MOLECULAR AND CELLULAR MECHANISMS OF DISEASE

Polycystin-1 but not polycystin-2 deficiencycauses upregulation of the mTOR pathway and can besynergistically targeted with rapamycin and metformin

Djalila Mekahli & Jean-Paul Decuypere & Eva Sammels & Kirsten Welkenhuyzen &

Joost Schoeber & Marie-Pierre Audrezet & Anniek Corvelyn & Georges Dechênes &Albert C. M. Ong & Martijn J. Wilmer & Lambertus van den Heuvel & Geert Bultynck &

Jan B. Parys & Ludwig Missiaen & Elena Levtchenko & Humbert De Smedt

Received: 17 May 2013 /Revised: 30 September 2013 /Accepted: 21 October 2013# Springer-Verlag Berlin Heidelberg 2013

Abstract Autosomal dominant polycystic kidney disease(ADPKD) is caused by loss-of-function mutations in eitherPKD1 or PKD2 genes, which encode polycystin-1 (TRPP1)and polycystin-2 (TRPP2), respectively. Increased activity ofthe mammalian target of rapamycin (mTOR) pathway hasbeen shown in PKD1 mutants but is less documented forPKD2 mutants. Clinical trials using mTOR inhibitors weredisappointing, while the AMP-activated kinase (AMPK)activator, metformin is not yet tested in patients. Here, westudied the mTOR activity and its upstream pathways inseveral human and mouse renal cell models with either siRNAor stable knockdown and with overexpression of TRPP2. Our

data reveal for the first time differences between TRPP1 andTRPP2 deficiency. In contrast to TRPP1 deficiency, TRPP2-deficient cells did neither display excessive activation of themTOR-kinase complex nor inhibition of AMPK activity,while ERK1/2 and Akt activity were similarly affected amongTRPP1- and TRPP2-deficient cells. Furthermore, cellproliferation was more pronounced in TRPP1 than inTRPP2-deficient cells. Interestingly, combining lowconcentrations of rapamycin and metformin was moreeffective for inhibiting mTOR complex 1 activity in TRPP1-deficient cells than either drug alone. Our results demonstratea synergistic effect of a combination of low concentrations of

Djalila Mekahli and Jean-Paul Decuypere shared first co-authorship.

Electronic supplementary material The online version of this article(doi:10.1007/s00424-013-1394-x) contains supplementary material,which is available to authorized users.

D. Mekahli : J.<P. Decuypere : E. Sammels :K. Welkenhuyzen :G. Bultynck : J. B. Parys : L. Missiaen :H. De SmedtLaboratory of Molecular and Cellular Signaling, Department ofCellular and Molecular Medicine, KU Leuven, CampusGasthuisberg O&N I, Leuven, Belgium

D. Mekahli (*) : E. LevtchenkoDepartment of Pediatric Nephrology, University Hospital of Leuven,Herestraat 49, 3000 Leuven, Belgiume-mail: Djalila.mekahli@uzleuven.be

J. Schoeber : L. van den Heuvel : E. LevtchenkoLaboratory of Pediatrics, KU Leuven, Campus Gasthuisberg O&N I,Leuven, Belgium

M.<P. AudrezetLaboratoire de Génétique Moléculaire, CHU - INSERM U613,Brest, France

A. CorvelynLaboratory for Molecular Diagnosis, Center for Human Genetics,KU Leuven, Campus Gasthuisberg O&N I, Leuven, Belgium

G. DechênesDepartment of Pediatric Nephrology, Hôpital Robert-Debré,Paris, France

A. C. M. OngAcademic Unit of Nephrology, University of Sheffield,Sheffield, UK

M. J. Wilmer : L. van den HeuvelRadboud University Nijmegen Medical Centre,Nijmegen, The Netherlands

Pflugers Arch - Eur J PhysiolDOI 10.1007/s00424-013-1394-x

drugs suppressing the increased mTOR activity in TRPP1-deficient cells. This novel insight can be exploited infuture clinical trials to optimize the efficiency andavoiding side effects of drugs in the treatment of ADPKDpatients with PKD1 mutations. Furthermore, as TRPP2deficiency by itself did not affect mTOR signaling, thismay underlie the differences in phenotype, and genetictesting has to be considered for selecting patients for theongoing trials.

Keywords ADPKD .mTOR . Rapamycin .Metformin

List of abbreviationsADPKD Autosomal dominant polycystic kidney

diseaseAMPK AMP-activated protein kinase[Ca2+]c Free Ca2+ concentration in the cytosolCaMKKβ Ca2+/calmodulin-dependent protein kinase

kinase-βCD13 Aminopeptidase NciPTEC Conditionally immortalized proximal-tubule

epithelial cellECL Enhanced-chemiluminescenceESRD End-stage renal diseaseFACS Fluorescence-activated cell sortingFITC FluoresceinisothiocyanateKD KnockdownmTOR Mammalian target of rapamycinTRPP1 Polycystin-1TRPP2 Polycystin-2P-AMPK Phosphorylated AMP-activated protein

kinasePKD1 Gene for TRPP1PKD2 Gene for TRPP2P-S6Rp Phosphorylated S6 ribosomal proteinP-S6Rp/TotS6Rp

Phosphorylated S6 ribosomal protein/total S6ribosomal protein

PVDF Polyvinylidene fluorideS6Rp S6 ribosomal proteinsiRNA Small interfering RNASTO609 7-oxo-7H-benzimidazo

[2,1-a]benz[de]isoquinoline-3-carboxylicacid-acetic acid

TBS Tris-buffered saline

Introduction

Autosomal dominant polycystic kidney disease (ADPKD) isone of the most common monogenic disorders, with anincidence of 1:400–1,000. The disease is characterized by

the progressive, bilateral development, and enlargement ofkidney cysts progressing ultimately to end-stage renal disease(ESRD) [49]. It is caused by loss-of-function mutations ineither PKD1 (85 %) or PKD2 (15 %) which encodepolycystin-1 (TRPP1) and polycystin-2 (TRPP2), respectively[49].

ADPKD is a genetically very heterogeneous disease withstrong phenotypic variability. Although there is an overlap inthe clinical manifestations between the two types of genedefects, patients with PKD1 mutations have a more severerenal disease than patients with PKD2 mutations. They havean earlier onset, larger kidneys with more cysts, andsubsequently earlier onset of ESRD (median age, 53.4 vs.72.7 years, respectively) [2, 12, 16, 18, 48]. Despite theavailability of genetic testing, ADPKD patients are typicallydiagnosed by a familial history and imaging. Clinicians usethe renal disease-severity predictors of the patients and theirrelatives to speculate about the underlying mutated gene type[2].

The major aberrant signaling molecules involved in cystformation in ADPKD are the mammalian target of rapamycin(mTOR), Ca2+, and cAMP. The identification of thesedisturbed cellular mechanisms led to new drug targets to slowdown cystogenesis. Current treatment strategies are aimed to:(1) inhibit cell proliferation, (2) reduce cAMP levels, and (3)reduce fluid secretion [3, 5, 49].

