 pi were found to be statistically significant for IL-10 and IL-4 but not for TGF-β (p=0.053) when compared to day 0 baseline levels. Data is shown as the mean ±SEM of n=3 mice per group for IL-4 and IL-10 (A) and the combined mean ±SEM from two independent experiments examining the pooled cells from a total of n=6 mice per time point for TGF-β (B). * p>0.01, *** p>0.001
115
Chapter 3
0 160
100
200
300
400
500 IL-10TGF-b
*
days post infection
spot
s/10
5 cel
ls
Figure 3.6 Tr cytokine production by CD4+ T cells using ELISpot The secretion of IL-10 ( ) and TGF-β ( ) by purified CD4+ T cells from mice at day 0 and day 16 post LP-BM5 infection were examined by ELISpot without further restimulation of the cells. CD4+ T cells were purified by MACS bead selection as described in Section 2.2.9.1. The increase in cytokine secreting cells at day 16 was found to be significant for TGF-β (p=0.02) but not for IL-10 (p=0.16). Data is shown as the combined mean ±SEM from two independent experiments for the pooled cells from a total of n=6 mice group. * p<0.05
116
Chapter 3
the number of CD4+ T cells secreting TGF-β was found to be the same as
reported for total splenocytes (Figure 3.5B and 3.6), indicating that CD4+ T cells
were responsible for the production of TGF-β following LP-BM5 infection. The
increase in the number of cells was found to be approximately 30%, a result
that is also consistent with the intracellular flow reported in the previous section.
3.2.6 Levels of Tr cytokines in serum
In addition to directly assessing the cells producing the Tr associated cytokines
IL-10 and TGF-β, it was also of interest to determine whether the amount of
cytokine being produced was ‘spilling over’ into the circulation to act
systemically. The level of cytokine in the periphery was measured by collecting
blood from mice over days 0-21, harvesting the serum by centrifugation as
described in Section 2.2.5.2.1 for use in cytokine specific ELISA. The Tr
cytokines IL-10 and TGF-β were examined in addition to IL-4 and IFN-γ. Only
bioactive TGF-β was measured as serum samples were not acidified prior to the
ELISA being performed. Despite considerable mouse to mouse variation within
and between all three experiments clear trends consistent with published
literature were observed in the expression of all four cytokines examined,
although no statististical significance was observed at the 95% confidence level.
The level of IL-10 in peripheral blood was found to fluctuate from days 0-11 pi
before beginning to increase from day 12 pi (Figure 3.7A). A diffuse peak was
seen from day 12, with maximal levels observed at day 16 pi before the level of
IL-10 returned to levels observed in the first week pi. This is consistent with the
results observed for both the intracellular flow and ELISpot analysis. In contrast
the level of TGF-β followed a very clear pattern of peaks and troughs (Figure
3.7B), with peaks observed at days 7, 15 and 20 pi.
IL-4 levels were found to peak at day 7 pi and again at day 16 pi before
continuing to increase beyond day 19 (Figure 3.8A). This result is consistent
with those reported in the literature for IL-4 (Gazzinelli, et al., 1992). IFN-γ was
examined as a control as Tr cells are not known to secrete this cytokine and its
role in LP-BM5 has been well studied. IFN-γ was found to be present in
117
Chapter 3
0 1 2 3 4 5 6 7 8 9 101112131415161718192021220
500
1000
1500
2000A
days pi
IL-1
0 (p
g/m
l)
0 1 2 3 4 5 6 7 8 9 101112131415161718192021220
1000
2000
3000
4000
5000
6000B
days pi
TGF-β
(pg/
ml)
Figure 3.7 Serum levels of IL-10 and TGF-β from days 0-21 post LP-BM5 infection Blood was collected from the tail vein of mice from days 0-21 post LP-BM5 infection, the serum collected by centrifugation and the levels of IL-10 (A) and TGF-β (B) determined by ELISA using cytokine specific mAbs. Data is shown as the combined mean ±SEM of 2 (TGF-β) and 3 (IL-10) independent experiments. The values shown represent n=9 mice per group for IL-10 (A) and n=6 mice per group for TGF-β (B).
118
Chapter 3
0 1 2 3 4 5 6 7 8 9 101112131415161718192021220
2000
4000
6000
8000
10000
12000
14000
16000
18000
20000A
days pi
IL-4
(pg/
ml)
0 1 2 3 4 5 6 7 8 9 101112131415161718192021220
200
400
600
800
1000
1200
1400
1600
1800
2000B
days pi
IFN
- γ (p
g/m
l)
Figure 3.8 Serum levels of IL-4 and IFN-γ from day 0-21 post LP-BM5 infection Blood was collected from the tail vein of mice from days 0-21 post LP-BM5 infection, the serum collected by centrifugation and the levels of IL-4 (A) and IFN-γ (B) determined by ELISA using cytokine specific mAbs. Data is shown as the combined mean ±SEM of 3 independent experiments. The values shown represent n=9 mice per group for both IL-4 and IFN-γ.
119
Chapter 3
increased amounts in the first week of infection (Figure 3.8B) before decreasing
back to pre-infection levels and fluctuating at this level for the duration of the
time course. These results are consistent with the literature that has previously
been published examining IFN-γ levels following LP-BM5 infection (Akarid, et
al., 1995).
3.3 Tr cell associated cell surface markers by flow cytometry
In addition to the expression of IL-10 and TGF-β, Tr cells can also be identified
by cell surface marker expression. A number of cell surface markers have been
associated with clearly defined subsets of CD4+ Tr cells including CD25
(Sakaguchi, et al., 1995; McGuirk and Mills, 2002), CD38 (Read, et al., 1998;
Singh, et al., 2001; Annacker and Powrie, 2002) and CD69 (Iwashiro, et al.,
2001). CD4+CD25+ Tr cells are involved in a variety of different models
including infectious diseases and the CD25 molecule has been found on almost
all of the currently defined Tr subsets.
In addition to the investigation of expansion of CD25-expressing CD4+ cells
following infection with LP-BM5, the expression of CD38 and CD69 by CD4+ T
cells were also examined in a time course of LP-BM5 infection. It has been
reported that there is a significant increase in the level of expression of these
markers on the CD4+ T cells of mice chronically infected with the related
retrovirus, Friends murine leukemia virus (Iwashiro, et al., 2001). Co-
expression of CD4 and CD69 was used to purify a population of Tr cells that
had immunosuppressive functions. As these viruses are closely related it was
of interest to determine whether the same changes could be observed in the
MAIDS model.
A time course examining the in vivo changes in the percentage of CD4+ T cells
co-expressing CD25, CD38 and CD69 in the blood of LP-BM5 infected mice
from day 0-21 post LP-BM5 infection was conducted using flow cytometry. This
was done to determine whether there are any changes in the expression of
these markers that correspond to the peaks in cytokine expression that have
been identified. Groups of mice were infected and blood collected from the tail
120
Chapter 3
0 5 10 15 204
5
6
7
8
9
10
11A *
days pi
% C
D4+ c
ells
that
are
CD
25+
0 5 10 15 200
5
10
15
20
25B
Days post infection
%C
D4+ c
ells
that
are
CD
69+
0 5 10 15 200
5
10
15
20C
days pi
% C
D4+ c
ells
that
are
CD
38+
Figure 3.9 Expression of Tr cell surface markers on peripheral blood CD4+ T cells Flow cytometric analysis of the co-expression of Tr cell surface markers CD25 (A), CD69 (B) and CD38 (C) by CD4+ T cells in the peripheral blood of mice at days 0-21 pi. Data is shown as mean ±SEM for n=3-9 mice per time point from 2-3 independent experiments. * p<0.05
121
Chapter 3
vein for the analysis of peripheral white blood cells. The cells were stained for a
combination of CD4, CD25, CD38 and CD69 before analysis by flow cytometry.
There was no rapid increase observed in the level of CD25 expression by CD4+
T cells, in fact no large increase was found until day 11 pi. The results of three
independent experiments, shown combined in Figure 3.9A, indicate that there is
a statistically significant peak (p<0.05 by Dunnett’s T test for multiple
comparisons) in the percentage of CD25+ CD4 T cells at day 12 pi in the
peripheral blood. The peak of CD25 co-expression on CD4+ T cells was seen
at day 12 in two of the experiments and at day 11 pi in the third, showing some
variability in the individual mouse responses. No other significant increase in
CD25 co-expression was observed during the first 21 days following LP-BM5
infection.
The level of CD69 on peripheral blood CD4+ T cells was found to increase
steadily for the 6 days following infection, an approximately 4-fold increase
(Figure 3.9B). CD69 co-expression fluctuated from days 7-16 pi with levels
remaining at close to 10% of CD4+ T cells during this period prior to a further
increase in CD69 levels at day 20 pi. In contrast, CD38 co-expression on CD4+
T cells was found to increase rapidly, by approximately 5-fold by 4 days pi and
levels remained elevated at all time point examined (Figure 3.9C). Two peaks
in expression were found at days 5 and 14 pi and then a trend of increasing
CD38 levels on CD4+ T cells was observed. This rapid increase in response to
LP-BM5 infection suggested that this marker was acting as an early marker of
activation and would therefore not be useful in differentiating a Tr population in
MAIDS.
The co-expression of CD25 and CD69 was also examined in the spleens of
infected mice at a range of different times post LP-BM5 infection to determine
whether the Tr cell changes in peripheral blood were reflected in the spleen.
The level of CD25 co-expression on CD4+ T cells was found to change very
little over the first 3 weeks pi and had not increased substantially by 10 weeks pi
(Figure 3.10). As was observed for CD25, the level of CD69 co-expression did
not increase significantly during the first 16 days pi. However in contrast to
122
Chapter 3
0 7 8 10 14 16 18 21 30 36 700
10
20
30
40
50
60
CD25 CD69
days post infection
% C
D4+
cells
co-
expr
essi
ng
Figure 3.10 Expression of CD25 and CD69 on splenic CD4+ T cells The expression of CD25 and CD69 on splenic CD4+ T cells was examined on a time course of different days post LP-BM5 infection by flow cytometry. Cells were stained for a combination of CD4, CD25 and CD69. The data is shown as the mean ±SEM for n=2-10 mice per time point.
123
Chapter 3
CD25, the percentage of CD4+ T cells co-expressing CD69 increased rapidly
from day 18 pi and over half of all CD4+ T cells were expressing CD69 by 10
weeks pi. This increase is very similar in magnitude to that observed in the
spleens of mice infected with Friend Virus where these cells were later shown to
have suppressive functions (Iwashiro, et al., 2001).
3.4 Discussion
The aim of the work presented in this chapter was to determine whether
infection with LP-BM5 resulted in the induction or activation of a population of Tr
cells which may then influence disease development. The involvement of Tr
cells in chronic viral infections has been described in Hepatitis C in humans
(MacDonald, et al., 2002). A population of Tr cells have also been shown to be
induced in the Friends retroviral model (Iwashiro, et al., 2001). In addition the
presence of CD4+CD25+ Tr cells specific for HIV and CMV antigens in the
peripheral blood of HIV+ patients that have been infected for less than a year
has also been recently reported (Aandahl, et al., 2004). Initial evidence that
these cells are also involved in the development or progression of MAIDS has
been presented in this chapter.
While changes in cytokine expression following LP-BM5 infection have been
investigated in the context of the Th1/Th2 paradigm, there has been no
investigation of whether these cytokines are involved in Tr induction or function.
One of the best means of currently identifying Tr cells is by their cytokine
secretion profile: high IL-10 (and/or TGF-β) with low IL-4 (K. Mills, Trinity
College, Dublin, personal communication).
Previous studies have focussed on ELISA or RT-PCR to determine cytokine
expression and have often involved restimulation of cells in vitro prior to
analysis. In order to investigate whether Tr cells were involved in MAIDS,
changes in the cytokine production of a small number of cells had to be
investigated, requiring the application of two sensitive and quantitative
124
Chapter 3
techniques; intracellular flow cytometry and ELISpot. Both techniques can also
be used without restimulation of the cells, allowing for an accurate assessment
of cytokine levels in response to the antigens introduced by the pathogen. The
study was also limited to the first 21 days of infection as Tr cells, if involved,
would arise as part of the primary immune response to infection. Analysis of
IL-4, IL-10 and TGF-β expression by intracellular flow found that there was a
very clear peak in the number of cells with intracellular IL-4 and IL-10 at day 16
pi (Figure 3.3). The percentage of CD4+ T cells expressing intracellular IL-4,
IL-10 and TGF-β were all found to peak at day 16 pi (Figure 3.4).
ELISpot was then used to determine whether these cytokines were also being
secreted. This assay found that, in contrast to the results of the intracellular
flow (Figure 3.3), the number of IL-10 secreting cells was considerably higher
than those secreting IL-4. Secretion of IL-4, IL-10 and TGF-β was also found to
peak at day 16 pi (Figure 3.6) with this assay. When purified CD4+ T cells were
assayed it was found that there was no change in the level of secreted IL-10 but
an increase in the number of cells secreting TGF-β between days 0 and 16 pi
was observed (Figure 3.7). In fact, the number of CD4+ T cells secreting TGF-β
was found to be equivalent to the number of cells in the unseparated sample,
demonstrating that it is a small population of CD4+ T cells which is secreting
TGF-β in response to LP-BM5 infection. In contrast, IL-10 was produced
primarily by non-CD4+ cells. These results also suggest that the increase in the
number of TGF-β producing CD4+ T cells in the spleen may reflect an increase
in the number of Tr cells in response to LP-BM5 infection. Further to this, peaks
in the levels of IL-10 and TGF-β are also found in the serum from days 12-16 pi,
demonstrating that the cytokine is spilling over into the peripheral blood.
Analysis of known Tr cell surface markers shows a peak in CD25 levels on CD4+ T
cells at day 12 pi. The subsequent loss of CD25 expression is consistent with the
presence of a CD4+ Tr cell population that loses surface expression of CD25
following maturation, whilst maintaining function as has previously been found in a
study conducted by Gavin and colleagues (Gavin, et al., 2002). Further to this there
appears to be little change in the level of CD25 expression on CD4+ T cells in the
peripheral blood and spleen of infected mice at various time points making this a
125
Chapter 3
useful marker for the identification of Tr cells particularly in the early stages of
MAIDS. The changes observed in the percentage of CD4+ T cells co-expressing
CD69 are consistent with the CD69+CD4+ Tr population that has been described in
the Friends retroviral model (Iwashiro, et al., 2001). However, the increased
expression of CD69 after day 16 pi suggests that it may also be acting as a marker
of activation, potentially limiting its use for the identification of Tr cells after this time
point. The very early increase in the number of CD38+CD4+ suggest that CD38 is
acting as an activation marker and would not be useful for the identification of a Tr
cell subset.
It is interesting to note that the peak in CD25+ expression occurred on days 10-
12 pi, corresponding with the beginning of the IL-10 and TGF-β peaks. Taken
together temporal expression of cell surface markers (CD4+CD25+) and the
direct ex vivo cellular data (TGF-β and IL-10) is highly suggestive of a small
regulator cell population expanding and becoming functional (with the loss of
CD25) at an early stage of MAIDS infection.
This also raises questions about the role and mechanism of action of Tr cells in
MAIDS progression. Little work has been done to investigate the role of TGF-β
in MAIDS and role of the IL-10 also remains unclear. IL-10-/- mice have
previously been shown to develop MAIDS and the lack of effect of anti-IL-10
mAb treatment in disease suggests that there is little role for IL-10 in disease
progression (Uehara, et al., 1994). Yet the overall increase in the levels of IL-
10 following infection gives rise to speculation that there is a role for IL-10 in the
general immunosuppression found later in disease (Morawetz, et al., 1994).
The peak in IL-10 levels observed at day 16 p.i. suggests that IL-10 may play a
role in the induction of the Tr cells that arise following LP-BM5 infection. The
fact that the majority of cells that are producing IL-10 are not CD4+ T cells
certainly supports the notion of induction of Tr cells by a population of dendritic
cells through the secretion of IL-10 (McGuirk and Mills, 2002). It also is
possible that IL-10 and TGF-β work in tandem and that there is sufficient
redundancy in this system that TGF-β alone is sufficient to induce Tr cells in the
absence of IL-10, a possibility that explains the results of the IL-10 studies
126
Chapter 3
discussed above. An alternate possibility is that IL-10 plays little role in the
induction and function of Tr cells in MAIDS and that it is TGF-β that is the main
regulatory cytokine involved. It has previously been shown in the Friends
leukaemia virus model the induced CD4+CD69+ Tr cells were able to induce (in
vitro) suppression in a TGF-β and CTLA-4 dependent manner (Iwashiro, et al.,
2001). It is entirely possible that this is also the case in MAIDS, which is
caused by a closely related virus.
The data that is presented in this chapter provides evidence of a population of
CD4+ Tr cells that express CD25 and secrete TGF-β, some IL-10 and low levels
of IL-4 that are induced following infection with LP-BM5. The timing of the
changes in cytokines and cell surface markers at days 12-16 pi suggests that
the opportunity to intervene therapeutically to alter the disease outcome exists
and can be used to determine the importance of Tr cells in MAIDS development
and progression. This approach has previously been utilised in a murine T cell
leukaemia model where it was found that the most effective time of treatment
with the anti-mitotic agent Vinblastine was at day 13 and 15 post tumour
inoculation (North and Awwad, 1990). The authors went on to demonstrate that
treatment was effective due to the targeting of an expanding CD4+ Tr cell
population. These ideas have led to the design of the experiments presented in
Chapter 4, which demonstrate that this is also the case in MAIDS. Further work
to phenotypically and functionally characterise this Tr cell population has also
been undertaken and is presented in Chapter 5 of this thesis.
127
Chapter 4:
Therapeutic targeting of Tr cells
in MAIDS infection
Chapter 4
128
4.1 Introduction
In the previous chapter evidence for a Tr cell population playing a role in the
development of MAIDS was presented based on the early expression of Tr cell-
associated cytokines and cell surface markers. These data indicated that there
is a period between days 12-16 post infection during which the Tr cells induced
by LP-BM5 infection become activated and begin to exert their suppressive
function. These findings raised questions as to the possible role these cells
may play in disease development. If Tr cells play a crucial role in the viral
pathology then the removal or functional inactivation of these cells should have
a significant effect on disease progression, measurable by a reduction in
symptoms such as splenomegaly. The experiments presented in this chapter
examine the effect of therapeutically targeting the Tr cell population on MAIDS
development.
The first step in this process was choosing a therapeutic agent that could be
used to target the Tr cells. The MAIDS model has been used to test a number
of anti-retroviral agents and new combinations of agents including
azidothymidine (AZT) (Magnani, et al., 1997; Fraternale, et al., 2001). However
these agents target the virus rather than the cells, ruling them out for use in this
study.
A comprehensive search of the literature revealed that anti-neoplastics have
also been used to treat MAIDS-infected mice. The transformation theory of
MAIDS pathogenesis suggests that the infection causes a paraneoplasia, with
disease developing due to the expansion of infected target cells (Jolicoeur,
1991). It was therefore suggested that the ablation of these cells with
anti-neoplastic agents should result in a beneficial outcome (Simard and
Jolicoeur, 1991). This theory was tested using three different anti-neoplastic
agents in mice infected with helper-free BM5d virus and it was found that
cyclophosphamide was extremely effective in treating the disease with all
measured parameters indistinguishable from uninfected controls. Whilst
Chapter 4
129
cyclophosphamide use can undoubtedly be interpreted as blocking the
expansion of virally infected target cells, it is also possible that the
cyclophosphamide may have blocked an early expansion of Tr cells. These Tr
cells normally support the immune response against such expanding
populations of virally-infected target cells. These results would be the same
with either mechanism operating, provided that the Tr cells normal function was
critical to disease progression.
This suggested that an anti-neoplastic agent might be of use in the
immunomodulation of Tr cells, particularly if the agent was administered in a
precisely timed fashion. This timed administration could be used when Tr cells
are expanding, rather than over an extended treatment course as is usual for
limiting neoplastic growth with conventional chemotherapy. The concept of
modulating the immune system to enhance the immune response by timed
application of an anti-mitotic has been explored in a murine T cell leukemia
model (North and Awwad, 1990). North and Awaad hypothesised that the
immune response to certain immunogenic tumours fails to develop sufficiently
due to down regulation by Tr cells (then called suppressor T cells) and that the
selective removal of these cells at the appropriate time would result in tumour
regression. They were able to show that injection with a single timed dose of
the anti-mitotic agent Vinblastine was able to cause immunologically mediated
regression of an advanced lymphoma. A series of elegant experiments went on
to show that Vinblastine has very little direct anti-tumour activity and that it was
the removal of the dividing CD4+ Tr cells at days 13 or 15 post tumour
inoculation which resulted in CD8+ mediated tumour clearance (North and
Awwad, 1990).
Much of the work presented in this chapter has been based on the approach
taken by North and Awaad to demonstrate the effect of removing Tr cells on
disease. The use of a single timed injection of Vinblastine was a treatment
regime that could be easily applied to MAIDS infection. Additionally Vinblastine
is an anti-mitotic agent, meaning that it only targets dividing cells in contrast to
cyclophosphamide, which is cytostatic so all cells would be affected by
Chapter 4
130
treatment. Thus the use of Vinblastine could potentially allow for the
identification of a single time point at which the expansion of the Tr cells was
occurring that could be correlated with the cytokine and cell surface marker data
that had already been obtained. The work presented in this chapter has been
published in the Journal of Immunology (Beilharz, Sammels, Paun et al., 2004).
4.2 Results
4.2.1 Therapeutic effect of a single dose of Vinblastine administered at different times post infection
In order to further examine the hypothesis that a population of Tr cells arises
and expands in response to LP-BM5 infection an experiment was designed to
test the effect of removing these cells during infection. As it was proposed that
these cells are an expanding population they should be targetable using an
anti-mitotic agent. Loss of such a dominant regulatory population would remove
the down regulation of the virus-induced immune effector cells, resulting in a
delay in disease development. As Vb is an antimitotic agent that targets
actively proliferating cells, a single dose of Vb given at a particular day pi would
pinpoint whether such a population exists, as its elimination will result in
measurably slower disease progression.
For these experiments groups of mice were infected with LP-BM5 and
subsequently treated with a single dose (6mg/kg i.p.) of Vb (as described in
Section 2.2.4 and 2.2.4.1). This single dose of Vb was given at various times
from 6hrs to 28 days post LP-BM5 infection. Spleen weight at 10 weeks pi is
considered a reliable indicator of MAIDS progression (Morse, et al., 1992) and
Figure 4.1 shows the combined results of four independent experiments
presented as spleen weights.
The administration of Vb at 6hrs post infection was found to be highly effective
in preventing disease development. This result was not surprising as BM5d
requires the presence of actively dividing cells to replicate, the same cells are
Chapter 4
131
also the target of the anti-mitotic Vb. This would result in the removal of these
cells before or while the virus is replicating and subsequently preventing the
virus from establishing infection.
Treatment with Vb was also remarkably therapeutic when administered at 14
days pi, with mice in this group showing no significant increase in spleen weight
at 10 weeks pi when compared to uninfected controls. Statistical analysis
showed that the reduction in spleen weight in mice treated at 14 days pi was
highly significant when compared to untreated LP-BM5 infected controls. In
contrast, the same single Vb administration at all other time points pi results in
either some (6, 9, 11 and 16 days pi) or no protection (all other time points
examined) from MAIDS development at 10 weeks pi as measured by spleen
weight. These experiments provide evidence that there is a cycling population
of cells at this time point which is involved in MAIDS development and that the
removal of these cells results in the prevention of splenomegaly. It was decided
to further investigate this phenomenon using only the day 14 pi time point.
Chapter 4
132
M U 6hr 1 2 3 4 5 6 7 8 9 10 11 12 14 16 21 280.0
0.2
0.4
0.6
0.8
1.0
***
day of Vb treatement pi
sple
en w
eigh
t (g)
FIGURE 4.1 Protection from MAIDS at 10 weeks pi following day 14 pi Vb therapy. Mice were infected with LP-BM5 and treated with a single dose of Vb (6mg/kg ip) at various days post infection. Data are from four independent experiments. The time points examined are as follows: uninfected control (uc, , n=13), virus-infected control (vc, , n=38), and treatment (, n value) at: 1 day (8), 2 days (17), 3 days (21), 4 days (4), 5 days (8), 6 days (10), 7 days (23), 8 days (9), 9 days (3), 10 days (4), 11 days (4), 12 days (5), 14 days (27), 16 days (5), 21 days (5) and 28 days (5). Mice were assessed for MAIDS development by spleen weight at 10 weeks pi. For each experimental group the figure describes the mean ± SEM. Statistical analysis using Dunnett’s t test for multiple comparisons showed a highly significant reduction in the mean spleen weight of the day 14 pi treatment group at the 99% confidence level when compared to the MAIDS controls. *** p<0.05
Chapter 4
133
4.2.2 Characterising the day 14 Vb effect
Mice treated at day 14 pi with Vb were further examined for other characteristic
indicators of disease progression such as changes in the splenic architecture,
changes in the proportions of lymphocyte subsets and the development of
hypergammaglobulinaemia. Histological examination showed the splenic
architecture of all MAIDS infected mice to be profoundly disorganised as has
been previously reported (Figure 4.2B) (Hartley, et al., 1989). In contrast, the
splenic architecture of the day 14 pi Vb treated mice (Figure 4.2C) was
indistinguishable from that of uninfected control mice at 10 weeks pi (Figure
4.2A).
To further support the histological data and the normal spleen weights seen in
these day 14 pi Vb-treated MAIDS mice, FACS analysis of splenocytes was
also conducted. The LP-BM5 infected mice showed a significant reduction in
the percentage CD8+ T cells and a significant increase in the percentage of B
cells (Figure 4.3A), which is consistent with previous studies of immune cell
changes in the spleen during MAIDS (Klinman and Morse, 1989; Holmes, et al.,
1990; Morse, Chattopadhyay, Makino, Fredrickson, Hugin and Hartley, 1992).
In contrast, the cell subset percentages in Vb-treated mice showed no
difference compared to control mice (Figure 4.3B). Furthermore normal mice
treated with Vinblastine and examined 10 weeks later showed no change in the
spleen weight or in the subset composition of splenocytes compared to
untreated normal mice.
In addition, the LP-BM5 infected day 14 pi Vb treated mice had normal serum
IgG2a levels, not the elevated levels that are normally observed in LP-BM5
infected mice at 10 weeks pi (Figure 4.3B). All of these assays indicate that the
day 14 pi Vb treated mice were protected from MAIDS development. The 4
parameters of MAIDS progression examined (spleen weight, spleen histology,
splenocyte percentages and serum IgG2a) were all negative.
Chapter 4
134
Figure 4.2 The effect of day 14 pi Vb treatment on the development of MAIDS as determined by histopathological examination. Spleens were removed from age-matched uninfected control mice (A), LP-BM5-infected mice (B) and LP-BM5-infected, Vb-treated mice (C) at 10 weeks pi and examined by light microscopy (A,-C: x25). Areas of white pulp (WP) and red pulp (R) are indicated.
A
WP
R
B
WP
R
C
WP
R
Chapter 4
135
0
10
20
30
40
50
60
70
uninfected MAIDS MAIDS +Vb
A%
of c
ells
in s
plee
n
uninfected MAIDS MAIDS + Vb0.0
0.1
0.2
0.3B
OD
(415
nm)
Figure 4.3 Comparison of lymphocytes and serum IgG2a levels in control and treatment groups at 10 weeks post infection. A. FACS analysis of the major lymphocyte subsets in control and treatment groups. Data shows the percentages of CD4 ( ), CD8 ( ) and B ( ) cells from total spleens of uninfected, MAIDS infected and MAIDS infected day 14 pi Vb treated mice. Data is shown as mean± SEM for n=5 mice per group. B. Serum IgG2a levels in normal (n=2), MAIDS infected (n=4) and MAIDS infected day 14 pi Vb treated (n=5) mice. Data is shown as mean± SEM.
