Part 1 Chapter 11

Analysis of protein-RNA interactions with single-nucleotide resolution using iCLIP and Next Generation Sequencing

Julian König, Nicholas J. McGlincy and Jernej Ule Julian König MRC Laboratory of Molecular Biology Hills Road CB2 0QH Cambridge United Kingdom Nicholas J. McGlincy MRC Laboratory of Molecular Biology Hills Road CB2 0QH Cambridge United Kingdom Jernej Ule MRC Laboratory of Molecular Biology Hills Road CB2 0QH Cambridge United Kingdom

Analysis of protein-RNA interactions with single-nucleotide resolution using iCLIP and Next Generation Sequencing

Julian König, Nicholas J. McGlincy and Jernej Ule Abstract Post-transcriptional regulation of gene expression is controlled by the unique composition and spatial arrangement of RNA-binding proteins (RBPs) on individual transcripts. Therefore, understanding post-transcriptional regulation requires precise and comprehensive binding-site maps for RBPs. UV cross-linking and immunoprecipitation (CLIP) is a state-of-the-art technique for generating such maps on a genome-wide scale. However, data complexity is often limited, and the resolution of the resulting maps is confined to approximately 30 nucleotides. This, in turn, complicates the identification of individual binding sites. We recently described individual nucleotide resolution CLIP (iCLIP), an approach that both increases data complexity and allows binding site detection at single nucleotide resolution. Here we present the latest version of our iCLIP protocol, discussing critical aspects and recent modifications. 11.1 Introduction Throughout their lifetime, transcripts are associated with a plethora of RNA-binding proteins (RBPs). The combinatorial binding and spatial arrangement of these RBPs give rise to a diverse range of ribonucleoprotein particles that determine the cellular fate and function of each RNA [1, 2]. Recent advances towards more precise positional information on the binding sites of RBPs within RNAs have improved our understanding of the molecular mechanisms of post-transcriptional regulation [3]. Originally, protein-RNA interactions were studied using biochemical methods such as SELEX, electrophoretic mobility shift and RNA protection assays, or genetic methods such as the yeast three-hybrid system [4-6]. These approaches, however, did not address RNA binding in its native cellular context. In a first step towards preserving the cellular context, RNA immunoprecipitation was combined with differential display or microarray analysis (RIP-CHIP) [7-9]. These methods were of low resolution and prone to identifying indirect interactions. Furthermore, they were limited to studying stable RNPs since protein-RNA complexes can re-associate after cell lysis [10]. In order to increase the resolution and specificity, a strategy referred to as CLIP (UV cross-linking and immunoprecipitation) was developed [11, 12]. CLIP combines UV cross-linking of RBPs to their cognate RNA molecules with rigorous purification schemes. In combination with high-throughput sequencing, CLIP has proven as a powerful tool to study protein-RNA interactions on a genome-wide scale (referred to as HITS-CLIP or CLIP-seq) [13, 14]. Prominent examples range from regulation of alternative splicing in mammals [14-16], to protein-microRNA interactions and subcellular RNA localization in organisms as diverse as Caenorhabditis elegans and the fungus Ustilago maydis [17-19]. Recent modifications of the protocol include the use of photoreactive ribonucleoside analogs (PAR-CLIP) [20, 21] and affinity purification under denaturing conditions (CRAC) [22].

Despite the high specificity of the obtained data, CLIP experiments commonly generate cDNA libraries of limited complexity. This is partly due to the restricted amount of co-purified RNA, resulting from inefficiency of cross-linking and the two RNA ligation reactions that are required for library amplification. In addition, many cDNAs prematurely truncate at the cross-linked nucleotide [23] and are thus lost during the standard CLIP library preparation protocol. We recently developed iCLIP (individual-nucleotide resolution CLIP) to overcome this limitation [24]. In order to capture the truncated cDNAs, we replaced one of the inefficient intermolecular RNA ligation steps with a more efficient intramolecular cDNA circularisation. Importantly, sequencing the truncated cDNAs provides direct insights into the position of the cross-link site, allowing us to map protein-RNA interactions with single-nucleotide resolution. We have successfully applied iCLIP to study the impact of binding position on the regulation of alternative splicing by hnRNP C and TIA1/TIAL1 [24, 25]. In the following chapter we describe our most recent version of the iCLIP protocol and discuss new additions and key features of this technology. 11.2 Procedure Overview In order to preserve in vivo protein-RNA interactions, living cells or tissue are irradiated with UV-C light. This covalently cross-links proteins to RNA molecules at positions of close proximity (Fig. 1). Cross-linked sites will therefore represent the positions of direct protein-RNA interactions. Following cross-linking, the cells are lysed and the RNA is fragmented using low concentrations of RNase I. Next, the protein-RNA complex is immunoprecipitated with an antibody specific to the protein of interest. The antibody is immobilized on magnetic beads to facilitate washing and buffer changes. After stringent washing, a DNA adapter is ligated to the 3´ end of the RNA, while the 5´ end is radioactively labelled. Upon denaturing gel electrophoresis, the complex is transferred to a nitrocellulose membrane. This removes free RNAs that are not covalently attached to the protein. The radioactive label allows visualisation of the purified protein-RNA complex by autoradiography (Fig. 2). This is used to guide extraction of the membrane region containing the protein–RNA complex. The covalent bond formed by UV cross-linking is irreversible, so the protein is removed from the RNA by proteinase K digestion. This leaves a short, covalently attached peptide at the cross-link site that interferes with reverse transcription. Consequently, most cDNAs will truncate at this position, thereby inheriting the information about the cross-linked nucleotide. In order to recover these truncated cDNAs, we developed a cloning procedure based on cDNA circularization. To this end, reverse transcription is performed with oligonucleotide primers that contain two inversely oriented adapter regions separated by a BamHI restriction site. In addition, the primers carry at their 5´-end a 4-nt barcode to mark individual experiments, as well as a 5-nt random barcode to control for PCR artefacts by individualizing single cDNA molecules. The resulting cDNAs are size-purified using denaturing gel electrophoresis (Fig. 3) and circularized by single-stranded DNA ligase. The circularized cDNAs are re-linearized by BamHI digestion. This is accomplished by annealing a complementary oligonucleotide to the single-stranded restriction site between the two adapter regions. The re-linearized cDNAs are PCR-amplified and analyzed using polyacrylamide gel

