selected projects

Anna Ulahelová

2005–2012

rate of bookbrochures, adjustment of small printedmatter, combining writing and painting, rate text

type of project

multimediainteractive, use of digital technologies,web page, animation, motion design

visual identity / stylelogo design, complex visual concept ideas to promote a diverse institution and service, campaign

typographywork with type, design a new font

infographicsinstructions, maps, graphs

packaging design decorative, protective, efficient, promotingand creative too

comicsvisual concept (illustration), a story dramaturgicalline, diversified processing

poster attention to social problems but also cultural events, approach the atmosphere of the event or problem that has to attract attention

author‘s object / installationreflection of the world around me,a new confrontation, subjective concept

year of manufacture

project dimensionsin cm

2012

2010

2011

2005

2009

2008

2007

2006

11

6

Error 404:Anka can notbe displayedweb

In my project, I focus on the issue of presentation

of women in the mass media (in advertising, television

as well as in magazines or on the Internet). I refer to

the amount of information, guides and products, which

the woman is overwhelmed daily and which submit to her

how to manage her life to be the perfect mother, housewife,

partner, lover, and thus the good woman. I focus on research

and summarize these models and ideals, which I apply to

a woman‘s own personality. I generalize my own subjective

critical opinion and present it people for evaluation in the form

of interactive web pages. Here I give everyone the space to test

themselves and confront both my attitude and other people‘s

opinions. The result is a public research and statistics on the

extent to which other women identify with me and what men

can accept in a woman. The importance of this work is to

alert the public to the phenomenon of creating artificial ideal

women, while forcing a general reflection on the extent to

which the media affect us and how much we are aware of this

problem.

Bachelor‘s project / installation

Bachelor‘s project / the way of the web site

Encyclopedic book was created in the last semester of subject

Practical Typography (short PRTY). The task was to work

with information (or works) of individuals who took part in this

process and process them to any form. I decided to create a

sort of dictionary, in which it would be possible to look at some

of the individual information about each of us. The base is to

divide the site into three parts (information) - personal data, me

and prty, additional terms. These three spheres interrelate and

22

15,5

one refers to another - for example if there is a foreign

term in the job description the reader has the option to search

in another part its meaning or the related link. The whole book

is perforated. The reader has the opportunity to work with book

by various ways - to divide it into parts, which could be leafed

through individually, or to note information that caught his

attention by making a tear. The book is made and

sewn by hand.

PRTY-PEDIAbook

Inspiration through the window that pops up on your computer

when you download something. In this case, however, you flay

a poor rabbit! What will you do? Here, a single click stops all.

But the decision is up to you.

stop fursa poster for the competition

59,4

89,4

Poster was awarded third place in the Czech round of

international competition DAF-Design Against Fur.

Internet poster, which you can move the mouse over

and then typical slogans and symbols of the Velvet

Revolution appear at the heads of the crowd, including

how the revolution started. In the crowd you can

cross out Husak or discover Vaclav Havel with the

motto Truth Prevails!

interactive poster at the 20thanniversaryof the VelvetRevolution

My intention was that the magazine apart from the information

funktion also has any other practical use for students. And

because the magazine informs about the various events that

have been or will be, I decided to make it partly the diary of

every month. From inspiration by the form of diaries

I depended on the individual elements of the magazine - how

to read upside-down, use the calendar on the cover instead

of content, modular grid at a type matter of texts and images.

The magazine is enriched with pages with the structure of

pictograms that are used to write various notes, appointments,

writing homework, etc. I chose a smaller format that easily fits

into every bag.

informationsheets for the Faculty of Architecture STUBratislavadesign of magazine

21

14,85

The proposal received awards for innovative

processing.

Designs of New Year cards for nursing home Sue Ryder

Home in Prague. From details of a warm sweater I created

motifs typical for Christmas time. The home subsequently

offered these cards for a fee to companies that can become

his sponsors.