Chapter 4
136
4.2.3 Long-term protection from MAIDS development following day 14 pi Vb therapy
As a further test of lack of MAIDS progression day 14 pi Vb treated mice were
maintained for 20 weeks pi. MAIDS is fatal in 100% of mice at 24 weeks pi
(Morse, Chattopadhyay, Makino, Fredrickson, Hugin and Hartley, 1992),
therefore survival to 20 weeks is perhaps the most reliable marker of non-
progression in LP-BM5 infected mice. Mice were treated with Vb at day 14 pi
and spleen weights determined at 10 and 20 weeks pi. The results of this
experiment (Figure 4.4) showed that mice had not developed splenomegaly at
both 10 and 20 weeks pi with no significant difference between uninfected
control spleen weights and spleen weights of infected day 14 pi Vb treated
mice. The disease progression in control mice seen in the increase in spleen
weight from an average of 0.46g to 0.8g is expected while the slight increase in
the average spleen weight of Vb-treated mice (0.2g to 0.26g) is minor and not
statistically significant.
4.2.4 No protection from viral rechallenge following day 14 pi Vb therapy
This long-term protection raised the question of whether or not the protected
mice could withstand a second infection with LP-BM5. Groups of mice infected
with LP-BM5 were treated with Vb at day 14 pi and were then rechallenged with
a second inoculation of LP-BM5 at 3 or 8 weeks post Vb treatment. These
times were chosen as being sufficient for protective immunological memory to
develop following treatment. If protective immune memory to LP-BM5 had
developed the rechallenged mice would be able to respond effectively to the
viral infection, and splenomegaly would not develop. However, the mice were
not protected from viral rechallenge (as shown in Figure 4.5) with spleens
significantly enlarged compared to uninfected controls. In fact, there was no
significant difference between the 20 week pi MAIDS controls and either of the
rechallenged groups, indicating that there is no development of a protective
immunological memory following day 14 pi Vb treatment.
Chapter 4
137
0.00
0.25
0.50
0.75
1.00
uninfected MAIDS day 14 Vb MAIDS day 14 Vb control control control
10 weeks 20 weeks
sple
en w
eigh
t (g)
Figure 4.4 Long term effect of day 14 pi Vb treatment on LP-BM5 infection Mice were infected with LP-BM5 and treated on day 14 pi () with a single dose of Vb following the standard treatment protocol. MAIDS controls () and uninfected controls () were also included in the experiment. Mice were euthanased at 10 or 20 weeks pi and assessed for MAIDS development by spleen weight. The 20 weeks pi MAIDS control mice were euthanased at a humane endpoint, when the enlargement of the spleen and lymph nodes began to cause visible signs of distress in the mice. For each experimental group, the figure describes the mean ± SEM, where each group contains a minimum of five individual mice. Statistical analysis shows that there is no significant difference in the mean spleen weight between the uninfected control group and mice receiving day 14 pi Vb treatment when examined at 10 weeks pi (p=0.155) or at 20 weeks pi (p=0.458).
Chapter 4
138
FIGURE 4.5 Rechallenge with LP-BM5 virus following protective Vb therapy.
Mice were infected with LP-BM5 and treated at day 14 pi with the standard Vb treatment protocol (). One group of mice was rechallenged with an injection of LP-BM5 at 3 weeks post treatment, the other at 8 weeks post treatment. Controls were not re-infected with LP-BM5 (), uninfected controls received no treatment at all (). Mice were allowed to progress to 20 weeks pi and euthanased to assess for MAIDS development by spleen weight. The 20 weeks pi MAIDS control mice were euthanased at a humane endpoint, when the enlargement of the spleen and lymph nodes began to cause visible signs of distress in the mice. For each experimental group, the figure describes the mean ± SEM, where each group contains a minimum of five individual mice. The analysis shows no significant difference in the mean spleen weights of the uninfected control group and the day 14 pi Vb treated group at 20 weeks pi (p=0.458). There was also no significant difference between the mean spleen weight of MAIDS control group at 20 weeks pi and that of the mice rechallenged with LP-BM5 at either 3 weeks post Vb (p=0.759) or 8 weeks post Vb (p=0.300).
0.00
0.25
0.50
0.75
1.00
uninfected MAIDS d14 Vb 3w post Vb 8w post Vbcontrol control rechallenge rechallenge
20 weeks
sple
en w
eigh
t (g)
Chapter 4
139
4.2.5 Vinblastine treatment targets cycling CD4+ T cells at day 14 post infection
During the course of these investigations data was published for other models,
specifically the Friend virus model, showing that the Tr cells involved in
immunosuppression are CD4+ T cells (Iwashiro, et al., 2001; McGuirk and Mills,
2002). In order to delineate the subset of immune cells mediating the day 14 pi
Vb treatment effect on LP-BM5 infected mice, adoptive transfer experiments
were designed as follows. Recipient mice were infected with LP-BM5 and
treated with a single dose of Vb at day 14pi. The following day (day 15 pi) the
mice were divided into three treatment groups and received an i.v. adoptive
transfer of splenocytes from one of three different groups of donor mice. One
group received splenocytes from LP-BM5 infected donors at day 15 pi that had
received no further treatment. The second group received splenocytes from
LP-BM5 infected donors at day 15 pi that had received a single dose of Vb at
day 14 pi and the third group received cells from LP-BM5 infected donors at day
15 pi that had been depleted of CD4+ cells by flow cytometric sorting prior to
transfer. The groups of recipient mice were then allowed to progress to 10
weeks pi at which time MAIDS development was assessed by spleen weight.
The results (Figure 4.6) show that Vb-treated mice, when infused with LP-BM5-
infected but otherwise untreated day 15 pi splenocytes, went on to develop
MAIDS pathology (advanced splenomegaly) indicating that the protective effect
of day 14 pi Vb therapy had been negated by the adoptive transfer. Those mice
receiving splenocytes from infected donors that had also received Vb treatment
on day 14 pi did not develop splenomegaly at 10 weeks pi. The group of
recipients that received a CD4+ depleted splenocyte transfer from LP-BM5
infected untreated donors also displayed no splenomegaly. This result shows
that day 14 pi Vb treatment is targeting a cycling CD4+ T cell population that is
vital for the progression of MAIDS.
Chapter 4
140
FIGURE 4.6 Adoptive transfer of splenocytes from LP-BM5 infected donors to day 14 pi Vb treated recipients. Briefly, donor and recipient mice were infected with LP-BM5 and on day 14 pi all recipients and one group of donor mice were treated with Vb following our standard protocol. Donor mice were euthanased day 15 pi and splenocytes prepared for transfer to the Vb-treated recipients. One group received splenocytes from untreated LP-BM5 infected donors ( ), a second group received splenocytes from LP-BM5 infected, day 14 pi Vb treated donors ( ) and the third received splenocytes depleted of CD4+ cells from untreated LP-BM5 infected donors ( ). Mice were assessed for MAIDS development by spleen weight at 10 weeks pi. The figure describes the mean ± SEM, where each group contains a minimum of six individual mice. Analysis shows that there is no significant difference in mean spleen weight of the MAIDS control group and the mice receiving untreated donor cells (p=0.161). The mice receiving Vb-treated or CD4+-depleted donor cells were found to be significantly different to the MAIDS controls (p=0.00011 and p=0.00006) but not significantly different to uninfected controls (p=0.916 and p=0.674).
0.0
0.2
0.4
0.6
0.8
1.0
uninfected MAIDS MAIDS infected, day 14 Vb-treated control control recipient mice
sple
en w
eigh
t (g)
Chapter 4
141
4.2.6 In vivo depletion of CD4+ T cells at day 14 pi results in protection from MAIDS development
The targeting of a population of CD4+ T cells by Vb treatment at day 14 pi
implicates CD4+ T cells as being involved in an event that is critical for
subsequent MAIDS development precisely at day 14 pi. Whilst CD4+ T cells
have previously been shown to be critical for MAIDS progression (Yetter, et al.,
1988) the finding that a specific involvement of CD4+ T cells at or on day 14 pi is
essential for disease progression can be seen as further evidence of a CD4+ Tr
population. In order to confirm the adoptive transfer results, it was proposed
that a single timed injection of anti-CD4 mAb should have the same effect in
delaying disease progression as Vb treatment. MAIDS-infected mice were
treated with a single injection of anti-CD4 mAb on day 14 pi and assessed for
splenomegaly at 10 weeks pi. Control mice were treated with an anti-CD8 mAb.
Figure 4.7 shows that in vivo depletion of CD4+ cells on day 14 pi resulted in a
significant reduction in spleen weight compared to untreated LP-BM5 infected
control mice. In contrast, in vivo depletion of CD8+ cells at day 14 pi had no
significant effect on disease progression.
In an independent experiment, the day 14 pi anti-CD4+ mAb treatment was
directly compared to the same treatment given on day 21 pi. The results of this
experiment are presented in Figure 4.8A and show that the anti-CD4 mAb
treatment will prevent splenomegaly at 10 weeks pi when administered on day
14 pi, but has no effect of disease progression when administered on day 21 pi.
A second experiment examining the effect of treating with anti-CD4 mAb at an
earlier time point, day 7 pi (Figure 4.8B), shows that this was also ineffective in
preventing disease progression, confirming the time dependence of the anti-
CD4 mAb treatment. Treatment with anti-CD4 mAb is mimicking the protective
effect of Vb when given on day 14 pi.
Chapter 4
142
FIGURE 4.7 In vivo depletion of CD4+ cells at day 14 pi significantly slows the progression of MAIDS. Mice were infected with LP-BM5 and on day 14 pi were treated with 0.5mg of either anti-CD4 () or anti-CD8 () mAb i.p. Mice were then allowed to progress to 10 weeks pi before MAIDS development was assessed by spleen weight. For each experimental group, the figure describes the mean ± SEM, where each group contains a minimum of twelve individual mice. Statistical analysis shows that there is no significant difference in the mean spleen weight of the anti-CD8 treatment group when compared with the MAIDS control () (p=0.644). The anti-CD4-treatment group showed a significant difference in mean spleen weight compared to the MAIDS control group (p=0.0007) and the uninfected control group () (p=0.0362).
0.0
0.2
0.4
0.6
0.8
1.0
uninfected MAIDS anti-CD4 anti-CD8 control control mAb mAb
sple
en w
eigh
t (g)
Chapter 4
143
0.0
0.2
0.4
0.6
0.8
1.0
MAIDS day 14 day 21
Asp
leen
wei
ght (
g)
MAIDS day 7 anti-CD4 day 7 anti-CD80.0
0.2
0.4
0.6
0.8
1.0B
sple
en w
eigh
t (g)
FIGURE 4.8 The protective effect of in vivo CD4 depletion is time-dependent. A. Mice were infected with LP-BM5 and treated with 0.5mg of either anti-CD4 ( ) or anti-CD8 ( ) mAb by i.p. injection on day 14 or 21 pi, controls remained untreated ( ). MAIDS development was assessed at 10 weeks pi by spleen weight. For each experimental group, the figure shows the mean ± SEM, n=5 for day 21 groups, n=16 for day 14 anti-CD4 and n=12 for day 14 anti-CD8 mAb. Statistical analysis shows a significant difference in mean spleen weight in the day 14 pi CD4 depleted mice compared to the untreated control (p=0.0245). All other treatment groups were not found to be significantly different to that of the untreated control group. B. Mice were infected with LP-BM5 and treated with 0.5mg of either anti-CD4 ( ) or anti-CD8 ( ) mAb by i.p. injection on day 7 pi, controls remained untreated ( ). MAIDS development was assessed at 10 weeks pi by spleen weight. For each experimental group, the figure shows the mean ± SEM, n=5.
Chapter 4
144
4.3 Discussion
Having previously demonstrated that there is a Tr cell population induced in
response to LP-BM5 infection the work presented in this chapter was designed
to investigate whether these cells were playing a role in disease progression. It
was proposed that targeting Tr cells should result in significant and measurable
changes in disease progression if this was the case. The approach that was
taken in investigating this hypothesis was based on work conducted in a murine
T cell leukemia model which investigated a similar hypothesis (North and
Awwad, 1990). In order to determine the best time for treating the mice during
the early stages of primary infection a time course of Vinblastine treatment was
conducted. Mice were infected with LP-BM5 and treated with a single dose of
Vinblastine (6mg/kg i.p.) at a range of different time points from 6 hours to 28
days pi. This study found that treatment at 6hrs or 14 days pi were both highly
effective in preventing disease progression (Figure 4.1). The efficacy of 6hrs pi
was not a surprising result, as treatment at this time would remove any dividing
cells, therefore removing the target cells of the infecting virus and preventing
the establishment of infection. A similar result has previously been reported by
the Beilharz laboratory in a study administering interferon α/β 2hours after LP-
BM5 infection (Heng, et al., 1996). These results, in combination with the
present studies, suggest that any treatment that can effectively prevent viral
replication, either through anti-viral effects or removal of the viral target cells, in
the early stages of infection can prevent MAIDS development.
In contrast, the efficacy of a single dose of Vinblastine at preventing the
development of MAIDS, when administered at 14 days post LP-BM5 infection is
remarkable as the retroviral infection is well established and early disease
processes are underway by this time in the infection (Morse, et al., 1992).
Further investigation showed that treatment at day 14 pi resulted in apparently
disease free mice at 10 weeks pi as measured by several criteria (normal
spleen weight and histology, lack of elevated serum IgG2a and normal splenic
WBC percentages). In fact, splenomegaly had still not developed in these mice
at 20 weeks post infection, at which point the majority of virus control mice had
succumbed to disease (Figure 4.4). The apparent disease free status of treated
Chapter 4
145
mice at 10 and 20 weeks pi suggests the immune system has effectively dealt
with or severely slowed the retroviral infection. When treatment is given at
times other than day 14 pi there is measurable but non-significant effect on the
rate of MAIDS progression. These results suggest that a cell population crucial
in the pathogenesis of MAIDS is being targeted at 14 days pi. Alternative
hypotheses to explain the empirical data such as direct effects on the cells in
which the virus replicates are difficult to sustain, as significant prevention of
MAIDS development is only observed after treatment is administered on day 14
pi. Furthermore, if the Vb treatment was merely removing a sufficient number of
cells to halt disease progression then treatment at other time points tested,
particularly early ones, should have been effective. Instead treatment given on
any of days 1-5 pi had no significant effect on disease (Figure 4.1).
As the vast majority of Tr cells defined to date are CD4+ T cells, in particular
those implicated in the Friends leukemia virus model (Iwashiro, et al., 2001),
and considerable evidence indicates that this is also the case in MAIDS
(presented in Chapter 3), it was important to confirm that the cells that were
being targeted by day 14 pi Vinblastine treatment were indeed CD4+ T cells.
The adoptive transfer studies show that following day 14 Vb treatment mice
receiving a transfusion of unfractioned MAIDS-infected day 14 pi Vb-treated
cells did not go on to develop disease, unlike those mice that received
unfractioned MAIDS-infected cells. Similarly, mice receiving MAIDS-infected
splenocytes depleted of CD4+ cells did not go on to develop disease, confirming
that Vinblastine is targeting CD4+ T cells at day 14 pi and verifying the critical
role of a population of CD4+ T cells at this point in infection.
An interesting point that arises from this study is whether the cells that are being
transferred into the host mice following day 14 pi Vb treatment are “re-infecting”
the hosts. It has previously been reported that it is possible to transfer MAIDS
to uninfected recipients using as few as 1-2x106 CD4+ T cells (Donaldson, et al.,
1994) and another study reported that transfer of 1x106 enriched T or B cells
was sufficient to transfer disease (Numata, et al., 1997), indicating that the
number of cells transferred in this study (at least 8x106) should be sufficient to
Chapter 4
146
transfer disease. The main cellular target of BM5d has been shown to be
mature B cells (Kim, et al., 1994; Morse, et al., 1995), which were still
transferred into all of the recipient mice in this experiment. That disease did not
progress in the group receiving Vb-treated cells demonstrates that it is the
removal of CD4+ T cells by Vb prior to transfer which is responsible for the
observed results. That the same results are also observed following the
removal of CD4+ T cells by cell sorting, where no other cells are affected,
confirms the results observed for the Vb-treated donor cells. These results are
further strengthened by the efficacy of day 14 pi anti-CD4 mAb treatment in
controlling MAIDS progression. Protection from disease progression was not
observed after day 7 or day 21 pi treatment with anti-CD4 mAb treatment or
following treatment at any time with anti-CD8 mAb. In addition to this, results
are presented in Chapter 6 of this thesis demonstrating that day 14 Vb
treatment has little effect on viral spread in vivo, providing further evidence that
“re-infection” is not occurring following the adoptive transfer of lymphocytes.
The efficacy of the day 14 pi Vb and anti-CD4 mAb treatment is also interesting
in light of the results obtained in Chapter 3 where it was proposed that the loss
of CD25 co-expression prior to cytokine production indicated the
induction/activation of the Tr cells that have been induced by BM5d. The data in
Chapter 3, in conjunction with the data presented in this chapter, help to shed
light on a possible chain of events involved in the induction and activation of Tr
cells by BM5d. At day 12 pi the Tr cells or the immediate precursors thereof are
present but have not yet been activated and begun dividing to increase their
numbers, hence the Vb treatment at this time point has no effect on disease
progression. This suggests that the activation of Tr cells may be occurring on
day 13 pi, with the loss of CD25 expression on peripheral blood CD4+CD25+ Tr
cells. The cytokines that are already present may be acting as a signal for the
activation of the virus-specific Tr cells. These cytokines may be secreted by
dendritic cells as discussed in Chapter 3 (McGuirk and Mills, 2002) or by other
cells affected by the virus. When given on day 14 pi treatment with Vinblastine
and anti-CD4 mAb have the most dramatic effect on disease progression. In
order to be affected by Vb the Tr cells must be dividing. The data suggest that
Chapter 4
147
treatment would be targeting cells after the activation signal has been received,
therefore the removal of Tr cells at this point in the infection would result in the
loss of the suppression that they would be exerting. This indicates that the day
14 treatments are targeting the Tr cells at a point in the infection that is crucial
for disease progression.
The role of Tr cells in MAIDS progression is further substantiated by the results
of the viral rechallenge of day 14 pi Vb treated mice. The removal of Tr cells at
the critical day 14 pi time point resulted in protection from further disease
development but did not result in the generation of protective immunity against
a subsequent re-infection at later time points (Figure 4.5). This has striking
similarities with the results that have been published on Leishmania major
(Belkaid, et al., 2002). Chronic infection of mice with L. major was found to
result in the induction of a population of CD4+CD25+ Tr cells at the site of the
lesion in the skin. Manipulation of the IL-10 mediated suppression exerted by
these induced Tr cells resulted in a sterile cure but also the loss of protection
against secondary infection (concomitant immunity). If the results observed for
MAIDS infection are interpreted in the same context as those for L. major, it is
possible that removal of the Tr cells by treatments would result in a re-infection
being seen as a primary infection by the immune system due to the lack of
memory development. The parallels between the two models help strengthen
the case for Tr cells playing a crucial role in the development of MAIDS.
The results presented in this chapter present further evidence for the induction
of Tr cells by BM5d and the critical role these cells play in disease development.
In addition to the data presented in Chapter 3, this chapter confirms that the Tr
cells involved in MAIDS are CD4+ T cells. The removal of these cells has
substantial and measurable effects on disease development. These findings
have also raised two very important questions. It has been established that the
Tr cells are CD4+ T cells, which naturally leads to the question of whether these
cells belong to any of the currently defined Tr cell subsets. Chapter 5 goes on
to further characterise these cells, both phenotypically and functionally, to try
and address this question. The second question that is raised as a direct result
Chapter 4
148
of the work presented in this chapter (Chapter 4) is whether the day 14 pi
treatments are working through limiting the viral spread or by interrupting an
event that is crucial for the development of the disease pathology. This
question has led to the development of highly sensitive real time PCR and real
time RT PCR assays and the results will be discussed in Chapter 6 of this
thesis.
Chapter 5:
Further characterisation of Tr cell phenotype, development and
function
Chapter 5
149
5.1 Introduction
In the previous two chapters evidence has been presented for the induction of
virus-specific CD4+ Tr cells following MAIDS infection. In Chapter 3 this was
demonstrated through the induction of the Tr associated cytokines IL-10 and
TGF-β both systemically and in CD4+ T cells, in conjunction with modulation of
the Tr associated cell surface markers CD25 and CD69 on CD4+ T cells. In
Chapter 4 evidence was presented that Tr cells are critical for disease
development. Indeed, removing Tr cells at day 14 pi had a dramatic effect on
disease development, with treated mice being indistinguishable from uninfected
controls as measured by several key characteristics of MAIDS development. It
was demonstrated that a population of CD4+ Tr cells is responsible for this effect
by both monoclonal antibody depletions and adoptive transfer experiments.
The aim of the research presented in this chapter is the further characterisation
of the Tr cells induced by LP-BM5 infection to determine their relationship to
other currently defined CD4+ Tr cells by a number of Tr cell characteristics.
The field of Tr research is currently expanding and the investigation of these
cells in the context of autoimmune disease, cancer, transplantation tolerance
and infectious disease has led to the discovery of multiple subtypes of Tr cells.
Currently these Tr cell subtypes are defined by the use of several different
surface molecules in different models. This has led to some variation in the
“definition” of the characteristic cell surface phenotype of Tr cells. In addition,
many of the cell surface markers that have been investigated, including CD25,
CD38, CD45RBhigh and CD69, are also markers of activation or memory on
other cells of the immune system (Hori and Sakaguchi, 2004; Mills and
McGuirk, 2004). Some efforts have recently been made to try and link the Tr
cell surface markers across different models to determine whether these cells
are the same in all cases or fall into distinct subtypes (Singh, et al., 2001).
The initial use of CD25 to differentiate Tr cells has now been expanded to a
combination of cell surface marker expression and cytokine secretion as a
means of identifying regulator cells in the various models (McGuirk and Mills,
2002). The lack of a single definitive marker for Tr cells has also been the
Chapter 5
150
impetus behind a large body of research that is striving to find a means of easily
identifying these cells. This has led to the identification of several molecules
that are constitutively expressed on naturally occurring Tr cells in naïve mice.
The co-stimulatory molecules GITR (Shimizu, et al., 2002) and CTLA-4
(Takahashi, et al., 2000; Iwashiro, et al., 2001; McHugh, et al., 2001; Kingsley,
et al., 2002) have been shown to be constitutively expressed on Tr cells and are
also involved in cell contact dependent suppression of effector cells. Results
presented in this chapter indicate that these co-stimulatory molecules are also
important in the development of MAIDS, presumably through their expression
on virus-induced Tr cells.
Recent research has also focussed on trying to identify the origins of Tr cells
and the mechanisms through which they develop. In the later stages of this
PhD, the transcription factor Foxp3 was identified as a master control switch for
the Tr lineage in the thymus (Hori, et al., 2003). Foxp3 was shown to be
specifically expressed by naturally occurring CD4+CD25+ Tr cells (Hori, et al.,
2003) and expression of this molecule in non-regulatory cells transferred
suppressive functions (Fontenot, et al., 2003; Hori, et al., 2003; Khattri, et al.,
2003). This research has now led to the theory that there are two major types
of Tr cells; naturally occurring Tr cells which develop in the thymus and antigen-
specific Tr cells which are induced following exposure to antigen in the
periphery. The role of Foxp3 in the development of antigen-specific Tr cells is
still undetermined. The results presented in this chapter demonstrate that, in
the case of LP-BM5 infection, Foxp3 is involved in the development of Tr cells in
the periphery following exposure to antigen.
Beyond the use of cell surface markers and cytokine profiles, the most effective
means of determining the presence of Tr cells has been the demonstration of
functional suppression. The ability of Tr cells to suppress effector cells has
been shown in vitro through the use of a chromium release assay (Iwashiro, et
al., 2001) and in vivo through the transfer of putative Tr cells back into animals
(Singh, et al., 2001; Suri-Payer and Cantor, 2001). Both of these approaches
are used to confirm the presence of a functionally suppressive Tr cell population
that is induced following LP-BM5 infection. The results presented in this
Chapter 5
151
chapter also go some way towards characterising the phenotype of these cells
and elucidating both their origin and the role that they play in disease
progression.
5.2 Results
5.2.1 In vivo cytotoxic lymphocyte (CTL) assay
The in vivo CTL assay allows for the detection of a peptide specific CTL
response generated by infection with LP-BM5 in a true physiological setting.
This assay has been used to measure tumour-specific CTL activity (Nelson, et
al., 2001). The assay is used to measure the specific killing of peptide-loaded
target cells compared to control cells by staining the two populations with
differential concentrations of the fluorescent dye CFSE, resulting in two distinct
peaks of fluorescence when the cells are analysed by flow cytometry. These
cells are i.v. injected in equal numbers into mice at different days post infection
and left in vivo for 24 hours. Flow cytometry is then used to analyse these two
populations, with CTL-specific killing being present if a depletion of
peptide-labelled cells, without a reduction in the control cell peak, is observed.
As LP-BM5 is a systemic infection the spleen was the organ examined for
specific CTL activity.
The peptide p12-10 (TENLPNLPPL) is an exogenous antigen encoded in the
p12 gag region of the BM5d genome, which is presented by MHC Class I (Yee,
et al., 1997b). This peptide was found to effectively stimulate unprimed CD8+ T
cells in vitro (Yee, et al., 1997a). The p12-10 peptide has also been used as a
vaccine against MAIDS, resulting in significantly delayed disease progression in
treated mice (Mizuochi, et al., 1998). These studies show that the peptide is
immunodominant and capable of inducing a CTL response, making it an
excellent choice for use in the in vivo CTL assay.
In order to definitively demonstrate the presence of virus-induced Tr cells in
MAIDS it was first necessary to demonstrate functional antigen-specific killing
by effector cells following infection with LP-BM5. Mice at day 0 (uninfected), 10
Chapter 5
152
and 20 post LP-BM5 infection were injected i.v. with the differentially labelled
peptide-pulsed and control cells from naive syngeneic donors and lysis
examined 24 hrs later (as described in Chapter 2.2.10). As MAIDS is a
systemic infection and the virus is given by i.p. injection the level of killing was
analysed in the spleens.
Uninfected mice did not exhibit peptide-specific lysis of target cells (Figure 5.1A)
with no significant reduction of the peptide-pulsed peak observed. A potent
p12-10 specific CTL response was seen in mice at day 10 pi (Figure 5.1B)
however this response had returned to the levels observed in uninfected mice
by day 20pi (Figure 5.1C). This loss of peptide-specific lysis, 60% of targets
being lysed at day 10 pi compared to less than 10% lysis at day 20 pi (means
shown in Figure 5.2) was highly suggestive of a Tr population arising and
suppressing the CTL response against LP-BM5.
In order to measure the suppressive ability of virus-induced Tr cells the assay
was modified so that recipient mice would receive both CFSE-labelled target
and control cells and Tr cells in a single injection. Mice would receive the 1x106
Tr cells, and both CD4+CD25+ and CD4+CD69+ Tr cells were tested for their
ability to suppress effector cells in the in vivo CTL assay. The putative Tr cells
were purified from the spleens of mice at day 18 pi using MACS bead cell
sorting. Day 18 post LP-BM5 infection was chosen for this study as the peak
time of IL-10 and TGF-β production in early infection had been found to occur at
day 16pi (Chapter 3) and Figures 5.1 and 5.2 show apparent suppression in
vivo by day 20pi. Mice at day 10 pi were used for the assay as the highest level
of specific lysis had been observed at this time point (Fig 5.1 and 5.2).
