Number 104 January 2016 ERCIM NEWS - Credential · ERCIM NEWS 104 Janaury 2016 21 Computational...

ERCIM NEWSwww.ercim.eu

Number 104 January 2016

Special theme

Tackling Big Data

in the

Life Sciences

Also in this issue:

Research and Society:

Women in ICT Research and Education

ERCIM News is the magazine of ERCIM. Published quarterly,

it reports on joint actions of the ERCIM partners, and aims to

reflect the contribution made by ERCIM to the European

Community in Information Technology and Applied

Mathematics. Through short articles and news items, it pro-

vides a forum for the exchange of information between the insti-

tutes and also with the wider scientific community. This issue

has a circulation of about 6,000 printed copies and is also

available online.

ERCIM News is published by ERCIMEEIG

BP 93, F-06902 Sophia Antipolis Cedex, France

Tel: +33 4 9238 5010, E-mail: [email protected]

Director: Jrme Chailloux

ISSN 0926-4981

Editorial Board:

Central editor:

Peter Kunz, ERCIMoffice ([email protected])

Local Editors:

Austria: Erwin Schoitsch ([email protected])

Belgium:Benot Michel ([email protected])

Cyprus: Ioannis Krikidis ([email protected])

Czech Republic:Michal Haindl ([email protected])

France: Steve Kremer ([email protected])

Germany: Michael Krapp ([email protected])

Greece: Eleni Orphanoudakis ([email protected]),

Artemios Voyiatzis ([email protected])

Hungary: Erzsbet Csuhaj-Varj ([email protected])

Italy: Carol Peters ([email protected])

Luxembourg: Thomas Tamisier ([email protected])

Norway:Poul Heegaard ([email protected])

Poland: Hung Son Nguyen ([email protected])

Portugal: Joaquim Jorge ([email protected])

Spain: Silvia Abraho ([email protected])

Sweden: Kersti Hedman ([email protected])

Switzerland: Harry Rudin ([email protected])

The Netherlands: Annette Kik ([email protected])

W3C: Marie-Claire Forgue ([email protected])

Contributions

Contributions should be submitted to the local editor of your

country

Copyright notice

All authors, as identified in each article, retain copyright of their

work

Advertising

For current advertising rates and conditions, see

http://ercim-news.ercim.eu/ or contact [email protected]

ERCIM News online edition

The online edition is published at

http://ercim-news.ercim.eu/

Subscription

Subscribe to ERCIM News by sending an email to

[email protected] or by filling out the form at the

ERCIM News website: http://ercim-news.ercim.eu/

Next issue

April 2016, Special theme: Planning and Logistics

Editorial Information Contents

ERCIM NEWS 104 Janaury 2016

JoINT ERCIM ACTIoNS

4 International Workshop on Computational Intelligence

for Multimedia Understanding

by Davide Moroni, Maria Trocan and Ales Prochazka

5 Activities of the ERCIM Working Group Dependable

Embedded Software-Intensive Systems

by Erwin Schoitsch

SPECIAL ThEME

The special theme section Tackling Big Data in the Life

Sciences has been coordinated by Roeland Merks, CWI

and Marie-France Sagot, Inria.

Introduction to the Special Theme

16 Tackling Big Data in the Life Sciences

by Roeland Merks and Marie-France Sagot

17 Networks to the Rescue From Big Omics Data to

Targeted Hypotheses

by Gunnar Klau

18 Interactive Pay-As-You-Go-Integration of Life Science

Data: The HUMIT Approach

by Christoph Quix, Thomas Berlage and Matthias Jarke

20 Eliminating Blind Spots in Genetic Variant Discovery

by Alexander Schnhuth and Tobias Marschall

RESEARCh AND SoCIETy

This section Women in ICT Research and Education has

been coordinated by Lynda Hardman, CWI

6 Because its 2016 Introduction

by Lynda Hardman

7 Women in Informatics Research and Education

by Jane Hillston

8 Reflections from a Leadership Program for Women

in Scientific Positions

by Katja Abrahamsson, Letizia Jaccheri and Harald verby

10 The Girl Project Ada: A Successful Project for

Recruiting Female Students to the ICT-Studies at NTNU

by Line Berg

12 Inspire, Network, Encourage womENcourage 2015

by Reyyan Ayfer and Bev Bachmayer

13 Integrating Gender in Research Institutions in Greece

by Pavlos Hatzopoulos, Nelli Kambouri and Kathy Kikis-Papadakis

14 Women in IT Security Research: The Case of SBA

Research

by Veronika Nowak

ERCIM NEWS 104 Janaury 2016

21 Computational Estimation of Chromosome Structure

by Claudia Caudai and Emanuele Salerno

22 Modelling Approaches to Inform the Control and

Management of Invasive Seaweeds

by James T. Murphy, Mark Johnson and Frdrique Viard

24 Kbdock Searching and Organising the Structural

Space of Protein-Protein Interactions

by Marie-Dominique Devignes, Malika Smal-Tabbone andDavid Ritchie

25 The Source of the Data Flood: Sequencing Technologies

by Alberto Magi, Nadia Pisanti and Lorenzo Tattini

27 Big Data in Support of the Digital Cancer Patient

by Haridimos Kondylakis, Lefteris Koumakis, ManolisTsiknakis, Kostas Marias and Stephan Kiefer

28 Towards an On-board Personal Data Mining

Framework For P4 Medicine

by Mohamed Boukhebouze, Stphane Mouton and JimmyNsenga

30 Can Data-driven Self-Management Reduce Low Back

Pain?