10,5

14,85

New Year Card for nursing home

tapewormsauthorbook

23,5

18

A story of a man, who is gradually eaten through

by tapeworms. It is a string that pierces the entire book

and has no end or beginning.

A series of logos for three years of Biathlon

Championships in Nové Město na MoravěBiathlon

is a sport that combines speed and accuracy. As a central

theme, I chose the number representing the year when

the ‒ championship is held and the motive of the shooting

trace typical black dots. Logo does not stay the same

for all three years,I used the motive of the shooting until

almost completely shoot numbers into pieces. Brands

vary, but their interdependence is also clear.

Logo design for a non-profit organization for visually

impaired KAFIRA I used a finger print as the theme

‒ as a symbol of sense of touch,as a substitute sense for

communication with the surroundings. The letters are

intentionally illegible, out of focus, like we would see badly

ourselves..

EIGE ‒ International Organization for gender equality

Two „e“, which are facing each other in an inscription,

are a male (with legs) and a female (with a skirt). They

communicate together with each other and stand on a

swing, which holds in a horizontal position = symbol of

equal rights for both sexes. Both „e“ are equal.

The map shows my personality as a part of various social

or geographical environments. It starts from the widest one,

I as a person = a small dot among millions of dots. The record

proceeds with next stages as I – a citizen, I – a student,

I – a sister… the dot gradually expands and defines itself and

remains the only one - I as me, as Anna Ulahelová.

70

100

map of auexistentialrecord

Screen printing posters printed on grease paper,

installed on the window of each other.

Development of consumption of Czech householdssampler datavisualization

In the project I proceeded from the annual reports issued by

the Ministry of Environment, which charts the development

of consumption of Czech households in the last 25 years.

My intention was to revise the often dry and cold data into

attractive forms that would be suitable for reading or for looking

through. It should attract people, who are otherwise bored by

reading austere lists of data and graphs. Graphs are devoted

to various thematic areas of consumption, from economic

factors over specific areas of household consumption

(food, appliances, water, ...), to impacts, which household

consumption includes . I tried to handle thirty selected graphs

with the different media. I was looking the formal solution at the

picture, vector graphics, drawing, etc. The aim was to try out

different solutions of graphic visual record data and information,

while also to try to handle varying degrees of abstraction rate

(from completely clear charts with reference to the specific

topic of data, to the complete data abstraction

without visual context).

The resulting catalog can act as a picture,

annual reports, it is also a graphic sampler

of different methods of processing information.

16

21

rococosanitary towelstextile objects

A series of sanitary towels inspired by the rococo style.

I responded to the absurdity of making aesthetic objects

disposable things . Inspiration in rococo style, that was full of

luxury and kitsch, is not random. Almost everything, by what a

person was normally surrounded, was unnecessarily beautified

in this style. The same absurdity, I tried to transfer on my objects.

Installed in Textile Miniature Exhibition at Gallery X

in Bratislava, the 2009th.

An object that looks like a screen or a container for eggs.

I placed 44 eggs into the pockets that hold the eggs in any

direction - up or hanging sideways and downwards. The

object is created from one piece of cardboard plastered with

colourful foils. Pockets of hard cardboard are strong enough

to keep the eggs separately. This method could be applied in

the production of a more functional packaging. (However, my

intention was to develop ideas of more aesthetic environment

of poultry farms in our country.)

the ovarypackagingfor eggs

The packaging was selected and presented in the

exhibition and catalog of competition Young Package

2007th.

pocket

9

9

1201201200202200

120

80

11

36

The main idea in the design of the calendar, was to relieve all

hypochondriacs their constant trauma of what disease they

have probably caught. I found a variety of typical sayings for

each month, which I subsequently transformed. In my calendar

they predict what disease we can expect in some days instead

of weather, for instance St. Anne - cold in the morning. This

way hypochondriac is prepared in advance what to expect.