The injection of CD4+CD25+ cells together with target cells resulted in complete
suppression of the CTL response against the p12-10 peptide. In Figure 5.3A
this is seen as the retention of the CFSEhigh peptide-labelled peak, which
indicates that the specific killing previously observed at day 10 pi (Figure 5.1B
Chapter 5
100 101 102 103 104
CFSE
0
10
20
30
40
# ce
lls
100 101 102 103 104
CFSE
0
10
20
30
# C
ells
100 101 102 103 104
CFSE
0
10
20
30
40
# C
ells
A
B
C
Figure 5.1 Histogram plots of the in vivo CTL assay 1x107 peptide-pulsed CFSEhigh cells and 1x107 CFSElow control cells were infused i.v. into recipient mice at day 0 (A), day 10 pi (B) and day 20 pi (C). 24 hours later mice were euthanased, the spleens excised and prepared as a single cell suspension for FACS analysis. Figures show histograms of the CFSEhigh and CFSElow populations from the spleens of these mice. Reduction of the CFSEhigh peak without killing of the CFSElow control cells is indicative of peptide-specific cell killing. Data is representative of 3 mice per group.
153
Chapter 5
day 0 day 10 day 200
1020
304050
6070
8090
100
day post infection
% k
illin
g of
pep
tide
labe
lled
cells
Figure 5.2 Peptide-specific cell lysis at different days post LP-BM5 infection 1x107 CFSEhigh peptide-pulsed and 1x107 CFSElow control cells were infused i.v. into recipient mice at days 0, 10 and 20 pi. 24 hours later mice were euthanased, the spleens excised and prepared as a single cell suspension for FACS analysis. The data is shown as the percentage of peptide-labelled CFSEhigh cells that were specifically killed. Data is shown as the mean ±SEM for n=3 mice per time point.
154
Chapter 5
155
and 5.2) has been suppressed. In comparison, CD4+CD69+ Tr cells were only
able to suppress the specific killing of the peptide-labelled target cells by half
(Figure 5.3B, means shown in Figure 5.4) compared to day 10 pi (Figure 5.1
and 5.2). This data suggests that while this population of cells has some
suppressive activity, the co-expression of CD69 alone is not sufficient for the
identification of these virus-induced Tr cells following LP-BM5 infection.
The in vivo CTL data indicate that a CTL response specific for LP-BM5 arises
by day 10 pi, and is subsequently suppressed by day 20 pi. When putative Tr
cells are added into the assay at day 10 pi, the data shows that there is a
population of functionally suppressive, virus-specific CD4+CD25+ Tr cells
induced by LP-BM5 infection which arise subsequent to the CTL response.
These cells are able to suppress the CTL response to p12-10 BM5d at a time
when this response is effectively removing “virus-infected” cells.
The cytokine profile of these purified Tr cells was also measured by ELISpot for
IL-10 and TGF-β (Figure 5.5). Interestingly, a greater proportion of the purified
CD4+CD25+ Tr cells were found to secrete both IL-10 and TGF-β compared to
CD4+CD69+ Tr cells. FACS analysis of the purified Tr cell subsets following
MACS bead cell sorting found that approximately 20-25% of CD4+CD25+ T cells
co-express CD69. This suggests that Tr cells are being purified together with
non-regulatory cells when the expression of CD69 is used to try and
differentiate the two populations. These results also suggest that the
suppression exerted by the CD4+CD69+ cell population may be due to a number
of CD4+CD25+ cells that also express CD69.
Chapter 5
B
A
100 101 102 103 104
CFSE
0
5
10
15
# C
ells
100 101 102 103 104
CFSE
0
3
6
9
12
# C
ells
Figure 5.3 Histogram plots of the in vivo CTL assay with putative Tr cells 1x107 peptide-pulsed CFSEhigh cells and 1x107 CFSElow control cells together with 1x106 CD4+CD25+ (A) or CD4+CD69+ (B) cells from day 18 pi donors were infused i.v. into recipient mice at day 10 pi. 24 hours later mice were euthanased, the spleens excised and prepared as a single cell suspension for FACS analysis. Figures show histograms of the CFSEhigh and CFSElow populations from the spleens of these mice. Reduction of the CFSEhigh peak without killing of the CFSElow control cells is indicative of peptide-specific cell killing. Data is representative of 3 mice per group.
156
Chapter 5
day 0 day 10 CD4+CD25+ CD4+CD69+0
1020304050
6070
8090
100
% k
illin
g of
pep
tide
labe
lled
cells
day 10 pi+ day 18pi Treg cells
Figure 5.4 The effect of Tr cells on peptide-specific in vivo cell lysis at day 10 post LP-BM5 infection 1x107 peptide-pulsed CFSEhigh cells and 1x107 CFSElow control cells together with 1x106 CD4+CD25+ or CD4+CD69+ cells from day 18 pi donors were infused i.v. into recipient mice at day 10 pi. 24 hours later mice were euthanased, the spleens excised and prepared as a single cell suspension for FACS analysis. The data is shown as the percentage of peptide-labelled CFSEhigh cells that were specifically killed. Data is shown as the mean ±SEM for n=3 mice per time point.
157
Chapter 5
0
50
100
150
200
250
300
350IL-10TGF-b
CD4+CD25+ CD4+CD69+
spot
s/10
4 cel
ls
Figure 5.5 ELISpot of CD4+CD25+ and CD4+CD69+ Tr cells at day 18 post infection The level of IL-10 ( ) and TGF-β ( ) secretion by CD4+CD25+ and CD4+CD69+ Tr cells was measured by ELISpot without further restimulation. Tr cells were purified from the spleens of mice at day 18 post LP-BM5 infection by MACS bead cell sorting. Data is shown as the mean ±SEM of pooled cells from 5 mice per group run in duplicate.
.
158
Chapter 5
159
5.2.2 Foxp3
The transcription factor Foxp3 has recently been discovered as a crucial
regulator of the development and function of Tr cells and importance of Foxp3
has now been described in a number of different models (see Chapter 1.5.3.1)
(Fontenot, et al., 2003; Hori, et al., 2003; Khattri, et al., 2003; Hori and
Sakaguchi, 2004). However, the role of Foxp3 in the development antigen-
induced Tr cells has not yet been clearly elucidated. It was therefore of interest
to see if there was any measurable change in the levels of Foxp3 during the
early stages of MAIDS that could be related to the development of Tr cells.
The analysis of Foxp3 was conducted using a two-step real time RT PCR as
developed by Hori (Hori, et al., 2003). Total RNA was extracted from 2x106
sorted cells (Chapter 2.2.15.4.2), converted to cDNA (Chapter 2.2.16.4.1) and
the levels of Foxp3 and the housekeeping gene HPRT measured using real
time PCR (Chapter 2.2.16.4.2). The amount of Foxp3 mRNA was then
normalised against HPRT (Chapter 2.2.16.4.2). In the spleens of naïve mice
the majority of Foxp3 expression was found to be in the CD4+ T cell subset
(Figure 5.6), with a 100-fold lower expression being observed in CD8+ T cells.
There was no significant expression of Foxp3 expression in the B cell subset.
The expression of Foxp3 was then measured in CD4+CD25+ T cells and
CD4+CD69+ T cells in naive mice and at a number of different time points after
infection with LP-BM5. These subsets had previously been investigated in
Chapter 3 of this thesis as well as being identified as Tr cells in other models
(Iwashiro, et al., 2001; Singh, et al., 2001; Hori, et al., 2003). CD4+CD25+ T
cells were found to express 100-fold greater levels of Foxp3 mRNA compared
with their CD4+CD25- equivalents in naïve mice (Figure 5.7A) suggesting that
the majority of Foxp3 is expressed by CD4+ T cells which co-express CD25.
This result is consistent with those reported for the same subsets in the thymus
of naïve BALB/c mice (Hori, et al., 2003). By day 16 pi a small increase is seen
in the level of Foxp3 mRNA in CD25- cells, this corresponds with a decrease in
Foxp3 levels in CD25+ cells at this time point. By day 30 pi there is greater
expression of Foxp3 in CD4+CD25- cells than in the equivalent CD25+
population and this
Chapter 5
CD4 CD8 B
1.0×100
1.0×101
1.0×102
1.0×103
norm
alis
ed F
oxp3
RNA
Figure 5.6 Foxp3 expression in major lymphocyte subsets in the spleens of naive mice CD4, CD8 and B cells were purified from the spleens of naive mice by a combination of MACS bead cell sorting. Total RNA was extracted from 2x106 cells for each subset and the levels of the Tr specific transcription factor Foxp3 measured by two-step real time RT PCR. Data is shown as Foxp3 mRNA expression normalised against HPRT. Each point is representative of the pooled cells from n=5 mice.
160
Chapter 5
naive d16 d30 10 weeks1.0×100
1.0×101
1.0×102
1.0×103
1.0×104 CD4+CD25+
CD4+CD25-
Time post infection
norm
alis
ed F
oxp3
RNA
A
naive d8 d16 d301.0×100
1.0×101
1.0×102
1.0×103
1.0×104 CD4+CD69+
CD4+CD69-B
days post infection
norm
alis
ed F
oxp3
RN
A
Figure 5.7 Foxp3 levels in Tr cell subsets during LP-BM5 infection Mice were infected with LP-BM5 and CD4+CD25+/- (A) and CD4+CD69+/- (B) cells were purified from the spleens of infected mice at days 8, 16, 30 and 10 weeks pi by a combination of MACS bead and FACS cell sorting. Total RNA was extracted from 2x106 cells for each subset at each time point and the levels of the Tr specific transcription factor Foxp3 measured by two-step real time RT PCR. Data is shown as Foxp3 mRNA expression normalised against HPRT. Each point is representative of the pooled cells from n=5 mice.
161
Chapter 5
162
trend is maintained at 10 weeks post infection. These data suggests that there
is a loss of CD25 expression by the Foxp3+ Tr cells in the spleen taking place
between day 16 and 30 pi, a result that is consistent with the loss of CD25
expression in the peripheral blood presented in Chapter 3.
In contrast, the relative expression of Foxp3 mRNA in CD4+CD69+ T cells was
found to be only slightly higher than in CD4+CD69- T cells in the spleens of
naïve mice (Figure 5.7B). These levels remained unchanged at day 8 post
LP-BM5 infection. By day 16 pi the levels of Foxp3 mRNA were the same in
both CD69+ and CD69- cells and this remained unchanged at day 30 post
infection. These results show that expression of Foxp3 does not correlate with
the expression of CD69 on the cell surface, thereby limiting the usefulness of
this combination of Tr cell markers in MAIDS.
5.2.3 Adoptive transfer of CD4+CD25+ Tr cells
The addition of Tr cells in a number of experimental models has resulted in the
reversal of autoimmune disease (Powrie, et al., 1994a, 1994b). The results
presented in Chapter 4 of this thesis have shown that the removal of Tr cells
results in the abrogation of MAIDS progression and that the re-addition of these
cells results in renewed disease progression. An experiment was designed to
investigate the effect of adding additional Tr cells on MAIDS progression, the
predicted result being that the additional Tr cells would result in exacerbated
disease.
Mice were infected with LP-BM5 and allowed to progress to day 15 pi. At this
point mice received a transfusion of 1x106 CD4+CD25+ or CD4+CD25- cells by
i.v. injection. These cells were purified by MACS bead sorting from the spleens
of three different groups of donor mice; uninfected, day 15 pi MAIDS infected
and day 15 pi MAIDS infected mice that had received a single dose of Vb on
day 14 pi. Control mice were infected with LP-BM5 and received no cell
transfusion. The mice were then allowed to progress to 10 weeks pi at which
point disease development was assessed by spleen weight and the results are
shown in Figure 5.8. Mice receiving CD4+CD25+ cells from uninfected donors
Chapter 5
0.0
0.2
0.4
0.6
0.8
1.0
1.2 CD4+CD25+
CD4+CD25-
uninfected donors
MAIDSdonors
MAIDS + d14pi Vb donors
MAIDScontrol
*
sple
en w
eigh
t (g)
Figure 5.8 Adoptive transfer of CD4+CD25+/CD25- into MAIDS infected mice at day 15 post LP-BM5 infection Mice were infected with 100µl LP-BM5 i.p. and at day 15 pi received an adoptive transfer of 1x106 CD4+CD25+ ( ) or CD4+CD25- ( ) cells. The cells were purified by MACS bead sorting from three groups of donors: uninfected mice, mice at day 15 post LP-BM5 infection, and mice that were infected with LP-BM5 and treated with a single dose of Vb at day 14 pi. Disease development was assessed by spleen weight at 10 weeks pi in comparison to control mice ( ) which received no further treatment. Data is shown as the mean ±SEM for n=3-6 mice per group.
163
Chapter 5
164
developed highly exacerbated splenomegaly (0.976±0.14g), indicating faster
disease progression than the MAIDS controls (0.466±0.05g). In contrast, the
mice receiving uninfected CD4+CD25- cells (0.522±0.05g) developed disease at
a similar rate to the virus-only controls, indicating that the Tr population is
present in the CD25+ fraction of CD4+ T cells in naïve mice. Mice receiving
CD4+CD25+ cells from the MAIDS infected donors developed moderately
exacerbated disease in comparison to controls (0.665±0.09g). Interestingly,
mice receiving CD4+CD25- T cells from mice with day 15 pi MAIDS also
developed highly exacerbated disease (0.878±0.286g) in comparison to both
the CD4+CD25+ recipients and the virus only control group. Two of these mice
had spleen weights of over 1g (a 10 to 12-fold increase over uninfected mice).
These data are consistent with the interpretation that the Tr cells lose CD25
expression whilst still maintaining potent regulatory functions. This is supported
by the observed increase in Foxp3 expression in the CD25- cells with a
corresponding decrease in CD25+ Foxp3 expression.
Furthermore, treatment with Vinblastine was able to completely remove all Tr
cell activity, with mice receiving CD4+CD25+ or CD4+CD25- cells from day 15 pi
MAIDS mice that received day 14 Vb treatment developing disease at the same
rate as the virus only controls (0.416±0.05g and 0.424±0.06g respectively).
These results indicate that treatment with a single dose of Vb is able to remove
the expanding Tr cell population at day 14 post infection resulting in no
exacerbation of disease progression.
5.2.4 Anti-CD25 mAb treatment
Having identified that CD25 is a marker for the Tr cells that are induced by
infection with LP-BM5, experiments were designed to test the effect of CD25
depletion on MAIDS development. Cells expressing CD25 were targeted with
single timed injections of anti-CD25 mAb. Treatment with anti-CD25 mAb has
been used to successfully treat mice in a number of different tumour models
(Onizuka, et al., 1999; Shimizu, et al., 1999; Jones, et al., 2002) or significantly
slow tumour growth (Sutmuller, et al., 2001). Treatment with anti-CD25 mAb in
these studies was given pre-tumour inoculation as it is thought to reduce the
Chapter 5
MAIDS d-4 anti-CD250.0
0.1
0.2
0.3
0.4
0.5
sple
en w
eigh
t (g)
Figure 5.9 Pre-depletion of CD25 does not affect disease progression Mice were treated with a single injection of 0.5mg of anti-CD25 mAb ( ) i.p. and 4 days later infected with 100µl LP-BM5 i.p. Disease development was assessed by spleen weight at 10 weeks pi. Treatment with anti-CD25 mAb at day -4 had no effect on disease progression in comparison to untreated virus-infected controls ( ). Data is shown as mean ±SEM of n=3 mice per group.
165
Chapter 5
uninfected MAIDS day 12 day 14 day 160.0
0.1
0.2
0.3
0.4
0.5
*
sple
en w
eigh
t (g)
Figure 5.10 Single timed depletion of CD25 does not affect disease progression Mice were infected with 100µl LP-BM5 i.p. and treated with a single timed injection of 0.5mg anti-CD25 mAb ( ) i.p. at day 12, 14 or 16 pi. Disease development was assessed by spleen weight at 10 weeks pi. Treatment with anti-CD25 mAb at any of these time points had no effect on disease progression in comparison to untreated virus-infected controls ( ). Data is shown as mean ±SEM of n=5 mice per group for day 12 and 16 treatments and n=20 for day 14 treatment. * p<0.05
166
Chapter 5
167
number of CD4+CD25+ naturally occurring Tr cells in the periphery, resulting in a
loss of Tr suppressive activity and a concomitant rise in tumour immunity.
In order to test this in MAIDS, mice were treated with a single injection of 0.5mg
anti-CD25 mAb i.p. and four days later were infected with LP-BM5. Mice were
then allowed to progress to 10 weeks pi, at which point disease progression
was assessed by spleen weight. Pre -depletion of CD25+ cells 4 days before
infection with LP-BM5 had no effect on disease progression (Figure 5.9).
In Chapter 4 it was shown that single timed treatments with Vb or anti-CD4 mAb
were able to abrogate disease progression. This approach was also tested for
anti-CD25 mAb treatment, with mice receiving a single 0.5mg dose (i.p.) on
either day 12, 14 or 16 pi. Day 12 was chosen as this is the time of peak CD25
expression by peripheral blood CD4+ T cells (Figure 3.9A), day 14 is the time
point at which all previous timed treatments have been successful and day 16 pi
is the peak time of Tr cytokine expression (Chapter 3). Depletion of CD25+ cells
at days 12 or 14 pi had no significant impact on disease progression, with all
mice developing disease to the same extent as untreated virus controls (Figure
5.10). However, treatment with anti-CD25 mAb at day 16pi was able to
moderately affect disease progression, with a small but statistically significant
reduction observed in the spleen weight of treated mice when compared to
untreated virus controls.
5.2.5 Extended in vivo depletion targeting Tr cell surface markers
The results reported for single timed depletions of CD25 raise questions about
the specificity of anti-CD25 mAb treatment for Tr cells as activated effector cells
also express CD25 on the cell surface and the removal of these cells could
actually result in the exacerbation of disease progression. Additionally it is
possible that the inefficacy of timed anti-CD25 mAb treatment is due to the fact
that such precise targeting of a single Tr cell surface marker may not be
sufficient to impact disease progression. Data presented in Chapter 3 and in
this chapter indicate that the induced Tr cells, whilst beginning as CD4+CD25+
cells, go on to lose CD25 expression whilst maintaining suppressive functions.
If this is the case it would be expected that day 14 pi treatment would be more
Chapter 5
168
effective than day 16 pi treatment. However, as discussed in the previous
section, this is not observed, possibly due to the concurrent removal of
activated effector cells also expressing CD25. These results suggest that
precisely timed treatment with anti-CD25 mAb after infection will not remove all
of the Tr cells. As Tr cells have been shown to constitutively express CTLA-4
and GITR (Read, et al., 2000; Takahashi, Tagami, Yamazaki, Uede, Shimizu,
Sakaguchi, Mak and Sakaguchi, 2000; Shimizu, Yamazaki, Takahashi, Ishida
and Sakaguchi, 2002) the targeting of these molecules may be used to affect Tr
cells that are not expressing CD25. The antibodies used against CTLA-4 is a
blocking rather than depleting antibody whilst the anti-GITR behaves as an
agonist, disrupting the functioning of the molecule and therefore blocking the
suppressive effect of these co-stimulatory molecules (Sutmuller, van
Duivenvoorde, van Elsas, Schumacher, Wildenberg, Allison, Toes, Offringa and
Melief, 2001; Shimizu, Yamazaki, Takahashi, Ishida and Sakaguchi, 2002).
In order to address this hypothesis, groups of mice received extended treatment
with mAbs against CD25, CTLA-4 and GITR either singly or in pair-wise
combinations every fourth day beginning at two days pre-infection and
continuing to 18 days pi. Controls were treated at the same time points with
whole IgG or anti-CD8 mAb. The mice were then allowed to progress to 10
weeks pi and disease progression was assessed by spleen weight.
The results (Figure 5.11) show that treatment with the control antibodies did not
abrogate disease progression, in fact, treatment with anti-CD8 appeared to
exacerbate disease, demonstrating the effect of removing effector cells on
disease progression. Treatment with any single mAb also had no significant
effect on disease progression. In contrast, treatment with any two mAbs in
combination appeared to have a greater effect, resulting in a significant slowing
of disease progression when compared to control mice. The groups receiving
treatment with pair-wise combinations of mAbs showed a significant decrease in
spleen weight, regardless of which combination of mAbs was used. This effect
was not increased when mice received treatment with mAbs against all three
cell surface markers with mice in this group having a statistically significant
reduction in spleen weight compared to the MAIDS controls.
Chapter 5
MAIDS IgG CD8 A B C A+B A+C B+C A+B+C0.0
0.2
0.4
0.6
0.8
1.0
1.2
* *
*** ***
Sple
en w
eigh
t (g)
Figure 5.11 Extended treatment with mAbs against regulator cell markers slows MAIDS progression. Mice received injections of single or combinations of mAbs. Mice were treated on days -2, 2, 6, 10, 14 and 18 pi with the appropriate antibody. The amount of antibody given per treatment was as follows: 0.5mg anti-CD8, 1mg IgG, 0.5mg anti-CD25 (A), 1mg anti-GITR (B), 0.1mg anti-CTLA-4 (C). MAIDS development was assessed at 10 weeks pi by spleen weight. For the experimental groups, the figure shows the mean ± SEM, for the MAIDS control group (,n=6), n=3-6 mice per treatment group and for the IgG isotype control and CD8 binding control groups. Statistical significance was based on a comparison between treatment groups and MAIDS controls. * = p<0.05, ***=p<0.005
169
Chapter 5
170
5.3 Discussion
The data that has been presented in the previous two chapters has provided
strong evidence that a population of CD4+ Tr cells is induced following infection
with LP-BM5. Timed depletion of Tr cells has been shown to abrogate disease
progression and the return of these cells to a successfully treated host results in
renewed MAIDS progression. As there are several subtypes of CD4+ Tr cells
this chapter has focussed on the further phenotypic characterisation of these
cells as well as examining the induction and development of these cells. Most
importantly this chapter also examines the functional role of these cells in
disease progression.
In order to determine a role for Tr cells in MAIDS it was first essential to
demonstrate that suppression of the CTL response to LP-BM5 was occurring. It
has previously been demonstrated that CD8+ T cells retain function to
approximately 8 weeks pi before also becoming anergic (Morse, et al., 1992).
An in vivo CTL assay was utilised to measure the level of CTL activity specific
for an immunodominant peptide, encoded on the p12 region of the gag gene of
BM5d, in the early stages of infection. Naive mice were found to exhibit no
significant p12-10 peptide-specific lysis of target cells (Figure 5.2). This
indicates that there are no p12-10 specific CD8+ effector T cells present in the
naive mice, which would be expected, as these mice have not been previously
exposed to LP-BM5. However, by day 10 post LP-BM5 infection a potent CTL
response specific for the peptide had arisen with an average of 60% lysis of the
peptide-labelled target cells. This agrees with studies which demonstrate that
CD8+ T cells help to mediate resistance to MAIDS (Makino, et al., 1992;
Pavlovitch, et al., 1996; Tang, et al., 1997). Interestingly, the level of
peptide-specific cell lysis in mice at day 20pi was the same as observed for
naive mice. This suggested that the functional CTLs generated in response to
LP-BM5 infection at day 10 pi are functionally suppressed at day 20 post
infection. This corresponds to the induction and activation of Tr cells at day 14
pi as demonstrated in Chapters 3 and 4.
Chapter 5
171
A modified in vivo CTL assay was then utilised to examine the suppressive
effects of CD4+CD25+ and CD4+CD69+ cells, which had been identified in
Chapter 3 as good candidates for the phenotype of the induced Tr cell
population in MAIDS. When purified CD4+CD25+ T cells were infused, together
with the target cells into day 10 pi hosts, a complete suppression of the
peptide-specific CTL response was observed (Figure 5.4). In contrast,
co-transfer of CD4+CD69+ T cells was only able to suppress the CTL response
by approximately 50% compared to mice receiving no Tr cells. This
demonstrated that the Tr cells induced by LP-BM5 infection are CD4+CD25+ Tr
cells and that these cells are capable of effectively suppressing the CTL
response at a time when it is effectively clearing BM5d-“infected” cells. The
data also indicates that there may be some overlap in the expression of CD25
and CD69 on Tr cells. FACS analysis shows that approximately 20% of
CD4+CD25+ cells also express CD69 on the cell surface and vice versa. This is
most likely due to the fact that both of these molecules are also activation
markers.
The suppressive activity observed in the CD4+CD69+ fraction could be
explained by the presence of CD25+ cells within this fraction. These cells are
being purified together with other CD4+CD69+ non-regulatory cells resulting in a
partial suppression of the CTL response. This explanation is supported by the
large difference in the suppressive activity of the two subsets as well in the level
of Tr-associated cytokine secretion as measured by ELISpot. An alternative
explanation for these observations is that splenic CD4+CD25+ Tr cells are still in
the process of becoming activated in response to viral antigen and the secretion
of IL-10 and TGF-β at day 16 pi (Chapter 3). It is conceivable that the activation
of Tr cells and the subsequent down-regulation of CD25 may take time due to
the naturally anergic nature of these cells. Studies by Gavin et al. (Gavin, et al.,
2002) have shown the loss of CD25 in vivo occurred over a period of 6 days.
As such, by day 18 pi some cells have down regulated CD25 expression,
resulting in the suppression seen in the CD4+CD69+ fraction. The inclusion of
these activated Tr cells that are CD25- would therefore also account for the
suppressive activity that is observed in the CD4+CD69+ fraction.
Chapter 5
172
Further in vivo functional studies examining different time points of infection as
well as different combinations of Tr cell surface markers will help to clarify both
the phenotype and the timing of Tr cell induction. Indeed, the molecule
neuropilin 1 (Nrp1) has recently been identified as an activation-independent Tr
cell surface marker (Bruder, et al., 2004). Preliminary studies indicate an early
expansion of the number of CD4+Nrp1+ cells in the spleen, warranting the
inclusion of this marker in future studies as it may provide an alternate or
additional marker for the BM5d-specific Tr cells.
The loss of CD25 expression which has previously been observed in the
peripheral blood (Chapter 3, Figure 3.8A) and the overlapping of suppressive
function observed in the in vivo CTL assay in this chapter have also raised
questions as to the origin of these antigen-specific Tr cells. The recent
discovery of the transcription factor Foxp3 as a master switch for Tr cells has
allowed a better understanding of the development of the Tr cell lineage
(Fontenot, et al., 2003; Hori, et al., 2003; Khattri, et al., 2003). Foxp3 appears
to be critical for the development and function of naturally occurring Tr cells,
however its role in the generation of antigen-specific Tr cells in the periphery
remains poorly understood.
The level of Foxp3 expression in splenic CD4+CD25+ and CD4+CD69+ T cells
was examined in MAIDS to determine whether BM5d-specific Tr cells are Foxp3
dependent. Naive mice expressed approximately 100-fold (2 log) greater levels
of Foxp3 mRNA in CD4+CD25+ cells compared to the CD4+CD25- cells, a result
that is consistent with those reported for T cells in the thymus (Hori, et al.,
2003). A gradual change is observed in Foxp3 expression levels of
CD4+CD25+/- cells as disease progresses, with greater expression of Foxp3
being observed in the CD25- fraction by day 30 pi. No correlation was found
between Foxp3 levels and expression of CD69 on the cell surface in naive mice
and as disease progresses. This data suggests that the naturally occurring
CD4+CD25+ Tr cells present in the periphery may possibly be the precursors for
the antigen-specific CD4+CD25- Tr cells in MAIDS, with infection resulting in a
loss of CD25 expression, but maintenance of suppressive function.