by Kerstin Bach, Paul Jarle Mork and Agnar Aamodt

31 Twitter can Help to Find Adverse Drug Reactions

by Mark Cieliebak, Dominic Egger and Fatih Uzdilli

32 Trust for the Doctor in the Loop

by Peter Kieseberg, Edgar Weippl and Andreas Holzinger

34 Big Data Takes on Prostate Cancer

by Erwan Zerhouni, Bogdan Prisacari, Qing Zhong, PeterWild and Maria Gabrani

35 Mining Electronic Health Records to Validate

Knowledge in Pharmacogenomics

by Adrien Coulet and Malika Smal-Tabbone

36 Modelling the Growth of Blood Vessels in Health and

Disease

by Elisabeth G. Rens, Sonja E. M. Boas and Roeland M.H.Merks

38 Modelling? Using Standards Can Help You

by Brett G. Olivier and Bas Teusink

39 Understanding Metadata to Exploit Life Sciences Open

Data Datasets

by Paulo Carvalho, Patrik Hitzelberger and Gilles Venturini

40 Management of Big and Open Data in the Life Cycle

Assessment of Ecosystem Services

by Benedetto Rugani, Paulo Carvalho and Benoit Othoniel

42 WITDOM: Empowering Privacy and Security in Non-

trusted Environments

by Juan Ramn Troncoso-Pastoriza and Elsa Prieto Prez

3

RESEARCh AND INNoVATIoN

This section features news about research activitiesand innovative developments from Europeanresearch institutes

44 Secure and Privacy-Preserving Identity

Management in the Cloud

by Bernd Zwattendorfer, Stephan Krenn andThomas Lornser

46 PRISMACLOUD Privacy and Security

Maintaining Services in the Cloud

by Daniel Slamanig, Agi Karyda and ThomasLornser

47 TREDISEC: Towards Realizing a Truly Secure

and Trustworthy Cloud

by Beatriz Gallego-Nicasio Crespo, Melek nenand Ghassan Karame

48 Smart Devices for the Home of the Future: A

New Model for Collaboration

by Daniele Spoladore, Gianfranco Modoni andMarco Sacco

50 FOODWEB Studying Food Consumption and

Production Patterns on the Web

by Christoph Trattner, Tomasz Kumierczyk andKjetil Nrvg

51 Robots Learn Actions and Cooperative Tasks by

Imitation

by Maria Koskinopoulou and Panos Trahanias

52 Unlocking the Secrets of the Dynamics of

Earths Interior

by Costas Bekas

EVENTS, IN BRIEf

Announcement

54 EMC Summit in conjunction with the CPS

Week 2016

54 More on IFIP TC6s Open Digital Library

Book

54 Online Social Networks: Human Cognitive

Constraints in Facebook and Twitter Personal

Graphs

In Brief

55 Lynda Hardman President Informatics Europe

55 QuSoft Research Center for Quantum Software

Launched

55 ERCIMAlain Bensoussan Fellowship

Programme

Joint ERCIM Actions

International Workshop

on Computational

Intelligence for

Multimedia Understanding

by Davide Moroni, Maria Trocan and Ales Prochazka

Over 80 researchers from academia and industry

attended a workshop on Computational Intelligence for

Multimedia Understanding organized by the ERCIM

MUSCLE Working Group in Prague, 29-30 October 2015.

The workshop was held in close collaboration with theUniversity of Chemistry and Technology and the CzechTechnical University in Prague. Prof. Vladimir Marik andDr. Davide Moroni were honorary chairs.

Among the topics addressed by the MUSCLE workinggroup, this year it was decided to give special emphasis tobiomedical applications. Biological signals and images posesignificant challenges to multimedia understanding, which,if addressed with success, would result in advances in bothbiomedical science and in signal and image processing andrecognition. A detailed analysis of raw biomedical data isessential if their full potential is to be exploited in bioengi-neering, control and robotic systems. Thanks to contributionsfrom several related research communities, the workshopwas able to cover and discuss many interesting aspects of thisdomain, ranging from human motion and rehabilitation tospeech recognition, from polysomnography to cell imageanalysis. The relevance of techniques able to extract the mostsalient features affecting the biomedical domain from theever increasing data deluge, blend them successfully,emerged clearly, and was discussed in the lectures deliveredby the distinguished invited speakers of this edition:

Dr. Saeid Sanei, Surrey University, UK: Man-MachineInteraction and Motion Modelling

Dr. Joan Lasenby, University of Cambridge, UK: Appli-cations of Dimensionality Reduction Techniques in Med-ical Data Analysis

Prof. Danilo Mandic, Imperial College, UK: Computa-tional Intelligence and Wearable Body-Sensor Networks

Prof. Jonathan Chambers, Newcastle University, UK: Dig-ital Signal Processing and Assistive Technologies.

41 papers were accepted for oral presentation by the pro-gramme chairs, Prof. Jonathan Chambers, Prof. Enis Cetinand Dr. Oldrich Vysata and the workshop featured a set ofsessions focussing on current hot topics. A Data Fusion inBiomedicine session stressed the role of computational intel-ligence in putting together data from different biosensors inthe diagnosis of disorders, treatment monitoring, rehabilita-tion and analysis of sport activities. A session was dedicatedto Ambient Assisted Living (AAL) and Intelligent Tools forDisabled and Elderly People, where the focus was on howcomputational intelligence can be used to provide personal-ized guidance that can empower people and foster a healthierlifestyle. Classical biological data and signal processing wasthe main theme of the BIODAT session, which featured sev-eral talks on EEG processing, including microsleep and spin-dles analysis. Finally, a session on Big and Linked Data wasincluded in which aspects related to smart cities, socialmedia analytics and semantic data stream processing wereaddressed.