electrophoresis (Fig. 4). Finally, samples are subjected to high-throughput sequencing on the Illumina Genome Analyser II. ((Figure 1)) 11.3 Antibody and Library Preparation Quality Controls During the course of an iCLIP experiment, the quality of immunoprecipitation and library preparation can be monitored at two steps: first, the autoradiograph, which allows study of the size distribution of the purified protein-RNA complexes, and second, gel electrophoresis of the final PCR products, which allows monitoring of the size distribution of amplified cDNA fragments and the identification of any non-specific products. It is of vital importance to use these two steps to control for the correct size of the protein-RNA complex, the antibody specificity and the quality of cDNA amplification. In the first step, the size distribution of the protein–RNA complexes after partial and complete RNase digestion (low RNase, used for library preparation, and high RNase; Fig. 2) is compared by autoradiography. In the low-RNase sample, the radioactive signal should be broad, extending from the size of the protein into higher molecular weight areas. This represents the protein cross-linked to radioactively labelled RNA fragments of various sizes. In the high-RNase sample, where the cross-linked RNA is reduced to its minimum size, there should be only one sharp radioactive band migrating slightly above the expected size of the protein. The absence of a clear change in signal migration upon RNase treatment could indicate that conditions for partial digestion are inappropriate, that cell extracts contain high endogenous RNase activity or that the RBP itself has been labelled by the polynucleotide kinase reaction. In the latter case, the radioactive signal would persist in the control sample omitting of UV irradiation. This control also allows detection of contaminating non-cross-linked RNA. ((Figure 2)) The specificity of the immunoprecipitation is typically assessed with a no-antibody control, which should give no signal in the autoradiograph (Fig. 2). In addition, the high-RNase samples should be carefully examined to detect signals from non-specific RBPs that co-immunoprecipitate with the protein of interest. Ideally, these contaminating signals should be avoided or minimized by optimizing the immunoprecipitation conditions or changing the antibody. An alternative source of additional signals in the autoradiograph can be remnants of free DNA adapter, which is applied in huge excess. The free adapter migrates at approximately 55 kDa. Increasing the duration and number of washing steps after the ligation can reduce this background. To completely avoid radioactive labelling of the DNA adapter, it is possible to remove the aliquot for radioactive labelling prior to the ligation step. It is, however, important to note that carry-over of DNA adapter into the reverse transcription reaction can lead to undesired primer-dimer products, therefore labelling of the complex after ligation is recommended to monitor such contamination. Finally, specificity of the antibody itself should be controlled with samples from knockout or

knockdown cells (or tissue). In the latter samples, a decrease in radioactive signal should correlate with the knockdown efficiency. In order to control the different steps of library preparation, it is important to maintain one or more negative controls throughout the complete experiment. Optimal input material for these controls are the no-antibody samples or an immunoprecipitation from knockout cells. Control samples should show no product after PCR amplification (Fig. 4) and should return very few unique sequences from high-throughput sequencing. Knockdown cells are not recommended as a sequencing control, since these still contain the protein, albeit in smaller quantities. After PCR amplification, the length distribution of the products should reflect the size range of cDNAs that were cut from the polyacrylamide gel after reverse transcription (Fig. 3 and 4). Note that the PCR primers introduce an additional 76 nt, therefore amplification of cDNAs of 75-120 nt should produce products of 151-196 nt on the PCR gel. In some cases, especially if the RNA input was low, a primer-dimer product of 128 nt can appear. This should be removed by further gel purification. A broader size distribution or additional bands are indicative of secondary products formed during the PCR reaction (most often due to over-amplification), degradation of cDNAs prior to circularization or, in the worst case, amplification of contaminating DNA. If any of these products are seen, sequencing of the library is not recommended. ((Figure 3)) ((Figure 4)) 11.4 Oligonucleotide Design The iCLIP protocol requires a specific set of RNA and DNA oligonucleotides that guide the enzymatic reactions and minimize the generation of undesired by-products (Fig. 5): In the latest version of our protocol, the DNA oligonucleotide L3-App is ligated to the 3´ end of the purified RNA to allow for sequence-specific priming of the reverse transcription. The sequence of L3-App is complementary to the 3´ end of the PCR primer P3Solexa, which is used to amplify the library for high-throughput sequencing. The 3´ end of L3-App is blocked with a dideoxycytidine to prevent oligomerization during the ligation reaction. Importantly, the 5´ end of L3-App is pre-adenylated (App) to improve the ligation efficiency [26, 27]. The pre-adenylation constitutes a ligation intermediate upon ATP activation, and therefore no further ATP has to be added to the reaction. This prevents the formation of L3-App-independent inter- or intramolecular ligation products. Furthermore, since the 5´ ends of the RNAs no longer need to be dephosphorylated, we replaced the calf intestine phosphatase (CIP) with the polynucleotide kinase (PNK), which contains efficient 3' end-specific phosphatase activity when used at low pH. ((Figure 5))

Reverse transcription is primed with one of the oligonucleotides Rt1Clip - Rt16Clip (abbreviated as Rt#Clip), which are complementary to the last nine nucleotides (excluding the dideoxycytidine) at the 3´ end of L3-App. Since annealing of primer P3Solexa during the subsequent PCR reaction requires the full sequence introduced by L3-App, this incomplete overlap ensures that the Rt#Clip products cannot be amplified unless L3-App served as a template during reverse transcription. This is vital since excess of circularized Rt#Clip oligonucleotides would otherwise facilitate generation of primer-dimers during the PCR amplification. The Rt#Clips also contain an adapter region complementary to the 3´ end of the second PCR primer P5Solexa. The regions of Rt#Clip corresponding to P3Solexa and P5Solexa are separated by a BamHI restriction site that allows linearization of the circularized cDNAs later on in the proceedure. At the 5´ end, Rt#Clips contain two distinct barcode regions. The 4-nt experiment-specific barcode is unique to each Rt#Clip oligonucleotide and marks individual experiments or replicates. The 5-nt random barcode is unique to each Rt#Clip molecule and allows products of different reverse transcription events to be distinguished from mere PCR duplicates. In our latest versions of Rt#Clip, we split the random barcode and moved three random nucleotides to the beginning of the sequence reads. This is different from our previous primer design, where the sequence read started with the experiment-specific barcode. The reason for this rearrangement was that cluster definition by the Genome Analyser software can be impaired if all reads share the same starting nucleotides. The remaining two random nucleotides were placed at the 5´ end of the Rt#Clips to reduce a sequence-dependent bias during circularization. To allow for ligation during the circularization reaction, all Rt#Clip oligonucleotides are 5´-phosphorylated. Prior to PCR amplification, the circularized cDNA molecules require linearization by cutting between the two adapter regions. To guide this enzymatic reaction, a DNA oligonucleotide (cut-oligo) covering the BamHI site and its flanking regions is annealed to the cDNAs. To prevent cut-oligo from serving as a primer during the subsequent PCR amplification, it contains four non-complementary adenosines at its 3´ end. PCR amplification is performed with the oligonucleotides P3Solexa (61 nt) and P5Solexa (58 nt). Their 3´ ends are complementary to the two adapter regions introduced by L3-App and the Rt#Clip oligonucleotides. P3Solexa and P5Solexa contain additional 41 and 39 nt, respectively, required for high-throughput sequencing with the Illumina Genome Analyser II. 11.5 Recent Modifications of the iCLIP Protocol In order to generate RBP binding maps of superior coverage and specificity, we are continuously working to improve the iCLIP protocol. Recent key modifications are the new barcode design for the reverse transcription primers and the usage of a pre-adenylated adapter that improves efficiency of the intermolecular ligation step (as discussed above). To further enhance ligation efficiency we now add polyethylene glycol 400 (PEG400) to the ligation reaction. We found that PEG of higher molecular weights had a negative effect on protein recovery from the immunoprecipitation.