Chapter 5
173
Further evidence for this explanation is provided by the adoptive transfer
studies that have been conducted. It was proposed that the transfer of
additional Tr cells into an already infected host would result in the exacerbation
of disease development due to additional suppression, resulting in a
measurable increase in spleen weight. The transfer of CD4+CD25+ Tr cells from
naive mice into infected hosts resulted in a significant exacerbation of disease
(Figure 5.8) with the average spleen weight approximately double that of the
virus only controls. In contrast, transfer of naive CD4+CD25- cells had no
impact on disease progression. This suggested that naturally occurring/naive
CD4+CD25+ Tr cells were providing the precursors for antigen-specific Tr cells.
This interpretation is supported by the results of the transfer of day 15 pi MAIDS
infected CD4+CD25+/- T cells into infected hosts. The transfer of CD25+ cells
resulted in a small but statistically insignificant increase in the spleen weight of
the host animals. However, mice receiving CD25- donor cells presented with
exacerbated disease. This result indicates that the Tr cells are now present in
the CD25- fraction of CD4+ T cells, a finding which is consistent with other
results that have been reported in this, and previous chapters. These results
are also consistent with the interpretation that naturally CD4+CD25+ Tr cells are
the precursor cells for the CD4+CD25+ antigen-specific Tr cells which are
induced by infection with LP-BM5. These cells then go on to lose CD25
expression but maintain Foxp3 expression and suppressive function as disease
progresses. However these results may also be indicative of the induction of
secondary Thsupp cells by naturally occurring Tr cells in the periphery
(Dieckmann, et al., 2002; Jonuleit, et al., 2002; Stassen, et al., 2004a). Further
studies would be required to determine whether this is a possibility as to date
this phenomenon has only been demonstrated in vitro for human CD4+CD25+ Tr
cells.
Further to this, treatment of the donor mice on day 14 pi with a single dose of
Vb prior to the transfer of cells on day 15 pi resulted in no exacerbation of
disease in the recipient mice. This result demonstrates that Vb treatment was
able to remove the Tr cell population at this time, indicating that the Tr cell
population is expanding at this point in infection. This result both confirms and
expands on the findings reported in Chapter 4, where it was demonstrated that
Chapter 5
174
treatment with a single dose of Vb at day 14 pi was removing a dividing
population of CD4+ Tr cells.
Having obtained results which suggest that the Tr cells involved in MAIDS are
generated from CD4+CD25+ precursors, experiments were designed to examine
the effect of removing these cells on disease progression. In Chapter 4,
treatment with Vb or anti-CD4 mAb was used, however this is quite non-specific
as these treatments also remove other cell populations in addition to the Tr
cells. In order to remove Tr cells more specifically, mice were treated with a
single injection of anti-CD25 mAb four days prior to infection with LP-BM5,
however this was found to have no effect on disease progression. This is in
contrast to successful treatment for a number of tumours using this protocol
(Onizuka, et al., 1999; Shimizu, et al., 1999; Sutmuller, et al., 2001; Jones, et
al., 2002) and in a murine mesothelioma model within this laboratory. Testing
of the anti-CD25 mAb in vivo subsequently found that depletion of CD25+ cells
was only occurring for 3 days, after which the population began to rebound back
to levels seen prior to treatment. It is possible that this in an insufficiently long
depletion in the context of this viral infection for pre-depletion of CD4+CD25+ to
have any impact on disease progression. These results suggested that a later
depletion may have a greater effect in slowing disease progression.
In order to determine whether depletion of Tr cells following infection would be
as effective as the Vb and anti-CD4 mAb treatment (Chapter 4), specific timed
depletions following infection using a single injection of anti-CD25 mAb were
also tested for their effect on disease progression. Treatment at either day 12
and 14 pi was found to have no significant effect on disease progression, whilst
treatment at day 16 pi was found to have only a small effect on disease
progression. The lack of efficacy of CD25 depletion on disease progression
was initially somewhat surprising as this thesis has compiled a considerable
body of evidence for the involvement of CD4+CD25+ Tr cells in MAIDS
progression. However, data has also been presented in this Chapter
demonstrating the loss of CD25 by Tr cells following activation. This suggests
that anti-CD25 mAb treatment alone after infection, or even at day -4
pre-infection may not be sufficient to target Tr cells.
Chapter 5
175
The study was therefore expanded to examine the effect of the extended
depletion of CD25, and other Tr associated cell surface markers, on disease
progression. The effect of removing activated effector cells was also addressed
in this experiment through the inclusion of an anti-CD8 mAb treatment group.
Mice were treated every fourth day from 2 days prior to infection through to day
18 pi. As expected, the depletion of activated effector cells resulted in the
exacerbation of disease progression as measured by spleen weight.
Interestingly, extended depletion of CD25 had no significant effect on disease
progression but did not exacerbate disease; suggesting treatment with
anti-CD25 mAb alone was not having a significant effect on Tr cells. Extended
depletion of the Tr-associated cell surface molecules CTLA-4 and GITR was
also conducted and found to have no effect on disease progression.
In contrast, the extended targeting of any pair wise combination of CD25,
CTLA-4 and GITR with monoclonal antibodies resulted in a significant slowing
of disease progression, with a 34-52% reduction in spleen weight observed at
10 weeks pi following treatment. Treatment with monoclonal antibodies against
all three markers together did not result in a greater effect than pair wise
depletion with a 45% reduction in spleen weight at 10 weeks pi. The
anti-CTLA-4 mAb acts by blocking and the anti-GITR mAb by antagonising the
action of their target molecules (Sutmuller, et al., 2001; Shimizu, et al., 2002).
These results indicate a synergy in the targeting action of the monoclonal
antibodies, suggesting that there may be some redundancy in the signalling
pathways by which Tr cells exert their suppressive effects. A similar synergy
has been previously observed using the same monoclonal antibodies against
CTLA-4 and CD25 in a murine melanoma model (Sutmuller, et al., 2001).
The results obtained demonstrate that these co-stimulatory molecules play a
significant role in disease development and progression although it can not be
said conclusively that this is only in the context of Tr cells. Data from this thesis
on MAIDS and other models indicate that cytokine secretion is a characteristic
feature of antigen-specific Tr cells (McGuirk and Mills, 2002) and the blockade
of co-stimulatory molecules may not affect this sufficiently to stop suppression.
Infection with LP-BM5 results in a very aggressive infection which affects
Chapter 5
176
virtually every component of the immune system including cells, cytokines and
antibody production. The published literature demonstrate that there are factors
not linked to Tr cells such as other cellular interactions and cytokines that are
influencing disease progression (Morse, et al., 1992; Green, et al., 1998; Green,
et al., 2001).
When taken together, the results presented in this chapter together with
Chapters 3 and 4 also consistently demonstrate that the Tr cells induced by
LP-BM5 infection arise late in the second week of infection. Changes in CD25
expression are observed at day 12 pi in the peripheral blood and in conjunction
with a substantial increase in IL-10 and TGF-β expression at day 12 pi, peaking
at day 16pi (Chapter 3). Changes in Foxp3 expression are seen by day 16 pi
and functional suppression is evident from day 15 pi by adoptive transfer and
day 18 pi by in vivo CTL assay. In addition, therapy targeting Tr cells is
effective at day 14 pi (Chapter 4). All of these results concur that Tr cells are
induced from day 12 pi onwards, subsequent to the generation of virus-specific
CTLs, and act to suppress this CTL response to LP-BM5. The results
presented in this chapter also demonstrate the presence of a functionally
suppressive Tr cell population that develops, possibly from naturally occurring
CD4+CD25+ Tr cells, following infection with LP-BM5. These cells lose CD25
expression as they become activated but maintain expression of Foxp3 and
their suppressive function. These results also reinforce the need to find a
specific marker for Tr cells, particularly a cell surface marker, in order to
facilitate more accurate and focused research. This work, together with the
results presented in Chapter 4, raises the question of the impact that
therapeutically targeting Tr cells has on the BM5d virus, an issue that is
addressed in Chapter 6 of this thesis.
Chapter 6:
Quantitating the spread of defective and ecotropic viruses
during LP-BM5 infection
Chapter 6
177
6.1 Introduction
In Chapter 4 of this thesis it was shown that a single treatment at day 14 post
infection with Vinblastine or anti-CD4 monoclonal antibody was highly effective
in preventing disease progression. Effects on disease progression were
measured using a 10 week pi spleen weight however this provided no
information about the mechanism by which treatment was so effective. It is
hypothesised that it is due to the removal of Tr cells at a crucial stage of
infection. Substantial evidence has been presented in Chapters 3 and 5 of this
thesis demonstrating both the induction of Tr cells by BM5d, and that these cells
play an important role in disease progression. In order to determine whether
the effectiveness of the treatment is due to direct anti-viral effects or an effect
on disease pathology it was necessary to develop assays that could reliably and
easily measure viral DNA and RNA levels.
Quantitation of the levels of virus both in viral stocks and in infected animals is
an area that has changed rapidly with the development of PCR. Previously, the
levels of BM5e and MCF viruses were used as surrogate markers to analyse
viral stocks as BM5d could not be easily quantitated due to the virus being
replication defective. Viral titres were measured by plaque assay for BM5e
(Rowe et al., 1970) and there are a number of other plaque assays used to
quantify the various groups of murine retroviruses (Hartley, et al., 1992). More
recently an immunochemical assay has been developed for the detection of all
three virus types in LP-BM5 in the foci of an infected cell monolayer (Hugin, et
al., 1999).
More recently a number of PCR based methods have been developed and are
now used to examine BM5d nucleic acid levels following infection. The
expression of BM5d viral DNA has been assessed by specific PCR (Ogata, et
al.,1993), semi-quantitative PCR (Fraternale, et al.,1996), a combination of PCR
and anion exchange HPLC (Hugin, et al., 1996) and competitive PCR
(Casabianca, et al., 1998). BM5d RNA has been detected using competitive
RT-PCR (Desforges, et al.,1996; Yu, et al., 1999) or semi-quantitative RT-PCR
(Gazzinelli, et al., 1994; Green, et al., 1998, 1996). This approach has also
Chapter 6
178
been used to examine BM5e viral RNA expression (Gazzinelli, et al., 1994).
More recently a quantitative one-step RT-PCR assay for both BM5e and BM5d
(Casabianca, et al., 2003) as well as a real time RT-PCR assay, allowing for
direct quantitation of both viruses (Cook, et al., 2003), have been described.
The assays described in this Chapter were developed independently at the
same time as these published assays in order to differentiate between direct
anti-viral effects or effects on disease pathology.
This chapter describes the development and application of a highly sensitive
real time PCR assay for the direct quantitation of BM5d and BM5e viral DNA to
monitor viral integration as infection progresses. This assay is able to measure
both unintegrated and integrated viral DNA and as such, provides an accurate
reflection of total viral DNA levels in the host. A real time RT-PCR assay was
also developed and used for the quantitation of viral RNA levels during LP-BM5
infection. These assays were used to measure the levels of viral DNA and RNA
in both peripheral blood and spleen at different stages of infection for BM5d and
BM5e. It was also established that viral levels in the blood are an accurate
reflection of viral expansion in the spleen, providing a simple way to monitor
mice throughout infection and after treatment. Vinblastine and anti-CD4 mAb
treatments were investigated to determine whether the treatments were
delaying disease progression by direct anti-viral activity or by effects on disease
pathology. This information is crucial in understanding both the mechanism of
action of the treatment and also in exploring the role of Tr cells in the
progression of MAIDS. The development of this assay and its application to the
viral load during disease progression has been published in the Journal of
Virological Methods (Paun et al., 2005:124(1-2);57-63).
6.2 Results
6.2.1 PCR for detection of LP-BM5 DNA
This system was based on the PCR detection of BM5def DNA published by
Ogata (Ogata, et al., 1993). The specificity of the primers for
Chapter 6
A
1 2 3 4 5 6 7
B
1 2 3 4 5 6 7 8
C
1 2 3 4 5 6 7 8
Figure 6.1 Development of PCR for the detection of BM5d viral DNA Reactions were conducted as described in Chapter 2.2.14.2. For all panels Lane 1 is 1kb ladder. A. Specificity of the PCR reaction. The target DNA used were the following: MAIDS infected spleen at 10 weeks post infection (Lane 2), uninfected spleen (Lane 3), SC1 cells (Lane 4), SC1-G6 cells (Lane 5), pBM5e (Lane 6) and JP-1 (Lane 7) DNA. B and C. Sensitivity of the PCR reaction. The following concentrations of JP-1 DNA were tested: 100ng/µl (B, Lane 2), 10ng/µl (B3), 1ng/µl (B4), 100pg/µl (B5), 10pg/µl (B6), 1pg/µl (B7 and C2), 0.1pg/µl (C3), 10fg/µl (C4), 1fg/µl (C5), 0.1fgµl (C6) and 0.01fg/µl (C7) and no template control (B8 and C8).
179
Chapter 6
180
BM5d was tested using a number of different DNA samples, the results of which
are shown in Figure 6.1A. The BM5d primers were able to amplify specific
product from the positive control samples; SC1-G6 and JP-1 DNA as well as
DNA from a MAIDS-infected spleen at 10 weeks pi. These samples were
positive controls as the SC1-G6 cell line is chronically infected with the LP-BM5
retroviral mixture, the JP-1 plasmid (provided by Prof. Paula Pitha-Rowe, Johns
Hopkins University, USA) contains the BM5d viral sequence and the 10 week
p.i. spleen contains high levels of BM5d DNA. No product was amplified in the
negative control samples; the uninfected spleen DNA, SC1 cell line (the
parental cell line from which SC1-G6 cells were generated) and pBM5e plasmid
DNA which contains the BM5e viral sequence (supplied by Prof. Paula Pitha-
Rowe, Johns Hopkins University, USA).
As this assay will be used to determine whether there has been a change in
viral DNA levels at different stages post infection as well as following treatment,
the assay sensitivity is paramount. The range of the PCR assay was
determined by amplifying 10-fold dilutions of the JP-1 plasmid ranging from
100ng/µl to 0.01fg/µl. The results (shown in Figure 6.1B and C) indicate that
the PCR was able to detect up to 10 fg/µl of plasmid DNA.
Total DNA extracted from the spleens of mice at a number of weeks post
infection was then analysed for the presence of BM5d DNA. BM5d DNA was
not detected until 4 weeks post infection (6/6 mice). This suggested that the
sensitivity of the assay was not sufficient for the detection of small amounts of
BM5d viral DNA. This lack of sensitivity was compounded by the use of UV
visualisation for quantitation of the PCR product. As accurate quantitation of
the viral DNA is crucial for the detection of changes in viral DNA levels following
treatments it was decided to adapt the assay to real time PCR, an assay which
is generally acknowledged to be far more sensitive.
6.2.2 Real time PCR for detection of LP-BM5 DNA
This real time system was also based on the PCR protocol published by Ogata
(Ogata, et al., 1993). Real time PCR was chosen as a means of more
sensitively and accurately determining the amount of viral DNA present in vivo
Chapter 6
181
at different times post infection. The use of the dye SybrGreen allows real time
quantitation of samples and standards of known concentration. Melting
temperature analysis then allows for the detection of specific and non-specific
products (Chapter 2.2.14.3).
6.1.1.1 Selection of primers
The primers used for PCR described in 5.2.1 were also used for the real time
PCR. These primers amplify a 209bp product in the p12 region of the gag gene
which only has 30-40% homology with the same region of other murine
retroviruses (Aziz, et al., 1989; Ogata, et al., 1993). The primers used for BM5e
were described by Cook (Cook, et al., 2003). These primers were designed to
amplify 222bp product from the gag gene of the ecotropic virus in a region that
was found to be unique to BM5e (Cook, et al., 2003).
6.1.1.2 Standard curves
The LS-1 and pBM5e plasmids containing the viral sequences for BM5d and
BM5e respectively were chosen for use as standards for PCR. The plasmid
LS-1, which contains the BM5d genome modified to include a GFP cassette in
the pol/env region was constructed from the JP-1 plasmid and supplied by Dr L.
Sammels (UWA, Australia).
Plasmids were purified using the Qiagen Plasmid Purification kit (Qiagen) and
linearised using Bam HI (BM5e) and Eco RI (BM5d) before being quantitated by
spectrophotometry and agarose gel electrophoresis for use. The standard
curves consist of 10-fold serial dilutions from 1x10-10 to 1x10-17 g/µl for BM5d
and 1x10-9 to 1x10-16 g/µl for BM5e (shown in Figure 6.2). The assay gave a
linear curve over 7-8 logs for both the defective and ecotropic standards and the
products were amplified with similar efficiency. The limit of detection was found
to be 1x10-17g/µl for BM5d and 1x10-16g/µl for BM5e. Melting curve profiles
indicated that a single specific product was generated by each set of primers
with BM5d product having a melting temperature of 83˚C and the BM5e product
having a melting temperature of 81˚C. This assay was then applied to examine
BM5d and BM5e DNA in infected samples.
Chapter 6
0 10 20 30 401.0×10-18
1.0×10-17
1.0×10-16
1.0×10-15
1.0×10-14
1.0×10-13
1.0×10-12
1.0×10-11
1.0×10-10
1.0×10-09
1.0×10-08
BM5d
BM5e
r2=0.9991
r2=0.9949
Ct
g/µ l
Figure 6.2 Typical standard curves for the BM5d and BM5e real time PCR. Serial (10-fold) dilutions were made of the LS-1 or pBM5e plasmid DNA prior to amplification. These pre-diluted targets are then amplified as described in Chapter 2.2.14.3 using an Applied Biosystems GeneAmp 5700 sequence detector using the primers, probes and cycling condition described in Table 2.5. These standard curves are highly reproducible in each individual run performed.
182
Chapter 6
183
6.2.3 Infected tissues
Real time PCR was used to determine the level of viral DNA in both peripheral
blood and splenic white blood cells over a time course of MAIDS infection.
Samples from uninfected mice were used to determine basal levels of viral DNA
due to possible detection of endogenous retroviral sequences. Samples that
recorded having less than 1x10-17g/µl of BM5d were considered to be below the
limit of detection and were recorded as 1x10-17g/µl for analysis. The limit of
detection was found to be 1x10-16g/µl for BM5e and samples which recorded
levels lower than this limit were recorded as 1x10-16g/µl for analysis.
6.1.1.3 Peripheral Blood
Viral DNA levels were measured in peripheral blood samples of uninfected or
MAIDS infected mice prepared as described in Section 2.2.13.7.1. BM5d was
not detected in uninfected mice using the above limit of detection although a low
level of BM5e was detected (Figure 6.3). Following infection the level of BM5e
DNA increased slowly for the first 2 weeks pi and had increased significantly at
3 weeks. The levels of BM5d DNA increased rapidly from 1 week pi.
Interestingly, the level of BM5d DNA had reached maximal levels by 4 weeks pi
(approximately 1x10-13g/µl) and this was maintained for the rest of the time
points measured. BM5e DNA levels peaked earlier (3 weeks) but were
maintained at the same level as BM5d DNA in peripheral blood.
6.1.1.4 Spleen
In spleen, equal amounts of BM5d and BM5e were found at 1 week pi (Figure
6.4), however by 3 weeks pi, greater amounts of BM5d DNA were found. The
amount of viral DNA was found to be the same at 3 and 7 weeks pi for BM5d, a
result which was also was observed for BM5e. BM5d levels were not found to
have increased any further by 10 weeks pi in either blood or spleen. The
elevated levels of BM5d DNA were also found to correlate well with the
development of splenomegaly (Figure 6.5). This suggests that viral DNA levels
reach their maximum at approximately the same time in blood and the spleen
and that these levels are then maintained for the course of the infection.
Chapter 6
0 10 20 30 40 50 601.0×10-17
1.0×10-16
1.0×10-15
1.0×10-14
1.0×10-13
1.0×10-12
BM5d
BM5e
*
*
Days post infection
vira
l DN
A (g
/ µl)
Figure 6.3 Time course of viral DNA levels in the peripheral blood of LP-BM5 infected mice. Data shown as mean ± SEM from three individual experiments, n=10 mice per time point for BM5d and n=4 mice per time point for BM5e. Peripheral blood was collected from the same mice at different weeks post infection, prepared as described in Chapter 2.2.13.7.1 and assayed by real time PCR as described in Chapter 2.2.14.3 using the primers, probes and cycling conditions described in Table 2.5. The first time post infection at which the increase in viral DNA was found to be statistically significant when compared to day 0 is indicated, * p<0.05
184
Chapter 6
naive 3w 7w1.0×10-17
1.0×10-16
1.0×10-15
1.0×10-14
1.0×10-13
1.0×10-12
BM5dBM5e
* ***
***
time
DN
A (g
/ µl)
Figure 6.4 Comparison of viral DNA in the spleen at different times post infection. Data shown is the mean ± SEM, n=4 mice per group. Splenic DNA was extracted from the spleens of uninfected mice and mice at different weeks post infection as described in Chapter 2.2.13.7.2. BM5d and BM5e viral DNA was assayed by real time PCR as described in Chapter 2.2.14.3 using the primers and probes and cycling conditions described in Table 2.5. Viral DNA levels after infection were compared to naïve mice and statistical significance is indicated, * p<0.10, *** p<0.01
185
Chapter 6
uninfected (weight <0.15g) infected (weight >0.3g)1.0×10-18
1.0×10-17
1.0×10-16
1.0×10-15
1.0×10-14
1.0×10-13
1.0×10-12
1.0×10-11
*** p>0.001
BM
5d p
rovi
ral D
NA (g
/µl)
Figure 6.5 Relationship between spleen weight and BM5d viral DNA levels Data is shown as the peripheral blood BM5d DNA levels in the same group of mice when they were uninfected and at 8 weeks pi. Uninfected spleen weights were not taken for these mice however previous experiments have found that uninfected mice have a typical spleen weight of approximately 0.1g. The level of viral DNA was found to be at the limit of detection of the assay in uninfected mice. The level in mice at 8 weeks pi was found to be approximately 4 logs greater than uninfected mice and this correlates well with the increase in spleen weight.
186
Chapter 6
187
6.3 Real time RT PCR
An RT PCR assay was developed in order to monitor viral RNA levels at
different stages of disease and also to monitor any changes in viral RNA in
response to treatment with Vb or anti-CD4 mAb. The assay was initially
developed as a standard one-step RT PCR, with products being analysed by
agarose gel electrophoresis. However, as previously described for the PCR,
sensitivity was a critical issue with BM5d RNA not detectable in the spleen until
4 weeks pi and 6 weeks pi in serum. Adapting the assay to real time
technology was anticipated to increase the assay sensitivity by 4-5 logs, or
10000-100000-fold. The same primers described for the real time PCR were
used for the RT PCR assay, generating products of the same size, 209bp for
BM5d and 222bp for BM5e. A one-step real time RT PCR was developed in
order to reduce the handling of the sample and to lower the risk of
contamination.
6.3.1 Standard curve
To ensure that quantitation was as accurate as possible RNA standards were
generated for both BM5d and BM5e. The methods by which these constructs
were generated are described in Chapter 2.2.16.3.1 and 2.2.16.3.2. Standard
curves consist of 10-fold serial dilutions from 7x10-11 to 7x10-18 g/µl for BM5d
and 8x10-12 to 8x10-18 g/µl for BM5e. Characterisation of the linear range of the
assay showed that a linear curve can be generated over 7-8 logs (Figure 6.6).
Melting profiles showed the generation of specific products with melting
temperatures as described for the PCR. Assay sensitivity was found to be
equivalent to 7x10-17g/µl for BM5d and 8x10-17g/µl for BM5e. The PCR products
were amplified with similar efficiency for both the ecotropic and defective
viruses. This assay was then applied to measure viral RNA levels in infected
mouse tissues.
Chapter 6
0 10 20 30 401.0×10-18
1.0×10-17
1.0×10-16
1.0×10-15
1.0×10-14
1.0×10-13
1.0×10-12
1.0×10-11
1.0×10-10BM5d
BM5e
r2=0.9961
r2=0.9834
Ct
g/µ l
Figure 6.6 Typical standard curves for BM5d and BM5e real time RT-PCR Serial (10-fold) dilutions were made of the BM5d and BM5e RNA transcripts generated from the expression vector prior to amplification. These pre-diluted targets are then amplified as described in Chapter 2.2.16.2 using an Applied Biosystems GeneAmp 5700 sequence detector using the primers, probes and cycling conditions described in Table 2.5. These standard curves are highly reproducible in each individual run performed.
188
Chapter 6
189
6.3.2 Infected tissue
Real time RT PCR was used to determine the level of viral RNA in both
peripheral blood and splenic white blood cells over a time course of infection.
Uninfected mice were used to determine whether there were basal levels of
viral RNA possibly due to the detection of endogenous retroviral sequences.
The murine genome is known to contain endogenous retroviral sequences (See
Chapter 1.7.1.4). Samples that recorded having less than 1x10-17g/µl virus
were considered to be below the limit of detection and were recorded as
1x10-17g/µl for analysis.
6.1.1.5 Peripheral Blood
BM5d and BM5e viral RNA levels were measured in the plasma of infected
mice over a time course of infection (Figure 6.7). The level of BM5d RNA
present in uninfected mice was below the limit of detection while a low basal
level was recorded for BM5e. Viral RNA levels had increased significantly at 3
weeks pi. BM5e RNA levels continued to increase rapidly until 4 weeks pi, after
which only a small increase was observed. This pattern in viral RNA levels was
also observed for BM5d although the defective MuLV was found to be present
in lower quantities than BM5e. Furthermore, a 2-3 log difference is observed in
the levels of BM5d and BM5e viral RNA levels. The higher levels of BM5e
suggest that beyond the initial infection, replication of the ecotropic virus (as a
helper virus) is required to allow further expansion of BM5d. The large
difference in viral RNA levels between the two viruses is in contrast to the
results observed for viral DNA, which found there were very similar levels of
BM5e and BM5d at all stages of infection (Figure 6.3).
6.1.1.6 Spleen
Spleen BM5e RNA levels also increased rapidly at 3 weeks pi in comparison to
1 week pi (Figure 6.8) with no further significant increase seen at 7 weeks pi.
This pattern is also observed for BM5d RNA in spleen, with the BM5d RNA
found to be present at 2 logs lower concentration than BM5e. This is consistent
with the results observed for peripheral blood viral RNA levels. BM5d RNA
levels were not found to increase significantly between 7 and 10 weeks pi. The
Chapter 6
0 10 20 30 40 50 60
1.0×10-17
1.0×10-16
1.0×10-15
1.0×10-14
1.0×10-13
1.0×10-12
1.0×10-11
BM5dBM5e
* *
***
days pi
Vira
l RN
A (g
/ µl)
Figure 6.7 Comparison of BM5d and BM5e viral RNA in the peripheral blood of LP-BM5 infected mice. Data shown as mean ± SEM, n=4 mice per time point. Peripheral blood was collected from the same mice at different weeks post infection and prepared as described in Chapter 2.2.15.4.1. Samples were assayed by real time RT PCR as described in Chapter 2.2.16.2 using the primers, probes and cycling conditions described in Table 2.5. Viral RNA levels following infection were compared to uninfected mice. * p<0.1, *** p<0.05
190
Chapter 6
1w 3w 7w1.0×10-16
1.0×10-15
1.0×10-14
1.0×10-13
1.0×10-12
1.0×10-11
1.0×10-10
1.0×10-09BM5dBM5e
time post infection
RN
A (g
/ µl) * *
Figure 6.8 Comparison of spleen BM5d and BM5e viral load in the spleen at different times post infection. Data shown is the mean ± SEM, n=3 mice per time point shown. Splenic RNA was extracted from the spleens of uninfected mice and mice at different weeks post infection as described in Chapter 2.2.15.4.3. BM5d and BM5e viral DNA was assayed by real time PCR as described in Chapter 2.2.16.2 using the primers, probes and cycling conditions described in Table 2.5. . Viral RNA levels following infection were compared to uninfected mice. *p<0.1
191
Chapter 6
uninfected (weight <0.15g) infected (weight >0.3g)1.0×10-18
1.0×10-17
1.0×10-16
1.0×10-15
1.0×10-14
1.0×10-13
*** p>0.001
BM5d
vira
l RNA
(g/µ
l)
Figure 6.9 Relationship between spleen weight and BM5d viral RNA levels Data is shown as the peripheral blood BM5d viral RNA levels in the same group of mice when they were uninfected and at 10 weeks pi. Uninfected spleen weights were not taken for these mice however previous experiments have found that uninfected mice have a typical spleen weight of approximately 0.1g. The level of viral RNA was found to be at the limit of detection of the assay in uninfected mice. The level in mice at 10 weeks pi was found to be approximately 3 logs greater than uninfected mice and this correlates well with the increase in spleen weight.