I chose to use a package of tissues for the calendar. Each

month is printed on a single tissue. The calendar also serves

as an elegant accessory of hypochondriac`s image. Thanks to

its practical packaging they may have it at any time with them

and watch the current status.

hypochondriac calendar

181818181818818

22222222222222222

ThThThThThThTThe e e e e ee cacacacacacaatatatatatatttataalololololololooooooguguguguguguggue e e ee e ee anananananana dddddddd prprprprprprprpprpppromomomomomomommommomotototototototo ioioioioioiooooonananananannn lllll mamamamamamamamamatetetetetetetet riririririrr alalalalalalallaaa ssssssss weweweweweweweweeeeeeererererererererere ccccccccrerererererereerereeatatatatatatataaa ededededededed

totototottooto mmmmmmmararararara k kk k kkk ththththththtthe ee e ee fiffiffiffiffifffiftetetetetet enenenenennnthththththththh aaaaaaannnnnnnnnnnnnnivivivivivvvererererererrsasasasasasaaryryryryryryyryryy ooooooof f f f f ffff thththththththhhhhe ee eeee ee CeCeCeCeCeCeCentntntntttntntnttrararaararaararaaaal l ll l l lll ScScScScScScSccScS hohohohohohohohohohoooh oolololololololoo

ofofofofoffofof AAAAAAAArtrtrtrtrtrtr iiiiinnnnn OpOpOpOpOpOpOpOO avavavavavvva.a.a.a.a.aa.aaa TTTTTTTThehehehehehehheeh aaaaaaaimimimimimim ooooooooofff f f thththththht e e e e e eeee cacacacacacacc tatatatatatatataaalololololoolloguguguguguguggggue e e eeee wawawawawawawwawas s s s s ss tototototooototoo iiiiinfnfnfnfnfnfnfnffnnnfoorororororororoormmmmmmmmmmm

thththhthththht e e e eee pupupupuppupupuppublblblblblbbblbb icicicicicicc,,,,, orororororoo ttttttthohohohohohoseseseseseseseee wwwwwwisisisisissishihihihihihiiiiihingngngngngnng tttttttoooooooo stststststststtsts udududududuudy y y y y yyy atatatatatata oooooooooourururururururrr sssssssssschchchchchcchhooooooooooooooool.l.l.l.l.l

InInInInnInn mmmmmmmy y y y y yy cocococoococoncncncncnccncepepepepeeepeepptititititionononononononoo ,,,,,, I I I II fofofofofooocucucucucucuccuuseseseseseses d d d ddd dd onononononononon ttttthehehehehehheeeh pppppppprererererereeeesesesesesesesessesentntntntntntttntttatatatatattaa ioioioioioooiiiii n nnnnnn nnn ofofofofofofoo

wowowowowowowowowowoowow rkrkrkrkrkrrkrkrkr s s ss sssss bybybybybybybybybyyyy ssssssstututututututudededededeedeentntntntntnnnnnnnn s s s s s inininininninin aaaaaaaalllllllllllll ttttttthrhrhrhrhrhrhrhrreeeeeeeeeeeeee ddddddddddisisisisisissssscicicicicicc plplplpplplpplinininininninineseseseseesesesee (((((((totototototootoy,yy,y,y,yyyy ggggggrarararararaaraaaaphphphphphhhphphp icicicciciciciccccs,s,s,s,s,s,s,

dededededededededddd sisisisisisisiiisis gngngngngngngngnggngnn),),),),),),),),),)) aaaaaaaaasssssss wewewewewewewellllllllllllllll aaaaaaaaas s s s s ononononononooooo sssssssssupupupupuppuuuupuppopopopopoppppp rtrtrtrtrtrtrttttinininininiinng g g gg gggg thththththtthe e e e e e imimimimimimmmimimpopopopopopopportrtrtrtrttttrtrtanananananananannt t t t ttt

sussusususususususussuuubjbjbjbjjbjececeecececcecece tststsstsststststss aaaaaaaandndndndndndnd aaaaaactctctctctcttivivivvivivvvvititittitititieieieieieeeees s s s s wiwiwiwiwiwiww thththththththt ininiininin ttttthehehehehehehh ssssschchchchchchhchhchhchhooooooooooooooooo l.l.l.l.l.l.. IIIIIII uuuuuuuusesesesesesesees ddddddddd thththththhhhhhhhhhhttt eeeeeee