Size purification of the cDNA products is necessary to remove excess reverse transcription primer that can give rise to primer-dimer formation during the PCR reaction. We excise three bands of different molecular weights from the cDNA gel. We found that the lower molecular weight fraction is prone to isolation of contaminant primer-dimers. However, this fraction can also contain interesting short RNA species, such as micro RNAs. Splitting the cDNA into three size fractions therefore avoids contamination of higher molecular weight fractions with primer-dimer products and at the same time allows recovery of smaller cDNAs (Fig. 3). The three fractions are treated separately during PCR and gel analysis, but can be mixed before submitting the library for high-throughput sequencing. The choice of fractions to be sequenced can be made after analysis of the final PCR products and evaluation of primer-dimer occurrence. During PCR amplification of the cDNA library it is critical that no secondary products are generated. Therefore, we have tested different PCR enzyme mixes for their efficiency and propensity to generate undesired products. In our hands, Accuprime supermix I (Invitrogen) and Immomix (Bioline) performed best in terms of specificity. We prefer Accuprime supermix, since the reaction buffer is compatible with TBE gel electrophoresis. This eliminates the need for purification prior to the gel run. In terms of efficiency, we found Phusion mix (Finnzymes) to be the best enzyme mix. The reaction is, however, very sensitive to over-amplification and secondary product generation, so we do not recommend it for iCLIP experiments. 11.6 Troubleshooting Since the iCLIP protocol contains a diverse range of enzymatic reactions and purification steps, it is not always easy to identify a problem when an experiment fails. Therefore, this section contains a few general suggestions, while more specific comments are given throughout the protocol. Each step has to be performed with high accuracy to obtain proper results. Precautions should also be taken to avoid contamination with PCR products from previous experiments. The best way to minimize this problem is to spatially separate pre- and post-PCR steps. Ideally, the analysis of the PCR products and all subsequent steps should be performed in a separate room. Moreover, buffers and other reagents should be aliquoted so that each member of the laboratory has their own set. In this way, sources of contamination can be easier identified. Finally, let's get started with your iCLIP experiment. 11.7 Protocol 1. UV Cross-linking 1.1 Tissues Note 1 – 50 mg tissue produced good data using the anti-Nova or anti-hnRNP C

antibodies. For neuronal tissue use HBSS instead of PBS.

1.1 A. Harvest 500 mg of tissue (enough for 10 immunoprecipitations). Add 5 ml ice-cold PBS.

1.1 B. Sequentially pass the tissue several times through the following: a) a 10 ml pipette. b) a 10 ml pipette with a cut p1000 tip (cut off a bit from the tip with a blade). c) a 10 ml pipette with an uncut p1000 tip. d) a 10 ml pipette with a p10 tip. Note 2 – UV light can penetrate a few cell layers, so triturating to a single cell

suspension is unnecessary. We use this procedure to partially triturate (?) brain tissue. Other tissue may require different dissociation protocols.

1.1 C. Transfer to a 10 cm tissue culture plate and place on ice. Irradiate suspension

4x with 100 mJ/cm2 in a Stratalinker 2400 at 254 nm. Mix between each irradiation.

Note 3 – The length of cross-linking should be optimised for each protein, as each

RNA-binding domain cross-links with different efficiency depending on its content of aromatic amino acids and the nucleotide composition of the binding site. Try 100, 200 and 400 mJ/cm2, then use the shortest condition that gives >70% of the maximum signal.

1.1 D. Add 0.5 ml suspension to each of 10 microtubes, spin at top speed for 10 s at

4°C to pellet cells and remove the supernatant. 1.1 E. Snap freeze pellets on dry ice and store at -80°C until use. 1.2 Tissue culture cells 1.2 A. Add 6 ml ice-cold PBS to cells growing in a 10 cm plate (enough for 10

immunoprecipitations). Remove lid and place on ice. 1.2 B. Irradiate once with 150 mJ/cm2 in a Stratlinker 2400 at 254 nm. Note 4 – Cells grown in a monolayer are equally exposed to the UV light and hence

only require a single irradiation to cross-link equally. 1.2 C. Harvest cells by scraping, using cell lifters. 1.2 D. Add 2 ml suspension to each microtube, spin at top speed for 10 s at 4°C to

pellet cells, then remove supernatant. 1.2 E. Snap freeze pellets on dry ice and store at -80°C until use. 2. Immunoprecipitation 2.1 Solutions 2.1 A. Store all buffers in the fridge and perform the procedure on ice.

Lysis Buffer 50 mM Tris-HCl, pH 7.4 100 mM NaCl 1% NP-40 0.1% SDS 0.5% sodium deoxycholate On the day of experiment, add 1/100 volume of protease inhibitor cocktail

(Calbiochem) to the amount of buffer required for lysis (but not washing). Note 5 – If you are working with a tissue with high RNase A activity, adding 1/1000

volume of ANTI-RNase (AM2692, Ambion) will control the RNase conditions, without affecting the activity of RNase I.