The workshop was held in the historical halls of the StrahovMonastery and the social programme included a visit to thefamous library of the monastery.

The complete conference programme and videorecords ofinvited talks can be found at (http://iwcim.isep.fr/). All theaccepted papers are available through IEEE Xplore.

Links:

http://wiki.ercim.eu/wg/MUSCLE/http://iwcim.isep.fr/

Please contact:

Davide Moroni, ISTI-CNR, ItalyE-mail: [email protected]

Maria Trocan, ISEP, FranceE-mail: [email protected]

Ales Prochazka, UCT & CTU, Czech RepublicE-mail: [email protected]

ERCIM NEWS 104 January 20164

Workshop lecture hall inside the Strahov

Monastery in Prague and Dr. Joan Lasenby,

invited speaker from the Engineering

Department of the University of Cambridge,

UK (photos taken by VIC CVUT).


Activities of the ERCIM

Working Group Dependable

Embedded Software-

Intensive Systems

by Erwin Schoitsch

The ERCIM Working Group "Dependable Embedded

Software-Intensive Systems" (DES WG) co-organized two

events in 2016: a workshop at the 2015 SAFECOMP

conference in Delft on 22 September and a special

session on "Teaching, Education and Training for

Dependable Embedded Cyber-Physical Systems" at the

Euromicro SEAA/DSD Conference on 26-28 August 2015

in Funchal, Madeira, Portugal.

ERCIM/EWICS/ARTEMIS WorkshopThe already well established ERCIM/EWICS/ARTEMISWorkshop on Dependable Embedded Cyber-physicalSystems and Systems-of-Systems (DECSoS) was held as afull-day workshop on 22 September in conjunction with theSAFECOMP 2015 conference in Delft, The Netherlands.

Since it was established in 1979 by the European Workshopon Industrial Computer Systems, Technical Committee 7 onReliability, Safety and Security (EWICS TC7), SAFECOMPhas contributed to the progress of the state of the art independable application of computers in safety-related andsafety-critical systems. SAFECOMP (www.safecomp.org) isan annual event covering the experience and new trends in theareas of safety, security and reliability of critical computerapplications. It provides ample opportunity to exchangeinsights and experience on emerging methods, approachesand practical solutions. The next SAFECOMP 2016 will takeplace in Trondheim, Norway, 20-23 September 2016. It isbeing organized by Amund Skavhaug, NTNU, supported byErwin Schoitsch, AIT, both co-chairs of the ERCIM DES WG

The DECSoS Workshop included: an overview and introduc-tion to the Cyber-physical Systems (CPS) initiatives of theEuropean Union; a presentation of the ARTEMIS projects;and discussions by ERCIM and EWICS. Erwin Schoitschalso presented the following four sessions: Introduction, and Safety & Cyber-Security Co-assessment

(3 papers) Robotics and Motion Control (3 papers) Modelling, Testing and Verification (3 papers) Dependability and Scalability (2 papers).

The workshop was co-hosted by the following EmbeddedSystems/CPS projects, which were represented by papersand several other presentations: CRYSTAL Critical Systems Engineering Factories

(http://www.crystal-artemis.eu) ARROWHEAD1 Ahead of the Future

(http://www.arrowhead.eu/), EMC2 Embedded Multi-Core systems for Mixed Crit-

icality applications in dynamic and changeable real-timeenvironments (http://www.artemis-emc2.eu/ )

R5-COP Reconfigurable ROS-based Resilient Reason-ing Robotic Cooperating Systems (http://www.r5-cop.eu/ )

MBAT Combined Model-based Analysis and Testing ofEmbedded Systems (http://www.mbat-artemis.eu),

nSafeCer Safety Certification of Software-intensive Sys-tems with Reusable Components (http://www.safecer.eu).

ARTEMIS was one of the European, industry-drivenresearch initiatives and is now part of the ECSEL JointTechnology Initiative (JTI). The current ARTEMIS projectswill continue according to the ARTEMIS rules, but managedby the ECSEL JU. The workshop was very successful andled to interesting discussions, providing a good overview oncurrent work and future perspectives. Details are availableon request from Erwin Schoitsch. The proceedings have beenpublished by Springer as SAFECOMP WorkshopProceedings LNCS 9338. Abstracts and contents are avail-able at: http://www.springer.com/de/book/9783319242484.

Special Session at SEAA/DSD 2015The ERCIM/ARTEMIS/Euromicro Special Session TET-DEC (Teaching, Education and Training for DependableEmbedded Cyber-Physical Systems) was held during theSEAA/DSD 2015 conference in Funchal, Madeira, Portugalon 26-28 August. The special session covered five presenta-tions and a concluding plenary discussion. The presentationsin the first session focused partly on E&T Use Cases inARTEMIS projects and their impact on industrial and uni-versity education and training. They included: An introduction to the topic and an overview (Introduction

to TET-DEC Session An E&T Use Case in a Europeanproject) (Erwin Schoitsch),

Reuse in Safety Critical Systems: Educational Use Case FinalResults (Miren Illarramendi Rezabal, Leire Etxeberria andXabier Elkorobarrutia Letona from Mondragon University).