192
Chapter 6
193
increase in viral RNA levels is consistent with the pattern observed in the real
time PCR for viral DNA. The high levels of BM5d viral RNA also correlated well
with the development of splenomegaly in infected mice (Figure 6.9). The data
suggests that viral RNA levels also reach their maximum at approximately the
same time in the blood and spleen and that these levels are then maintained for
the duration of the infection.
6.4 Peripheral blood levels of BM5d DNA and RNA are an
accurate reflection of spleen infection
A comparison of the quantity of BM5d DNA in the spleen and peripheral blood
following LP-BM5 infection was conducted to determine how reflective blood
viral DNA levels were of splenic levels. The data used for this direct
comparison of tissue viral levels has also been presented in Figures 6.3 and
6.4. Figure 6.10A shows that while splenic viral DNA levels have increased
more rapidly by 3 weeks pi, blood BM5d DNA levels are still 3 logs (1000-fold)
higher then observed in naïve mice. As a diagnostic assay this gives a clear
indication of whether mice are infected. By 7 weeks pi blood and spleen BM5d
DNA is present in the same quantity. These results indicate that peripheral
blood is highly reflective of BM5d DNA levels in the spleen during infection.
The same comparison was carried out for BM5d RNA levels in the peripheral
blood and spleen (Figure 6.10B). A similar result to that seen for BM5d DNA
levels is observed for spleen BM5d RNA levels, a large rapid increase in viral
RNA levels from 1 week to 3 weeks pi and then little change between 3 and 7
weeks. The data used for this direct comparison of tissue viral DNA levels has
also been presented in Figures 6.7 and 6.8. The amount of BM5d RNA found in
peripheral blood is lower than in spleen indicating that BM5d RNA levels do not
reflect the infection taking place in the spleen as accurately as DNA levels.
Both assays show a significant increase in the amount of BM5d nucleic acid at
3 weeks pi, allowing for diagnosis of infection at an early stage of infection.
Chapter 6
naive 3w 7w1.0×10-17
1.0×10-16
1.0×10-15
1.0×10-14
1.0×10-13
1.0×10-12
blood spleen
A
***
**** ***
Time
BM
5d D
NA
g/ µ
L
1w 3w 7w1.0×10-17
1.0×10-16
1.0×10-15
1.0×10-14
1.0×10-13
1.0×10-12
1.0×10-11 spleenbloodB
*
* *
time
BM
5d R
NA
(g/ µ
l)
Figure 6.10 Comparison of DNA and RNA levels in blood and spleen at different times post infection BM5d viral DNA (Chapter 2.2.13.7.1, 2.2.13.7.2. and 2.2.14.3) and RNA (Chapter 2.2.15.4.1, 2.2.15.4.3 and 2.2.16.2) were extracted and assayed as described using the primers, probes and cycling conditions described in Table 2.5. All data is shown as mean ± SEM. (A) BM5d DNA, n=10 for naïve and 3 weeks and n=15 for 7 weeks pi (B) BM5d viral RNA, n=5 for 1w and n=7 for 3 weeks and 7 weeks pi. . Viral RNA levels following infection were compared to uninfected mice. * p<0.1, *** p<0.01
194
Chapter 6
195
6.5 Effect of Vinblastine or anti-CD4 monoclonal antibody
treatment on BM5d viral levels during LP-BM5 infection
The real time PCR and RT PCR methods were established to have a means of
determining whether the successful treatments described in Chapter 4 were
acting directly on the virus itself or affecting disease pathology with altering viral
replication levels. Having established reliable assays for measuring the viral
DNA and RNA levels and showing that the peripheral blood is reflective of the
systemic infection, these assays were then applied to measuring the viral load
in mice treated at day 14 post infection with a single dose of Vinblastine or
anti-CD4 mAb.
The first of these experiments examined BM5d viral RNA levels over a time
course of infection. The efficacy of the treatment was examined by allowing the
mice to progress to 10 weeks pi, at which time the spleens were weighed to
assess disease progression. The results (Figure 6.11A) show that there was a
significant reduction in the spleen weight of mice treated with a single dose of
Vinblastine at day 14 pi (p=0.032). A reduction in spleen weight was also
observed following day 14 pi anti-CD4 mAb treatment, although this reduction
was only significant at the 90% confidence interval (p=0.079). However, it is
important to note that although there was a significant reduction observed in
spleen weight, particularly following Vb treatment, the spleens were still
considerably enlarged compared to previous experiments reported in Chapter 4.
For this reason a second experiment was conducted. This experiment involved
measuring BM5d RNA levels in both the spleen and peripheral blood (plasma)
at 1, 3, 5 and 7 weeks pi. The effect of day 14 pi Vb treatment on the BM5d
viral RNA levels in these organs were also examined at 3, 5 and 7 weeks pi.
Spleen weight was again used to assess disease progression and the efficacy
of treatment (Figure 6.12A). In this experiment significant reductions in spleen
weight were observed in the day 14 Vb treated mice at 3 weeks (p=0.01) and 5
weeks (p=0.01) and to a lesser extent at 7 weeks (p=0.015) post infection. One
possible explanation for the discrepancies between these experiments and
those presented in Chapter 4 is the viral inoculum; experiments examining this
issue are presented in Chapter 6.3.4.3.
Chapter 6
196
6.5.1 Viral DNA
The level of BM5d viral DNA was measured in the peripheral blood of mice
infected with LP-BM5 which received either day 14 pi Vinblastine, day 14 pi
anti-CD4 mAb or were left untreated to provide a control group (Figure 6.11B).
There is no significant difference observed in the amount of BM5d DNA
detected at any of the time points examined following treatment with either
Vinblastine or anti-CD4 mAb.
6.5.2 Viral RNA
In addition to examining the level of viral DNA we were also interested in
whether treatment resulted in a reduction of viral RNA levels. Whilst treatment
will not result in the loss of integrated proviral DNA, a reduction in the level of
viral RNA being produced may be observed. Therefore the level of BM5d viral
RNA was measured in the same mice (Figure 6.11C) and again there was no
significant difference found in the amount of BM5d RNA detected at any of the
time points following treatment with Vinblastine or anti-CD4 mAb.
To determine whether this was due to the lesser effect of the treatments in this
experiment a second experiment was also examined. Reduced levels of BM5d
RNA were observed in both the spleen (Figure 6.12B) and the blood (Figure
6.12C) of Vinblastine-treated mice at 3 and 5 weeks post infection when
compared to non-treated MAIDS controls. With the exception of the reduction
in viral RNA levels observed at 5 weeks pi in the blood (Figure 6.12C) these
differences were not found to be of any statistical significance. Indeed, by week
7 post infection this difference was no longer observed in either tissue despite
there still being a significant difference in the spleen weights of the two groups.
Chapter 6
MAIDS anti-CD4 mAb Vinblastine0.0
0.2
0.4
0.6
0.8
1.0
sple
en w
eigh
t (g)
0 10 20 30 40 50 601.0×10 -18
1.0×10 -17
1.0×10 -16
1.0×10 -15
1.0×10 -14
1.0×10 -13
1.0×10 -12
MAIDSanti-CD4 mAbVinblastine
days pi
prov
iral
DN
A (g
/ µl)
0 10 20 30 40 50 60 70 801.0×10 -18
1.0×10 -17
1.0×10 -16
1.0×10 -15
1.0×10 -14
MAIDSanti-CD4 mAbVinblastine
days pi
vira
l RN
A (g
/ µl)
A
B
C
****
Figure 6.11 The effect of day 14 Vb and anti-CD4 treatment on spleen weight and BM5d viral DNA and RNA levels in peripheral blood A. Spleen weights at 10 weeks pi are shown as mean ± SEM for n=5 mice per group. B. BM5d DNA levels in peripheral blood. Samples were extracted and assayed as described in Chapter 2.2.13.7.1 and 2.2.14.3. Data is shown as mean ± SEM for n=5 mice per group. C. BM5d viral RNA levels in peripheral blood. Samples were prepared as described in Chapter 2.2.15.4.1and 2.2.16.2. Data is shown as mean ± SEM for n=5 mice per group. . Viral RNA levels following infection were compared to uninfected mice. *= p<0.10, *** = p <0.05
197
Chapter 6
0.0
0.1
0.2
0.3
0.4
0.5
MAIDS MAIDS + Vb
1 3 5 7weeks pi
sple
en w
eigh
t (g)
1.0×10 -18
1.0×10 -17
1.0×10 -16
1.0×10 -15
1.0×10 -14
1.0×10 -13
1.0×10 -12
1.0×10 -11
MAIDS MAIDS + Vb
1 3 5 7weeks pi
BM
5d R
NA
(g/ µ
l)
1.0×10 -19
1.0×10 -18
1.0×10 -17
1.0×10 -16
1.0×10 -15
1.0×10 -14
1.0×10 -13
1.0×10 -12
MAIDS MAIDS + Vb
1 3 5 7weeks pi
***
BM
5d R
NA
(g/ µ
l)
A
B
C
Figure 6.12 The effect of day 14 pi Vb on spleen weight and BM5d viral RNA in spleen and peripheral blood at different stages of infection A. Spleen weights at different weeks pi are shown as mean ± SEM for n=3 mice per group. B. BM5d viral RNA levels in spleen. Samples were extracted and assayed as described in Chapter 2.2.13.7.2 and 2.2.14.3. Data shown as pooled samples for n=3 mice per group. C. BM5d viral RNA levels in plasma. Samples extracted and assayed as described in Chapter 2.2.15.4.3 and 2.2.16.2. Data shown as mean ± SEM for n=3 mice per group. Viral RNA levels following infection were compared between infected and infected, Vb treated groups of mice. *** = p <0.05. = MAIDS infected, = MAIDS + day 14 pi Vb treatment.
198
Chapter 6
199
6.5.3 Viral inoculum
The differences observed in the results obtained in the two experiments (with
regards to the success of Vb or anti-CD4 mAb treatment) described above and
those reported in Chapter 4 raises the issue of the size of the viral inoculum and
subsequent disease progression. As several different virus stock preparations
were used throughout the course of this PhD project it was of interest to
determine whether viral inoculum may account for the difference observed in
the efficacy of day 14 post infection treatments in the different experiments.
In order to address this issue, two separate experiments were conducted to
examine the effect of differing viral inocula on disease progression. The first
experiment was designed as a time course measuring viral DNA levels in two
groups of mice infected with either 100µl or 200µl of LP-BM5. BM5d DNA in
peripheral blood was monitored by real time PCR (Figure 6.13A). The amount
of BM5d DNA was found to increase more rapidly in the 3 weeks of infection in
mice inoculated with 200µl of LP-BM5. However from 3 weeks pi onwards
BM5d DNA levels in peripheral blood were found to be the same in both groups
of mice, regardless of viral inoculum.
A further experiment investigated the effect of viral inoculum size on disease
progression as measured by 10 week pi spleen weight. Groups of mice were
inoculated with either 25, 50 100 or 200µl of LP-BM5 and allowed to progress to
10 weeks pi, at which point mice were sacrificed and spleen weights measured.
The results of this experiment (shown in Figure 6.13B) indicate that the size of
the viral inoculum had no significant effect on disease progression, all groups of
mice developed splenomegaly. These results show that viral inoculum does not
appear to be an important factor in the later stages of disease, with all mice
developing similar levels of splenomegaly and showing no difference in the
amount of BM5d DNA. However inoculum size does appear to be important in
the early stages of disease progression; the mice infected with a higher dose of
virus appeared to develop disease at a slightly faster rate than those receiving a
lower inoculum. This difference may be enough to account for the different
results observed between the experiments in this chapter and Chapter 4.
Chapter 6
0 10 20 30 40 50 601.0×10-18
1.0×10-17
1.0×10-16
1.0×10-15
1.0×10-14
1.0×10-13
1.0×10-12
200µl LP-BM5100µl LP-BM5
A
days pi
BM
5d v
iral
DN
A (g
/ µl)
25 50 100 2000.0
0.2
0.4
0.6
0.8
1.0B
LP-BM5 viral inoculum (µl)
sple
en w
eigh
t (g)
Figure 6.13 Effect of viral inoculum size on disease progression A. BM5d DNA levels in peripheral blood. Samples were extracted and assayed as described in Chapter 2.2.13.7.1 and 2.2.14.3. Data is shown as mean ± SEM for n=5 mice per group. B. Spleen weights at 10 weeks pi are shown as mean ± SEM for n=5 mice per group.
200
Chapter 6
201
6.6 Discussion
This chapter describes the development of a real time PCR assay which allows
for the specific amplification and quantitation of BM5d and BM5e viral DNA. To
date the PCR assays which examine LP-BM5 require the product to be run on
an agarose gel before specificity or quantity are determined by product size
(Desforges, et al., 1996; Green, et al., 1996; Ogata, et al., 1993; Yu, et al.,
1999), a specific probe (Casabianca, et al., 2003; Casabianca, et al., 1998;
Fraternale, et al., 2002; Fraternale, et al., 1996; Fraternale, et al., 2001;
Fraternale, et al., 2000; Gazzinelli, et al., 1994; Magnani, et al., 1997) or by
chromatography (Hulier, et al., 1996). The use of real time technology allows
for the highly accurate quantitation of both BM5d and BM5e in tissues such as
blood and spleen at any time post infection without the need for agarose gel
electrophoresis. The analysis of PCR product melting temperature profiles also
enables the identification of any non-specific PCR products that may have been
generated. In addition, this chapter described the development of a real time
RT PCR assay which is also highly sensitive and utilises an RNA standard to
control for variations in RT efficiency and RNA stability, unlike the previously
described RT PCR assays (Casabianca, et al., 2003; Cook, et al., 2003). The
reaction is a one-step RT PCR requiring no post-PCR detection methodology,
thereby reducing the risk of carry over and contamination. In addition, both the
real time PCR and RT PCR assays have been developed to have the same
cycling conditions for BM5d and BM5e, allowing for the simultaneous analysis
of both viruses.
In infected mice the level of BM5d viral DNA in peripheral blood was found to
increase rapidly in the first 4 weeks pi and then plateau until the end point of the
experiment, a trend also observed in the spleen. This suggests that in the later
stages of infection viral levels are maintained in the host until death. The same
pattern was observed for BM5e in both blood and spleen. The results obtained
for BM5d and BM5e are consistent with those reported in an earlier study of a
limited time course of BM5d and BM5e DNA (Casabianca, et al., 1998;
Pozsgay, et al., 1993b). BM5e DNA was found to be present at higher levels
than BM5d DNA in both the blood and spleen of infected mice. This is not a
surprising result as BM5e is a replication competent virus and would
presumably replicate at a faster rate than BM5d, and would subsequently
Chapter 6
202
integrate more frequently. It is also interesting to note that BM5e has a higher
basal level in blood than BM5d. This low level of BM5e DNA and RNA detected
in the blood and spleen of naïve mice may be due to the amplification of
endogenous retroviral sequences.
The rapid increase in the amount of viral RNA present in the plasma of infected
mice observed in the first 4 weeks pi correlates well with the increase in the
amount of DNA for both BM5d and BM5e. This is again consistent with
previous results (Casabianca, et al., 1998; Pozsgay, et al., 1993a). The levels
of BM5e in both sample types were found to be higher than BM5d, a result that
is in contrast to the study conducted by Cook (Cook, et al., 2003) who describe
higher levels of BM5d than BM5e. Interestingly, the levels of defective virus
found in blood and spleen are equivalent between the two studies. These
contrasting results could be attributed to a number of differences between the
assay described in this chapter and that of Cook (Cook, et al., 2003), including
differing extraction techniques, single vs. two-step real time RT PCR assays
with different amplification conditions, the use of an RNA as opposed to a DNA
standard and even the initial inoculum of virus and the method of viral
preparation. Any of these factors alone or in combination could help to explain
the observed differences in the levels of BM5e. However, the results described
in this chapter suggest a biological explanation for these observations, which is
that the replication competent BM5e first begins to replicate itself before
providing help for BM5d. This is the opposite conclusion that was reached by
Cook (Cook, et al., 2003) who, from their observations, in fact go on to
speculate that enhanced BM5e replication may in some way contribute to
resistance to MAIDS. These results certainly suggest that more research is
required to clarify and further understand the complex relationship between
BM5d and the helper viruses present in the LP-BM5 retroviral mixture.
The real time PCR and RT PCR assays were also used to examine how
accurately peripheral blood reflects the events taking place in the spleen during
LP-BM5 infection. The spleen is the organ most often used to assess/measure
disease progression and therefore, presumptively, the effect of treatments on
splenomegaly as a measure of the disease progression. Being able to easily
monitor disease without having to sacrifice mice would be of considerable
Chapter 6
203
benefit. It was found that, particularly in the case of viral DNA, the levels found
in blood are highly reflective of the levels found in the spleen. The viral RNA
levels, while not as elevated as those found in the spleen, are still significantly
elevated compared to uninfected mice. The levels of both BM5d DNA and RNA
in the blood were also found to correlate well with the presence of
splenomegaly at the end point of the experiments conducted. This indicates
that both assays are useful as a diagnostic assay to determine the infection
status of mice. Indeed, BM5d DNA levels measured by real time PCR can be
used to diagnose the infection status of mice as early as 2-3 weeks pi.
Having established that both assays could be used to accurately monitor
infection, the assays were then applied to the analysis of the effect of day 14
post infection Vinblastine or anti-CD4 mAb treatment on BM5d DNA and RNA
levels in order to give an accurate measure of the impact of treatment on the
virus. This information was crucial in determining whether the treatments have
been effective due to direct anti-viral effects or effects on disease pathology. In
two independent experiments neither day 14 pi Vinblastine or anti-CD4 mAb
treatment was found to have any sustained statistically significant effect on the
levels of BM5d DNA or RNA in either the peripheral blood or the spleen.
In the first experiment this may have been partly due to the treated animals still
developing splenomegaly (Figure 5.11A), suggesting that the treatments were
not completely effective in halting disease progression. However, it is
interesting to note that despite the significant reduction in spleen weight there is
no difference observed in the level of viral DNA or RNA in the different groups.
If there were a direct anti-viral effect a marked decrease in the viral levels would
have been expected immediately after treatment. The results of the second
experiment concur with the first experiment. This experiment shows even more
clearly that despite the Vinblastine treatment resulting in a significant reduction
in spleen weight there is little difference in the viral load in the spleens of the
treated and untreated mice at 3 weeks pi (Figure 5.12 A and B). This difference
in viral load is further reduced by 5 weeks pi and by 7 weeks pi the viral load in
the treated and untreated spleens is almost identical even though the spleen
weights remain significantly different. This same pattern is also observed in the
peripheral blood where the difference between the treated and untreated groups
Chapter 6
204
is negligible (although statistically significant) by 5 weeks pi. The data
examining the effect of day 14 post infection Vinblastine or anti-CD4 mAb
treatment on the BM5d virus indicate that neither treatment has a direct antiviral
effect.
This indicates that the results being observed are due to effects on the disease
pathology, possibly due to interruption of a crucial event or interaction required
for the development of further disease pathology. Data presented in previous
chapters indicates that this signal may be from Tr cells which are induced by
BM5d. The lack of splenomegaly and other characteristic MAIDS symptoms
following treatment, together with the lack of change in the pattern of viral DNA
and RNA levels, certainly suggest that this may be occurring. The interruption
of a crucial signalling event or cellular interaction could result in a delay in
disease pathology, however, for the increasing viral load not to result in these
events taking place at a later stage in the infection, a level of immunological
control must certainly also be exerted by the host cells. Interestingly, an
increase in the viral inoculum results in a loss of efficacy of both Vb and
anti-CD4 treatment, suggesting that a larger amount of virus is able to
overpower these effects. This can be observed in the data presented in this
thesis, as earlier viral stocks used in the Vinblastine and anti-CD4 mAb
treatments shown in Chapter 4 had more dramatic effects in reducing
splenomegaly than the experiments in this chapter. The later viral stocks used
in this study were shown to be highly virulent (Figure 6.13B), resulting in larger
spleens than observed in early experiments (Chapter 4). The viral titration
experiment shown in Figure 6.13 only titrated down to 25µl, a volume which was
still not small enough to fully assess this effect. A further extension of this work
that should also be examined is the effect of titrating the viral inoculum relative
to the efficacy of day 14 Vb or anti-CD4 mAb treatment to determine whether
there is indeed a viral load threshold at which the therapies lose their efficacy as
is suggested by the results presented in this chapter.
The BM5d DNA and RNA time courses presented in this chapter and the
analysis of Vb treated mice show that despite an increase in the levels of viral
nucleic acid there is a lack of other disease symptoms following treatment. This
suggests that BM5d does not cause serious disease without the induction of
Chapter 6
205
immunosuppression. Removal of the immunosuppression instead results in an
infection that more closely resembles an ecotropic viral infection, which has
previously been shown not to induce overt disease in mice (Chattopadhyay, et
al., 1991; Morse, et al., 1992). Instead BM5e is included as a helper virus to
allow for better BM5d viral replication and faster disease progression
(Chattopadhyay, et al., 1991; Morse, et al., 1992). BM5d alone is still capable
of causing disease in mice, but disease progression was found to be delayed
due to the lack of virus-encoded replicative genes, requiring BM5d to rely on
interactions with endogenous retroviruses (Hugin, et al., 1991; Pozsgay, et al.,
1993a).
An alternate hypothesis for the observed results is the development of an
attenuated strain of BM5d in response to treatment. This would account for the
same observations of a loss of disease pathology with no significant change in
the viral load. It is possible that this attenuated strain would be less
immunogenic, and as the viral load increases would result in the induction of
less cytokines (IL-4, IL-10 and TGF-β) than the original virus. This, in
conjunction with the CD4+ T cell ablation shown in Chapter 4, could result in a
limiting of the splenic cytokine production required for the later Th2 cytokine
switch that results in the B cell proliferation which occurs from the fourth week
of infection (Gazzinelli et al., 1992). The manipulation of Th2 cytokine levels
has previously been shown to have an impact on disease progression (Wang et
al., 1994). Further experiments would be required to determine if this
hypothesis offers a viable alternative, or even complimentary, explanation to the
evidence that has been presented in this thesis for the involvement of Tr cells in
this complex disease.
One of the major questions raised during the course of this investigation is the
mechanism by which Tr cells are induced following LP-BM5 infection. The data
presented in this thesis go some way towards answering this question. The
data presented in Chapter 5 suggests that the Tr cells involved in MAIDS
progression are antigen specific and appear to lose CD25 expression as
disease progresses. Naturally occurring CD4+CD25+ Tr cells appear to provide
the precursors for these cells, which develop into antigen specific Tr cells in the
periphery. Another possible interpretation is the induction of secondary Thsupp
Chapter 6
206
cells from CD4+CD25- T cells in the periphery as described in Chapter 1.3.3.
This would help to explain the observation that pre-depletion with anti-CD25
mAb had no effect on disease development, as the critical Tr cells are found in
the CD25- compartment at this time. Tr cells may also be induced by
tolerogenic DC (tol DC) in the periphery and peripheral lymphatic tissues
following infection. Tol DC have been postulated to induce Tr cells in a TCR
specific manner and antigen presentation coupled with the cytokine milieu may
govern Tr cell induction. Certainly these two mechanisms are not mutually
exclusive and further research may even demonstrate that the two are linked in
some situations.
Tr cells are now being shown to be involved in an ever growing catalogue of
infectious diseases (Mills, 2004; Mills and McGuirk, 2004; Rouse, 2004). Tr
induction results in relationships which generally benefit the pathogen, but
occasionally can help to maintain a balance which is beneficial to both the
pathogen and host, as is seen in leischmaniasis (Belkaid, et al., 2003; Belkaid,
et al., 2002). Inroads are also being made in identifying the mechanisms by
which Tr cells are generated (Groux, 2003; Mills, 2004) and advances in
technology are allowing for the identification of new, and potentially more
specific, Tr cell surface markers such as neuropilin 1 (Bruder, et al., 2004) and
LAG-3 (Huang, et al., 2004). Tr cells have rapidly become recognised as one of
the most important mechanisms in controlling the balance of the immune
response between host and pathogen.
The data presented in this chapter gives some insight into the role that Tr cells
may play in MAIDS progression. The induced Tr cells would not be present
immediately but would take some time to develop following infection (evidence
of this is the in vivo CTL assay presented in Chapter 5). The results presented
in Chapter 4 indicate an event crucial for MAIDS progression takes place at day
14 pi and that this event is CD4+ T cell dependent. In Chapter 3 it was shown
that there is a peak in the production of Tr-associated cytokines at day 16 pi and
this is likely to be involved in the induction of immunosuppression. Treatment
with Vb or anti-CD4 mAb at day 14 pi would significantly interrupt this event (as
well as other cell-to-cell contact mediated events taking place at this time),
resulting in a loss of this signal and therefore a lack of development of the
Chapter 6
207
resultant Tr cell-mediated suppression. Murine AIDS is a complex disease as
illustrated by the requirement for B cells (Cerny et al., 1990), T cells (Mosier et
al., 1987; Giese et al., 1994) and the interactions that these cells have including
CD40-CD154 interactions (Green, et al., 1996; Green, et al., 2001; Green, et
al., 1998). The data presented in this thesis clearly demonstrate the induction
of a population of antigen specific CD4+ Tr cells. The induction of Tr cells may
be a phenomenon of infection or a mechanism used by BM5d to manipulate the
immune response. Further detailed characterisation of these cells in terms of
the events leading to their induction, development and mechanism of action are
required. This is particularly relevant as CD4+CD25+ Tr cells are now being
described in the peripheral blood of HIV+ individuals (Aandahl, et al., 2004;
Kinter, et al., 2004; Weiss, et al., 2004). The ability to specifically manipulate Tr
cells in vivo in an animal model of AIDS, albeit it a somewhat imperfect one, will
provide valuable information about the mechanisms of induction, suppression
and therapeutic treatments that may potentially be of use against HIV/AIDS.