The mTOR pathway is upregulated in the cystic kidneys ofpatients with ADPKD aswell as in rodent models with TRPP1dysfunction. mTOR is a serine/threonine kinase thatassembles into two distinct complexes: mTOR complex 1(mTORC1), which is implicated in cell growth, proliferationand autophagy, and mTOR complex 2 (mTORC2), whichamong others controls the actin cytoskeleton and resistanceto apoptosis [3, 22, 23]. mTORC1 and mTORC2 havedifferent downstream targets and respond differently torapamycin. Indeed, rapamycin inhibits mTORC1 uponbinding to an endogenous protein, FKBP12 without affectingmTORC2. However, it has been reported that long exposureto rapamycin mildly inhibits mTORC2 in a cell-dependentmanner [3, 22, 23]. mTOR inhibitors inhibit cell proliferationand cyst growth in a number of orthologous and non-orthologous models but the underlying molecularmechanisms are poorly understood [44, 47, 55, 58]. AlthoughmTOR inhibitors slowed the increase in total-kidney volumein anADPKD population, they did not prevent the progressiverenal impairment [42, 51].Moreover, in a Pkd1 -mutant mousemodel, the effect of rapamycin on mTOR activity was dose-dependent and higher doses than the ones used forimmunosuppression were needed to reach a therapeutic effect[27].

AMP-activated protein kinase (AMPK) inhibits mTOR. Itis activated through phosphorylation by the LKB1 tumor-suppressor kinase at low energy levels and by Ca2+/

Pflugers Arch - Eur J Physiol

calmodulin-dependent protein kinase kinase-β (CaMKKβ) inresponse to an increase in the cytosolic-free Ca2+

concentration ([Ca2+]c) [22, 23, 40, 43]. Recently, it has beendemonstrated that metformin, an activator of AMPK, inhibitsthe mTOR pathway and induces significant arrest of renalcystogenesis in an ADPKD mouse model [46]. In additionto AMPK, other signaling pathways, e.g., via Akt and ERKwere found to be important in the upstream regulation ofmTOR [19, 22, 23].

In the present study, we examined how loss-of-function ofeither TRPP1 or TRPP2 affects mTOR activity and its upstreampathways. First, we used a cell model of conditionallyimmortalized proximal-tubule epithelial-cell (ciPTEC) lines fromthe urine of a healthy individual with a stable suppression ofpolycystin-gene expression (PKD1–PKD2) using lentiviralknockdown (KD) vectors [26, 53] and using small interferingRNA (siRNA) KD. Additionally, we produced ciPTEC linesfrom the urine of ADPKD patients with either PKD1 or PKD2mutations. Finally, we used exogenous expression of TRPP2 inTRPP2−/− mouse renal cells [39]. We investigated the effects oftwo clinically relevant drugs that affect the mTOR pathway inour cell models, to test the efficacy of combining these drugs.The overall results from our study indicate that mTORC1 andAMPK activities were differently regulated upondownregulation of either TRPP1 or TRPP2.We also demonstratefor the first time that a combination of low concentrations ofrapamycin and metformin is more effective for suppressingmTORC1 activity in TRPP1-KD cells than either drug alone.

Results

Differential mTORC1 activity and cell proliferation in renalcells with altered TRPP1 or TRPP2 expression

Figure 1a demonstrates that TRPP1 and TRPP2 wereeffectively knocked down in ciPTEC TRPP1- and TRPP2-KD lines respectively in comparison with control. Figure 3inthe Electronic supplementary material (ESM) shows siRNA-mediated KD of the respective proteins. We investigated themTORC1 activity in these ciPTEC lines by assessing thephosphorylation of S6 ribosomal protein (S6Rp) downstreamtarget of mTORC1 using immunoblotting assays [19, 56].

We found a significant increase in phosphorylated S6Rp(P-S6Rp) reflecting an increase in mTORC1 activity in theTRPP1-KD cells compared with control (165 vs. 100 %,respectively; p <0.01) (Fig. 1b). By contrast, P-S6Rp wasreduced in TRPP2-KD cells compared with control (85 vs.100 % respectively; p <0.01). P-S6Rp was also significantlydifferent between TRPP1-KD and TRPP2-KD cells (p <0.001) suggesting a differential effect on mTORC1 activity.

Figure 3 in the ESM shows that siRNA-mediated TRPP1-KD in ciPTEC control also demonstrated a significant

increase in P-S6Rp compared with siRNA scramble control(152 vs. 100 % respectively; p <0.05). By contrast, P-S6Rpwas not significantly different in siRNA TRPP2-KD cellscompared with siRNA scramble control (105 vs. 100 %respectively; p =0.68). These results confirmed the differentialeffect on mTORC1 activity between TRPP1 KD and TRPP2KD in either stable cell lines or using acute siRNA KD.

Subsequently, we investigated the mTORC1 activity inciPTEC lines derived from patients with ADPKD andcontrols. Figure 2a, b shows a decreased expression of full-length TRPP1 or TRPP2 in cell lines from patients withrespectively PKD1 or PKD2 mutations compared withcontrols. A higher P-S6Rp was also found in ciPTEC linesfrom patients with PKD1 mutations as compared withcontrols (Fig. 2c). However, the cell lines from patients withPKD2 mutations showed a similar P-S6Rp compared withcontrols. Figure 2d shows that the mean value of P-S6Rp inthe seven patients with PKD1 mutations was significantly (p<0.01) higher than the mean of the controls and than the meanof patients with PKD2 mutations (185 and 128 % vs. controlfor PKD1 and PKD2 , respectively). The value for PKD2patients was not significantly different from the controls.

We also tested renal epithelial mouse cells with stronglyvarying expression levels of TRPP2 (Fig. 3a) (see “Methods”).P-S6Rp was not significantly different in TRPP2−/− cellscompared with TRPP2+/− cells that expressed low endogenouslevels of TRPP2 (Fig. 3b). There was also no significantdifference in P-S6Rp in TRPP2−/−+ctrl cells as compared withTRPP2−/−+TRPP2 cells, where we have introduced a highexogenous expression of TRPP2 by adenoviral transduction.

Taken together, the data in various experimental systemsstrongly suggest a difference in the mTORC1 activity (P-S6Rp) between TRPP1- and TRPP2-deficient cells. IncreasedmTORC1 activity seems a hallmark for TRPP1-deficient cellsbut not for TRPP2-deficient cells.

We next performed a cell-viability assay (XTT) as a measurefor the rate of cell proliferation (n=5).We found that the TRPP1-deficient cells had a higher cell proliferation rate than controls(181 vs. 100%; p<0.5). However, the TRPP2-deficient cells hada milder but not statistically significant increase of cellproliferation in comparison with control (128 vs. 100 %; p=0.56) (Fig. 4).

Differential AMPK, but not Akt and ERK activities, in renalcells with altered TRPP1 or TRPP2 expression

AMPK activity was assessed by immunoblotting assaysmeasuring the phosphorylation of at Thr172 in the α subunit.The AMPK activity, expressed by the levels of phosphorylatedAMPK (P-AMPK), was lower in TRPP1-KD cells comparedwith controls (70 vs. 100 %, respectively; p <0.001), but not inTRPP2-KD cells (105 vs. 100 %, p =0.337) (Fig. 1c). The

Pflugers Arch - Eur J Physiol

difference between TRPP1- and TRPP2-KD cells was alsostatistically significant (p <0.001).

By contrast, there was no evidence for a difference betweenTRPP1- and TRPP2-KD cells regarding mTORC2 activity ascan be concluded fromAkt activity, which is a downstream targetofmTORC2 [7]. Both TRPP1- and TRPP2-KD cells had a lowerAkt activity than control cells (p<0.01) (Fig. 1d). Furthermore,the levels of P-ERK 1/2 were upregulated in both TRPP1- andTRPP2-KD cells as compared with control cells (p<0.05), butagain there was no difference in behavior between TRPP1- andTRPP2-KD cells regarding this activity (Fig. 1e). The latterfindings on Akt and ERK1/2 are compatible with the view that

loss-of-function mutations in either PKD1 or PKD2 cause alarge similarity in their cystic phenotypes. The commondysfunctions occurring in several signaling pathways representpotential therapeutic targets for both groups.