The second session discussed more general concepts aroundhow to teach particular topics: What Training is Needed by Practicing Engineers Who

Create Cyberphysical Systems? (Christopher Scaffidi), Teaching Software Safety to Master Students (Clara

Benac Earle, Ana Mara Fernndez-Soriano, Lars-AkeFredlund and Elena Gmez-Martnez) and

Applying property-based testing in teaching safety-criticalsystem programming (Lars-Ake Fredlund, Angel Herranzand Julio Mario).

The plenary discussion sparked some new insights and rec-ommendations about how to successfully motivate andengage in teaching and education and encourage use ofembedded CPS. Input from overseas (the US) provided dif-ferent views in this area. One recommendation made was tostimulate interest within industry by focusing on existingwork in connection with the training contents, so managerscan see direct benefits in terms of project outputs as a resultof the training. The Proceedings have been published byIEEE CPS and are available via IEEE Explore. Details areavailable on request from [email protected].

Please contact:

Erwin Schoitsch, AIT Austrian Institute of Technology,ERCIM DES WG co-chairE-mail: [email protected]

5

Because its 2016

by the guest editor Lynda Hardman

The informatics and mathematics communities suffer froman affliction common to many technical and scientific fields,that fewer than 30% of those who choose to study and con-tinue their profession in the field are women. This leads to amasculine-oriented culture that unwittingly discriminatesagainst women.

While as a discipline we cannot change the culture in whichwe live, we can at least be aware of it and take appropriatemeasures. The elephant in the room is the assumed andindisputable gender neutrality of the practice of science [1].

Awareness is key. Particularly that we all hold values that areinvisible from within the culture in which we operate. Thesecan be seemingly irrelevant attributes, such as height, where,for example, USA presidents are taller than average [2], orvoice pitch, where a lower pitch increases your perceivedquality as a leader.

While plenty of excellent women are highly active in infor-matics and mathematics research they are not always as vis-ible as they should be. This can be for various reasons, suchas the topics on which they work are not seen as core.Whatever the underlying cause, they tend not to be invited togive keynote talks, so that the notion that women are not ableto reach the top of their field is perpetuated.

It is no individual's conscious intention that women are dis-criminated against, so providing unconscious bias training is

a very good place to start. A number of large companies, suchas Google, Oracle, Bloomberg, Cisco and Facebook, areaware of the necessity to attract and keep women in the field.They spend considerable effort sponsoring events to attractyoung women and girls and Facebook have even put theirunconscious bias training online [3].

Perhaps we will learn that even when gender bias has beenremoved, we still don't have a minimum level of 30% womenin the community. We have to be very aware that this willstill tend to a masculine style environment and is likely topush the more feminine values out and will require effort tosustain good gender representation.

I am extremely grateful to our authors for this special sec-tion. They took precious time away from their research andteaching activities that contribute to building their academicCV. All too often it is the women, who are few and farbetween, who spend their time on these activities. Attractingand keeping women is the responsibility of men and womenalike. Such activities need to become mainstream in a depart-mental portfolio and assigned time in the same way as otherresponsibilities.

The contributions explain a number of different initiativesfrom different groups, including ACM-W Europe,Informatics Europe, and Athena SWAN in the UK. Some areactions that management can take, for example InformaticsEurope and Athena SWAN, whereas others are more orientedto women themselves, such as ACM-W Europe. The contri-butions give pointers to best practices that you can imple-ment in your local context. Most measures that can be takento redress the bias, such as open recruiting and promotion


Research and Society

Women in ICT

Research

and Education

ERCIM NEWS 104 January 2016 7

procedures, shared parental responsibilities, will help manymen as well. The fight your way to the top culture isstressful for both genders.

Europe, however, is a mix of many different cultures where,in some, gender equality is a way of life and, in others, theculture has yet to recognise that there even is a problem thatneeds to be addressed. Communication across Europe, par-ticularly demonstrable best practices, often from our morenorthern colleagues, can allow us to share best practicesacross the continent. If you are interested in becoming moreinvolved with initiatives then please feel free to contactmyself or one of the authors of the contributions.

The recently instated Prime Minister of Canada, JustinTrudeau, presented his gender balanced government on 4thNovember 2015 [4]. When asked why he felt gender paritywas important his reply was, Because its 2015.

Further reading:

Do it yourself how biased are you?https://implicit.harvard.edu

References:

[1] ERCIM News 104 article by Hatzopoulos et al. p.13[2] https://en.wikipedia.org/wiki/Heights_of_presidents

_and_presidential_candidates_of_the_United_States[3] https://managingbias.fb.com/[4] http://www.huffingtonpost.ca/2015/11/04/justin-trudeau-

gender-parity-because-it-s-2015_n_8474386.html

Please concact:

Lynda HardmanPresident Informatics Europe 2016-2017CWI and University Utrecht, The NetherlandsE-mail: [email protected]

Women in Informatics

Research and Education

by Jane Hillston

Informatics Europe is a membership organization for

university departments and research laboratories

aiming to create a strong common voice to safeguard,

shape and stimulate quality research and teaching in

Informatics in Europe. There are currently over 90

member institutions across 25 countries. The

organization has a number of working groups, including

WIRE, Women in ICST Research and Education, which

works to promote actions that contribute to improve

gender balance in Information and Communication

Sciences and Technologies.

In 2013 WIRE published a booklet entitled More Women inInformatics Research and Education and circulated itwidely within Europe. The booklet is a compact source ofclear and simple advice aimed at deans and heads of depart-

ment, collecting best practices already implemented at insti-tutions from across Europe. The handy guide makes sugges-tions of small changes that can have a large impact for adepartment aiming to recruit, support and encourage femalecolleagues to get the most from their careers. The booklet isendorsed by the European Commission and features a fore-word by Neelie Kroes, who was Vice-President of theEuropean Commission, responsible for the Digital Agenda atthe time. The booklet is freely available at the InformaticsEurope web site.