High-salt Wash 50 mM Tris-HCl, pH 7.4 1 M NaCl 1 mM EDTA 1% NP-40 0.1% SDS 0.5% sodium deoxycholate PNK Buffer 20 mM Tris-HCl, pH 7.4 10 mM MgCl2 0.2% Tween-20 5x PNK pH 6.5 Buffer: 350 mM Tris-HCl, pH 6.5 50 mM MgCl2 25 mM dithiothreitol (freeze aliquots of the buffer) 4x Ligation Buffer 200 mM Tris-HCl, pH 7.8 40 mM MgCl2 40 mM dithiothreitol PK Buffer 100 mM Tris-HCl, pH 7.4 50 mM NaCl 10 mM EDTA PK Buffer + 7 M Urea 100 mM Tris-HCl, pH 7.4 50 mM NaCl 10 mM EDTA 7 M urea 2.2 Bead preparation

Note 6 – The amounts given below are meant for the cloning experiment. For

preliminary experiments or the high-RNase control less can be used. 2.2 A. Add 100 µl of protein A Dynabeads (for rabbit antibodies; Dynal, 100.02) per

experiment to a microtube. Note 7 – Use protein G Dynabeads for a mouse or goat antibody. These can

sometimes work better for rabbit antibodies, too. 2.2 B. Wash beads 2x with lysis buffer. 2.2 C. Resuspend beads in 100 µl lysis buffer with 2-10 µg antibody per experiment. Note 8 – The amount of antibody required depends on its quality and purity. This

should be optimised in preliminary experiments. 2.2 D. Rotate tubes at room temperature for 30-60 min (until lysate is ready). 2.2 E. Wash 3x with lysis buffer and leave in the last wash until ready to proceed to

2.4 A. 2.3 Partial RNA digestion and centrifugation 2.3 A. Resuspend cell pellet (from step 1) in 1 ml lysis buffer (with protease

inhibitors). Note 9 – We are aiming for a concentration of ~ 10 mg/ml. Mouse brain pellets have

±50 mg, and cell culture pellets ±20 mg. Weighing pellets before freezing can help you to be more precise about the required volume of lysis buffer.

2.3 B. Sonicate sample on ice (optional step). The probe should be approximately 0.5

cm from the bottom of the tube and not touching the tube sides in order to avoid foaming. Sonicate 2x with 10 s bursts at 5 decibels. Clean the probe by sonicating water before and after sample treatment.

Note 10 – Sonication helps when using cell culture as undigested viscous DNA can

sometimes cause problems with the IP. It can also alleviate problems caused by mild lysis buffers or hard-to-lyse tissues.

Note 11 – Optionally, the lysate can be pre-cleared with protein A sepharose (this

doesn’t hurt, but usually makes little difference; it may reduce background when using protein A Dynabeads with a dirty antibody). Prepare a 30% protein A sepharose slurry in water. Add 100 µl protein A sepharose slurry to 1.5 ml lysate and rotate for 10 min in the cold room before spinning.

2.3 C. Make 1/1000 RNase I (Ambion, AM2295) dilution in lysis buffer and add 10

µl to the lysate together with 2 µl Turbo DNase (Ambion, AM2238).

2.3 D. Incubate for 3 min at 37°C shaking at 1100 rpm. After incubation transfer to ice for >3 min.

Note 12 – It is important to digest for exactly 3 min. Use 1.5 ml tubes for 1.5 ml

Eppendorf thermomixer to make the warming to 37°C efficient and reproducible.

Note 13 – The optimal dilution factor for the low-RNase condition depends on the

batch of RNase, so in the first experiment several dilutions should be tested. Concentrations between 1:500 to 1:2000 have worked well for us in the past. Unlike other DNases, Turbo DNase is active in conditions of up to 200 mM NaCl.

2.3 E. (optional step, recommended for initial optimisations) Treat one sample with

high RNase: prepare a 1/50 RNase I dilution in lysis buffer and add 10 µl to the lysate together with 2 µl Turbo DNase. Incubate for 3 min at 37°C shaking at 1100 rpm and then transfer to ice for >3 min. This control can go straight from step 2.4 D to step 2.7 B (the RNA will be too short for ligation of the RNA linker). To minimise the use of reagents, it is possible to use only 1/5 of the cell lysate and all other reagents for this experiment.

Note 14 – The high-RNase control can be omitted after successful optimisation. Other

recommended controls include a control where the RNA-binding protein is absent from the original material (such as a knockout animal or knockdown cells), a control where no cross-linking is done and a control where no antibody is used during IP.

Note 15 – Unlike other RNases, RNase I has no base preference, and therefore

cleaves after all four nucleotides. Under high-RNase conditions, the size of the radioactive band viewed by SDS-PAGE has to change in comparison to low-RNase conditions, confirming the band corresponds to a protein-RNA complex. Furthermore, this experiment helps to determine the size of the immunoprecipated RNA-binding protein, as the protein will be bound to short RNAs and thus will migrate as a less diffuse band ~5 kDa above the expected molecular weight.

2.3 F. (optional step) Add cold lysis buffer to the lysate to bring it to the total of 2 ml.

A more diluted lysate can decrease the background in the IP. Note 16 – Optional: To test a new antibody, collect 15 µl at this step for Western blot

comparison of lysate before and after IP (to visualise depletion of the protein from the lysate).

2.3 G. Spin at 4°C at top speed for 20 minutes (15000 rpm or 21800 g with our

centrifuge) and carefully collect the supernatant. 2.4 Immunoprecipitation 2.4 A. Remove wash buffer from the beads, then add the cell extract to the beads.

2.4 B. Rotate beads/lysate mix for 1 h or over night at 4°C. Note 17 – Optional: save 15 µl supernatant for Western blot analysis in order to

assess the amount of the antigen before and after immunoprecipitation. 2.4 C. Discard the supernatant and wash 2x with high-salt wash (rotate the second

wash for at least 1min in the cold room). 2.4 D. Wash 2x with PNK buffer and then resuspend in 1 ml PNK buffer (samples

can be left at this at 4°C [even overnight] until you are ready to proceed to step 2.5).

2.5 3' end RNA dephosphorylation 2.5 A. Discard supernatant. Resuspend the beads in 20 µl of the following mixture: 4.0 µl 5x PNK pH 6.5 buffer 0.5 µl PNK (NEB; with 3’ phosphatase activity) 0.5 µl RNasin 15.0 µl water 2.5 B. Incubate for 20 min at 37°C. 2.5 C. Wash 1x with PNK buffer. 2.5 D. Wash 1x with high-salt wash (rotate wash for at least 1 min in cold room). 2.5 E. Wash 2x with PNK buffer. 2.6 L3 Linker ligation 2.6 A. Carefully remove the supernatant and resuspend the beads in 20 µl of the

following mix: 9.0 µl water 4.0 µl 4X ligation buffer 1.0 µl RNA ligase (NEB) 0.5 µl RNasin (NEB) 1.5 µl pre-adenylated linker L3-App (20 µM) 4.0 µl PEG400 (81170, Sigma) 2.6 B. Incubate overnight (~16 h) at 16°C. 2.6 C. Add 500 µl PNK buffer. 2.6. D. Wash 2x with 1 ml high-salt buffer, rotating in the wash for 5 min in the cold

room. 2.6 E. Wash 2x with 1 ml PNK buffer and leave in 1 ml of the second wash.