We conclude that mTORC1 and AMPK activities weredifferently affected by a downregulation of TRPP1 orTRPP2. As AMPK suppresses the mTORC1 activity, ourresults suggest a role of AMPK in the difference of themTORC1 activity upon downregulation of either TRPP1or TRPP2. Our observation that the levels of P-Akt and P-ERK 1/2 were similar in TRPP1- and TRPP2-KD cells alsoindicates that these activities cannot account for the

Fig. 1 mTOR activity and itsupstream pathways in TRPP1-KD and TRPP2-KD ciPTEC linescompared with control. aRepresentative immunoblot ofTRPP1 and TRPP2 expression inciPTEC lines with stable TRPP1or TRPP2 KD (n =6). bRepresentative immunoblot ofmTORC1 activity assessed by theratio P-S6Rp/Tot S6Rp (n =20). cRepresentative immunoblot ofAMPK activity expressed as theratio P-AMPK/Tot AMPK (n =8).d Representative immunoblot ofthe ratio P-Akt/Tot Akt (n =6). eRepresentative immunoblot of theratio P-ERK 1/2/Tot ERK 1/2(n =6). The right panels show thequantification of the datapresented as means±SEM. Thevalues of the control cells were setat 100 %. The means werecompared using a Student's t testfor paired data: *p<0.5; **p<0.01; ***p <0.001. NS notsignificant

Pflugers Arch - Eur J Physiol

observed differential regulation of mTORC1 by TRPP1 orTRPP2.

Rapamycin and metformin synergistically inhibit mTORC1activity in TRPP1-deficient cells

Next, we evaluated the effect of rapamycin on mTORC1activity. Rapamycin (10 nM, 3 h) caused a pronounced

decrease in mTORC1 activity in control, TRPP1- andTRPP2-KD cells (Fig. 5). Interestingly, rapamycin treatmentwas associated with a concomitant increase in AMPK activityin the three cell lines.

To tackle the AMPK-mTORC1 branch in the mTORC1-signaling pathway, we treated the TRPP1-KD, TRPP2-KD,and control cells with either the AMPK activator metformin orwith the CaMKKβ inhibitor STO609 (7-oxo-7H-

Fig. 2 mTORC1 activity inciPTEC lines from patients withPKD1 and PKD2 mutations. aRepresentative immunoblot ofTRPP1 and of TRPP2 in ciPTEClines of four healthy controls,seven patients with PKD1mutations, and three patients withPKD2 mutations (n =4). b Therelative amounts of TRPP1/TRPP2 expressed as ratio. cRepresentative immunoblot ofmTORC1 activity assessed by theratio P-S6Rp/Tot S6Rp inciPTEC lines from patients withPKD1 mutations compared withcontrols and to patients withPKD2 mutations (n =4). Thelower panel shows thequantification of the data (means±SEM). d The mean value±SEMof mTORC1 activity of controlsand of patients with PKD1 orPKD2 mutations. **p <0.01. NSnot significant

Pflugers Arch - Eur J Physiol

benzimidazo[2,1-a]benz[de]isoquinoline-3-carboxylic acid-acetic acid) to reduce AMPK activity via its upstreamactivation mechanism. Incubation with metformin (100 mM,24 h) increased the AMPK activity in TRPP1-KD, TRPP2-KD, and control cells and strongly reduced the mTORC1activity in TRPP1-KD cells and nearly abolished its activityin control and TRPP2-KD cells (Fig. 5). Treatment withSTO609 (1 μg/ml, 6 h) resulted in a complete downregulationof AMPK activity and an increased mTORC1 activity in allcell types. This stimulatory effect of STO609 on the mTORC1activity was more pronounced in control and TRPP2-KD cellsthan in TRPP1-KD cells. This might be explained by thealready elevated levels of S6 phosphorylation in TRPP1 KD.

Treatment with rapamycin for 1, 2, or 3 h showed a time-and concentration-dependent decrease in P-S6Rp (Fig. 6a).Treatment with metformin for 24 h also showed aconcentration-dependent decrease in P-S6Rp with a parallel

increase in AMPK activity (Fig. 6b). Interestingly, thecombination of low concentrations of rapamycin for 3 h withlow concentrations of metformin for 24 h resulted in a morepronounced inhibition of P-S6Rp than either drug alone(Fig. 6c). Strikingly, sub-threshold concentrations ofrapamycin (0.05 and 0.1 nM) that were not effective inreducing mTORC1 activity (P-S6Rp) as a single treatment,clearly potentiated threshold concentrations of metformin (0.3and 1 mM) that had only mildly inhibited mTORC1 activity(P-S6Rp) as a single treatment. Taken together, these findingsindicate that both drugs act in a synergistic way.

Discussion

Using ADPKD-related human renal epithelial cell models, wedemonstrated for the first time a synergistic effect of

Fig. 3 mTORC1 activity in aTRPP2−/− mouse model. aRepresentative immunoblot ofTRPP1 and of TRPP2 (n =4). bRepresentative immunoblot ofmTORC1 activity assessed by theratio P-S6Rp/Tot S6Rp (n=4).The lower panel shows thequantification of the datapresented as means±SEM. Thevalues of TRPP2−/− TRPP2−/−+ctrl

cells were set at 100 %. NS notsignificant

Pflugers Arch - Eur J Physiol

rapamycin and metformin in inhibiting the increasedmTORC1 activity in TRPP1-KD cells. Moreover, our resultssuggest a role for AMPK in the increased mTORC1 activityupon downregulation of TRPP1. By contrast, mTORC1activity was not increased and AMPK activity not decreasedby downregulation of TRPP2.

Several mechanisms by which TRPP1 and TRPP2 mayaffect different pathways involved in cyst formation have beenproposed, but a general picture is lacking. It is also not clearhow downregulation of either TRPP1 or TRPP2 can lead tocyst formation and how both polycystins interact in theseprocesses. One of the major signaling dysfunctions involvedin cyst formation in ADPKD is the mTOR pathway [3, 22,23]. It has been demonstrated in TRPP1-disrupted animalsand in human epithelial cells that mTORC1 activity isenhanced [8, 17, 44]. However, the effects of TRPP2 inmTOR signaling were not yet completely elucidated [3]. Inaddition, mTOR inhibitors have been shown to inhibit cellproliferation and cyst growth in several orthologous and non-orthologous models and were therefore regarded as a potentialtreatment of ADPKD [36, 44, 45, 47, 50].

We report an upregulation of mTORC1 in the TRPP1-KDcells, using either stable lentiviral KD or siRNA KD (Fig. 1b;Fig. 3b in the ESM) and in ciPTEC lines from patients withPKD1 mutations compared with controls (Fig. 2c, d). Bycontrast, in TRPP2-KD cells mTORC1 activity was notupregulated neither in de KD models using either stablelentiviral KD or siRNA KD (Fig. 1b; Fig. 3b in the ESM).Furthermore, no significant upregulation of mTORC1 was

observed in ciPTEC lines from patients with PKD2 mutations(Fig. 2c, d) and in a TRPP2-overexpressing mouse cell model(Fig. 3b). These results obtained in various experimentalmodels highlight an important divergence in the downstreammechanisms of TRPP1 or TRPP2 with respect to their effecton mTORC1 signaling. One previous report showed thatmTORC1 was increased in Pkd2WS25/ mice compared withnormal littermate controls, and this is in contrast with ourresults [59]. We have no direct explanation for this divergentobservation. However, we have used here different cellmodels with either downregulation (via siRNA or stable KDin human cell model) or with overexpression of TRPP2(mouse TRPP2−/− and the rescued TRPP2−/−+ctrl andTRPP2−/−+TRPP2 cells), all demonstrating that the deficiencyof TRPP2 did not directly result in an increase of mTORC1activity compared with control. We have also confirmed thisfinding in human cells from genotyped ADPKD patients.Adaptive effects however, are a major concern in most modelsystems upon prolonged downregulation of a particular gene.As no information was available on the actual expressionlevels of TRPP2 and TRPP1 in the Pkd2WS25/ mice fromZafar et al. [59], it remains conceivable that a simultaneousdecrease of TRPP1 expression in this particular mouse modelcould have resulted in the different outcome as compared withour data.