When possible WIRE works jointly with ACM-WE, astanding committee of ACM Europe, which has a remit tocultivate and inspire people about the opportunities in com-puter science and clear pathways throughout Europe forwomen in computing. In particular, WIRE was proud tosponsor the ACM WomENcourage event that took place inSweden in September 2015.

To further raise the profile of gender issues, in 2016 WIRE islaunching a new award in order to recognize and celebratethe achievements of departments who have taken action toattract, retain and promote women. The Informatics EuropeMinerva Informatics Equality Award will be presented forthe first time in October 2016. Nominations will be soughtin the spring and the closing date will be 1st May 2016.Judged by an international panel, the award will be given to adepartment that is able to demonstrate benefits to femalestaff or students through implemented policies and initia-tives. On a three-year cycle, the award will focus on dif-ferent stages of the career pipeline: Encouraging female students to enroll in computer sci-

ence/informatics degree programmes at undergraduate orpostgraduate levels;

Supporting the transition for PhD students or postdoctoralresearchers into faculty positions;

Developing the careers of female faculty, including reten-tion and promotion.

For the inaugural award in 2016 we will focus on initiativesto support the career development of female faculty.

WIRE has also started work on a web resource, which pro-vides links to other organizations and initiatives around theworld that can provide support and inspiration for thoseseeking to improve gender balance within an academic envi-ronment. This is an ongoing project but already the resourcehas more than 20 links to stimulating and informative pages,including national initiatives such as the Athena SWANawards in the UK.

For over a decade, the Equality Challenge Unit (ECU), hasbeen granting Athena SWAN awards to higher education andresearch institutions in the UK, and their departments, if theyare able to demonstrate commitment to advancing the careersof women in science, technology, engineering, mathematicsand medicine (STEMM).

Athena SWAN awards in the UKThe Equality Challenge Unit is a government-funded bodywhich supports universities and other research institutions tobuild an inclusive culture, promoting diversity and removingbarriers to progression and success. The Athena SWAN

https://en.wikipedia.org/wiki/Heights_of_presidents_and_presidential_candidates_of_the_United_States

charter was established in 2005 for STEMM subjects and inMay 2015 was expanded to encompass work undertaken inarts, humanities, social sciences, business and law and topromote gender equality more broadly.

Across all disciplines, the existence of the Athena SWANawards has had a profound impact on the level of awarenessof diversity and equality issues in UK universities, particu-larly when it was suggested that funding bodies would makefuture awards conditional on the host department holding anaward (this has not happened yet). Moreover, a departmentor institution that achieves an award cannot then rest on itslaurels, as awards must be renewed every three years withdemonstrable progress against a previously submitted actionplan. As a discipline computer science and informatics werea little slower than some disciplines to get involved, but therehas been growing interest in recent years and more than 25computer science/informatics departments now hold awards.The British Computer Society has sought to encourage moredepartments to increase their engagement in the AthenaSWAN process, for example by organising a successfulCignetS meeting in December 2014 to provide collabora-tive support for computing departments preparing applica-tions for the first time. Most of the awards in computer sci-ence/informatics are currently at the bronze level but thereare two silver awards and more aspired to. The model is oneof inevitable rivalry and competition between departments ofthe same discipline, and between disciplines, but academicsare naturally competitive and in this case its all in a goodcause!

Links:

http://www.informatics-europe.org

Women in ICST Research and Education working group:http://www.informatics-europe.org/services/women-in-icst-research-and-education.html

Booklet: More Women in Informatics Research andEducation:http://www.informatics-europe.org/images/documents/more-women-in-informatics-research-and-education_2013.pdf

Equality Challenge Unit: http://www.ecu.ac.uk

Athena SWAN awards: http://www.ecu.ac.uk/equality-charters/athena-swan/

Please contact:

Jane HillstonUniversity of Edinburgh, Scotland, UKE-mail: [email protected]



Reflections from

a Leadership Program

for Women in Scientific

Positions

by Katja Abrahamsson, Letizia Jaccheri and Haraldverby

This paper presents insights from a leadership

programme for women in academic positions in

Computing Sciences with the goal of helping to advance

their scientific careers. This is a joint programme

between the Department of Computer and Information

Science, and the Department of Telematics at

Norwegian University of Science and Technology (NTNU).

It has long been recognized that more women need to beattracted to Computer Science (CS) programs globally [1].However, overwhelming research evidence shows that thetrend has taken the opposite direction. In 1984, 37% ofComputer Science degrees in the U.S. were awarded towomen and in 2014 the number dropped to 14 percent [2].Currently in Norway, only 26% of professor positions areheld by women [L1]. Gender balance in academic positionsis a recognized goal in Norwegian society.

NTNU has been making systematic and successful efforts toincrease female student recruitment (see article by Line Bergin this issue). Table 1 lists the percentage of women in personyears at the Faculty of Information Technology, Mathematicsand Electrical Engineering (IME), and for the two depart-ments in this program. There is a significant gap between thenumber of women in temporary and permanent academicpositions. The leadership program will therefore focus ontemporary staff to increase their awareness of the importanceof strategic career planning and development.