2.7 5' end labelling 2.7 A. Collect 200 µl (20%) of beads from step 2.6 E and remove the supernatant. 2.7 B. Add 4 µl of hot PNK mix: 0.2 µl PNK (NEB) 0.4 µl 32P-γ-ATP 0.4 µl 10x PNK buffer (NEB) 3.0 µl water 2.7 C. Incubate for 5min at 37°C. 2.7 D. Remove the supernatant and add 20 µl of 1x NuPAGE loading buffer (prepared

by mixing 4x stock with water; Invitrogen) to the beads. Remove the supernatant from remaining cold beads from step 2.6 E. Then add the radioactively labelled beads to the cold beads. Incubate at 70°C for 5 min.

2.7 E. Place on magnet to precipitate the beads and load the eluate on the gel. 3. SDS-PAGE and nitrocellulose transfer 3 A. Load the samples on a 4-12% NuPAGE Bis-Tris gel (Invitrogen) according to

the manufacturer's instructions. Use 0.5 l 1× MOPS running buffer (Invitrogen). Also load 5 µl of a pre-stained protein size marker (for example PAGE ruler plus, Fermentas, SM1811).

Note 18 – The Novex NuPAGE gels are critical. A pour-your-own SDS-PAGE gel

(Laemmli) changes its pH during the run which can get to ~9.5 leading to alkaline hydrolysis of the RNA. The Novex NuPAGE buffer system is close to pH 7. We use MOPS NuPAGE running buffer.

3 B. Run the gel for 50 min at 180 V. 3 C. Remove the dye front and discard it as solid waste (contains free radioactive

ATP). 3 D. Transfer the protein-RNA complexes from the gel to a Protan BA85

Nitrocellulose Membrane (Whatman) using the Novex wet transfer apparatus according to the manufacturer's instructions (Invitrogen; transfer for 1 h at 30 V; do not forget to add 10% methanol to the transfer buffer).

Note 19 – The pure nitrocellulose membrane is a little fragile, but it works better for

the RNA/protein extraction step. 3 E. After the transfer, rinse the membrane in PBS buffer, then wrap it in saran wrap

and expose it to a Fuji film at -80°C (place a fluorescent sticker next to the membrane to later align the film and the membrane). Perform exposures for 30 min, 1 h and over night.

Note 20 – Most free RNA will have left out of the gel or through the membrane, so the

membrane will be 10-100 times less radioactive than the samples loaded on the gel.

4. RNA isolation 4 A. Use the high-RNase condition to examine the specificity of the protein-RNA

complex. Note 21 – When performing iCLIP for the first time, use the following criteria to

check that a specific RNA-protein cross-link and pulldown has been performed: 1. Is there a radioactive band ~5 kDa above the molecular weight of the protein in

the high-RNase experiment? 2. Does the band disappear in the control experiments? These might include: no

UV cross-link, pulldown with no antibody (beads only or pre-immune serum), samples from a knockout organism or knockdown cells, or an appropriate control for overexpressed tagged proteins.

3. Does the band move up and become more diffuse in the low-RNase condition? Because the RNA digestion is random, the RNA sizes vary more in the low RNase condition and thus the RNA-protein complexes are more heterogeneous in size.

On this basis, if you are convinced of the veracity of your results, proceed to RNA

isolation and amplification. Note the following guidelines: 1. The average molecular weight of 70 nucleotides of RNA is ~20 kDa. As the tags

contain a linker of 21 nt (L3-App), the ideal position of RNA-protein complexes that will generate iCLIP tags of sufficient length is ~20-60 kDa above the expected molecular weight of the protein.

2. The width of the excised band depends on potential other RNA-protein complexes present in the vicinity as seen in the high RNase experiment. If none are apparent, cut a wide band of ~20-60 kDa above the molecular weight of the protein. If, however, other contaminant bands are present above the size of the protein, cut only up to the size of those bands. If the contaminating bands run below your RNA-protein complex, you might consider cutting an additional band between the contaminating band and your protein-RNA complex. The RNA sequences cloned from this band can later be used to compare with those purified with your protein/RNA complex to control the specificity of your experiment.

4 B. Isolate the protein-RNA complexes from the low-RNase experiment using your

autoradiograph as a mask by cutting the respective region out of the nitrocellulose membrane. The region can be taken either in a single piece or further divided into two portions designated H (high, upwards from the band) and L (low, downwards from the band). Place the membrane fragments into 1.5 ml tubes. If a piece of membrane is too large to fit down to the bottom of the tube, cut it into several pieces before placing it into the tube.

4 C. Add 10 µl proteinase K (Roche, 03115828001) in 200 µl PK buffer to the nitrocellulose pieces (all should be submerged). Incubate shaking at 1100 rpm for 20 min at 37°C.

4 D. Add 200 µl of PK buffer + 7 M urea and incubate for further 20 min at 37°C and

1100 rpm. 4 E. Collect the solution and add it together with 400 µl RNA phenol/CHCl3

(Ambion, 9722) to a 2 ml Phase Lock Gel Heavy tube (713-2536, VWR). Note 22 – Over 90% of the radioactive signal should be removed after proteinase K

treatment. This can be monitored by a Geiger counter measurement of the membrane pieces before adding proteinase K and after removing it.

4 F. Incubate for 5 min at 30°C shaking at 1100 rpm (DO NOT VORTEX). Separate

the phases by spinning for 5 min at 13000 rpm at room temperature. 4 G. Transfer the aqueous layer into a new tube (be careful not to touch the gel matrix

with the pipette). Precipitate by addition of 0.5 µl glycoblue (Ambion, 9510), 40 µl 3 M sodiumacetate pH 5.5. Then mix and add 1 ml 100% ethanol, mix again and place over night at -20°C.