We also showed that an increase in cell proliferation ismore pronounced in TRPP1-deficient cells than in TRPP2-deficient cells (Fig. 4). This is another manifestation ofdifferential signaling effects of TRPP1- and TRPP2-KD. Thisfinding is also compatible with the observed differences inkidney and cyst volumes between patients with PKD1 andthose with PKD2 mutations [6]. Indeed, patients with PKD2mutations have smaller kidney and cyst volumes.

Next, we evaluated various upstream pathways of mTORand measured the activity of AMPK, Akt and ERK 1/2 bymeasuring their phosphorylation via Western blotting. Wefound that P-AMPK was decreased in TRPP1-KD cellscompared with control but not in TRPP2-KD cells (Fig. 1c).This is compatible with the recent finding of Takiar et al. thatmetformin, an activator of AMPK, inhibits the mTORpathways, and induces significant arrest of renal cystogenesisin a PKD mouse model [46]. In contrast to the differentialeffect on P-AMPK, we found no such divergence betweenTRPP1- and TRPP2-KD cells for other pathways upstream ofmTOR. P-Akt was downregulated while P-ERK 1/2 wasupregulated in both TRPP1- and TRPP2-KD cells ascompared with control (Fig. 1d, e). These findings thereforesuggest that the increase in mTORC1 activity upon TRPP1downregulation was determined mainly by the AMPK-mTORC1 branch of this signaling pathway. Moreover, theeffect of STO609 indicates that the AMPK activity wasregulated via [Ca2+]c. It may be very relevant in this respectthat we also found a divergence in the TRPP1- and TRPP2-

Fig. 4 Cell proliferation assay. Relative cell viability as assayed by theXTT cell viability kit” (#30007) from Biotium (Hayward, CA), inTRPP1- and TRPP2-deficient cells compared with control (n =5). *p <0.5. NS not significant

Pflugers Arch - Eur J Physiol

KD cells with respect to the resting [Ca2+]c [26]. Indeed, theresting [Ca2+]c was decreased in TRPP1-KD cells, butincreased in TRPP2-KD cells [26]. Taken together, ourfindings may indicate a differential signaling chain betweenTRPP1 and TRPP2 via decreased/increased levels of [Ca2+]c,CaMKKß and AMPK to an increased/decreased level ofmTORC1, respectively. Our results highlight an importantdifference in the underlying molecular mechanism of PKD1and PKD2 mutations and also confirm some similarities. Thesimilarities in P-Akt and P-ERK 1/2 signaling for TRPP1- andTRPP2-KD cells are in line with the concept that both

polycystins are, at least to some extent, in a common signalingpathway that ultimately results in the formation of renal cystsin both PKD1 and PKD2 patients [15, 35, 57]. Thedivergence between TRPP1- and TRPP2-KD cells found here,however, could be one of the factors underpinning thephenotypic difference in severity. The two polycystin proteinsare also involved in independent functions [10]; e.g., theestablishment of left-right asymmetry in the developingmouse embryo requires TRPP2, but not TRPP1 [10, 21].Our results show another important difference in the signalingpatterns of both polycystins. Since clinical trials are ongoing,

Fig. 5 Effect of rapamycin,metformin and STO609 onmTORC1 activity in TRPP1-KD,TRPP2-KD and control cells. aRepresentative immunoblots ofthe mTORC1 activity assessed byP-S6Rp and Tot S6Rp in theabsence or presence of 10 nMrapamycin (3 h), 100 mMmetformin (24 h), or 1 μg/mlSTO609 (6 h; n =4). The lowerpanel shows the quantification ofthe data presented as means±SEM. b Representativeimmunoblots of P-AMPK and TotAMPK in the absence or presenceof 10 nM rapamycin (3 h),100 mM metformin (24 h), or1 μg/ml STO609 (6 h) (n =4).The lower panel shows thequantification of the datapresented as means±SEM

Pflugers Arch - Eur J Physiol

Fig. 6 Synergistic effect of rapamycin and metformin on mTORC1activity in TRPP1-KD cells. a Time- and concentration-dependent effectof rapamycin onmTORC1 activity in TRPP1-KD cells. b Concentration-response of a 24-h treatment with metformin on mTORC1 and AMPKactivities in TRPP1-KD cells. c Representative immunoblot of the effect

of rapamycin (R ; 3 h) and metformin (M ; 24 h) on mTORC1 activity inTRPP1-KD cells. Comparisons were made with TRPP1-KD cells treatedwith only the solvent DMSO (means±SEM; n =5) using a Student's t testfor paired data: *p <0.05. ciPTEC control cells were included todemonstrate the basal mTORC1 activity

Pflugers Arch - Eur J Physiol

our findings on differences in mTORC1 activity betweenPKD1 and PKD2 mutations may have important therapeuticimplications and indicate the necessity of genetic testing inADPKD. Rossetti et al. have recently reported the firstapplication of next-generation sequencing in ADPKD [38].This will enhance the feasibility of genetic testing in ADPKDpatients and will be of great importance for selecting patientsin the current clinical trials and optimizing the design of thesenovel therapies.

With regard to possible therapeutic applications, weevaluated in the next part of our study the effect of rapamycinand metformin in TRPP1-KD cells with increased mTORC1levels. Novalic et al. showed in two Pkd1 -mutant mousemodels that rapamycin decreases the mTOR activity in earlybut not late stages of ADPKD [27]. Moreover, the doses ofmTOR inhibitors used in rodent studies exceed the dosecommonly used for immunosuppression in patients [11, 27,52, 58]. To date, the dose of mTOR inhibitors required toadequately suppress mTOR in target organs, includingADPKD kidneys in humans, is unknown. Nonetheless, recentclinical trials using mTOR inhibitors in ADPKD have beendisappointing [42, 51]. Major criticisms of these studies havebeen the limited power, short follow-ups, wide ranges of renalfunction, and doses with inadequate pharmacological effectsand uncertain optimal targets [11, 32, 34, 52]. It has also beensuggested that the lack of beneficial effects may be caused bythe fact that the renal tissue was already significantly andirreversibly damaged [11, 32, 34, 41, 52]. In addition,metformin, although already a long-term clinically used drugin the treatment of type-2 diabetes mellitus, is not withoutrisks. As its elimination is exclusively through the kidneys, areduced renal function can lead to the accumulation of thedrug and to a rare but severe side effect of lactic acidosis [33].However, the use of metformin is well defined in renalimpairment and clear dose recommendations are proposedbased on the renal function [9, 24]. Although its potential riskof lactic acidosis precludes its use in late-stage ADPKD, itsutility as a potential therapeutic drug in the early-stageADPKD deserves further attention in future clinical trials[25, 46]. With this background information, we aimed toevaluate the combination of drugs and to test their effect in acell model. Rapamycin and metformin alone showed a time-and concentration-dependent inhibition of the increasedmTORC1 activity in TRPP1-KD cells (Fig. 6). These resultsare in agreement with earlier studies [27, 46] showing that lowdoses of either rapamycin or metformin were insufficient tosuppress mTORC1 and higher doses were needed to reach atherapeutic effect.