The goals of our programme, which was launched in 2014,include: enhancing the leadership and strategic skills of theparticipants; encouraging women to participate more in net-working in order to take a firm stand in scientific positions;and encouraging women to take top science and technologyleadership positions and act as mentors to fellow women.Previous experience from other leadership training pro-grammes is that such programmes are effective in empow-ering women to take leadership positions, and focusing onwomen already in an academic position within the fields ofTelematics and Computer Science department represents akey opportunity (World Bank, 2012) that this program willseek to utilize.

The leadership programme involves professional training tobe able to manage the gender biases that are embedded in thecurrent system, and be more strategic in scientific careerdevelopment and advancement. As an example, a trainingsession with an organizational psychologist on "Leadership,gender, and culture was organized this year. Anotherimportant focus is to strengthen internal and external net-working. The programme therefore collaborates with other


be able to continue, and extend the program, long term stablefunding is needed. This has been a major challenge for sim-ilar projects, and there is a strong need to provide morefunding opportunities for programmes with an aim ofenhancing womens advancement in their scientific careers[3]. Therefore, in order to improve the current situation andhave a sustainable impact, further actions need to be takenand more gender balance programmes need to be adopted.

Links:

[L1] Women discriminated in the top positions in the Nor-wegian academia (In Norwegian), Dagens Perspektiv:http://www.dagensperspektiv.no/2015/kvinner-diskrim-ineres-pa-toppen-i-norsk-akademia

[L2] Gender equality and women's empowerment: A criti-cal analysis of the third millennium development goal1: http://doi.org/10.1080/13552070512331332273

References:

[1] K.A. Frenkel: Women and computing, Communica-tions of the ACM, 33, 3446. doi:10.1145/92755.92756,1990.

[2] B. S. Zweben and B. Bizot: "2012 Taulbee Survey",Computing Research News, 25(5), 1160, 2013.

[3] Waylen, G. (2013). Informal Institutions, InstitutionalChange, and Gender Equality. Political Research Quar-terly, 67(1), 212223. doi:10.1177/1065912913510360.

Please contact:

Letizia Jaccheri NTNU, NorwayE-mail: [email protected]

similar programmes locally and internationally and inviteshighly recognized international female scientists, such as Dr.Leila Alem from Australia and Prof. Gabriella Dodero fromItaly, who gave inspirational talks and acted as mentors forour programme participants.

The programme has also participated in the Grace HopperConference (GHC) together with over 12,000 other femalecolleagues. NTNUs goal was to attract prospective PhD stu-dents and Post Docs for our programs as well as to networkwith future colleagues. Attracting new female employees istough with competition from high-profile companies such asFacebook and Google who emphasise their strong interest inhiring women in computer science positions.

As our programme is still at an early stage, it will be a whileuntil the full benefit can be assessed. However, based on thefeedback from the participants and interest shown by otherCS units, the programme is on the right track. New CS unitsfrom NTNU will join the programme in 2016. The partici-pants appreciate the extra effort that is put into supportingthem in their career advancement. As an example, KerstinBach, one of the program participants, said that the pro-gramme had been an inspiration and helped her to reflect onwhere she stands in her career, and how she can support morewomen to aim at top leadership positions in the field of sci-ence.

The next step for the programme is to involve more men inorder to increase awareness of the challenges raised, increasethe attractiveness of PhD programmes in CS and Telematics,and to offer more mentoring support for women. However, to

Position category Faculty IME Department CS Department Telematics

Person

years% Women

Person

years% Women

Person

years% Women

Temporary PhD

and Post Docs244.3 19.8 41.1 21.5 17.6 38.5

Research and

Teaching Positions165.3 13.5 42.1 14 14.4 8.3

Table 1: Person years for the Faculty and

Departments: Source http://dbh.nsd.uib.no

NTNU's booth at GHC Career Fair

in Houston Texas, October 2015.


The Girl Project Ada:

A Successful Project

for Recruiting female

Students to the

ICT-Studies at NTNU

by Line Berg

Ten years ago, girls represented only 16% of the

applicants to Science and Technology studies at the

Norwegian University of Science and Technology (NTNU).

This year that percentage share exceeded 30%. In the

same period the absolute number of female applicants

more than tripled. This is a consequence of focused and

targeted work from NTNU, which has required long-term

dedication and channelling of resources both time

and money.

The main goal of the Girl Project Ada [1] is to increase thenumber of women graduating with a masters degree in ICT.To achieve this, two main approaches are taken: organisingrecruitment events to promote ICT studies to girls at highschool; and operating career networks with professional andsocial networking amongst female ICT students.

Recruitment eventsThere are two annual recruiting events targeting girls only:Girls Day and the Technology Camp.

The purpose of Girls Day, a joint venture organised by threefaculties at NTNU, is to inform attendees about science andtechnology-studies offered at the university. Girls from thefinal year of high school are invited to apply. Two hundredand fifty girls get to spend two days at NTNU; listening topresentations and meeting students who talk about their ownstudy program. Girls day has been held annually since theearly 1990s.