Chapter 7:
References
Chapter 7
Aandahl, EM, Michaelsson, J, Moretto, WJ, Hecht, FM and Nixon, DF. Human CD4+ CD25+ regulatory T cells control T-cell responses to human immunodeficiency virus and cytomegalovirus antigens. J Virol 2004;78:2454-2459
Adams, VC, Hunt, JR, Martinelli, R, Palmer, R, Rook, GA and Brunet, LR. Mycobacterium vaccae induces a population of pulmonary CD11c+ cells with regulatory potential in allergic mice. Eur J Immunol 2004;34:631-638
Adorini, L, Penna, G, Casorati, M, Davalli, AM and Gregori, S. Induction of transplantation tolerance by 1,25-dihydroxyvitamin D(3). Transplant Proc 2001;33:58-59
Akarid, K, Pocidalo, MA, Desforges, B and Sinet, M. Kinetics of ex-vivo cytokine production by splenocytes during murine acquired immunodeficiency syndrome (MAIDS). European Cytokine Network 1995;6:181-185
Akbar, AN, Taams, LS, Salmon, M and Vukmanovic-Stejic, M. The peripheral generation of CD4+ CD25+ regulatory T cells. Immunology 2003;109:319-325
Akbar, AN, Terry, L, Timms, A, Beverley, PC and Janossy, G. Loss of CD45R and gain of UCHL1 reactivity is a feature of primed T cells. J Immunol 1988;140:2171-2178
Akbari, O, DeKruyff, RH and Umetsu, DT. Pulmonary dendritic cells producing IL-10 mediate tolerance induced by respiratory exposure to antigen. Nat Immunol 2001;2:725-731
Akbari, O, Freeman, GJ, Meyer, EH, Greenfield, EA, Chang, TT, Sharpe, AH, Berry, G, DeKruyff, RH and Umetsu, DT. Antigen-specific regulatory T cells develop via the ICOS-ICOS-ligand pathway and inhibit allergen-induced airway hyperreactivity. Nat Med 2002;8:1024-1032
Akbari, O, Stock, P, DeKruyff, RH and Umetsu, DT. Role of regulatory T cells in allergy and asthma. Curr Opin Immunol 2003;15:627-633
Akdis, CA and Blaser, K. Mechanisms of interleukin-10-mediated immune suppression. Immunology 2001;103:131-136
Alegre, ML, Noel, PJ, Eisfelder, BJ, Chuang, E, Clark, MR, Reiner, SL and Thompson, CB. Regulation of surface and intracellular expression of CTLA4 on mouse T cells. J Immunol 1996;157:4762-4770
Allez, M, Brimnes, J, Dotan, I and Mayer, L. Expansion of CD8+ T cells with regulatory function after interaction with intestinal epithelial cells. Gastroenterology 2002;123:1516-1526
Allez, M and Mayer, L. Regulatory T cells: peace keepers in the gut. Inflamm Bowel Dis 2004;10:666-676
Annacker, O and Powrie, F. Homeostasis of intestinal immune regulation. Microbes Infect 2002;4:567-574
Antony, PA and Restifo, NP. Do CD4+ CD25+ immunoregulatory T cells hinder tumor immunotherapy? J Immunother 2002;25:202-206
Asano, M, Toda, M, Sakaguchi, N and Sakaguchi, S. Autoimmune disease as a consequence of developmental abnormality of a T cell subpopulation. J Exp Med 1996;184:387-396
Aseffa, A, Gumy, A, Launois, P, MacDonald, HR, Louis, JA and Tacchini-Cottier, F. The early IL-4 response to Leishmania major and the resulting Th2 cell maturation steering progressive disease in BALB/c mice are subject to the control of regulatory CD4+CD25+ T cells. J Immunol 2002;169:3232-3241
208
Chapter 7
Asseman, C, Mauze, S, Leach, MW, Coffman, RL and Powrie, F. An essential role for interleukin 10 in the function of regulatory T cells that inhibit intestinal inflammation. Journal of Experimental Medicine 1999;190:995-1004
Aziz, DC, Hanna, Z and Jolicoeur, P. Severe immunodeficiency disease induced by a defective murine leukaemia virus. Nature 1989;338:505-508
Baecher-Allan, C, Brown, JA, Freeman, GJ and Hafler, DA. CD4+CD25high regulatory cells in human peripheral blood. J Immunol 2001;167:1245-1253
Baecher-Allan, C, Brown, JA, Freeman, GJ and Hafler, DA. CD4+CD25+ regulatory cells from human peripheral blood express very high levels of CD25 ex vivo. Novartis Found Symp 2003;252:67-88; discussion 88-91, 106-114
Baecher-Allan, C and Hafler, DA. Suppressor T cells in human diseases. J Exp Med 2004b;200:273-276
Baecher-Allan, C, Viglietta, V and Hafler, DA. Human CD4+CD25+ regulatory T cells. Semin Immunol 2004a;16:89-98
Banchereau, J and Steinman, RM. Dendritic cells and the control of immunity. Nature 1998;392:245-252
Banyer, JL, Hamilton, NH, Ramshaw, IA and Ramsay, AJ. Cytokines in innate and adaptive immunity. Rev Immunogenet 2000;2:359-373
Belkaid, Y. The role of CD4(+)CD25(+) regulatory T cells in Leishmania infection. Expert Opin Biol Ther 2003;3:875-885
Belkaid, Y, Piccirillo, CA, Mendez, S, Shevach, EM and Sacks, DL. CD4+CD25+ regulatory T cells control Leishmania major persistence and immunity. Nature 2002;420:502-507
Bell, EB, Sparshott, SM and Bunce, C. CD4+ T-cell memory, CD45R subsets and the persistence of antigen--a unifying concept. Immunol Today 1998;19:60-64
Blanchard, TG, Eisenberg, JC and Matsumoto, Y. Clearance of Helicobacter pylori infection through immunization: the site of T cell activation contributes to vaccine efficacy. Vaccine 2004;22:888-897
Bluestone, JA and Abbas, AK. Natural versus adaptive regulatory T cells. Nat Rev Immunol 2003;3:253-257 Brady, MT, MacDonald, AJ, Rowan, AG and Mills, KH. Hepatitis C virus non-structural protein 4 suppresses Th1 responses by stimulating IL-10 production from monocytes. Eur J Immunol. 2003;33:3448-3457 Brandi, G, Carnevali, A, Rossi, L, Fraternale, A, Schiavano, GF and Magnani, M. Effect of antiviral treatments on the bone marrow in murine aids. Blood Cells, Molecules, & Diseases 1995;21:109-118 Brandi, G, Casabianca, A, Schiavana, GF, Rossi, L, Fraternale, A, Albano, A and Magnani, M. Efficacy and toxicity of lont-term administration of 2`,3`-dideoxycytidine in the LP-BM5 murine-induced immunodeficiency model. Antiviral Chemistry and Chemotherapy 1995;6:153-161 Bruder, D, Probst-Kepper, M, Westendorf, AM, Geffers, R, Beissert, S, Loser, K, von Boehmer, H, Buer, J and Hansen, W. Neuropilin-1: a surface marker of regulatory T cells. Eur J Immunol 2004;34:623-630
Brunet, JF, Denizot, F, Luciani, MF, Roux-Dosseto, M, Suzan, M, Mattei, MG and Golstein, P. A new member of the immunoglobulin superfamily--CTLA-4. Nature 1987;328:267-270
209
Chapter 7
Casabianca, A and Magnani, M. A p12 gag gene homologue is present in the mouse genome. Biochemistry & Molecular Biology International. 1994;32:691-696 Casabianca, A, Orlandi, C, Fraternale, A and Magnani, M. A new one-step RT-PCR method for virus quantitation in murine AIDS. J Virol Methods 2003;110:81-90 Cepek, KL, Shaw, SK, Parker, CM, Russell, GJ, Morrow, JS, Rimm, DL and Brenner, MB. Adhesion between epithelial cells and T lymphocytes mediated by E-cadherin and the alpha E beta 7 integrin. Nature 1994;372:190-193 Cerny, A, Hugin, AW, Hardy, RR, Hayakawa, K, Zinkernagel, RM, Makino, M and Morse, HCd. B cells are required for induction of T cell abnormalities in a murine retrovirus-induced immunodeficiency syndrome. Journal of Experimental Medicine 1990;171:315-320 Cerny, A, Merino, R, Makino, M, Waldvogel, FA, Morse, HCd and Izui, S. Protective effect of cyclosporin A on immune abnormalities observed in the murine acquired immunodeficiency syndrome. European Journal of Immunology 1991;21:1747-1750 Charlton, B, Bacelj, A, Slattery, RM and Mandel, TE. Cyclophosphamide-induced diabetes in NOD/WEHI mice. Evidence for suppression in spontaneous autoimmune diabetes mellitus. Diabetes 1989;38:441-447 Chatenoud, L, Salomon, B and Bluestone, JA. Suppressor T cells--they're back and critical for regulation of autoimmunity! Immunol Rev 2001;182:149-163 Chattopadhyay, SK, Lander, MR, Rands, E and Lowy, DR. Structure of endogenous murine leukemia virus DNA in mouse genomes. Proceedings of the National Academy of Sciences of the United States of America 1980;77:5774-5778 Chattopadhyay, SK, Sengupta, DN, Fredrickson, TN, Morse, HCd and Hartley, JW. Characteristics and contributions of defective, ecotropic, and mink cell focus-inducing viruses involved in a retrovirus-induced immunodeficiency syndrome of mice. Journal of Virology 1991;65:4232-4241 Chen, W, Jin, W, Hardegen, N, Lei, KJ, Li, L, Marinos, N, McGrady, G and Wahl, SM. Conversion of peripheral CD4+CD25- naive T cells to CD4+CD25+ regulatory T cells by TGF-beta induction of transcription factor Foxp3. J Exp Med 2003;198:1875-1886 Chen, W, Jin, W and Wahl, SM. Engagement of cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) induces transforming growth factor beta (TGF-beta) production by murine CD4(+) T cells. J Exp Med 1998;188:1849-1857 Chen, W and Wahl, SM. TGF-beta: the missing link in CD4+CD25+ regulatory T cell-mediated immunosuppression. Cytokine Growth Factor Rev 2003;14:85-89 Chen, Y, Chou, K, Fuchs, E, Havran, WL and Boismenu, R. Protection of the intestinal mucosa by intraepithelial gamma delta T cells. Proc Natl Acad Sci U S A 2002;99:14338-14343 Chen, Y, Inobe, J and Weiner, HL. Induction of oral tolerance to myelin basic protein in CD8-depleted mice: both CD4+ and CD8+ cells mediate active suppression. J Immunol 1995;155:910-916 Chen, Y, Kuchroo, VK, Inobe, J, Hafler, DA and Weiner, HL. Regulatory T cell clones induced by oral tolerance: suppression of autoimmune encephalomyelitis. Science 1994;265:1237-1240 Cheung, SC, Chattopadhyay, SK, Hartley, JW, Morse, HCd and Pitha, PM. Aberrant expression of cytokine genes in peritoneal macrophages from mice infected with LP-BM5 MuLV, a murine model of AIDS. Journal of Immunology 1991;146:121-127 Chin, D, Boyle, GM, Parsons, PG and Coman, WB. What is transforming growth factor-beta (TGF-beta)? Br J Plast Surg 2004;57:215-221
210
Chapter 7
Cobbold, SP, Jayasuriya, A, Nash, A, Prospero, TD and Waldmann, H. Therapy with monoclonal antibodies by elimination of T-cell subsets in vivo. Nature 1984;312:548-551
Cohen, DA, Fitzpatrick, EA, Barve, SS, Guthridge, JM, Jacob, RJ, Simmerman, L and Kaplan, AM. Activation-dependent apoptosis in CD4+ T cells during murine AIDS. Cellular Immunology 1993;151:392-403
Cohen, JL, Trenado, A, Vasey, D, Klatzmann, D and Salomon, BL. CD4(+)CD25(+) immunoregulatory T Cells: new therapeutics for graft-versus-host disease. J Exp Med 2002;196:401-406
Cong, Y, Weaver, CT, Lazenby, A and Elson, CO. Bacterial-reactive T regulatory cells inhibit pathogenic immune responses to the enteric flora. J Immunol 2002;169:6112-6119
Cook, WJ, Green, KA, Obar, JJ and Green, WR. Quantitative analysis of LP-BM5 murine leukemia retrovirus RNA using real-time RT-PCR. J Virol Methods 2003;108:49-58
Curiel, TJ, Coukos, G, Zou, L, Alvarez, X, Cheng, P, Mottram, P, Evdemon-Hogan, M, Conejo-Garcia, JR, Zhang, L, Burow, M, Zhu, Y, Wei, S, Kryczek, I, Daniel, B, Gordon, A, Myers, L, Lackner, A, Disis, ML, Knutson, KL, Chen, L and Zou, W. Specific recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege and predicts reduced survival. Nat Med 2004;10:942-949
Dieckmann, D, Bruett, CH, Ploettner, H, Lutz, MB and Schuler, G. Human CD4(+)CD25(+) regulatory, contact-dependent T cells induce interleukin 10-producing, contact-independent type 1-like regulatory T cells [corrected]. J Exp Med 2002;196:247-253
Dieckmann, D, Plottner, H, Berchtold, S, Berger, T and Schuler, G. Ex vivo isolation and characterization of CD4(+)CD25(+) T cells with regulatory properties from human blood. J Exp Med 2001;193:1303-1310
Dittmer, U, Brooks, DM and Hasenkrug, KJ. Characterization of a live-attenuated retroviral vaccine demonstrates protection via immune mechanisms. J Virol 1998;72:6554-6558
Dittmer, U, Race, B and Hasenkrug, KJ. Kinetics of the development of protective immunity in mice vaccinated with a live attenuated retrovirus. J Virol 1999;73:8435-8440
Donaldson, LA, Cheng, R, Savage, SM and Sopori, ML. Characteristics of CD4+ T cells which transfer murine AIDS (MAIDS). Cellular Immunology 1994;156:468-479
Doyon, L, Simard, C, Sekaly, RP and Jolicoeur, P. Evidence that the murine AIDS defective virus does not encode a superantigen. Journal of Virology 1996;70:1-9
Durai, M, Gupta, RS and Moudgil, KD. The T cells specific for the carboxyl-terminal determinants of self (rat) heat-shock protein 65 escape tolerance induction and are involved in regulation of autoimmune arthritis. J Immunol 2004;172:2795-2802
Dzionek, A, Inagaki, Y, Okawa, K, Nagafune, J, Rock, J, Sohma, Y, Winkels, G, Zysk, M, Yamaguchi, Y and Schmitz, J. Plasmacytoid dendritic cells: from specific surface markers to specific cellular functions. Hum Immunol 2002;63:1133-1148
Egen, JG, Kuhns, MS and Allison, JP. CTLA-4: new insights into its biological function and use in tumor immunotherapy. Nat Immunol 2002;3:611-618
Ellery, JM and Nicholls, PJ. Possible mechanism for the alpha subunit of the interleukin-2 receptor (CD25) to influence interleukin-2 receptor signal transduction. Immunol Cell Biol 2002;80:351-357
Erdman, SE, Rao, VP, Poutahidis, T, Ihrig, MM, Ge, Z, Feng, Y, Tomczak, M, Rogers, AB, Horwitz, BH and Fox, JG. CD4(+)CD25(+) regulatory lymphocytes require interleukin 10 to interrupt colon carcinogenesis in mice. Cancer Res 2003;63:6042-6050
211
Chapter 7
Esplugues, E, Sancho, D, Vega-Ramos, J, Martinez, C, Syrbe, U, Hamann, A, Engel, P, Sanchez-Madrid, F and Lauzurica, P. Enhanced antitumor immunity in mice deficient in CD69. J Exp Med 2003;197:1093-1106
Fantini, MC, Becker, C, Monteleone, G, Pallone, F, Galle, PR and Neurath, MF. Cutting edge: TGF-beta induces a regulatory phenotype in CD4+CD25- T cells through Foxp3 induction and down-regulation of Smad7. J Immunol 2004;172:5149-5153
Fickenscher, H, Hor, S, Kupers, H, Knappe, A, Wittmann, S and Sticht, H. The interleukin-10 family of cytokines. Trends Immunol 2002;23:89-96
Filaci, G, Bacilieri, S, Fravega, M, Monetti, M, Contini, P, Ghio, M, Setti, M, Puppo, F and Indiveri, F. Impairment of CD8+ T suppressor cell function in patients with active systemic lupus erythematosus. J Immunol 2001;166:6452-6457
Filaci, G and Suciu-Foca, N. CD8+ T suppressor cells are back to the game: are they players in autoimmunity? Autoimmun Rev 2002;1:279-283
Fiorentino, DF, Zlotnik, A, Vieira, P, Mosmann, TR, Howard, M, Moore, KW and O'Garra, A. IL-10 acts on the antigen-presenting cell to inhibit cytokine production by Th1 cells. J Immunol 1991;146:3444-3451
Fitzpatrick, EA, Kaplan, AM and Cohen, DA. Defective CD4+ T cell signaling in murine AIDS: uncoupling of the T cell receptor complex from PIP2 hydrolysis. Cellular Immunology 1996;167:176-187
Fontenot, JD, Gavin, MA and Rudensky, AY. Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat Immunol 2003;4:330-336
Fraternale, A, Casabianca, A, Orlandi, C, Chiarantini, L, Brandi, G, Silvestri, G and Magnani, M. Repeated cycles of alternate administration of fludarabine and Zidovudine plus Didanosine inhibits murine AIDS and reduces proviral DNA content in lymph nodes to undetectable levels. Virology 2002;302:354-362
Fraternale, A, Casabianca, A, Rossi, L, Chiarantini, L, Brandi, G, Aluigi, G, Schiavano, GF and Magnani, M. Inhibition of murine AIDS by combination of AZT and dideoxycytidine 5'-triphosphate. JAIDS: Journal of Acquired Immune Deficiency Syndromes 1996;12:164-173
Fraternale, A, Casabianca, A, Tonelli, A, Chiarantini, L, Brandi, G and Magnani, M. New drug combinations for the treatment of murine AIDS and macrophage protection. European Journal of Clinical Investigation 2001;31:248-252
Fraternale, A, Tonelli, A, Casabianca, A, Chiarantini, L, Schiavano, GF, Celeste, AG and Magnani, M. New treatment protocol including lympholytic and antiretroviral drugs to inhibit murine AIDS. Journal of Acquired Immune Deficiency Syndromes 2000;23:107-113
Fraternale, A, Tonelli, A, Casabianca, A, Vallanti, G, Chiarantini, L, Schiavano, GF, Benatti, U, De Flora, A and Magnani, M. Role of macrophage protection in the development of murine AIDS. Journal of Acquired Immune Deficiency Syndromes 1999;21:81-89
Fu, S, Yopp, AC, Mao, X, Chen, D, Zhang, N, Mao, M, Ding, Y and Bromberg, JS. CD4+ CD25+ CD62+ T-regulatory cell subset has optimal suppressive and proliferative potential. Am J Transplant 2004;4:65-78
Furtado, GC, Olivares-Villagomez, D, Curotto de Lafaille, MA, Wensky, AK, Latkowski, JA and Lafaille, JJ. Regulatory T cells in spontaneous autoimmune encephalomyelitis. Immunol Rev 2001;182:122-134
Fuss, IJ, Boirivant, M, Lacy, B and Strober, W. The interrelated roles of TGF-beta and IL-10 in the regulation of experimental colitis. J Immunol 2002;168:900-908
212
Chapter 7
Gallatin, WM, Weissman, IL and Butcher, EC. A cell-surface molecule involved in organ-specific homing of lymphocytes. Nature 1983;304:30-34
Gallicchio, VS, Tse, KF, Morrow, J and Hughes, NK. Suppression of hematopoietic support function is associated with overexpression of interleukin-4 and transforming growth factor-beta 1 in LP-BM5 murine-leukemia-virus-infected stromal cell lines. Acta Haematologica 1996;95:204-212
Gangemi, JD, Cozens, RM, De Clercq, E, Balzarini, J and Hochkeppel, HK. 9-(2-Phosphonylmethoxyethyl)adenine in the treatment of murine acquired immunodeficiency disease and opportunistic herpes simplex virus infections. Antimicrobial Agents & Chemotherapy 1989;33:1864-1868
Gavin, MA, Clarke, SR, Negrou, E, Gallegos, A and Rudensky, A. Homeostasis and anergy of CD4(+)CD25(+) suppressor T cells in vivo. Nat Immunol 2002;3:33-41
Gazzinelli, RT, Giese, NA and Morse, HCr. In vivo treatment with interleukin 12 protects mice from immune abnormalities observed during murine acquired immunodeficiency syndrome (MAIDS). Journal of Experimental Medicine 1994;180:2199-2208
Gazzinelli, RT, Makino, M, Chattopadhyay, SK, Snapper, CM, Sher, A, Hugin, AW and Morse, HCd. CD4+ subset regulation in viral infection. Preferential activation of Th2 cells during progression of retrovirus-induced immunodeficiency in mice. Journal of Immunology 1992;148:182-188
Geijtenbeek, TB, Van Vliet, SJ, Koppel, EA, Sanchez-Hernandez, M, Vandenbroucke-Grauls, CM, Appelmelk, B and Van Kooyk, Y. Mycobacteria target DC-SIGN to suppress dendritic cell function. J Exp Med 2003;197:7-17
Gershon, RK and Kondo, K. Cell interactions in the induction of tolerance: the role of thymic lymphocytes. Immunology 1970;18:723-737
Gershon, RK and Kondo, K. Infectious immunological tolerance. Immunology 1971;21:903-914
Giese, NA, Gazzinelli, RT, Morawetz, RA and Morse, HCd. Role of IL12 in MAIDS. Research in Immunology 1995;146:600-605
Giese, NA, Giese, T and Morse, HCr. Murine AIDS is an antigen-driven disease: requirements for major histocompatibility complex class II expression and CD4+ T cells. Journal of Virology 1994;68:5819-5824
Gilmore, GL. Recovery from retrovirus-induced immune suppression in BDP/J mice: dominance of the "regressor' phenotype. Immunology 1997;90:7-13
Gorelik, L, Constant, S and Flavell, RA. Mechanism of transforming growth factor beta-induced inhibition of T helper type 1 differentiation. J Exp Med 2002;195:1499-1505
Gorelik, L and Flavell, RA. Transforming growth factor-beta in T-cell biology. Nat Rev Immunol 2002;2:46-53
Grdic, D, Hornquist, E, Kjerrulf, M and Lycke, NY. Lack of local suppression in orally tolerant CD8-deficient mice reveals a critical regulatory role of CD8+ T cells in the normal gut mucosa. J Immunol 1998;160:754-762
Green, KA, Crassi, KM, Laman, JD, Schoneveld, A, Strawbridge, RR, Foy, TM, Noelle, RJ and Green, WR. Antibody to the ligand for CD40 (gp39) inhibits murine AIDS-associated splenomegaly, hypergammaglobulinemia, and immunodeficiency in disease-susceptible C57BL/6 mice. Journal of Virology 1996;70:2569-2575
213
Chapter 7
Green, KA, Noelle, RJ, Durell, BG and Green, WR. Characterization of the CD154-positive and CD40-positive cellular subsets required for pathogenesis in retrovirus-induced murine immunodeficiency. Journal of Virology 2001;75:3581-3589
Green, KA, Noelle, RJ and Green, WR. Evidence for a continued requirement for CD40/CD40 ligand (CD154) interactions in the progression of LP-BM5 retrovirus-induced murine AIDS. Virology 1998;241:260-268
Green, WR. Cytotoxic T lymphocytes to endogenous mouse retroviruses and mechanisms of retroviral escape. Immunological Reviews 1999;168:271-286
Green, WR, Crassi, KM, Schwarz, DA and Green, KA. Cytotoxic T lymphocytes directed against MAIDS-associated tumors and cells from mice infected by the LP-BM5 MAIDS defective retrovirus. Virology 1994;200:292-296
Gregori, S, Casorati, M, Amuchastegui, S, Smiroldo, S, Davalli, A and Adorini, L. Transplantation tolerance by 1,25-dihydroxyvitamin D(3)-induced costimulation blockade. Transplant Proc 2001a;33:219-220
Gregori, S, Casorati, M, Amuchastegui, S, Smiroldo, S, Davalli, AM and Adorini, L. Regulatory T cells induced by 1 alpha,25-dihydroxyvitamin D3 and mycophenolate mofetil treatment mediate transplantation tolerance. J Immunol 2001b;167:1945-1953
Groux, H. Type 1 T-regulatory cells: their role in the control of immune responses. Transplantation 2003;75:8S-12S
Groux, H, O'Garra, A, Bigler, M, Rouleau, M, Antonenko, S, de Vries, JE and Roncarolo, MG. A CD4+ T-cell subset inhibits antigen-specific T-cell responses and prevents colitis. Nature 1997;389:737-742
Gurney, AL, Marsters, SA, Huang, RM, Pitti, RM, Mark, DT, Baldwin, DT, Gray, AM, Dowd, AD, Brush, AD, Heldens, AD, Schow, AD, Goddard, AD, Wood, WI, Baker, KP, Godowski, PJ and Ashkenazi, A. Identification of a new member of the tumor necrosis factor family and its receptor, a human ortholog of mouse GITR. Curr Biol 1999;9:215-218
Hansen, G, McIntire, JJ, Yeung, VP, Berry, G, Thorbecke, GJ, Chen, L, DeKruyff, RH and Umetsu, DT. CD4(+) T helper cells engineered to produce latent TGF-beta1 reverse allergen-induced airway hyperreactivity and inflammation. J Clin Invest 2000;105:61-70
Hara, M, Kingsley, CI, Niimi, M, Read, S, Turvey, SE, Bushell, AR, Morris, PJ, Powrie, F and Wood, KJ. IL-10 is required for regulatory T cells to mediate tolerance to alloantigens in vivo. Journal of Immunology 2001;166:3789-3796
Hartley, JW, Fredrickson, TN, Yetter, RA, Makino, M and Morse, HCd. Retrovirus-induced murine acquired immunodeficiency syndrome: natural history of infection and differing susceptibility of inbred mouse strains. Journal of Virology 1989;63:1223-1231
Harvie, P, Omar, RF, Dusserre, N, Desormeaux, A, Gourde, P, Tremblay, M, Beauchamp, D and Bergeron, MG. Antiviral efficacy and toxicity of ribavirin in murine acquired immunodeficiency syndrome model. JAIDS: Journal of Acquired Immune Deficiency Syndromes 1996;12:451-461
Hasenkrug, KJ, Brooks, DM and Dittmer, U. Critical role for CD4(+) T cells in controlling retrovirus replication and spread in persistently infected mice. J Virol 1998;72:6559-6564
Hasenkrug, KJ and Chesebro, B. Immunity to retroviral infection: the Friend virus model. Proc Natl Acad Sci U S A 1997;94:7811-7816
Hasenkrug, KJ and Dittmer, U. The role of CD4 and CD8 T cells in recovery and protection from retroviral infection: lessons from the Friend virus model. Virology 2000;272:244-249
214
Chapter 7
Heath, VL, Murphy, EE, Crain, C, Tomlinson, MG and O'Garra, A. TGF-beta1 down-regulates Th2 development and results in decreased IL-4-induced STAT6 activation and GATA-3 expression. Eur J Immunol 2000;30:2639-2649
Heng, JK, Price, P, Lai, CM and Beilharz, MW. Alpha/beta interferons increase host resistance to murine AIDS. Journal of Virology 1996;70:4517-4522
Herbelin, A, Gombert, JM, Lepault, F, Bach, JF and Chatenoud, L. Mature mainstream TCR alpha beta+CD4+ thymocytes expressing L-selectin mediate "active tolerance" in the nonobese diabetic mouse. Journal of Immunology 1998;161:2620-2628
Hesse, M, Piccirillo, CA, Belkaid, Y, Prufer, J, Mentink-Kane, M, Leusink, M, Cheever, AW, Shevach, EM and Wynn, TA. The pathogenesis of schistosomiasis is controlled by cooperating IL-10-producing innate effector and regulatory T cells. J Immunol 2004;172:3157-3166
Higgins, SC, Lavelle, EC, McCann, C, Keogh, B, McNeela, E, Byrne, P, O'Gorman, B, Jarnicki, A, McGuirk, P and Mills, KH. Toll-like receptor 4-mediated innate IL-10 activates antigen-specific regulatory T cells and confers resistance to Bordetella pertussis by inhibiting inflammatory pathology. J Immunol 2003;171:3119-3127