As cyst formation in ADPKD is induced by a cascade ofdifferent pathways, a combination of drugs targetingsimultaneously different signaling pathways may be aneffective way to minimize side effects. We therefore treatedTRPP1-KD cells with a combination of low concentrations of

rapamycin and metformin and demonstrated a synergisticeffect on the increased mTORC1 activity resulting in a morepronounced inhibition than either drug alone. This synergisticeffect is probably due to the effect of rapamycin andmetformin on different targets. Moreover, AMPK inhibitsmTOR through phosphorylation of tuberin but also via directphosphorylation of Raptor [13, 43]. Furthermore, an effect ofrapamycin on AMPK activation was already described incancer cells but not in ADPKD models [14]. Our results needto be confirmed in an animal model and in clinical trials. Thelowest concentration range of rapamycin (0.1 and 0.05 nM or45.7 and 91.4 ng/l) used in our experiments is much lowerthan the concentrations used in the clinical trials (10–15 ng/mlas target blood levels). However, pharmacokinetic andpharmacodynamic studies are needed to define the optimaldose in humans because it is difficult to extrapolate theconcentrations used in cell or animal models to the levels ofthe drug in human blood and in various human tissues,particularly the target kidney cells. This could also have ledto a negative outcome in the clinical studies [4].

In conclusion, we demonstrated a difference in mTORC1and AMPK activities between TRPP1- and TRPP2-deficientcells, and we report for the first time beneficial effects of acombination of low concentrations of rapamycin andmetformin. Our data argue for a better selection of patientsby pre-clinical genetic testing in future clinical trials and anadapted therapeutic regimen combining low doses ofrapamycin and metformin for patients with PKD1 mutations.

Methods

Materials and reagents

NuPAGE® gels, NuPAGE® loading-dye-solution samplebuffer and MOPS buffer were from Invitrogen (Merelbeke,Belgium). Immobilon-P PVDF microporous transfermembranes were from Millipore (Billerica, Massachusetts,USA). ECL and Hyperfilms were from GE Healthcare(Diegem, Belgium). The following reagents were used:phosphatase inhibitor cocktail 2 and 3, metformin andSTO609 from Sigma-Aldrich, and rapamycin from CellSignaling Technology.

Generation of stable TRPP1- and TRPP2-KD ciPTEC lines

We generated stable TRPP1-KD, TRPP2-KD, and DsRed(control) lines from a cloned ciPTEC line of a healthyindividual (34.8) that has been described previously [26, 53].The derived KD cell lines were not further subcloned.Silencing of either TRPP1 or TRPP2 expression was achievedusing lentiviral vectors containing miRNA-based shorthairpins as described [26].

Pflugers Arch - Eur J Physiol

Generation of small interfering RNATRPP1- and TRPP2-KDciPTEC cells

We knocked down either TRPP1 or TRPP2 using siRNAbased on siRNA predecessors. (TRPP1: 5_ CAACAAGAU U U C U A C G U U A d T d T 3 _ a n d T R P P 2 :5_UAUAGCUGCUGUCACAGUAdTdT 3_) [26]. We usedsiRNA scrambled as control. These siRNA candidates weredesigned and screened for possible off-targets using the LinuxBatch RNAi selector program [20]. Briefly, ciPTEC control(34.8) cells were seeded at 500,000 cells/plate (10 cm) in10 ml DMEM and cultured for 1 day. We maintained the cellsin Optimem (Invitrogen) without antibiotics and serum for20 min prior to transfection. The indicated amounts of siRNA(120 nM) and HiPerfect Transfection Reagent (Qiagen) werediluted in Optimem according to manufacturer's protocol inthe absence of antibiotics and serum. The transfection solutionwas incubated at room temperature for 10min. Finally, siRNAHiPerfect mixture was added to the plates. The plates werecultured at 33 °C and 5 % CO2 for 5 h, then the medium waschanged to fresh DMEM supplemented with 10 % FBS andantibiotics (1:100); subsequently, the cells were incubated at33 °C and 5 % CO2 for 48 h before harvesting.

Cell proliferation assay

We used the “XTT Cell Viability Kit” (#30007) from Biotium(Hayward, CA) to assess the rate of cell proliferation. Thecells were seeded at a density of 2000 cells per well and thecell proliferation activity was measured according to themanufacturer's protocol.

Patient population and mutational analysis

We included patients diagnosed with ADPKD and followed inthe University Hospital of Leuven, Leuven, Belgium, or theHôpital Robert-Debré, Paris, France. All patients had a clearfamilial history of ADPKD and bilateral renal cysts on renalultrasound. Informed consent was obtained from the patientsor their parents (if younger than 16 years) using a protocol thatwas approved by the local ethical committee.

Genetic testing was done using direct sequencing andquantitative fluorescent multiplex PCR on array-comparativegenomic hybridization for both conventional mutations andgross genomic rearrangements as described [1].

Production and characterization of ciPTEC lines from urinesamples of healthy individuals and ADPKD patients withknown germline PKD1 or PKD2 mutations.

The production of ciPTEC lines from urine samples wasdescribed earlier [53]. In summary, first-void morning mid-stream urine was collected from ADPKD patients. Afterpr imary cul tures were es tab l i shed , condi t iona limmortalization by infecting cells with SV40T and hTERT

was applied. As culture of the urine sediment may containcells originating from different nephron segments and theurinary tract, we used fluorescence-activated cell sorting toselect the proximal-tubule epithelial cells. The presence of thebrush-border membrane protein aminopeptidase N (CD13) asa specific indication of their proximal tubular origin wasdetected by using a monoclonal mouse-anti-human CD13-fluoresceinisothiocyanate (FITC)-coupled antibody (#F0831)from DAKO (Glostrup, Denmark) with a 1:100 dilution inPBS. Unlabeled cell suspensions were used as negativecontrols. ciPTEC lines from ADPKD patients containedbetween 40 and 75 % CD13-FITC-stained cells (Fig. 1 inthe ESM).

Furthermore, we performed Reverse Transcriptase PCR(RT-PCR) on ciPTEC lines from ADPKD patients forAquaporin-1 (Aq1) and P-glycoprotein (Pgp). Briefly, totalcellular RNA was extracted from cells using RNeasy PlusMini Kit (Qiagen) and cDNA was made with SuperscriptReverse Transscriptase III (Life Technologies) according tothe manufacturer’s protocol. The PCR amplification was donefor 3 min at 95 °C, 30 s at 95 °C, 30 s at 55 °C, and 30 s at72 °C for 35 cycles, then extended 7min at 72 °C and stored at15 °C. The expected RT-PCR product size is 358 bp for Aq1and 336 bp for Pgp. The forward and reverse primersequences for Aq1 (ATCGAGATCATCGGGACCCTCCA;TGTCGTCGGCATCCAGGTCATA ) a n d P g p(GCACCAACATGGACAACCGGCTT; CATAGAAGTCAGGGACCATTTTC). Human GAPDH primers forwardand reverse (GAGTCAACGGATTTGGTCGTAT, CATGAAGGCAGCTGGGAAT) were used as the housekeeping geneand the band size is 436 bp. As a positive control, we usedRNA from a well characterized ciPTEC control cell line andas control for the PCR reaction, we used water (Fig. 2 in theESM).