The Technology Camp [1] aims to promote, and recruitfemale students to, ICT studies at NTNU, including studiesin computer science, informatics, communication tech-nology, electronics systems design, mathematics, and cyber-netics and robotics. We invite every female high school student who is majoringin mathematics to apply to the Technology Camp. Through aselection process, which emphasises a students writtenmotivation, grades and national distribution, the 160 bestapplicants are invited to come to Trondheim and NTNU for athree-day visit to meet students and professors and to learnabout ICT. It is also important to give them a feel for howtheir life as a student will be, through a tour of the city andcampus, guided by current female students.They also meet ICT students and representatives from ICTcompanies. Experience has shown us that one of the mostimportant factors influencing recruitment and motivation isrole models. In order to break the stereotype that ICT is onlyfor guys, the most effective way is to make sure that highschool girls get to meet the female ICT students who are


Recruitment eventsThe Girls Day:

Recruitment to technology and natural sciences stud-ies

Technology Camp (organized by Ada):

Recruitment to ICT studies Lectures (examples from 2015): Online with hack-

ers, spies and scammers, How to win the Oscarswith a degree in mathematics, Learning fromgames (by the inventor of Kahoot Professor AlfInge Wang)

Workshops (examples from 2015); Introduction tohacking, Build your own computer, Code yourown game, Programming , Build your ownrobot, How to get an easier everyday through TheInternet Of Things , Would you like to fly a dronewith your brain? and Code a traffic light

70% of participants at the Technology Camp and theGirls Day later apply to a science and technology-study at NTNU

A subtitled film from the Technology Camp 2013:https://www.youtube.com/watch?v=VWXKCg3X-XQ

Career network for electronics systems design, cybernetics and

robotics, mathematics, communication technology,computer science and informatics students

companies: 22 ICT companies (including Facebook,ABB, Accenture, Acando, BEKK Capgemini,Telenor, EY, Cisco, Kongsberg, Silicon Labs, NordicSemiconductor, Sopra Steria, Netlight, Schlumberg-er, Norsk Elektro Optik, Skatteetaten, Visma, Mesan,Marintek.)

Annual funding 2.1 million NOK (233, 000 Euros) funded by : 40% from the university gender equality

fund, 35% from the faculty of Information Technol-ogy, Mathematics and Electrical Engineering and25% from the business sponsors.

facts

Figure 1: Number of female applicants for master of science and

technology.


already studying at NTNU, and alumni female ICT studentsfrom NTNU who now have exciting jobs in ICT. There is nobetter way than credible female role models to sell the mes-sage that ICT studies are suited for girls.

The Technology Camp participants get to listen to exciting,fun and motivating presentations and lectures, and engagingworkshops. We spend a lot of resources planning an excitingprogram for the Technology Camp. Examples of lecturesand workshop topics in 2015 are shown in the fact box.

About 70% of the participants at the Technology Camp andthe Girls Day later apply to a science and technology-studyat NTNU. Surveys among current students at NTNU whoparticipated in the Technology Camp show that this was cru-cial for their decision to study ICT; I would never havestarted communication technology studies if it had not beenfor the Technology Camp (third year CommunicationTechnology student).

Career NetworkThe career networks [3] are collaborative projects betweenthe Girl Project Ada and a number of companies in the busi-ness community. The aim of the career networks is to pro-mote networking between female students and relevant busi-ness associates in the private sector. The Girl Project Adacareer networks are for electronics, cybernetics, and ICT stu-dents. There are four annual gatherings where students andrepresentatives of the companies meet for professional andsocial networking. The majority of female ICT students atNTNU end up having their first job with one of the compa-nies in the career network (see fact box).Once a year the Girl Project Ada takes 90 female first yearstudents for a three-day trip to Oslo where we visit the com-panies in the career networks. This allows students to get a

feel for what a working day/typical employer is, andstrengthen friendships within their peer group. Surveys haveshown that this has a great impact on preventing drop-outs.Two days before enrolment to NTNU, The Girl Project Adaorganizes a welcome day [4] for new female students toassure a positive and welcoming start. We introduce them tocurrent students and student associations and give them aguided tour of campus with more information about the GirlProject Ada.

Throughout the semester, in addition to organizing career-network gatherings and the Oslo-trip for the first year stu-dents, we organize a variety of courses, including codingevenings with companies, social networking lunches andmountain hikes. The female ICT students also have theirown ICT lab Cybele girls only, no boys allowed!

Links:

[L1] http://www.ntnu.edu/girls[L2] https://www.youtube.com/watch?v=VWXKCg3X-XQ[L3] https://www.ntnu.edu/girls/career_networks[L4] Photos from the Welcome day:

https://www.flickr.com/photos/ntnuime/sets/72157645948372010/

Please contact:

Line Berg NTNU, NorwayE-mail: [email protected]

11

The 160 participants at the Technologycamp at NTNU 1-3 November 2015. Photo: Kai T Dragland.

https://www.flickr.com/photos/ntnuime/sets/72157645948372010/


Inspire, Network,

Encourage

womENcourage 2015

by Reyyan Ayfer and Bev Bachmayer

ACM President Alex Wolf welcomed the participants at

the opening of ACM-W Europe womENcourage 2015

Celebration of Women in Computing by effectually

pointing out: We would not be here at all if there was

not a problem in our community. I want to make sure

that all of us understand that this is not a womens

problem! This is a community problem! And it takes

everyone to solve this problem.

Alex stated the obvious in his opening talk. This problem hasbeen widely discussed, specifically, research shows thatComputer science as a discipline has not done well inattracting and retaining women and minority practitioners inany proportional scale to population representation: the per-centage of BS degrees conferred to women peaked in 1986and is still on a downturn. [1] Confirming the point of thecommunity problem: While the gender issue is often per-ceived as a womens issue, only when the majority of thedeans and heads of European informatics departments seethis as both a concern and an opportunity will there be anysignificant change. [2] More Women in ICT Research andEducation by IE-WIRE made recommendations that helpadministrators and deans with ideas and best practices sothey can recruit, inspire and encourage their current andfuture employees and students. ACM-WE raises awarenessamong womENcourage attendees about these recommenda-tions, which represent the minimal expectations of industryand academia.