thththththththhhthhtthemememememememememeememe e e e e eeeeeeeee oofofofofoofofooofoffo aaaaaaaaaa gggggggriririririririd d d d dddd asasasasasass ttttttttheheheheheheee aaaaaaaacccccccccccccccccomomomomomomomomoooo papapapapapaappanynynynynynynynyyinininininnnnnnnggggggg eleleleleleeleelele emememememememmemeee eneneneneneneneneennt t t t ttttt whwhwhwhwhwhwhwhwwhw iciciciciccccchhhhhhh

rerererererereerrereflflefleflflefleflflefleflefleeectctctctctctctcttcts s s sss s dididididiididid fffffffffffffffferereererrerere eneneneneneneneenencececececececec s s s s sss inininnnin iiiiindndndndndnndndivivivivivivivivi idididididididuauauauauauauauauuau llllll fiefiefiefiefiefiefiefififi ldldldldlddsssssss anananananaaa d d d d d ddd seseseseseseseseepapapapapapapapap rarararararararaatetetetetetetettetetessssssssss

ththththhthhhhhemememememememememme fffffffffrororororororororoom mmmm mmmmmmmm eaeaeaeaeaeaaeeaeae chchchchchhchchchchchchhh ooooooththththththththhererererererrr.... PlPlPlPlPPlPlPPPPPPPlPP ayayayaaayayayaayinininininng g g g ggggggg wiwiwwiwiwwwwiwww ththththththhhththhthhh sssssssscrcrcrcrcrccrcreeeeeeeeeeeeeee nsnsnsnsnsnsss IIII ttttttttriririririrr ededededededddddedd tttttttto o oooo o ooooo

evevevevevevevevevevokokokokokokokokokokkokoke e e e e e eeeeee thththththhthhhththheee ee eee e ee fefefefefefefefefefefeefeeleleleleleleleleeelele ininininininiing g g g gg ggg ofooofofofofofofofofoof wwwwwwwwanananannnananananndedededededddeeeeriririririrrr ngngngngnggngggngggn oooooooooof f ff f f f pipipipppipiecececececece esesesesesesss ooooooooof fff f ff papapapapaapappp pepepepepepepper r rrr rrr ovovovovovovvvvererererererereeeerer

ththththhhhthhhemememememememmseseseseseeeelvlvlvvllvvlvlvvvvvveseseseseseesesesessesse ..... InInIIInInInInInInInteteteeetetetetteeteetetererererererererererereeeeerer ststsstststststststss ininininnnnngggggggggggg spspspspspspsspacacacacacacacesesesesesesees wwwwwwwererererrererre e e e e eeeeeee crcrcrcrcrcrcrcreaeaeaeaeaeaeaeaaatetetetetettett d d d d d dd fofofofofofofofor r r r rrrrrr ththththththththththtthhhhe e ee e e e

slslslslsssss idididdidddddddesesesesssesesesshohohohohohoow.w.w.ww.wwwwww. EEEEEEEEEEveveveveveveevevevevevveveryryryryryyrryryyy dddddddddddddddisisisisisisscicicicicccic plplplpplplplp inininininininine e ee e e eeee ininininininininininnnn ttttttttthehheheheheheheheeehehee cccccccccatatatatatattaaa alalalalalalaa ogogogogogogoo ueueueueueueue hhhhhhhhhasasasasasasasasasssssss aaaaaaaaa fffffffffffololololollloloooo dddddddddddd ininininininnnii