We succeeded to develop ten ciPTEC lines from sevenpatients with PKD1 mutations from six unrelated familiesand from three patients with PKD2 mutations from twounrelated families (Table 1). PKD1 or PKD2 mutations wereconfirmed by DNA testing of each ciPTEC line, and all themutations were definitively or likely/highly likely pathogenic[1, 7, 31, 37]. The identified mutations were loss-of-functionmutations of the frameshift, nonsense, or splicing type, whichwill all lead to a truncated protein. As controls, we used 4ciPTEC lines from healthy individuals, which werecharacterized before [53].

Exogenous expression of TRPP2 in a TRPP2−/− mouse cellline

TRPP2−/− and TRPP2+/− renal proximal-tubule epithelial cellswere described previously [54]. For rescue of TRPP2 in thesecells, we used an adenovirus encoding TRPP2 and a controlvirus constructed from an empty pAD/PL-DEST vector [39].

Pflugers Arch - Eur J Physiol

We transduced TRPP2−/− cells by adding either the controlvirus (TRPP2−/−+ctrl) or the TRPP2 adenovirus (TRPP2−/−+TRPP2) for mimicking endogenous levels, both with a viral titerof 1/1000 [39]. TRPP2 was not detectable in TRPP2−/− cellsand TRPP2−/−+ctrl cells, moderately expressed in TRPP2+/−

cells and well expressed in TRPP2−/−+TRPP2 cells (Fig. 3a).

Western blot analyses

Protein samples from cell lysates with 1 % of phosphataseinhibitor cocktail 2 and 3 were analyzed by NuPAGE® 4–12 % Bis-Tris SDS/polyacrylamide gels using MOPSbuffer. We have used 4–12 % Bis-Tris gels to obtain anoverall good resolution and especially in the lowmolecular weight range. After electroblotting onto apolyvinylidene fluoride membrane and blocking withTris-buffered saline (TBS) containing 0.1 % Tween and5 % nonfat dry milk powder, the blots were incubatedwith primary antibody and then with secondary antibodies(both in TBS supplemented with 0.1 % Tween and 1 %nonfat dry milk powder). Between each step, the blotswere washed three times with TBS supplemented with0.1 % Tween. The immunoreactive bands were visualizedwith either enhanced-chemiluminescence substrate andexposed to Hyperfilm and developed using a KODAKX-Omat 1000 (KODAK, Rochester, New York, USA) orvisualized using a Licor Odyssey Infrared Imaging System(Westburg, Leusden, The Netherlands). Quantification wasdone with ImageJ software (http://rsbweb.nih.gov/ij/).Expression of P-S6Rp, total S6Rp, P-Akt, total Akt, P-AMPK, total AMPK, P-ERK 1/2, and total ERK 1/2 wasnormalized to GAPDH levels (n is the number ofindependent experiments).

Antibodies

The antibody against the N terminus of TRPP1 (7e12) wasdescribed elsewhere [28–30]. The antibody against the Cterminus of TRPP2 (#28331) was purchased from Santa CruzBiotechnology (Santa Cruz, California, USA).

Anti-P-S6Rp (Ser235/236, #4858), anti-Tot S6Rp (#2217),anti-P-Akt (Ser473, #4060), anti-Tot Akt (#2967), anti-P-AMPK (Thr172 of its α subunit, #2535), anti-Tot AMPK(#2532), anti-P-ERK 1/2 (44/42 MAPK, #4370; Thr202/Tyr204), and anti-Tot ERK 1/2 (#4695) were purchased fromCell Signaling Technology (Beverly, Massachusetts, USA).Anti-GAPDH (#G8795) was purchased from Sigma-Aldrich(St Louis, Missouri, USA).

Secondary antibodies used (goat-anti-mouse IgG,DyLightTM 800, #35521, and anti-rabbit IgG, DylightTM700, #21109) were purchased from Thermo Scientific(Rockford, Illinois, USA). Secondary antibodies coupled tohorseradish peroxidase (anti-rabbit IgG HRP, #7074S, anti-mouse IgG HRP, #7076S) were purchased from CellSignaling Technology.

Statistics

The data are presented as means±SEM. The values of thecontrol cells were set at 100 %. Statistical significance wasdetermined by a Student's two-sample t test and was definedas *p <0.05, **p <0.01, and ***p <0.001.

Acknowledgments This work was supported by grant G0A/09/012 ofthe Concerted Actions Program of the Research Council of the KULeuven, grant G.0B13.13 from the Research Foundation Flanders andClinical PhD fellowship of the Research Foundation Flanders

Table 1 ciPTEC lines from controls and ADPKD patients

ID ciPTEC line Family sex Age (years) Mutation Mutation type Classification of mutation Reference

PKD1 10.032 1 F 37 c.2674dup, exon 11 Frameshift Definitively pathogenic Audrezet et al. [1]

10.055 2 M 48 c.12138+3_12138+6del,intron 44

Splicing Likely pathogenic Audrezet et al. [1]

10.056 3 F 13 c.6574_6580del, exon 15 Frameshift Definitively pathogenic Roelfsema et al. [35]

10.057 3 F 41 c.6574_6580del, exon 15 Frameshift Definitively pathogenic Roelfsema et al. [35]

10.064 4 M 43 c10167+24_10167+42del,intron 31

Splicing Highly likely pathogenic Peral et al. [29]

10.066 5 F 17 c.10500-1G>A, intron 34 Splicing Definitively pathogenic Audrezet et al. [1]

10.068 6 M 14 c.3425_3428del, exon 15 Frameshift Definitively pathogenic Audrezet et al. [1]

PKD2 10.061 7 M 16 p.R361X, exon 4 Nonsense Definitively pathogenic Chung et al. [6]

10.062 7 M 48 p.R361X, exon 4 Nonsense Definitively pathogenic Chung et al. [6]

11.164 8 F 15 p.Q630X, exon 8 Nonsense Definitively pathogenic Audrezet et al. [1]

ID is the cell-line label used in our laboratory. We used four ciPTEC lines from healthy individuals already described, seven from patients with PKD1mutations from six different families, and three from patients with PKD2 mutations from two different families

F female, M male

Pflugers Arch - Eur J Physiol

(1700613N0). The authors are grateful for the excellent technicalassistance by Tomas Luyten. The authors thank Marina Crabbé, AnjaFlorizoone, Sandra Van Aerschot, and Inge Bongaers for their help withthe cell cultures; Dr. Kathleen Claes, Dr. Bert Bammens, and Dr. BjörnMeijers from the University Hospital of Leuven, Belgium for includingpatients; and Dr. Y. Cai and Dr. S. Somlo, Yale University (New Haven,CT) for sending the TRPP2−/− and TRPP2+/− renal proximal-tubuleepithelial cells.

Competing interests The authors declare that there are no competinginterests.