Hitoshi, Y, Okada, Y, Sonoda, E, Tominaga, A, Makino, M, Suzuki, K, Kinoshita, J, Komuro, K, Mizuochi, T and Takatsu, K. Delayed progression of a murine retrovirus-induced acquired immunodeficiency syndrome in X-linked immunodeficient mice. Journal of Experimental Medicine 1993;177:621-626
Hoffmann, JC, Peters, K, Henschke, S, Herrmann, B, Pfister, K, Westermann, J and Zeitz, M. Role of T lymphocytes in rat 2,4,6-trinitrobenzene sulphonic acid (TNBS) induced colitis: increased mortality after gammadelta T cell depletion and no effect of alphabeta T cell depletion. Gut 2001;48:489-495
Hoffmann, P, Ermann, J, Edinger, M, Fathman, CG and Strober, S. Donor-type CD4(+)CD25(+) regulatory T cells suppress lethal acute graft-versus-host disease after allogeneic bone marrow transplantation. J Exp Med 2002;196:389-399
Holmes, KL, Morse, HCd, Makino, M, Hardy, RR and Hayakawa, K. A unique subset of normal murine CD4+ T cells lacking Thy-1 is expanded in a murine retrovirus-induced immunodeficiency syndrome, MAIDS. European Journal of Immunology 1990;20:2783-2787
Hori, S, Carvalho, TL and Demengeot, J. CD25+CD4+ regulatory T cells suppress CD4+ T cell-mediated pulmonary hyperinflammation driven by Pneumocystis carinii in immunodeficient mice. Eur J Immunol 2002;32:1282-1291
Hori, S, Nomura, T and Sakaguchi, S. Control of regulatory T cell development by the transcription factor foxp3. Science 2003;299:1057-1061
Hori, S and Sakaguchi, S. Foxp3: a critical regulator of the development and function of regulatory T cells. Microbes Infect 2004;6:745-751
Horwitz, DA, Gray, JD and Ohtsuka, K. Role of NK cells and TGF-beta in the regulation of T-cell-dependent antibody production in health and autoimmune disease. Microbes Infect 1999;1:1305-1311
Horwitz, DA, Gray, JD, Ohtsuka, K, Hirokawa, M and Takahashi, T. The immunoregulatory effects of NK cells: the role of TGF-beta and implications for autoimmunity. Immunol Today 1997;18:538-542
Horwitz, DA, Zheng, SG and Gray, JD. The role of the combination of IL-2 and TGF-beta or IL-10 in the generation and function of CD4+ CD25+ and CD8+ regulatory T cell subsets. J Leukoc Biol 2003;74:471-478
215
Chapter 7
Huang, CT, Workman, CJ, Flies, D, Pan, X, Marson, AL, Zhou, G, Hipkiss, EL, Ravi, S, Kowalski, J, Levitsky, HI, Powell, JD, Pardoll, DM, Drake, CG and Vignali, DA. Role of LAG-3 in regulatory T cells. Immunity 2004;21:503-513
Huang, DS, Wang, Y, Marchalonis, JJ and Watson, RR. The kinetics of cytokine secretion and proliferation by mesenteric lymph node cells during the progression to murine AIDS, caused by LP-BM5 murine leukemia virus infection. Regional Immunology 1993;5:325-331
Huang, M, Hanna, Z and Jolicoeur, P. Mutational analysis of the murine AIDS-defective viral genome reveals a high reversion rate in vivo and a requirement for an intact Pr60gag protein for efficient induction of disease. Journal of Virology 1995;69:60-68
Huang, M and Jolicoeur, P. Myristylation of Pr60gag of the murine AIDS-defective virus is required to induce disease and notably for the expansion of its target cells. Journal of Virology 1994;68:5648-5655
Huang, M, Takac, M, Kozak, CA and Jolicoeur, P. The murine AIDS defective provirus acts as an insertional mutagen in its infected target B cells. Journal of Virology 1995;69:4069-4078
Hugin, AW, Vacchio, MS and Morse, HCd. A virus-encoded "superantigen" in a retrovirus-induced immunodeficiency syndrome of mice. Science 1991;252:424-427
Itoh, M, Takahashi, T, Sakaguchi, N, Kuniyasu, Y, Shimizu, J, Otsuka, F and Sakaguchi, S. Thymus and autoimmunity: production of CD25+CD4+ naturally anergic and suppressive T cells as a key function of the thymus in maintaining immunologic self-tolerance. Journal of Immunology 1999;162:5317-5326
Iwabuchi, K, Ohgama, J, Ogasawara, K, Iwabuchi, C, Negishi, I, Good, RA and Onoe, K. Distribution of MEL-14+ cells in various lymphoid tissues. Immunobiology 1991;182:161-173
Iwashiro, M, Messer, RJ, Peterson, KE, Stromnes, IM, Sugie, T and Hasenkrug, KJ. Immunosuppression by CD4+ regulatory T cells induced by chronic retroviral infection. Proc Natl Acad Sci U S A 2001;98:9226-9230
Ji, HB, Liao, G, Faubion, WA, Abadia-Molina, AC, Cozzo, C, Laroux, FS, Caton, A and Terhorst, C. Cutting edge: the natural ligand for glucocorticoid-induced TNF receptor-related protein abrogates regulatory T cell suppression. J Immunol 2004;172:5823-5827
Jiang, S, Tugulea, S, Pennesi, G, Liu, Z, Mulder, A, Lederman, S, Harris, P, Cortesini, R and Suciu-Foca, N. Induction of MHC-class I restricted human suppressor T cells by peptide priming in vitro. Hum Immunol 1998;59:690-699
Jolicoeur, P. Murine acquired immunodeficiency syndrome (MAIDS): an animal model to study the AIDS pathogenesis. FASEB Journal 1991;5:2398-2405
Jolicoeur, P. Interaction of the MAIDS defective virus with its host. Leukemia 1997;11:162
Jolicoeur, P. Pathogenesis of defective retroviruses. Dev Biol (Basel) 2001;106:201-208; discussion 209-210, 253-263
Jones, E, Dahm-Vicker, M, Simon, AK, Green, A, Powrie, F, Cerundolo, V and Gallimore, A. Depletion of CD25+ regulatory cells results in suppression of melanoma growth and induction of autoreactivity in mice. Cancer Immun 2002;2:1
Jonuleit, H, Schmitt, E, Kakirman, H, Stassen, M, Knop, J and Enk, AH. Infectious tolerance: human CD25(+) regulatory T cells convey suppressor activity to conventional CD4(+) T helper cells. J Exp Med 2002;196:255-260
Jonuleit, H, Schmitt, E, Schuler, G, Knop, J and Enk, AH. Induction of interleukin 10-producing, nonproliferating CD4(+) T cells with regulatory properties by repetitive
216
Chapter 7
stimulation with allogeneic immature human dendritic cells. Journal of Experimental Medicine 2000;192:1213-1222
Jordan, MS, Boesteanu, A, Reed, AJ, Petrone, AL, Holenbeck, AE, Lerman, MA, Naji, A and Caton, AJ. Thymic selection of CD4+CD25+ regulatory T cells induced by an agonist self-peptide. Nat Immunol 2001;2:301-306
Joshi, A, Vahlenkamp, TW, Garg, H, Tompkins, WA and Tompkins, MB. Preferential replication of FIV in activated CD4(+)CD25(+)T cells independent of cellular proliferation. Virology 2004;321:307-322
Jung, TM, Gallatin, WM, Weissman, IL and Dailey, MO. Down-regulation of homing receptors after T cell activation. J Immunol 1988;141:4110-4117
Kanagawa, O, Nussrallah, BA, Wiebenga, ME, Murphy, KM, Morse, HCd and Carbone, FR. Murine AIDS superantigen reactivity of the T cells bearing V beta 5 T cell antigen receptor. Journal of Immunology 1992;149:9-16
Kanagawa, O, Vaupel, BA, Gayama, S, Koehler, G and Kopf, M. Resistance of mice deficient in IL-4 to retrovirus-induced immunodeficiency syndrome (MAIDS) [see comments]. Science 1993;262:240-242
Kawakami, A, Kitsukawa, T, Takagi, S and Fujisawa, H. Developmentally regulated expression of a cell surface protein, neuropilin, in the mouse nervous system. J Neurobiol 1996;29:1-17
Khattri, R, Auger, JA, Griffin, MD, Sharpe, AH and Bluestone, JA. Lymphoproliferative disorder in CTLA-4 knockout mice is characterized by CD28-regulated activation of Th2 responses. J Immunol 1999;162:5784-5791
Khattri, R, Cox, T, Yasayko, SA and Ramsdell, F. An essential role for Scurfin in CD4+CD25+ T regulatory cells. Nat Immunol 2003;4:337-342
Kim, WK, Tang, Y, Kenny, JJ, Longo, DL and Morse, HCr. In murine AIDS, B cells are early targets of defective virus and are required for efficient infection and expression of defective virus in T cells and macrophages. Journal of Virology 1994;68:6767-6769
Kingsley, CI, Karim, M, Bushell, AR and Wood, KJ. CD25(+)CD4(+) Regulatory T Cells Prevent Graft Rejection: CTLA-4- and IL-10-Dependent Immunoregulation of Alloresponses. J Immunol 2002;168:1080-1086
Kinter, AL, Hennessey, M, Bell, A, Kern, S, Lin, Y, Daucher, M, Planta, M, McGlaughlin, M, Jackson, R, Ziegler, SF and Fauci, AS. CD25(+)CD4(+) regulatory T cells from the peripheral blood of asymptomatic HIV-infected individuals regulate CD4(+) and CD8(+) HIV-specific T cell immune responses in vitro and are associated with favorable clinical markers of disease status. J Exp Med 2004;200:331-343
Klagsbrun, M, Takashima, S and Mamluk, R. The role of neuropilin in vascular and tumor biology. Adv Exp Med Biol 2002;515:33-48
Klinken, SP, Fredrickson, TN, Hartley, JW, Yetter, RA and Morse, HCd. Evolution of B cell lineage lymphomas in mice with a retrovirus-induced immunodeficiency syndrome, MAIDS. Journal of Immunology 1988;140:1123-1131
Klinman, DM, Krieg, A, Conover, J, Ussery, MA and Black, PL. Effect of cyclophosphamide, total body irradiation, and zidovudine on retrovirus proliferation and disease progression in murine AIDS. AIDS Research & Human Retroviruses 1992;8:101-106
Klinman, DM and Morse, HCd. Characteristics of B cell proliferation and activation in murine AIDS. Journal of Immunology 1989;142:1144-1149
217
Chapter 7
Koch, S, Muralidhar, G and Swain, SL. Both naive and memory CD4 T cell subsets become anergic during MAIDS and each subset can sustain disease. Journal of Immunology 1994;152:5548-5556
Kriegel, MA, Lohmann, T, Gabler, C, Blank, N, Kalden, JR and Lorenz, HM. Defective suppressor function of human CD4+ CD25+ regulatory T cells in autoimmune polyglandular syndrome type II. J Exp Med 2004;199:1285-1291
Krummel, MF and Allison, JP. CD28 and CTLA-4 have opposing effects on the response of T cells to stimulation. J Exp Med 1995;182:459-465
Kubo, Y, Kakimi, K, Higo, K, Wang, L, Kobayashi, H, Kuribayashi, K, Masuda, T, Hirama, T and Ishimoto, A. The p15gag and p12gag regions are both necessary for the pathogenicity of the murine AIDS virus. Journal of Virology 1994;68:5532-5537
Kullberg, MC, Jankovic, D, Gorelick, PL, Caspar, P, Letterio, JJ, Cheever, AW and Sher, A. Bacteria-triggered CD4(+) T regulatory cells suppress Helicobacter hepaticus-induced colitis. J Exp Med 2002;196:505-515
Latarjet, R and Duplan, J-F. Experiment and discussion on leukaemogenesis by cell-free extracts of readiation-induced leukaemia in mice. Int. J. Radiat. Biol. 1962;5:339-344
Lavelle, EC, Jarnicki, A, McNeela, E, Armstrong, ME, Higgins, SC, Leavy, O and Mills, KH. Effects of cholera toxin on innate and adaptive immunity and its application as an immunomodulatory agent. J Leukoc Biol 2004;75:756-763
Leach, DR, Krummel, MF and Allison, JP. Enhancement of antitumor immunity by CTLA-4 blockade. Science 1996;271:1734-1736
Lee, JS, Giese, NA, Elkins, KL, Yetter, RA, Holmes, KL, Hartley, JW and Morse, HCr. Effects of exogenous, nonleukemogenic, ecotropic murine leukemia virus infections on the immune systems of adult C57BL/6 mice. Journal of Virology 1995;69:4182-4188
Lehmann, J, Huehn, J, de la Rosa, M, Maszyna, F, Kretschmer, U, Krenn, V, Brunner, M, Scheffold, A and Hamann, A. Expression of the integrin alpha Ebeta 7 identifies unique subsets of CD25+ as well as CD25- regulatory T cells. Proc Natl Acad Sci U S A 2002;99:13031-13036
Lepault, F and Gagnerault, MC. L-selectin(-/lo) and diabetogenic T cells are similarly distributed in prediabetic and diabetic nonobese diabetic mice. Laboratory Investigation 1998;78:551-558
Lepault, F and Gagnerault, MC. Characterization of peripheral regulatory CD4+ T cells that prevent diabetes onset in nonobese diabetic mice. Journal of Immunology 2000;164:240-247
Letterio, JJ and Roberts, AB. Regulation of immune responses by TGF-beta. Annu Rev Immunol 1998;16:137-161
Levings, MK, Bacchetta, R, Schulz, U and Roncarolo, MG. The role of IL-10 and TGF-beta in the differentiation and effector function of T regulatory cells. Int Arch Allergy Immunol 2002;129:263-276
Levings, MK, Bacchetta, R, Schulz, U and Roncarolo, MG. The role of IL-10 and TGF-beta in the differentiation and effector function of T regulatory cells. Int Arch Allergy Immunol 2002b;129:263-276
Levings, MK, Sangregorio, R, Sartirana, C, Moschin, AL, Battaglia, M, Orban, PC and Roncarolo, MG. Human CD25+CD4+ T suppressor cell clones produce transforming growth factor beta, but not interleukin 10, and are distinct from type 1 T regulatory cells. J Exp Med 2002a;196:1335-1346
218
Chapter 7
Lewinsohn, DM, Bargatze, RF and Butcher, EC. Leukocyte-endothelial cell recognition: evidence of a common molecular mechanism shared by neutrophils, lymphocytes, and other leukocytes. J Immunol 1987;138:4313-4321
Liu, H, Hu, B, Xu, D and Liew, FY. CD4+CD25+ regulatory T cells cure murine colitis: the role of IL-10, TGF-beta, and CTLA4. J Immunol 2003;171:5012-5017
Liu, Z, Tugulea, S, Cortesini, R and Suciu-Foca, N. Specific suppression of T helper alloreactivity by allo-MHC class I-restricted CD8+CD28- T cells. Int Immunol 1998;10:775-783
Lowenthal, JW, Corthesy, P, Tougne, C, Lees, R, MacDonald, HR and Nabholz, M. High and low affinity IL 2 receptors: analysis by IL 2 dissociation rate and reactivity with monoclonal anti-receptor antibody PC61. Journal of Immunology 1985;135:3988-3994
Lundgren, A, Suri-Payer, E, Enarsson, K, Svennerholm, AM and Lundin, BS. Helicobacter pylori-specific CD4+ CD25high regulatory T cells suppress memory T-cell responses to H. pylori in infected individuals. Infect Immun 2003;71:1755-1762
MacDonald, AJ, Duffy, M, Brady, MT, McKiernan, S, Hall, W, Hegarty, J, Curry, M and Mills, KH. CD4 T helper type 1 and regulatory T cells induced against the same epitopes on the core protein in hepatitis C virus-infected persons. J Infect Dis 2002;185:720-727
Magnani, M, Casabianca, A, Fraternale, A, Brandi, G, Chiarantini, L, Benatti, U, Scarfi, S, Millo, E and De Flora, A. Inhibition of murine AIDS by a new azidothymidine homodinucleotide. Journal of Acquired Immune Deficiency Syndromes & Human Retrovirology 1998;17:189-195
Magnani, M, Fraternale, A, Casabianca, A, Schiavano, GF, Chiarantini, L, Palamara, AT, Ciriolo, MR, Rotilio, G and Garaci, E. Antiretroviral effect of combined zidovudine and reduced glutathione therapy in murine AIDS. AIDS Res Hum Retroviruses 1997;13:1093-1099
Magnani, M, Rossi, L, Brandi, G, Schiavano, GF, Montroni, M and Piedimonte, G. Targeting antiretroviral nucleoside analogues in phosphorylated form to macrophages: in vitro and in vivo studies. Proceedings of the National Academy of Sciences of the United States of America 1992;89:6477-6481
Makino, M, Chattopadhyay, SK, Hartley, JW and Morse, HCd. Analysis of role of CD8+ T cells in resistance to murine AIDS in A/J mice. Journal of Immunology 1992;149:1702-1706
Makino, M, Morse, HCd, Fredrickson, TN and Hartley, JW. H-2-associated and background genes influence the development of a murine retrovirus-induced immunodeficiency syndrome. Journal of Immunology 1990;144:4347-4355
Makino, M, Winkler, DF, Wunderlich, J, Hartley, JW, Morse, HC and Holmes, KL. High expression of NK-1.1 antigen is induced by infection with murine AIDS virus. Immunology 1993;80:319-325
Makino, M, Yoshimatsu, K, Azuma, M, Okada, Y, Hitoshi, Y, Yagita, H, Takatsu, K and Komuro, K. Rapid development of murine AIDS is dependent of signals provided by CD54 and CD11a. Journal of Immunology 1995;155:974-981
Maloy, KJ and Powrie, F. Regulatory T cells in the control of immune pathology. Nat Immunol 2001;2:816-822
Marshall, NA, Vickers, MA and Barker, RN. Regulatory T cells secreting IL-10 dominate the immune response to EBV latent membrane protein 1. J Immunol 2003;170:6183-6189
219
Chapter 7
McGuirk, P, McCann, C and Mills, KH. Pathogen-specific T regulatory 1 cells induced in the respiratory tract by a bacterial molecule that stimulates interleukin 10 production by dendritic cells: a novel strategy for evasion of protective T helper type 1 responses by Bordetella pertussis. J Exp Med 2002;195:221-231
McGuirk, P and Mills, K. Pathogen-specific regulatory T cells provoke a shift in the Th1/Th2 paradigm in immunity to infectious diseases. Trends Immunol 2002;23:450
McGuirk, P and Mills, KH. Pathogen-specific regulatory T cells provoke a shift in the Th1/Th2 paradigm in immunity to infectious diseases. Trends Immunol 2002;23:450-455
McHugh, RS and Shevach, EM. Cutting edge: depletion of CD4+CD25+ regulatory T cells is necessary, but not sufficient, for induction of organ-specific autoimmune disease. J Immunol 2002b;168:5979-5983
McHugh, RS, Shevach, EM and Thornton, AM. Control of organ-specific autoimmunity by immunoregulatory CD4+CD25+ T cells. Microbes and Infection 2001;3:919-927
McHugh, RS, Whitters, MJ, Piccirillo, CA, Young, DA, Shevach, EM, Collins, M and Byrne, MC. CD4(+)CD25(+) immunoregulatory T cells: gene expression analysis reveals a functional role for the glucocorticoid-induced TNF receptor. Immunity 2002a;16:311-323 Medzhitov, R and Janeway, CA, Jr. How does the immune system distinguish self from nonself? Semin Immunol 2000;12:185-188; discussion 257-344
Mendez, S, Reckling, SK, Piccirillo, CA, Sacks, D and Belkaid, Y. Role for CD4(+) CD25(+) regulatory T cells in reactivation of persistent leishmaniasis and control of concomitant immunity. J Exp Med 2004;200:201-210
Miller, A, Lider, O, Roberts, AB, Sporn, MB and Weiner, HL. Suppressor T cells generated by oral tolerization to myelin basic protein suppress both in vitro and in vivo immune responses by the release of transforming growth factor beta after antigen-specific triggering. Proc Natl Acad Sci U S A 1992;89:421-425
Miller, DG and Miller, AD. A family of retroviruses that utilize related phosphate transporters for cell entry. Journal of Virology 1994;68:8270-8276
Mills, KH. Regulatory T cells: friend or foe in immunity to infection? Nat Rev Immunol 2004;4:841-855 Mills, KH and McGuirk, P. Antigen-specific regulatory T cells--their induction and role in infection. Semin Immunol 2004;16:107-117 Miyazawa, M and Fujisawa, R. Physiology and pathology of host immune responses to exogenous and endogenous murine retroviruses--from gene fragments to epitopes. Tohoku J Exp Med 1994;173:91-103 Mizuochi, T, Horino, A and Uchida, T. Delayed progression of murine AIDS in C57BL/6 mice pre-immunized with a highly antigenic 10-mer peptide encoded by the murine AIDS defective virus gag p12 gene. Vaccine 1998;16:2026-2030 Montagnoli, C, Bacci, A, Bozza, S, Gaziano, R, Mosci, P, Sharpe, AH and Romani, L. B7/CD28-dependent CD4+CD25+ regulatory T cells are essential components of the memory-protective immunity to Candida albicans. J Immunol 2002;169:6298-6308 Moore, KW, de Waal Malefyt, R, Coffman, RL and O'Garra, A. Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol 2001;19:683-765
220
Chapter 7
Moore, KW, Vieira, P, Fiorentino, DF, Trounstine, ML, Khan, TA and Mosmann, TR. Homology of cytokine synthesis inhibitory factor (IL-10) to the Epstein-Barr virus gene BCRFI. Science 1990;248:1230-1234
Morawetz, RA, Doherty, TM, Giese, NA, Hartley, JW, Muller, W, Kuhn, R, Rajewsky, K, Coffman, R and Morse, HCr. Resistance to murine acquired immunodeficiency syndrome (MAIDS) [letter; comment]. Science 1994;265:264-266; discussion 267
Morawetz, RA, Giese, NA, Gabriele, L, Rothman, P, Horak, I, Ozato, K and Morse, HC. Relationship Of Cytokines and Cytokine Signaling to Immunodeficiency Disorders In the Mouse. Brazilian Journal of Medical & Biological Research 1998;31:61-67
Morelli, L, Skamene, E and Gervais, F. Host resistance and susceptibility to MAIDS virus: a case of Th cell dichotomy. Folia Biologica 1994;40:249-262
Morse, HCd, Chattopadhyay, SK, Makino, M, Fredrickson, TN, Hugin, AW and Hartley, JW. Retrovirus-induced immunodeficiency in the mouse: MAIDS as a model for AIDS [editorial]. Aids 1992;6:607-621
Morse, HCr, Giese, N, Morawetz, R, Tang, Y, Gazzinelli, R, Kim, WK, Chattopadhyay, S and Hartley, JW. Cells and cytokines in the pathogenesis of MAIDS, a retrovirus-induced immunodeficiency syndrome of mice. Springer Seminars in Immunopathology 1995;17:231-245
Morse, HCr, Morawetz, RA, Giese, NA, Chattopadhyay, SK, Tang, Y, Fredrickson, TN and Hartley, JW. Immunologic havoc induced by the 60 kD Gag protein of the MAIDS defective virus. Leukemia 1997;11:167-169
Mosier, DE. Animal models for retrovirus-induced immunodeficiency disease. Immunological Investigations 1986;15:233-261
Mosier, DE. Small animal models for acquired immune deficiency syndrome (AIDS) research. Laboratory Animal Science 1996;46:257-265
Mosier, DE, Yetter, RA and Morse, HCd. Retroviral induction of acute lymphoproliferative disease and profound immunosuppression in adult C57BL/6 mice. Journal of Experimental Medicine 1985;161:766-784
Mosier, DE, Yetter, RA and Morse, HCd. Functional T lymphocytes are required for a murine retrovirus-induced immunodeficiency disease (MAIDS). Journal of Experimental Medicine 1987;165:1737-1742
Nagaeva, O, Jonsson, L and Mincheva-Nilsson, L. Dominant IL-10 and TGF-beta mRNA expression in gammadeltaT cells of human early pregnancy decidua suggests immunoregulatory potential. Am J Reprod Immunol 2002;48:9-17
Najafian, N, Chitnis, T, Salama, AD, Zhu, B, Benou, C, Yuan, X, Clarkson, MR, Sayegh, MH and Khoury, SJ. Regulatory functions of CD8+CD28- T cells in an autoimmune disease model. J Clin Invest 2003;112:1037-1048
Nakamura, K, Kitani, A and Strober, W. Cell contact-dependent immunosuppression by CD4(+)CD25(+) regulatory T cells is mediated by cell surface-bound transforming growth factor beta. Journal of Experimental Medicine 2001;194:629-644
Nakao, A, Miike, S, Hatano, M, Okumura, K, Tokuhisa, T, Ra, C and Iwamoto, I. Blockade of transforming growth factor beta/Smad signaling in T cells by overexpression of Smad7 enhances antigen-induced airway inflammation and airway reactivity. J Exp Med 2000;192:151-158
Nelson, DJ, Mukherjee, S, Bundell, C, Fisher, S, van Hagen, D and Robinson, B. Tumor progression despite efficient tumor antigen cross-presentation and effective "arming" of tumor antigen-specific CTL. J Immunol 2001;166:5557-5566
221
Chapter 7
Netea, MG, Sutmuller, R, Hermann, C, Van der Graaf, CA, Van der Meer, JW, van Krieken, JH, Hartung, T, Adema, G and Kullberg, BJ. Toll-like receptor 2 suppresses immunity against Candida albicans through induction of IL-10 and regulatory T cells. J Immunol 2004;172:3712-3718
Neurath, MF, Fuss, I, Kelsall, BL, Presky, DH, Waegell, W and Strober, W. Experimental granulomatous colitis in mice is abrogated by induction of TGF-beta-mediated oral tolerance. J Exp Med 1996;183:2605-2616
Nocentini, G, Giunchi, L, Ronchetti, S, Krausz, LT, Bartoli, A, Moraca, R, Migliorati, G and Riccardi, C. A new member of the tumor necrosis factor/nerve growth factor receptor family inhibits T cell receptor-induced apoptosis. Proc Natl Acad Sci U S A 1997;94:6216-6221
North, RJ. Down-regulation of the antitumor immune response. Adv Cancer Res 1985;45:1-43
North, RJ. Radiation-induced, immunologically mediated regression of an established tumor as an example of successful therapeutic immunomanipulation. Preferential elimination of suppressor T cells allows sustained production of effector T cells. J Exp Med 1986;164:1652-1666
North, RJ and Awwad, M. Elimination of cycling CD4+ suppressor T cells with an anti-mitotic drug releases non-cycling CD8+ T cells to cause regression of an advanced lymphoma. Immunology 1990;71:90-95
North, RJ, Awwad, M and Dunn, PL. The immune response to tumors. Transplant Proc 1989;21:575-577
North, RJ and Bursuker, I. Generation and decay of the immune response to a progressive fibrosarcoma. I. Ly-1+2- suppressor T cells down-regulate the generation of Ly-1-2+ effector T cells. J Exp Med 1984;159:1295-1311
Numata, F, Hitoshi, Y, Uehara, S and Takatsu, K. The xid mutation plays an important role in delayed development of murine acquired immunodeficiency syndrome. International Immunology 1997;9:139-146
O'Garra, A, Stapleton, G, Dhar, V, Pearce, M, Schumacher, J, Rugo, H, Barbis, D, Stall, A, Cupp, J, Moore, K and et al. Production of cytokines by mouse B cells: B lymphomas and normal B cells produce interleukin 10. Int Immunol 1990;2:821-832