ththththththhthttthhhe e e e eeee seseseseseseseesss cococococococoocococ ndndndndndndndndndndndddn ppppppppppppagagagagagagagagagagage eeee e e e (i(i(i(i(i(i(i((i(i(i(((ie e ee e ee e eee eeeee trtrtrtrttrtrtt ipipipipipippppplelelelelelelelele pppppppppppagagagagagagage)e)e)e)e)e)e)e)))e) ttttttttttooooooooooooooo eneneneneenennnabababaaabababableleleleleeleeleeleeeeeee ttttttheheheheheheeehehehhhee rrrrrreaeaeaeaeaeaeaeaeeeaeaaaaaadededededededededeeeer r rrr totototototottoo

gegegegeeeeet t t t tt a a a aa aa cocococoooooompmpmpmpmpmpmmpmpmpmpprerererereerererreereeeheheeheheeheheheheheeeeeensnsnsnsnnsnsnsnnnn iivivvvvviviivvive e e eeee lololololololookokokokokokokokkoko aaaaaaaat t t tt t t tt t ththththththhtththttt e e eeeee eeeee wowwowowowowoorkrkrkrkrkrkrkkkkkrrkrkrkrk oooooooooof f ff f f fffff eaeaeaeaeaeaeaeaeaeaeaeeeee chchchchchhchhhhhhchchhh dddddddddisisisisissisisisisciciciciccicciciiplplplplplplplplp ininininininnnni e.e.e.e.ee.e.eeeeeee

ThThThThThhhThhhisisisisiiiiii wwwwwwayayayaayayayayaayyy IIIIII gggggggggotootototototto aaaaaaaa bbbbbbbbbbbigigigigigiggigggiggggigggggegegegegegegegegeeeggeeeeeg r rr r rr r rrrrrr spspspspspsspsppacacacacacacacacacaccacace e ee ee e eeeee totototototototootooo wwwwwwwwwwororororororooo k k k k kkk wiwiwiwiwwiwwiththththththththhh iiiiiiiiiiimamamammamamamamammm gegegegegeegegegegggg s ss s s ssss

momomomoomomm rerererererrree dddddddynynynynyynyyyyynyynynyy amamamammmammaammmmicicicicicicicccicicalalalalaalalalaaa lylylylylylylylyly.. ThThThThThThThThThThThThTTTTT e e e e e eeeee e e vivivivivivvivisussusususususussusususualalalaaalalaal bbbbbbbbbbbbbbbrararararararararrraraarandndndndndndnnddndnddnddd HHHHHHHHHHHHHH ++++++++++++ GGGGGGGGGGGG ++++++++++ DDDDDDDDD wwwwwwwwwwwasasasasasasasasasassasa aaaaaaaaaalslslslslslslslssso o o o o oo

bababababbbbbbbb seseseseseseseeedddddddddddd ononononononnnonononnonnonon tttttttthehehehehehehehehhehehhee ggggggggggririririiririiriidsdsdsdssdsdsdsdsssdsdsdsds aaaaaaaaaandndndndndddndnddd eeeeeeeeeeeexpxpxpxpxpxxpxxpxpxpxpxpprererererererereererereressssssssssssssssssssesesesesesesesesesee tttttttthehehehehehehehheeeheh sssssssspepepeeepepepeppeecicicicciciciciccccc ficficficfificficficficficficcs s s ss ss ss ofofofofofofofofofoo eeeeeeeeacacacacacaccacacccacaa hhhhhhhhhhhhhh

fiefiefiefiefifiefi ldldldddlddlddddd... I I I I I alalalaaalalsosososososososossososo uuuuuuuuseseseseseeeseseeesesed d ddddd ddddddd ththththththhtthheeeeeeeeee acacaaacacaccaccacaacacroroorororororororoooroooonynynynynynynynynyyynynynynnym m mmmmmmmmm m mm aanananaanannaaa dddddddddd thththththththhththhththe eeeee eeee e e ee scscscscscscscscsscrererrrerereerererereeenenenenenennenenenenns ss ss s ssss tototototototototooo cccccccccrrerrererererereatatatatatatatatatttte e e ee eeeee