References

1. AudrezetMP, Cornec-Le Gall E, Chen JM, Redon S, Quere I, Creff J,Benech C, Maestri S, Le Meur Y, Ferec C (2012) Autosomaldominant polycystic kidney disease: comprehensive mutationanalysis of PKD1 and PKD2 in 700 unrelated patients. Hum Mutat33(8):1239–1250

2. BaruaM, Cil O, Paterson AD,WangK, He N, Dicks E, Parfrey P, PeiY (2009) Family history of renal disease severity predicts themutatedgene in ADPKD. J Am Soc Nephrol 20(8):1833–1838

3. Boletta A (2009) Emerging evidence of a link between thepolycystins and the mTOR pathways. Pathogenetics 2(1):6

4. Canaud G, Knebelmann B, Harris PC, Vrtovsnik F, Correas JM,Pallet N, Heyer CM, Letavernier E, Bienaime F, Thervet E,Martinez F, Terzi F, Legendre C (2010) TherapeuticmTOR inhibitionin autosomal dominant polycystic kidney disease: what is theappropriate serum level? Am J Transplant 10(7):1701–1706

5. Chang MY, Ong AC (2012) Mechanism-based therapeutics forautosomal dominant polycystic kidney disease: recent progress andfuture prospects. Nephron Clin Pract 120(1):c25–34, discussion c35

6. Chapman AB, Guay-Woodford LM, Grantham JJ, Torres VE, BaeKT, Baumgarten DA, Kenney PJ, King BF Jr, Glockner JF, WetzelLH, Brummer ME, O'Neill WC, Robbin ML, Bennett WM, Klahr S,Hirschman GH, Kimmel PL, Thompson PA, Miller JP (2003) Renalstructure in early autosomal-dominant polycystic kidney disease(ADPKD): The Consortium for Radiologic Imaging Studies ofPolycystic Kidney Disease (CRISP) cohort. Kidney Int 64(3):1035–1045

7. Chung W, Kim H, Hwang YH, Kim SY, Ko AR, Ro H, Lee KB, LeeJS, Oh KH, Ahn C (2006) PKD2 gene mutation analysis in Koreanautosomal dominant polycystic kidney disease patients using two-dimensional gene scanning. Clin Genet 70(6):502–508

8. Distefano G, Boca M, Rowe I, Wodarczyk C, Ma L, Piontek KB,Germino GG, Pandolfi PP, Boletta A (2009) Polycystin-1 regulatesextracellular signal-regulated kinase-dependent phosphorylation oftuberin to control cell size through mTOR and its downstreameffectors S6K and 4EBP1. Mol Cell Biol 29(9):2359–2371

9. Frid A, Sterner GN, Londahl M, Wiklander C, Cato A, Vinge E,Andersson A (2010) Novel assay of metformin levels in patients withtype 2 diabetes and varying levels of renal function: clinicalrecommendations. Diabetes Care 33(6):1291–1293

10. Giamarchi A, Feng S, Rodat-Despoix L, Xu Y, Bubenshchikova E,Newby LJ, Hao J, Gaudioso C, Crest M, Lupas AN, Honore E,Williamson MP, Obara T, Ong AC, Delmas P (2010) A polycystin-2 (TRPP2) dimerization domain essential for the function ofheteromeric polycystin complexes. EMBO J 29(7):1176–1191

11. Grantham JJ, Bennett WM, Perrone RD (2011) mTOR inhibitors andautosomal dominant polycystic kidney disease. N Engl JMed 364(3):286–287, author reply 287–289

12. Grantham JJ, Torres VE, Chapman AB, Guay-Woodford LM, BaeKT, King BF Jr, Wetzel LH, Baumgarten DA, Kenney PJ, Harris PC,

Klahr S, BennettWM, HirschmanGN,Meyers CM, ZhangX, Zhu F,Miller JP (2006) Volume progression in polycystic kidney disease. NEngl J Med 354(20):2122–2130

13. Habib SL (2011) Mechanism of activation of AMPK andupregulation of OGG1 by rapamycin in cancer cells. Oncotarget2(12):958–959

14. Habib SL, Kasinath BS, Arya RR, Vexler S, Velagapudi C (2010)Novel mechanism of reducing tumourigenesis: upregulation of theDNA repair enzyme OGG1 by rapamycin-mediated AMPKactivation and mTOR inhibition. Eur J Cancer 46(15):2806–2820

15. Hanaoka K, Qian F, Boletta A, Bhunia AK, Piontek K, Tsiokas L,Sukhatme VP, Guggino WB, Germino GG (2000) Co-assembly ofpolycystin-1 and -2 produces unique cation-permeable currents.Nature 408(6815):990–994

16. Harris PC, Bae KT, Rossetti S, Torres VE, Grantham JJ, ChapmanAB, Guay-Woodford LM, King BF, Wetzel LH, Baumgarten DA,Kenney PJ, Consugar M, Klahr S, Bennett WM, Meyers CM, ZhangQJ, Thompson PA, Zhu F, Miller JP (2006) Cyst number but not therate of cystic growth is associated with the mutated gene in autosomaldominant polycystic kidney disease. J AmSocNephrol 17(11):3013–3019

17. Hartman TR, Liu D, Zilfou JT, Robb V, Morrison T, Watnick T,Henske EP (2009) The tuberous sclerosis proteins regulate formationof the primary cilium via a rapamycin-insensitive and polycystin 1-independent pathway. Hum Mol Genet 18(1):151–163

18. Hateboer N, Van DijkMA,Bogdanova N, Coto E, Saggar-Malik AK,San Millan JL, Torra R, Breuning M, Ravine D (1999) Comparisonof phenotypes of polycystic kidney disease types 1 and 2. EuropeanPKD1-PKD2 Study Group. Lancet 353(9147):103–107

19. Huang J, Manning BD (2008) The TSC1–TSC2 complex: amolecular switchboard controlling cell growth. Biochem J 412(2):179–190

20. Iyer S, Deutsch K, Yan X, Lin B (2007) Batch RNAi selector: astandalone program to predict specific siRNA candidates in batcheswith enhanced sensitivity. ComputMethods Programs Biomed 85(3):203–209

21. Karcher C, Fischer A, Schweickert A, Bitzer E, Horie S, Witzgall R,Blum M (2005) Lack of a laterality phenotype in Pkd1 knock-outembryos correlates with absence of polycystin-1 in nodal cilia.Differentiation 73(8):425–432

22. Lieberthal W, Levine JS (2012) Mammalian target of rapamycin andthe kidney part I: the signaling pathway. Am J Physiol Renal Physiol303(301):301–310

23. Lieberthal W, Levine JS (2012) Mammalian target of rapamycin andthe kidney part II: pathophysiology and therapeutic implications. AmJ Physiol Renal Physiol 303(302):180–391

24. Lipska KJ, Bailey CJ, Inzucchi SE (2011) Use of metformin in thesetting of mild-to-moderate renal insufficiency. Diabetes Care 34(6):1431–1437

25. McCarty MF, Barroso-Aranda J, Contreras F (2009) Activation ofAMP-activated kinase as a strategy for managing autosomal dominantpolycystic kidney disease. Med Hypotheses 73(6):1008–1010

26. Mekahli D, Sammels E, Luyten T, Welkenhuyzen K, van den HeuvelLP, Levtchenko EN, Gijsbers R, Bultynck G, Parys JB, De Smedt H,Missiaen L (2012) Polycystin-1 and polycystin-2 are both required toamplify inositol-trisphosphate-induced Ca(2+) release. Cell Calcium51(6):452–458

27. Novalic Z, van der Wal AM, LeonhardWN, Koehl G, BreuningMH,Geissler EK, de Heer E, Peters DJ (2012) Dose-dependent effects ofsirolimus on mTOR signaling and polycystic kidney disease. J AmSoc Nephrol 23(5):842–853

28. Ong AC, Harris PC, Biddolph S, Bowker C, Ward CJ (1999)Characterisation and expression of the PKD-1 protein, polycystin,in renal and extrarenal tissues. Kidney Int 55(5):2091–2116

29. Ong AC, Harris PC, Davies DR, Pritchard L, Rossetti S, Biddolph S,Vaux DJ, Migone N, Ward CJ (1999) Polycystin-1 expression in

Pflugers Arch - Eur J Physiol

PKD1, early-onset PKD1, and TSC2/PKD1 cystic tissue. Kidney Int56(4):1324–1333

30. Ong AC,Ward CJ, Butler RJ, Biddolph S, Bowker C, Torra R, Pei Y,Harris PC (1999) Coordinate expression of the autosomal dominantpolycystic kidney disease proteins, polycystin-2 and polycystin-1, innormal and cystic tissue. Am J Pathol 154(6):1721–1729