O'Garra, A and Vieira, P. Twenty-first century Foxp3. Nat Immunol 2003;4:304-306
Ogata, N, Day, NK, Buell, RD, Good, RA and Bradley, WG. Detection of the MAIDS virus using the polymerase chain reaction. PCR Methods & Applications 1993;2:272-274
Oh, JW, Seroogy, CM, Meyer, EH, Akbari, O, Berry, G, Fathman, CG, Dekruyff, RH and Umetsu, DT. CD4 T-helper cells engineered to produce IL-10 prevent allergen-induced airway hyperreactivity and inflammation. J Allergy Clin Immunol 2002;110:460-468
Ohnota, H, Okada, Y, Ushijima, H, Kitamura, T, Komuro, K and Mizuochi, T. 3'-Azido-3'-deoxythymidine prevents induction of murine acquired immunodeficiency syndrome in C57BL/10 mice infected with LP-BM5 murine leukemia viruses, a possible animal model for antiretroviral drug screening. Antimicrobial Agents & Chemotherapy 1990;34:605-609
Onizuka, S, Tawara, I, Shimizu, J, Sakaguchi, S, Fujita, T and Nakayama, E. Tumor rejection by in vivo administration of anti-CD25 (interleukin-2 receptor alpha) monoclonal antibody. Cancer Research 1999;59:3128-3133
Oswald-Richter, K, Grill, SM, Shariat, N, Leelawong, M, Sundrud, MS, Haas, DW and Unutmaz, D. HIV Infection of Naturally Occurring and Genetically Reprogrammed Human Regulatory T-cells. PLoS Biol 2004;2:E198
222
Chapter 7
Papiernik, M, de Moraes, ML, Pontoux, C, Vasseur, F and Penit, C. Regulatory CD4 T cells: expression of IL-2R alpha chain, resistance to clonal deletion and IL-2 dependency. Int Immunol 1998;10:371-378
Pavlovitch, JH, Hulier, E, Rizk-Rabin, M, Marussig, M, Mazier, D, Joffret, ML, Hoos, S and Papiernik, M. Resistance to murine AIDS in offspring of mice infected with LP-BM5. Role of CD8 T cells. Journal of Immunology 1996;156:4757-4763
Peng, Y, Laouar, Y, Li, MO, Green, EA and Flavell, RA. TGF-beta regulates in vivo expansion of Foxp3-expressing CD4+CD25+ regulatory T cells responsible for protection against diabetes. Proc Natl Acad Sci U S A 2004;101:4572-4577
Perron, H, Jouvin-Marche, E, Michel, M, Ounanian-Paraz, A, Camelo, S, Dumon, A, Jolivet-Reynaud, C, Marcel, F, Souillet, Y, Borel, E, Gebuhrer, L, Santoro, L, Marcel, S, Seigneurin, JM, Marche, PN and Lafon, M. Multiple sclerosis retrovirus particles and recombinant envelope trigger an abnormal immune response in vitro, by inducing polyclonal Vbeta16 T-lymphocyte activation. Virology 2001;287:321-332
Piccirillo, CA, Letterio, JJ, Thornton, AM, McHugh, RS, Mamura, M, Mizuhara, H and Shevach, EM. CD4(+)CD25(+) regulatory T cells can mediate suppressor function in the absence of transforming growth factor beta1 production and responsiveness. J Exp Med 2002;196:237-246
Poussier, P, Ning, T, Chen, J, Banerjee, D and Julius, M. Intestinal inflammation observed in IL-2R/IL-2 mutant mice is associated with impaired intestinal T lymphopoiesis. Gastroenterology 2000;118:880-891
Powrie, F, Correa-Oliveira, R, Mauze, S and Coffman, RL. Regulatory interactions between CD45RBhigh and CD45RBlow CD4+ T cells are important for the balance between protective and pathogenic cell-mediated immunity. J Exp Med 1994a;179:589-600
Powrie, F, Leach, MW, Mauze, S, Menon, S, Caddle, LB and Coffman, RL. Inhibition of Th1 responses prevents inflammatory bowel disease in scid mice reconstituted with CD45RBhi CD4+ T cells. Immunity 1994b;1:553-562
Pozsgay, JM, Beilharz, MW, Wines, BD, Hess, AD and Pitha, PM. The MA (p15) and p12 regions of the gag gene are sufficient for the pathogenicity of the murine AIDS virus. Journal of Virology 1993a;67:5989-5999
Pozsgay, JM, Reid, S and Pitha, PM. Dissociation between lymphoproliferative responses and virus replication in mice with different sensitivities to retrovirus-induced immunodeficiency. Journal of Virology 1993b;67:980-988
Prud'homme, GJ and Piccirillo, CA. The inhibitory effects of transforming growth factor-beta-1 (TGF-beta1) in autoimmune diseases. J Autoimmun 2000;14:23-42
Qureshi, MH, Harmsen, AG and Garvy, BA. IL-10 modulates host responses and lung damage induced by Pneumocystis carinii infection. J Immunol 2003;170:1002-1009
Raghavan, S, Fredriksson, M, Svennerholm, AM, Holmgren, J and Suri-Payer, E. Absence of CD4+CD25+ regulatory T cells is associated with a loss of regulation leading to increased pathology in Helicobacter pylori-infected mice. Clin Exp Immunol 2003;132:393-400
Raghavan, S, Suri-Payer, E and Holmgren, J. Antigen-specific in vitro suppression of murine Helicobacter pylori-reactive immunopathological T cells by CD4CD25 regulatory T cells. Scand J Immunol 2004;60:82-88
Rasmussen, HB. Interactions between Exogenous and Endogenous Retroviruses. J Biomed Sci 1997;4:1-8
223
Chapter 7
Rasmussen, HB and Clausen, J. Possible involvement of endogenous retroviruses in the development of autoimmune disorders, especially multiple sclerosis. Acta Neurol Scand Suppl 1997;169:32-37
Read, S, Malmstrom, V and Powrie, F. Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of CD25(+)CD4(+) regulatory cells that control intestinal inflammation. Journal of Experimental Medicine 2000;192:295-302
Read, S, Mauze, S, Asseman, C, Bean, A, Coffman, R and Powrie, F. CD38+ CD45RB(low) CD4+ T cells: a population of T cells with immune regulatory activities in vitro. European Journal of Immunology 1998;28:3435-3447
Romeo, PH, Lemarchandel, V and Tordjman, R. Neuropilin-1 in the immune system. Adv Exp Med Biol 2002;515:49-54
Roncarolo, MG, Bacchetta, R, Bordignon, C, Narula, S and Levings, MK. Type 1 T regulatory cells. Immunol Rev 2001;182:68-79
Roncarolo, MG, Levings, MK and Traversari, C. Differentiation of T regulatory cells by immature dendritic cells. J Exp Med 2001;193:F5-9
Rosenberg, SA. Progress in human tumour immunology and immunotherapy. Nature 2001;411:380-384
Rossi, L, Brandi, G, Fraternale, A, Schiavano, GF, Chiarantini, L and Magnani, M. Inhibition of murine retrovirus-induced immunodeficiency disease by dideoxycytidine and dideoxycytidine 5'-triphosphate. Journal of Acquired Immune Deficiency Syndromes 1993;6:1179-1186
Rouse, BT and Suvas, S. Regulatory cells and infectious agents: detentes cordiale and contraire. J Immunol 2004;173:2211-2215 Rowe, WP, Pugh, WE and Hartley, JW. Plaque assay techniques for murine leukemia viruses. Virology. 1970;42:1136-1139 Sanders, ME, Makgoba, MW and Shaw, S. Human naive and memory T cells: reinterpretation of helper-inducer and suppressor-inducer subsets. Immunol Today 1988;9:195-199 Sansom, DM. CD28, CTLA-4 and their ligands: who does what and to whom? Immunology 2000;101:169-177 Saoudi, A, Seddon, B, Heath, V, Fowell, D and Mason, D. The physiological role of regulatory T cells in the prevention of autoimmunity: the function of the thymus in the generation of the regulatory T cell subset. Immunol Rev 1996;149:195-216 Satoguina, J, Mempel, M, Larbi, J, Badusche, M, Loliger, C, Adjei, O, Gachelin, G, Fleischer, B and Hoerauf, A. Antigen-specific T regulatory-1 cells are associated with immunosuppression in a chronic helminth infection (onchocerciasis). Microbes Infect 2002;4:1291-1300 Saubermann, LJ, Beck, P, De Jong, YP, Pitman, RS, Ryan, MS, Kim, HS, Exley, M, Snapper, S, Balk, SP, Hagen, SJ, Kanauchi, O, Motoki, K, Sakai, T, Terhorst, C, Koezuka, Y, Podolsky, DK and Blumberg, RS. Activation of natural killer T cells by alpha-galactosylceramide in the presence of CD1d provides protection against colitis in mice. Gastroenterology 2000;119:119-128
224
Chapter 7
Schubert, LA, Jeffery, E, Zhang, Y, Ramsdell, F and Ziegler, SF. Scurfin (FOXP3) acts as a repressor of transcription and regulates T cell activation. J Biol Chem 2001;276:37672-37679
Seddon, B and Mason, D. Regulatory T cells in the control of autoimmunity: the essential role of transforming growth factor beta and interleukin 4 in the prevention of autoimmune thyroiditis in rats by peripheral CD4(+)CD45RC- cells and CD4(+)CD8(-) thymocytes. J Exp Med 1999;189:279-288
Seddon, B and Mason, D. The third function of the thymus. Immunol Today 2000;21:95-99 Segal, BM, Glass, DD and Shevach, EM. Cutting Edge: IL-10-producing CD4+ T cells mediate tumor rejection. J Immunol 2002;168:1-4 Seo, N, Hayakawa, S, Takigawa, M and Tokura, Y. Interleukin-10 expressed at early tumour sites induces subsequent generation of CD4(+) T-regulatory cells and systemic collapse of antitumour immunity. Immunology 2001;103:449-457 Sher, A, Gazzinelli, RT, Oswald, IP, Clerici, M, Kullberg, M, Pearce, EJ, Berzofsky, JA, Mosmann, TR, James, SL and Morse, HC, 3rd. Role of T-cell derived cytokines in the downregulation of immune responses in parasitic and retroviral infection. Immunol Rev 1992;127:183-204 Shevach, EM. Regulatory T cells in autoimmmunity. Annual Review of Immunology 2000;18:423-449 Shevach, EM. Certified professionals: CD4(+)CD25(+) suppressor T cells. Journal of Experimental Medicine 2001;193:F41-46 Shevach, EM, McHugh, RS, Piccirillo, CA and Thornton, AM. Control of T-cell activation by CD4+ CD25+ suppressor T cells. Immunol Rev 2001;182:58-67 Shimizu, J, Yamazaki, S and Sakaguchi, S. Induction of tumor immunity by removing CD25+CD4+ T cells: a common basis between tumor immunity and autoimmunity. Journal of Immunology 1999;163:5211-5218 Shimizu, J, Yamazaki, S, Takahashi, T, Ishida, Y and Sakaguchi, S. Stimulation of CD25(+)CD4(+) regulatory T cells through GITR breaks immunological self-tolerance. Nat Immunol 2002;3:135-142 Siegelman, MH, Cheng, IC, Weissman, IL and Wakeland, EK. The mouse lymph node homing receptor is identical with the lymphocyte cell surface marker Ly-22: role of the EGF domain in endothelial binding. Cell 1990;61:611-622 Simard, C and Jolicoeur, P. The effect of anti-neoplastic drugs on murine acquired immunodeficiency syndrome. Science 1991;251:305-308 Singh, B, Read, S, Asseman, C, Malmstrom, V, Mottet, C, Stephens, LA, Stepankova, R, Tlaskalova, H and Powrie, F. Control of intestinal inflammation by regulatory T cells. Immunol Rev 2001;182:190-200 Sprent, J and Tough, DF. Lymphocyte life-span and memory. Science 1994;265:1395-1400 Stampfli, MR, Cwiartka, M, Gajewska, BU, Alvarez, D, Ritz, SA, Inman, MD, Xing, Z and Jordana, M. Interleukin-10 gene transfer to the airway regulates allergic mucosal sensitization in mice. Am J Respir Cell Mol Biol 1999;21:586-596 Stassen, M, Fondel, S, Bopp, T, Richter, C, Muller, C, Kubach, J, Becker, C, Knop, J, Enk, AH, Schmitt, S, Schmitt, E and Jonuleit, H. Human CD25+ regulatory T cells: two subsets defined by the integrins alpha 4 beta 7 or alpha 4 beta 1 confer distinct suppressive properties upon CD4+ T helper cells. Eur J Immunol 2004a;34:1303-1311
225
Chapter 7
Stephens, LA and Mason, D. CD25 is a marker for CD4+ thymocytes that prevent autoimmune diabetes in rats, but peripheral T cells with this function are found in both CD25+ and CD25- subpopulations. J Immunol 2000;165:3105-3110
Stephens, LA and Mason, D. Characterisation of thymus-derived regulatory T cells that protect against organ-specific autoimmune disease. Microbes Infect 2001b;3:905-910
Stock, P, Kallinich, T, Akbari, O, Quarcoo, D, Gerhold, K, Wahn, U, Umetsu, DT and Hamelmann, E. CD8(+) T cells regulate immune responses in a murine model of allergen-induced sensitization and airway inflammation. Eur J Immunol 2004;34:1817-1827
Sullivan, TJ, Letterio, JJ, van Elsas, A, Mamura, M, van Amelsfort, J, Sharpe, S, Metzler, B, Chambers, CA and Allison, JP. Lack of a role for transforming growth factor-beta in cytotoxic T lymphocyte antigen-4-mediated inhibition of T cell activation. Proceedings of the National Academy of Sciences of the United States of America 2001;98:2587-2592
Sumida, T, Sakamoto, A, Murata, H, Makino, Y, Takahashi, H, Yoshida, S, Nishioka, K, Iwamoto, I and Taniguchi, M. Selective reduction of T cells bearing invariant V alpha 24J alpha Q antigen receptor in patients with systemic sclerosis. J Exp Med 1995;182:1163-1168
Sundstedt, A, O'Neill, EJ, Nicolson, KS and Wraith, DC. Role for IL-10 in suppression mediated by peptide-induced regulatory T cells in vivo. J Immunol 2003;170:1240-1248 Super, HJ, Brooks, D, Hasenkrug, K and Chesebro, B. Requirement for CD4(+) T cells in the Friend murine retrovirus neutralizing antibody response: evidence for functional T cells in genetic low-recovery mice. J Virol 1998;72:9400-9403
Suri-Payer, E, Amar, AZ, McHugh, R, Natarajan, K, Margulies, DH and Shevach, EM. Post-thymectomy autoimmune gastritis: fine specificity and pathogenicity of anti-H/K ATPase-reactive T cells. European Journal of Immunology 1999;29:669-677
Suri-Payer, E, Amar, AZ, Thornton, AM and Shevach, EM. CD4+CD25+ T cells inhibit both the induction and effector function of autoreactive T cells and represent a unique lineage of immunoregulatory cells. Journal of Immunology 1998;160:1212-1218
Suri-Payer, E and Cantor, H. Differential cytokine requirements for regulation of autoimmune gastritis and colitis by CD4(+)CD25(+) T cells. Journal of Autoimmunity 2001;16:115-123
Suruga, Y, Makino, M, Okada, Y, Tanaka, H, De Clercq, E and Baba, M. Prevention of murine AIDS development by (R)-9-(2-phosphonylmethoxypropyl)adenine. JAIDS: Journal of Acquired Immune Deficiency Syndromes 1998;18:316-322
Sutmuller, RP, van Duivenvoorde, LM, van Elsas, A, Schumacher, TN, Wildenberg, ME, Allison, JP, Toes, RE, Offringa, R and Melief, CJ. Synergism of cytotoxic T lymphocyte-associated antigen 4 blockade and depletion of CD25(+) regulatory T cells in antitumor therapy reveals alternative pathways for suppression of autoreactive cytotoxic T lymphocyte responses. Journal of Experimental Medicine 2001;194:823-832
Suvas, S, Azkur, AK, Kim, BS, Kumaraguru, U and Rouse, BT. CD4+CD25+ regulatory T cells control the severity of viral immunoinflammatory lesions. J Immunol 2004;172:4123-4132
Suvas, S, Kumaraguru, U, Pack, CD, Lee, S and Rouse, BT. CD4+CD25+ T cells regulate virus-specific primary and memory CD8+ T cell responses. J Exp Med 2003;198:889-901
Szamel, M, Appel, A, Schwinzer, R and Resch, K. Different protein kinase C isoenzymes regulate IL-2 receptor expression or IL-2 synthesis in human lymphocytes stimulated via the TCR. J Immunol 1998;160:2207-2214
226
Chapter 7
Taams, LS, Smith, J, Rustin, MH, Salmon, M, Poulter, LW and Akbar, AN. Human anergic/suppressive CD4(+)CD25(+) T cells: a highly differentiated and apoptosis-prone population. Eur J Immunol 2001;31:1122-1131
Takahashi, T, Kuniyasu, Y, Toda, M, Sakaguchi, N, Itoh, M, Iwata, M, Shimizu, J and Sakaguchi, S. Immunologic self-tolerance maintained by CD25+CD4+ naturally anergic and suppressive T cells: induction of autoimmune disease by breaking their anergic/suppressive state. International Immunology 1998;10:1969-1980
Takahashi, T, Tagami, T, Yamazaki, S, Uede, T, Shimizu, J, Sakaguchi, N, Mak, TW and Sakaguchi, S. Immunologic self-tolerance maintained by CD25(+)CD4(+) regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. Journal of Experimental Medicine 2000;192:303-310
Tang, Y, Hugin, AW, Giese, NA, Gabriele, L, Chattopadhyay, SK, Fredrickson, TN, Kagi, D, Hartley, JW and Morse, HCr. Control of immunodeficiency and lymphoproliferation in mouse AIDS: studies of mice deficient in CD8+ T cells or perforin. Journal of Virology 1997;71:1808-1813
Tang, Y, Kim, WK, Holmes, KL, Hugin, AW, Kenny, JJ, Chattopadhyay, SK, Hartley, JW and Morse, HCr. Contribution of B cell subsets to delayed development of MAIDS in xid mice. Cellular Immunology 1995;165:1-6
Tawara, I, Take, Y, Uenaka, A, Noguchi, Y and Nakayama, E. Sequential involvement of two distinct CD4+ regulatory T cells during the course of transplantable tumor growth and protection from 3-methylcholanthrene-induced tumorigenesis by CD25-depletion. Jpn J Cancer Res 2002;93:911-916
Testi, R, D'Ambrosio, D, De Maria, R and Santoni, A. The CD69 receptor: a multipurpose cell-surface trigger for hematopoietic cells. Immunol Today 1994;15:479-483
Thompson, C and Powrie, F. Regulatory T cells. Curr Opin Pharmacol 2004;4:408-414
Thornton, AM and Shevach, EM. CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. Journal of Experimental Medicine 1998;188:287-296
Tivol, EA, Boyd, SD, McKeon, S, Borriello, F, Nickerson, P, Strom, TB and Sharpe, AH. CTLA4Ig prevents lymphoproliferation and fatal multiorgan tissue destruction in CTLA-4-deficient mice. J Immunol 1997;158:5091-5094
Torbett, BE and Mosier, DE. Does preferential Th subset activation contribute to the murine acquired immunodeficiency disease (MAIDS)? Research in Immunology 1994;145:696-701; discussion 701-692
Tordjman, R, Lepelletier, Y, Lemarchandel, V, Cambot, M, Gaulard, P, Hermine, O and Romeo, PH. A neuronal receptor, neuropilin-1, is essential for the initiation of the primary immune response. Nat Immunol 2002;3:477-482
Trani, J, Moore, DJ, Jarrett, BP, Markmann, JW, Lee, MK, Singer, A, Lian, MM, Tran, B, Caton, AJ and Markmann, JF. CD25+ immunoregulatory CD4 T cells mediate acquired central transplantation tolerance. J Immunol 2003;170:279-286
Trowbridge, IS and Thomas, ML. CD45: an emerging role as a protein tyrosine phosphatase required for lymphocyte activation and development. Annu Rev Immunol 1994;12:85-116
Tse, KF, Morrow, JK, Hughes, NK and Gallicchio, VS. Stromal cell lines derived from LP-BM5 murine leukemia virus-infected long-term bone marrow cultures impair hematopoiesis in vitro. Blood 1994;84:1508-1518
227
Chapter 7
Tsuji, NM, Mizumachi, K and Kurisaki, J. Antigen-specific, CD4+CD25+ regulatory T cell clones induced in Peyer's patches. Int Immunol 2003;15:525-534
Uehara, S, Hitoshi, Y, Numata, F, Makino, M, Howard, M, Mizuochi, T and Takatsu, K. An IFN-gamma-dependent pathway plays a critical role in the pathogenesis of murine immunodeficiency syndrome induced by LP-BM5 murine leukemia virus. International Immunology 1994;6:1937-1947
Umemura, M, Nishimura, H, Yajima, T, Wajjwalk, W, Matsuguchi, T, Takahashi, M, Nishiyama, Y, Makino, M, Nagai, Y and Yoshikai, Y. Overexpression of interleukin-15 prevents the development of murine retrovirus-induced acquired immunodeficiency syndrome. Faseb J 2002;16:1755-1763
Vahlenkamp, TW, Tompkins, MB and Tompkins, WA. Feline immunodeficiency virus infection phenotypically and functionally activates immunosuppressive CD4+CD25+ T regulatory cells. J Immunol 2004;172:4752-4761
Vieira, PL, Christensen, JR, Minaee, S, O'Neill, EJ, Barrat, FJ, Boonstra, A, Barthlott, T, Stockinger, B, Wraith, DC and O'Garra, A. IL-10-secreting regulatory T cells do not express Foxp3 but have comparable regulatory function to naturally occuring CD4+CD25+ regulatory T cells. Journal of Immunology 2004;172:5986-5993
Waidmann, M, Allemand, Y, Lehmann, J, di Genaro, S, Bucheler, N, Hamann, A and Autenrieth, IB. Microflora reactive IL-10 producing regulatory T cells are present in the colon of IL-2 deficient mice but lack efficacious inhibition of IFN-gamma and TNF-alpha production. Gut 2002;50:170-179
Wakkach, A, Cottrez, F and Groux, H. Can interleukin-10 be used as a true immunoregulatory cytokine? Eur Cytokine Netw 2000;11:153-160
Wakkach, A, Fournier, N, Brun, V, Breittmayer, JP, Cottrez, F and Groux, H. Characterization of dendritic cells that induce tolerance and T regulatory 1 cell differentiation in vivo. Immunity 2003;18:605-617
Walchner, M, Leib-Mosch, C, Messer, G, Germaier, H, Plewig, G and Kind, P. Endogenous retroviral sequences in the pathogenesis of systemic autoimmune disease. Archives of Dermatology 1997;133:767-771
Waldmann, H, Graca, L, Cobbold, S, Adams, E, Tone, M and Tone, Y. Regulatory T cells and organ transplantation. Semin Immunol 2004;16:119-126
Walker, MR, Kasprowicz, DJ, Gersuk, VH, Benard, A, Van Landeghen, M, Buckner, JH and Ziegler, SF. Induction of FoxP3 and acquisition of T regulatory activity by stimulated human CD4+CD25- T cells. J Clin Invest 2003;112:1437-1443
Walunas, TL and Bluestone, JA. CTLA-4 regulates tolerance induction and T cell differentiation in vivo. J Immunol 1998;160:3855-3860
Wang, Y, Ardestani, SK, Liang, B, Beckham, C and Watson, RR. Anti-IL-4 monoclonal antibody and IFN-gamma administration retards development of immune dysfunction and cytokine dysregulation during murine AIDS. Immunology 1994;83:384-389
Weiner, HL. Induction and mechanism of action of transforming growth factor-beta-secreting Th3 regulatory cells. Immunol Rev 2001;182:207-214
Weiner, HL. The mucosal milieu creates tolerogenic dendritic cells and T(R)1 and T(H)3 regulatory cells. Nat Immunol 2001;2:671-672
Weiss, L, Donkova-Petrini, V, Caccavelli, L, Balbo, M, Carbonneil, C and Levy, Y. Human immunodeficiency virus-driven expansion of CD4+CD25+ Regulatory T cells Which Suppress HIV-specific CD4 T-cell Responses in HIV-infected Patients. Blood 2004;
228
Chapter 7
Wildin, RS, Ramsdell, F, Peake, J, Faravelli, F, Casanova, JL, Buist, N, Levy-Lahad, E, Mazzella, M, Goulet, O, Perroni, L, Bricarelli, FD, Byrne, G, McEuen, M, Proll, S, Appleby, M and Brunkow, ME. X-linked neonatal diabetes mellitus, enteropathy and endocrinopathy syndrome is the human equivalent of mouse scurfy. Nat Genet 2001;27:18-20
Wildin, RS, Smyk-Pearson, S and Filipovich, AH. Clinical and molecular features of the immunodysregulation, polyendocrinopathy, enteropathy, X linked (IPEX) syndrome. J Med Genet 2002;39:537-545
Wilson, SB, Kent, SC, Patton, KT, Orban, T, Jackson, RA, Exley, M, Porcelli, S, Schatz, DA, Atkinson, MA, Balk, SP, Strominger, JL and Hafler, DA. Extreme Th1 bias of invariant Valpha24JalphaQ T cells in type 1 diabetes. Nature 1998;391:177-181
Wing, K, Ekmark, A, Karlsson, H, Rudin, A and Suri-Payer, E. Characterization of human CD25+ CD4+ T cells in thymus, cord and adult blood. Immunology 2002;106:190-199
Wing, K, Lindgren, S, Kollberg, G, Lundgren, A, Harris, RA, Rudin, A, Lundin, S and Suri-Payer, E. CD4 T cell activation by myelin oligodendrocyte glycoprotein is suppressed by adult but not cord blood CD25+ T cells. Eur J Immunol 2003;33:579-587
Wood, KJ, Luo, S and Akl, A. Regulatory T cells: potential in organ transplantation. Transplantation 2004;77:S6-8
Wood, KJ and Sakaguchi, S. Regulatory T cells in transplantation tolerance. Nat Rev Immunol 2003;3:199-210
Xu, D, Liu, H, Komai-Koma, M, Campbell, C, McSharry, C, Alexander, J and Liew, FY. CD4+CD25+ regulatory T cells suppress differentiation and functions of Th1 and Th2 cells, Leishmania major infection, and colitis in mice. J Immunol 2003;170:394-399
Yee, ST, Abe, E, Okada, Y, Matsuura, Y, Takebe, Y, Ogasawara, K, Takahashi, H and Mizuochi, T. A polypeptide encoded within the murine AIDS defective virus stimulates primary proliferation of CD8+ T-cells. Immunology Letters 1997a;55:93-98
Yee, ST, Okada, Y, Ogasawara, K, Omura, S, Takatsuki, A, Kakiuchi, T, Muno, D, Kominami, E and Mizuochi, T. MHC class I presentation of an exogenous polypeptide antigen encoded by the murine AIDS defective virus. Microbiology & Immunology 1997b;41:563-570
Yetter, RA, Buller, RM, Lee, JS, Elkins, KL, Mosier, DE, Fredrickson, TN and Morse, HC. CD4+ T cells are required for development of a murine retrovirus-induced immunodeficiency syndrome (MAIDS). Journal of Experimental Medicine 1988;168:623-635
Zelenika, D, Adams, E, Humm, S, Graca, L, Thompson, S, Cobbold, SP and Waldmann, H. Regulatory T cells overexpress a subset of Th2 gene transcripts. J Immunol 2002;168:1069-1079
Zheng, SG, Wang, JH, Gray, JD, Soucier, H and Horwitz, DA. Natural and induced CD4+CD25+ cells educate CD4+CD25- cells to develop suppressive activity: the role of IL-2, TGF-beta, and IL-10. J Immunol 2004;172:5213-5221
Zuany-Amorim, C, Sawicka, E, Manlius, C, Le Moine, A, Brunet, LR, Kemeny, DM, Bowen, G, Rook, G and Walker, C. Suppression of airway eosinophilia by killed Mycobacterium vaccae-induced allergen-specific regulatory T-cells. Nat Med 2002;8:625-629
229