Note 23 – Glycoblue is necessary to efficiently precipitate the small quantity of RNA. 4 H. Spin for 15 min at 15000 rpm at 4°C. Remove the supernatant and wash the

pellet with 0.5 ml 80% ethanol. Resuspend the pellet in 6.25 µl water. Note 24 – Remove the wash first with a p1000 and then with a p20 or p10. Try not to

disturb the pellet, but if you do, spin it down again. Leave on the bench for 3 min, but no longer, with the cap open to dry. When resuspending, make sure to pipette along the back area of the tube.

5. Reverse transcription 5 A. Add the following reagents to the resuspended pellet from step 4 H: 0.5 µl primer Rt#clip (0.5 pmol/µl) 0.5 µl dNTP mix (10 mM) Note 25 – Don’t forget a negative control. This can either be a reaction where no

RNA was added to the mix, but preferably a control sample that was isolated from a piece of nitrocellulose that did not contain the protein-RNA complex (for example the no-antibody control). Use distinct primers (Rt1clip - Rt16clip) for the control and the different replicates or experiments. The different primers contain individual 4-nt barcode sequences that allow multiplexing of samples and control for cross-contamination between samples.

5 B. RT thermal programme: 70°C 5 min

25°C hold until the RT mix (see below) is added, mix by pipetting. RT mix 2.0 µl 5x RT buffer (Invitrogen) 0.5 µl 0.1 M DTT 0.25 µl Superscript III RT (200 U/µl; Invitrogen)

25°C 5 min 42°C 20 min 50°C 40 min 80°C 5 min 4°C hold 5 C. Mix the samples that shall be multiplexed at this point. 5 D. Add TE buffer to 100 µl, then add 0.5 µl glycoblue and mix. Add 15 µl sodium

acetate, pH 5.5, and mix, then add 300 µl 100% ethanol. Mix again and precipitate over night at -20°C.

6. Gel purification 6 A. Spin down for 15 min at 15000 rpm at 4°C. Remove the supernatant and wash

the pellet with 0.5 ml 80% ethanol. Spin down again, remove supernatant and resuspend the pellet in 6 µl water.

6 B. Add 6 µl 2x TBE-urea loading buffer (Invitrogen) to the cDNA. It is

recommended, at least in initial experiments, to add loading buffer also to 6 µl size marker (NEB low molecular weight marker, N3233S; diluted 1/30). Heat samples to 80°C for 3 min directly before loading. Leave one lane between each sample to facilitate cutting.

6 C. Prepare 0.8 l 1x TBE running buffer and fill the upper chamber with 0.2 l and the

lower chamber with 0.6 l. Use p1000 to flush precipitated urea out of the wells before loading 12 µl of each sample. Load the marker into the last lane.

6 D. Run 6% TBE-urea gel for 40 min at 180 V until the lower (dark blue) dye is

close to the bottom. 6 E. (optional – only if the size marker was added) Cut off the last lane containing the

size marker and stain it by incubation for 10 min shaking in 10 ml TBE buffer with 2 µl SYBR green II stock. Wash 1x with TBE and visualise by UV transillumination. Record the sizes of the marker bands.

6 F. Together with the full L3-App sequence, the primer sequence accounts for 52 nt

of the cDNA. The upper (lighter blue) dye runs at ±110-150 nt and the first rim of the plastic gel cassette is at 75 nt - these marks can be used to guide excision together with the size marker. Cut three bands at 70-85 nt, 85-120 nt and 120-200 nt. Use Use Fig. 3 to guide the cutting of the bands. Place each gel piece into a 1.5 ml microtube.

6 G. Add 400 µl TE and crush the gel piece into small pieces with a 1 ml syringe plunger. Incubate shaking at 1100 rpm for 1 h at 37°C, then place on dry ice for 2 min, and place back at 1100 rpm for 1 h at 37°C.

6 H. Transfer the liquid portion of the supernatant into a Costar SpinX column

(Corning Incorporated, 8161) into which you have placed two 1 cm glass pre-filters (Whatman 1823010).

6 I. Spin at 13000 rpm for 1 min into a 1.5 ml tube. Add 0.5 µl glycoblue and 40 µl

sodium acetate, pH 5.5. Mix, then add 1 ml 100% ethanol. Mix again and precipitate over night at -20°C.

7. Ligation of the primer to the 5ʹ′ end of the cDNA 7 A. Spin down and wash as described above, resuspend it in 8 µl ligation mix and

incubate for 1 h at 60°C: 6.5 µl water 0.8 µl 10x CircLigase Buffer II (Epicentre) 0.4 µl 50 mM MnCl2 0.3 µl CircLigase II (Epicentre) 7 B. Add 30 µl oligo annealing mix: 26 µl water 3 µl FastDigest Buffer (Fermentas) 1 µl 10 µM Cut_oligo 7 C. Anneal the oligos with following programme: 95°C 2 min successive cycles of 20 s, starting from 95°C and decreasing the temperature by

1°C each cycle down to 25°C 25°C hold 7 D. Add 2 µl BamHI (Fast Fermentas) and incubate for 30 min at 37°C. 7 D. Add 50 µl TE, 0.5 µl glycoblue and mix. Add 10 µl sodium acetate, pH 5.5, and

mix. Then add 250 µl 100% ethanol. Mix again and precipitate over night at -20°C.

8. PCR amplification 8 A. Spin down and wash the cDNA as described above, then resuspend it in 11 µl

water. 8.1 Optimise PCR amplification

Note 26 – Step 8.1 is optional. If you previously prepared libraries with the same protein and you had good radioactive RNA signal, you can estimate the number of required cycles and move directly to step 8.2.

8.1 A. Prepare the following PCR mix: 0.5 µl cDNA (from step 8 A) 0.25 µl primer mix P5Solexa/P3Solexa, 10 µM each 5.0 µl Accuprime Supermix 1 enzyme (Invitrogen) 4.25 µl water 8.1 B. Run the following PCR:

94°C 2 min 25-35 cycles of 94°C 15 s 65°C 30 s 68°C 30 s 68°C 3min 25°C hold

Note 27 – All work done post PCR must be carried out on a specially designated

bench. This cDNA must never be taken to an area where work with iCLIP RNA is done.

8.1 C. Mix 8 µl PCR product with 2 µl of 5x TBE loading buffer, load on a 6% TBE

gel and stain with SYBR green I. 8.2 Preparative PCR 8.2 A. From your results in section 8.1, estimate the minimum number of PCR cycles

to use to amplify the whole library, such that it will give a band on a gel. Consider that you will now be amplifying 10 times more concentrated cDNA, therefore 3 cycles less are needed than in the preliminary PCR.