31. Peral B, Gamble V, Strong C, Ong AC, Sloane-Stanley J, Zerres K,Winearls CG, Harris PC (1997) Identification of mutations in theduplicated region of the polycystic kidney disease 1 gene (PKD1) bya novel approach. Am J Hum Genet 60(6):1399–1410

32. Perico N, Remuzzi G (2010) Do mTOR inhibitors still have a futurein ADPKD? Nat Rev Nephrol 6(12):696–698

33. Peters N, JayN, BarraudD, Cravoisy A, Nace L, Bollaert PE, Gibot S(2008) Metformin-associated lactic acidosis in an intensive care unit.Crit Care 12(6):R149

34. Ponticelli C, Locatelli F (2010) Autosomal dominant polycystickidney disease and mTOR inhibitors: the narrow road between hopeand disappointment. Nephrol Dial Transplant 25(12):3809–3812

35. Qian F, Germino FJ, Cai Y, Zhang X, Somlo S, Germino GG (1997)PKD1 interacts with PKD2 through a probable coiled-coil domain.Nat Genet 16(2):179–183

36. Qian Q, Du H, King BF, Kumar S, Dean PG, Cosio FG, Torres VE(2008) Sirolimus reduces polycystic liver volume in ADPKDpatients. J Am Soc Nephrol 19(3):631–638

37. Roelfsema JH, Spruit L, Saris JJ, Chang P, Pirson Y, van Ommen GJ,Peters DJ, Breuning MH (1997) Mutation detection in the repeatedpart of the PKD1 gene. Am J Hum Genet 61(5):1044–1052

38. Rossetti S, Hopp K, Sikkink RA, Sundsbak JL, Lee YK, Kubly V,Eckloff BW, Ward CJ, Winearls CG, Torres VE, Harris PC (2012)Identification of gene mutations in autosomal dominant polycystickidney disease through targeted resequencing. J Am Soc Nephrol23(5):915–933

39. Sammels E, Devogelaere B, Mekahli D, Bultynck G, Missiaen L,Parys JB, Cai Y, Somlo S, De Smedt H (2010) Polycystin-2activation by inositol 1,4,5-trisphosphate-induced Ca2+ releaserequires its direct association with the inositol 1,4,5-trisphosphatereceptor in a signaling microdomain. J Biol Chem 285(24):18794–18805

40. Sarbassov DD, Ali SM, Sabatini DM (2005) Growing roles for themTOR pathway. Curr Opin Cell Biol 17(6):596–603

41. Schrier RW (2010) Randomized intervention studies in humanpolycystic kidney and liver disease. J Am Soc Nephrol 21(6):891–893

42. Serra AL, Poster D, Kistler AD, Krauer F, Raina S, Young J, RentschKM, Spanaus KS, Senn O, Kristanto P, Scheffel H, Weishaupt D,Wuthrich RP (2010) Sirolimus and kidney growth in autosomaldominant polycystic kidney disease. N Engl J Med 363(9):820–829

43. Shaw RJ (2009) LKB1 and AMP-activated protein kinase control ofmTOR signalling and growth. Acta Physiol (Oxf) 196(1):65–80

44. Shillingford JM, Murcia NS, Larson CH, Low SH, Hedgepeth R,Brown N, Flask CA, Novick AC, Goldfarb DA, Kramer-Zucker A,Walz G, Piontek KB, Germino GG, Weimbs T (2006) The mTORpathway is regulated by polycystin-1, and its inhibition reverses renalcystogenesis in polycystic kidney disease. Proc Natl Acad Sci U S A103(14):5466–5471

45. Shillingford JM, Piontek KB, Germino GG, Weimbs T (2010)Rapamycin ameliorates PKD resulting from conditional inactivationof Pkd1. J Am Soc Nephrol 21(3):489–497

46. Takiar V, Nishio S, Seo-Mayer P, King JD Jr, Li H, Zhang L,Karihaloo A, Hallows KR, Somlo S, Caplan MJ (2011) ActivatingAMP-activated protein kinase (AMPK) slows renal cystogenesis.Proc Natl Acad Sci U S A 108(6):2462–2467

47. Tao Y, Kim J, Schrier RW, Edelstein CL (2005) Rapamycinmarkedlyslows disease progression in a rat model of polycystic kidney disease.J Am Soc Nephrol 16(1):46–51

48. Torra R, Badenas C, Perez-Oller L, Luis J, Millan S, Nicolau C,Oppenheimer F, Mila M, Darnell A (2000) Increased prevalence ofpolycystic kidney disease type 2 among elderly polycystic patients.Am J Kidney Dis 36(4):728–734

49. Torres VE, Harris PC (2009) Autosomal dominant polycystic kidneydisease: the last 3 years. Kidney Int 76(2):149–168

50. Wahl PR, Serra AL, Le Hir M, Molle KD, Hall MN, Wuthrich RP(2006) Inhibition of mTOR with sirolimus slows disease progressionin Han:SPRD rats with autosomal dominant polycystic kidneydisease (ADPKD). Nephrol Dial Transplant 21(3):598–604

51. Walz G, Budde K, Mannaa M, Nurnberger J, Wanner C, SommererC, Kunzendorf U, Banas B, Horl WH, Obermuller N, Arns W,Pavenstadt H, Gaedeke J, Buchert M, May C, Gschaidmeier H,Kramer S, Eckardt KU (2010) Everolimus in patients with autosomaldominant polycystic kidney disease. N Engl J Med 363(9):830–840

52. Watnick T, Germino GG (2010) mTOR inhibitors in polycystickidney disease. N Engl J Med 363(9):879–881

53. Wilmer MJ, Saleem MA, Masereeuw R, Ni L, van der Velden TJ,Russel FG, Mathieson PW, Monnens LA, van den Heuvel LP,Levtchenko EN (2010) Novel conditionally immortalized humanproximal tubule cell line expressing functional influx and effluxtransporters. Cell Tissue Res 339(2):449–457

54. Wu G, D'Agati V, Cai Y, Markowitz G, Park JH, Reynolds DM,Maeda Y, Le TC, Hou H Jr, Kucherlapati R, Edelmann W, Somlo S(1998) Somatic inactivation of Pkd2 results in polycystic kidneydisease. Cell 93(2):177–188

55. Wu M, Arcaro A, Varga Z, Vogetseder A, Le Hir M, Wuthrich RP,Serra AL (2009) Pulse mTOR inhibitor treatment effectively controlscyst growth but leads to severe parenchymal and glomerularhypertrophy in rat polycystic kidney disease. Am J Physiol RenalPhysiol 297(6):F1597–1605

56. Wullschleger S, Loewith R, Hall MN (2006) TOR signaling ingrowth and metabolism. Cell 124(3):471–484

57. Yu Y, Ulbrich MH, Li MH, Buraei Z, Chen XZ, Ong AC, Tong L,Isacoff EY, Yang J (2009) Structural and molecular basis of theassembly of the TRPP2/PKD1 complex. Proc Natl Acad Sci U S A106(28):11558–11563

58. Zafar I, Belibi FA, He Z, Edelstein CL (2009) Long-term rapamycintherapy in the Han:SPRD rat model of polycystic kidney disease(PKD). Nephrol Dial Transplant 24(8):2349–2353

59. Zafar I, Ravichandran K, Belibi FA, Doctor RB, Edelstein CL (2010)Sirolimus attenuates disease progression in an orthologous mousemodel of human autosomal dominant polycystic kidney disease.Kidney Int 78(8):754–761

Pflugers Arch - Eur J Physiol