susususususupppppppppppppppororororooororo tititiititiitingngnngngnngngngngnggngnggnggg ppppppppppprororororororoomomomomomomomommomomomotitititititttit onononononononononnooooonalalalalalalalaa mmmmmmmatatatatatatatatatataatererererererererere iaiaaaaiaiaiaaaiaialslslslslsslsllsssl ----- ppppppppppppososososososososososostctctctctctctcctctccararararararaarraraaa dsdsdsdsdsdsdsdsdssdss,,,,, ininininininnnnviviviviviviviviviv tatatatatatataataataaaatititititititittittiononononoonononononono s,s,s,sss,,s,s,s,

bobobobbobbbb okokokokkokokkokkkokmamamamamamaaaaammmamam rkrkrkkkrkrkrkrkkkrks,ss,s,sssssssssss,s ……………………

catalogueand promotional materials for the Secondary School of Art in Opava

Brand for the company of my dad, who is engaged in

hydrogeology and searching for water. Purely typographic

elements I tried to express the elements water and earth.

hydro-geologo

the second method to use /

side by side, black and white version

Animated interactive robot ‒ Chicken 009 ‒ was created within

the subject of multimedia. I took a photo and animated a real

(frozen) chicken, which in all four views, walks, stands, takes

off, flies down, speaks. In aplication (produced by Huba)

was then possible to connect more robots, that moved on

to various commands over the surface. Our task was to put

robots created by two people into any environment and create

a short story.

chicken 009an interactiverobot

animating chicken

The book consists of illustrations of Karel Plihal`s comments,

which entertain an audience between songs during concerts.

They are often absurd games with words, the ordinary things

of ordinary life. I conceived my illustrations in various ways

depending on what is suited to each verse.

The book is hand made and bound.

50 messages by Karel Plihalbook 15

11

posterfor the film festivalArt Film Fest

17. 6

. – 2

5. 6

. 201

1

The main theme of this year was „Dangerous Children“.

The section included films about children who, however, already

struggle with problems of adult world and are forced to mature

early. In the design of the poster, I wanted to capture the

contrast between children and adults, between naive and rough.

For the expression of my idea, I searched various objects,that

would also match the shape of the letters of the name. The title

became the bearer of the idea of the festival.

20 minutes of public transport seat‘s lifecomics

The story is captured from the perspective of public transport

seat ‒ constantly changing passengers` backs, belongings,

touching hands. The comics is printed by linocut technique

on a long strip of fabric, which is scrolled when watching and

evoces movement while driving.

17

576

The book was based on short texts and messages (for)

Mr. Tosenovsky. It was mostly a joke of the school environment,

as well as wisdom from everyday life. Lightweight text

allowed playful processing. I focused mainly on working with

typography, accompanied by a small cartoon motifs. Simple

heterogeneously processed image poems to cheer us up

every day were formed.

12

16

Advicesl,wisdomand piffle,jokesbooklet

The project for the exhibition of our department in the Slovak

National Gallery, where we reflected a variety of issues and

questions concerning this institution. My intention was to

highlight the rigidity and conservativeness with which it is

perceived. Into the alternative space of a cup, I diversely set

letters SNG giving a series of logos and links related to the

operation of the gallery. The result of my generative work -

punk collage - reminds a desk with designs how this major

cultural institution could be set into motion and more open to

people. „SNG is not dead,“ or rather, it would not be if they did

not want to.

SNG‘s not deadinstallation

applicationsfor opening jars

This project was purely created as a fictional matter for the

band Snow on the staircase. The packaging is designed as

a snowman‘s body. When we open it we can find the CD, the

booklet with lyrics and illustrations of the band sailing in the

snowman`s stomach. My goal was to test the package, which

would carry the story and was conceived in some unusual way.

I used the hard printed paper as the material.

22

21

creativecd cover for the musicgroup Snow on the stairs

stop furs no.2a poster for the competition

The inscription HELP as a hole in the fence, as an

opportunity to escape… what more to say.

Everyday event narrated in two versions. I was born on Friday,

the 13th, which to some extent affects my life nearly every step.