8.2 B. Prepare the following PCR mix: 10 µl cDNA (from step 8 A) 9 µl water 1 µl primer mix P5Solexa/P3Solexa, 10 µM each 20 µl Accuprime Supermix 1 enzyme (Invitrogen) 8.2 C. Run the same PCR programme as in step 8.1 B. 8.2 D. Mix 8 µl PCR product with 2 µl 5x TBE loading buffer, load on a 6% TBE gel

and stain with SYBR green I. The size of the cDNA insert to be mapped to the genome will be the size of product minus the combined length of the P3/P5Solexa primers and the barcode (128 nt). Ideally, the PCR products should

be larger than 145 nt. If sharp DNA bands are visible with a size <145 nt (most often the primer dimer at 128 nt), it is necessary to gel-purify the PCR products of >145 nt.

8.2 E. Submit 10 µl of the PCR library for sequencing and store the rest. 9 Linker and primer sequences Pre-adenylated 3’ linker DNA:

[We order the DNA adapter from IDT and then make aliquots of 20 µM.] L3-App: rAppAGATCGGAAGAGCGGTTCAG/ddC/ DNA primers:

[We order desalted oligonucleotides from Sigma and don’t gel purify them.]

Rt1clip X33NNAACCNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rt2clip X33NNACAANNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rt3clip X33NNATTGNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rt4clip X33NNAGGTNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rt5clip X33NNCGCCNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rt6clip X33NNCCGGNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rt7clip X33NNCTAANNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rt8clip X33NNCATTNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rt9clip X33NNGCCANNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rt10clip X33NNGACCNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rt11clip X33NNGGTTNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rt12clip X33NNGTGGNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rt13clip X33NNTCCGNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rt14clip X33NNTGCCNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rt15clip X33NNTATTNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC Rt16clip X33NNTTAANNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC X33 = 5’ phosphate Cut_oligo: GTTCAGGATCCACGACGCTCTTCaaaa P5Solexa: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT P3Solexa: CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC

T Acknowledgements: The authors thank all members of the Ule laboratory, Dr. Kathi Zarnack and Dr. Ignacio Schor for advice and discussion as well as experimental support. This work was supported by the European Research Council grant 206726-CLIP to J.U. and a Long-term Human Frontiers Science Program fellowship to J.K. References: [1] Moore, M. J., Science 2005, 309, 1514-1518. [2] Keene, J. D., Nat Rev Genet 2007, 8, 533-543.

[3] Wang, Z., Burge, C. B., RNA 2008, 14, 802-813. [4] Denman, R. B., Bioessays 2006, 28, 1132-1143. [5] Tuerk, C., Gold, L., Science 1990, 249, 505-510. [6] SenGupta, D. J., Zhang, B., Kraemer, B., Pochart, P., Fields, S., Wickens, M.,

Proc Natl Acad Sci U S A 1996, 93, 8496-8501. [7] Trifillis, P., Day, N., Kiledjian, M., Rna 1999, 5, 1071-1082. [8] Brooks, S. A., Rigby, W. F., Nucleic Acids Res 2000, 28, E49. [9] Tenenbaum, S. A., Carson, C. C., Lager, P. J., Keene, J. D., Proc Natl Acad Sci

2000, 97, 14085-14090. [10] Mili, S., Steitz, J. A., RNA 2004, 10, 1692-1694. [11] Ule, J., Jensen, K. B., Ruggiu, M., Mele, A., Ule, A., Darnell, R. B., Science

2003, 302, 1212-1215. [12] Ule, J., Jensen, K., Mele, A., Darnell, R. B., Methods 2005, 37, 376-386. [13] Licatalosi, D. D., Mele, A., Fak, J. J., Ule, J., Kayikci, M., Chi, S. W., Clark, T.

A., Schweitzer, A. C., Blume, J. E., Wang, X., Darnell, J. C., Darnell, R. B., Nature 2008, 456, 464-469.

[14] Yeo, G. W., Coufal, N. G., Liang, T. Y., Peng, G. E., Fu, X. D., Gage, F. H., Nat Struct Mol Biol 2009, 16, 130-137.

[15] Ule, J., Darnell, R. B., Curr Opin Neurobiol 2006, 16, 102-110. [16] Xue, Y., Zhou, Y., Wu, T., Zhu, T., Ji, X., Kwon, Y. S., Zhang, C., Yeo, G.,

Black, D. L., Sun, H., Fu, X. D., Zhang, Y., Mol Cell 2009, 36, 996-1006. [17] Chi, S. W., Zang, J. B., Mele, A., Darnell, R. B., Nature 2009, 460, 479-486. [18] Zisoulis, D. G., Lovci, M. T., Wilbert, M. L., Hutt, K. R., Liang, T. Y.,

Pasquinelli, A. E., Yeo, G. W., Nat Struct Mol Biol 17, 173-179. [19] König, J., Baumann, S., Koepke, J., Pohlmann, T., Zarnack, K., Feldbrügge, M.,

EMBO J 2009. [20] Hafner, M., Landthaler, M., Burger, L., Khorshid, M., Hausser, J., Berninger, P.,

Rothballer, A., Ascano, M., Jr., Jungkamp, A. C., Munschauer, M., Ulrich, A., Wardle, G. S., Dewell, S., Zavolan, M., Tuschl, T., Cell 141, 129-141.

[21] Hafner, M., Landthaler, M., Burger, L., Khorshid, M., Hausser, J., Berninger, P., Rothballer, A., Ascano, M., Jungkamp, A. C., Munschauer, M., Ulrich, A., Wardle, G. S., Dewell, S., Zavolan, M., Tuschl, T., J Vis Exp.

[22] Granneman, S., Kudla, G., Petfalski, E., Tollervey, D., Proc Natl Acad Sci U S A 2009, 106, 9613-9618.

[23] Urlaub, H., Hartmuth, K., Lührmann, R., Methods 2002, 26, 170-181. [24] König, J., Zarnack, K., Rot, G., Curk, T., Kayikci, M., Zupan, B., Turner, D. J.,

Luscombe, N. M., Ule, J., Nat Struct Mol Biol 2010, 17, 909-915. [25] Wang, Z., Kayikci, M., Briese, M., Zarnack, K., Luscombe, N. M., Rot, G.,

Zupan, B., Curk, T., Ule, J., PLoS Biol 2010, 8, e1000530. [26] Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P., Science 2001, 294, 858-

862. [27] Vigneault, F., Sismour, A. M., Church, G. M., Nat Methods 2008, 5, 777-779.