But maybe it‘s just about the extent to which you admit this

fact yourself? In the first version of my story it is a completely

normal situation ‒ I drive past a fast food stand, buy a hot

dog, eat it and still go on. I confront this version with the other,

which turns the incident into a paranoid angle, when the 13 as

a symbol of bad luck is reflected in everything around me ‒ the‒length of the park, dog weight, price… . The story emphasizes

quite different motives and inevitably ends catastrophically

in contrast to the first version.

thirteenthsausagecomics

The tanngram strip was created

by folding and cutting paper strip

at an angle of 45 °. As a tangram

puzzle this font provides lots of shape

combinations. The user can compose

individual letters and words according

his imagination and create more new

geometric composition.

Lego Little Red Riding Hoodinteractive fairy tale

The fairy-tale was created within the subject of multimedia.

In the space of a cube we created an environment and using

walls and panels we defined a concrete space. It was up to us

how to divide and process it visually. I created a Lego world

into which I put a classic story of Riding Hood. I conceived

individual panels as a story illustration, some contain more

images, they are like animated. The text is written in passages

(always refers to a specific panel) and provides a link to the

next or previous theme. Thanks to it the reader moves in the

virtual space as in the book.

FOR OPAVAvisualidentity

Civic Association, which deals with environmental issues in

Opava and its surroundings. The association has set itself

the goal to inform people about current issues of life and

environment in the town which directly concern citizens.

The association organizes open discussions, lectures, mainly

trying to communicate with people and to solve the concrete

situation. My logo is a response to this main objective and it

consists of question marks, exclamation marks, parentheses,

pauses,… It encourages communication.

The proposal was selected in competition. The association

is still present it

The multipurpose hammer is a product of joint workshop with

product designers on the theme „Working for Kremnica.“

We had to create a product inspired by this place and its

specifics. In joint work with Lubica and Janka we came out

of character for a typical working day, which is located in

the village coat of arms and points to its mining tradition.

Instructions were created under my direction as a humorous

illustration tool with diverse examples of the use of hammers.

pro

du

ct

multi-purpose hammerinstructionsfor use

han

db

oo

k

6

6

I focused my project on the problem of people‘s relationship

to public space. This space belongs to everybody, and to

nobody but the people often do not really know how they

can and should behave there. My goal was to realize the

public space as a place of which we are willy-nilly part every

day. In Bratislava we can find a lot of spaces, which we just

go through quickly and we rather not even want to see and

perceive it. Through a placard with the inscription ‒ a call for

action, notices and questions - I tried to make everyone to have

a think about their own indifference to these sites. A poo, as

the main symbol of communication, should point out that there

is something wrong and to encourage people‘s self-interest

and effort for more well-kept and pleasant urban spaces.

THE PUBLICSPACEaffects us allcampaign

round-robinthe conceptof the exhibition

Dramaturgy of the exhibition MADE TOGETHER is conceived

as a guide how to cook a common exhibition from our

works. The procedure begins with the shop where the visitor

according to the list of things purchases the necessary raw

materials (our work on the shelves). Finally, he cooks common

exhibition food according to a recipe (catalogue) at home.

I presented the concept by means of posters which illustrate

the cooking process in 2D through their interactions (due to

possible plucking perforating) .

series of six posters A1 (89,4 x 54,9)

Comics, whose main character ‒ a stain Kiclík ‒ embodies

the features of my personality. It is mainly about my infamous

bad luck. Everything that comes into my hands,I mostly

dirty, smudge or damage. And so Kiclík`s life ‒ like my‒life ‒ is not easy. He goes from trouble to trouble, gleeful

bad luck accompanies him everywhere everyday. That is his

story. I realized the comics on a tablecloth. I worked with real

ingredients like the jam, cheese, tomato…

Kiclíkcomics

120

80,5

Second updated edition of the portfolio

hand binding, typesetting,

editing: Anna Ulahelová

printed: Devin print

paper: Munken Pure

selected projects2005 – 2012Anna Ulahelová