Figure Legends: Figure 1 Schematic representation of the iCLIP protocol. Protein-RNA complexes are covalently cross-linked in vivo using UV irradiation (step 1). The protein of interest is purified together with the bound RNA (steps 2-5). To allow for sequence-specific priming of reverse transcription, an RNA adapter is ligated to the 3’ end of the RNA, whereas the 5’ end is radioactively labelled (steps 6 and 7). Cross-linked protein-RNA complexes are purified from free RNA using SDS-PAGE and membrane transfer (step 8). The RNA is recovered from the membrane by digesting the protein with proteinase K leaving a polypeptide remaining at the cross-link nucleotide (step 9). Reverse transcription (RT) truncates at the remaining polypeptide and introduces two cleavable adapter regions and barcode sequences (step 10). Size selection removes free RT primer before circularization. The following re-linearization generates suitable templates for PCR amplification (steps 11-15). Finally, high-throughput sequencing generates reads in which the barcode sequences are immediately followed by the last nucleotide of the cDNA (step 16). Since this nucleotide locates one position upstream of the cross-linked nucleotide, the binding site can be deduced with high resolution. Figure 2 Autoradiograph of cross-linked hnRNP C-RNA complexes using denaturing gel electrophoresis and membrane transfer. hnRNP C-RNA complexes were immunopurified from cell extracts using an antibody against hnRNP C (α hnRNP C, samples 3 and 4). RNA was partially digested using low (+) or high (++) concentration of RNase. Complexes shifting upwards from the size of the protein (40 kDa) can be observed (sample 4). The shift is less pronounced when high concentrations of RNase were used (sample 3). The radioactive signal disappears when no antibody was used in the immunoprecipitation (samples 1 and 2). Figure 3 Schematic 6% TBE-urea gel (Invitrogen) to guide the excision of iCLIP cDNA products. The gel is run for 40 min at 180 V leading to a reproducible migration pattern of cDNAs and dyes (light and dark blue) in the gel. Use a razor blade to cut (red line) the high (H), medium (M), and low (L) cDNA fractions. Start by cutting in the middle of the light blue dye and immediately above the mark on the plastic gel cassette. Divide the medium and low fractions and trim the high fraction about 1 cm above the light blue dye. Use vertical cuts guided by the pockets and the dye to separate the different lanes (in this example 1-4). The marker lane (m) can be stained and imaged to control sizes after the cutting. Fragment sizes are indicated on the right. Figure 4 Analysis of PCR-amplified iCLIP cDNA libraries using gel electrophoresis. RNA recovered from the membrane (Fig. 2) was reverse transcribed and size-purified using denaturing gel electrophoresis (Fig. 3). Three size fractions of cDNA (high [H]: 120-200 nt, medium [M]: 85-120 nt and low [L]: 70-85 nt) were recovered, circularized, re-linearized and PCR-amplified. PCR products of different size distribution can be observed as a result of the different sizes of the input fractions. Since the PCR primer introduces 76 nt to the cDNA, sizes should range between 196-276 nt for high, 161-196 nt for medium and 146-161 nt for low size fractions. PCR products are absent when no antibody was used for the immunoprecipitation (lanes 1-3).

Figure 5 RNA and DNA oligonucleotide design. The DNA adapter (L3-App) is pre-adenylated at the 5’ end (5’App) to allow ligation to the cross-linked RNA. The 3’ end is protected with dideoxycytidine to prevent concatenation. The reverse transcription primer (RT#Clip) is complementary to the 3’ half of L3-App to allow sequence-specific priming. The 5’ end is phosphorylated to enable circularization and contains the barcode sequences. NNN....NN indicates the split 5-nt random barcode, while XXXX is the experiment-specific 4-nt barcode which is unique for each RT#Clip oligonucleotide. Cut-oligo is complementary to the BamHI cleavage site in RT#Clip and contains four adenosines at its 3’ end (aaaa) to prevent the oligonucleotide from acting as primer during the subsequent PCR amplification. The oligonucleotides P3Solexa and P5Solexa are used for PCR amplification. Complementary sections are delimited by grey arrows. It is important to note that RT#Clip can only serve as a template for PCR amplification when acquiring sequence from L3-App during reverse transcription. This minimizes primer-dimer formation during PCR.

High-throughputsequencing

AAA

UV

UV

UV crosslinking in vivo

Cell lysis

Partial RNAdigestion

RBP

Immunoprecipitation

5’ 3’

Protein/RNAcomplex

SDS-PAGE and membranetransfer to remove free RNA

Crosslinkedprotein/RNA

complex

Protein

Com

plex

siz

e

Membrane

Extraction of RNA from the membrane. Proteinaise K leaves polypeptide ( ) at the crosslinknucleotide

Reverse transcription (RT)

cDNA RT primer:two cleavable adapterregions and barcode

CircularizationSize selection usinggel electrophoresis

BamHI

Linearization

1

2

3

4

8

Dephosphorylation5RNA adapter ligationRadioactive labelingof RNA

67

910

11 12

13 Annealing of oligo-nucleotide to thecleavage site

14

15

16

PCR amplification

RBP5’ 3’

RNAadapter

RTproducts

RT primer

cDN

A si

ze

Urea-PAGE

kDa

27

35

55

70100

130

250

RNase ++ + ++ +α hnRNP C - - + +

sample 1 2 3 4

area cut from the membrane

hnRNP Cprotein

protein-RNA complex

50

the light blue die

mark on the plastic gel cassette75

100

150200250

766

nt

RT primer (41nt)

H

M

L

the dark blue die

1234 m

bp

No antibody

50

75

100

150

200

300

766

cDNA gel

α hnRNP C

Primers

Primerdimer

AmplifiedcDNA

H M L H M L

1 2 3 4 5 6

5’P-NNXXXXNNNAGATCGGAAGAGCGTCGTGGATCCTGAACCGC UGAGAUCGGAAGAGCGGTTCAG-ddC

L3-AppRT#Clip

5’-GTTCAGGATCCACGACGCTCTTC Cut-oligo

-5’App split 5-nt random

barcode

4-nt experiment-speci�c barcode

BamHI cleavage site

Only RT products can serve as PCR templates after circularization, since this sequence is missing in the RT primer.aa

aa

CTGAACCGCTCTTCCGATCT

5’-CAA...CTG

P3Solexa

CACGACGCTCTTCCGATCT

5’-AAT...CTAP5Solexa

3’- RNA