Celebrations are effective in supporting women in techcareers, and research shows that even small regional cele-brations are effective in inspiring women and giving them asense of community [3]. ACM-WE survey results fromwomENcourage 2014 mirrored these results: 94% of respon-dents believed that their attendance at the Celebration of

Women in Computing strengthened their commitment totheir career. Additionally, an attendee at womENcourage2015 stated she learned during one of the case studies Thatno matter what issue appears during our career, there willalways be a way to solve it and people who support womenin STEM. Being part of a community and knowing thatthere will always be someone there to offer support is veryfortifying and helps individuals stay in their chosen field.ACM-WE knows that womENCourage celebrations providea unique opportunity for students, young researchers andearly practitioners to network and realise that they are notalone: there are others like them, they are part of a tech-nology community. Therefore, ACM-W Europe and theentire ACM family work to bring inspiring speakers and pan-ellists from across Europe and around the world to offerwomen both a sense of community and inspiration toincrease their commitment to their career.

The 2015 celebration included many activities: a career fair,keynote talks, panel discussions, technical paper sessions,workshops, case studies, unconference sessions, and ahackathon.

Keynotes are the most inspiring part of a celebration. Thekey learnings and exemplary presentation of accomplishedcomputer scientists positively influences young students andpractitioners [3]. WomENcourage 2015 attendees were for-tunate to hear from Vicki Hanson, Asa Cajander and Marie-Paule Cani.

Vicki Hansons keynote address focused on her research,highlighting inclusive technologies. Researchers in the fieldof accessibility seek to create devices and software toaddress the needs of people who through age or disability,face exclusion from full societal participation. In creatingaccessible technology and novel accessibility tools, researchhas not only facilitated digital interactions and quality of lifeneeds for many, but has also served to advance the field ofcomputing more generally.

sas Cajanders talk On Grit and Being the Token Figurebrought up a range of challenges that most women in theaudience have experienced. sa pointed out that many kindsof grit are needed for a woman to survive in her current envi-


ACM-W Europe womENcourage

2015 participants.


ronment, and she confirmed that women are not alone whenfaced with such circumstances. Asa said Change comesslowly, but it is changing, we all need to continue toencourage these changes.

Through examples and videos Marie-Paule explained whygraphical design is essential for human creativity, includingthe fact that graphical simulation is difficult to control, andshe described the new methodology which is emerging toease the interactive design of complex shapes, objects andcharacters, possibly in motion.

WomENcourage 2015 hosted three panel discussions onOpen Source as a Career Path, Teaching and Learning, Outof the Ordinary Jobs. Through the paper sessions studentswere given the opportunity to present and share their currentresearch work and receive valuable feedback. The unconfer-ence sessions effectuated interesting discussions on subjectssuggested by their participants who were also activelyinvolved in the discussions: feminism in computing, womenin computing: work-life balance, imposter syndrome, datamining, and learning analytics. The workshops were bril-liant, I really enjoyed the hands-on experience were thewords of one participant, echoing the sentiments of many.All workshops taught participants something new from basicelectronics to creating wearables, to understanding opensource code. The Hackathon had participants from 17 dif-ferent countries. The winning teams projects were FreeFall (a device to attach to wrist or belt which alerts assis-tance if the person suddenly falls), SafeHome (a portableCO2 and gas alarm system), and Be My Eyes (a device thathelps visually impaired people.)

ACM-WE is inviting everyone to attend the futurewomENcourage events in September, 2016 in Linz, Austria,and in September, 2017 in Barcelona, Spain.

Links:

ACM: http://www.acm.org/ACM-W: http://women.acm.org/ACM-Europe: http://europe.acm.org/ACM-WE: http://europe.acm.org/acm-w-europe.htmlwomENcourage2014:http://womencourage.acm.org/archive/2014/index.htmlwomENcourage2015: http://womencourage.acm.org/

References:

[1] B.Nelson: The Data On Diversity, Communicationsof the ACM, Vol. 57, No. 11, Pages 86-95, 2014,http://dx.doi.org/10.1145/2597886

[2] L. Hardman: More Women in Informatics Researchand Education, 2013, http://kwz.me/RT

[3] G. Townsend, K. Sloan: An Effective Alternative to theGrace Hopper Celebration in Proc. of the 46th ACMTechnical Symposium on Computer Science Education SIGCSE 15, 2015,http://dx.doi.org/10.1145/2676723.26772332015

Please contact:

Reyyan Ayfer, Bev Bachmayer ACM EuropeE-mail: [email protected]

13

Integrating Gender

in Research Institutions

in Greece

by Pavlos Hatzopoulos, Nelli Kambouri and Kathy Kikis-Papadakis

A research project on "Gender, Science and Innovation

in Greece" is focusing on gender issues in research

institutions. Its recommendations were recently

publicised by the Educational Research and Evaluation

(ERE) Group of the Foundation for Research and

Technology FORTH.

The progress of Greece in integrating gender in researchinstitutions is slow. Without being able to enjoy the benefitsof labor rights and without having any privileges as a worker,you are still expected to perform all your obligations as aresearcher. This quote from an interview with a youngfemale biologist could well be one of the principal conclu-sions of the research project. The research addressed the gen-dering processes that shape the research sector in Greece,focusing on gendered institutional structures and practicesalong with the analysis of gender hierarchies and gender dis-crimination in research institutions as these are articulated inthe contemporary context of the Greek economic crisis.

The absence of an institutional framework for genderPublic research institutes in Greece have not adopted policiesor strategies for integrating gender in their work, precluding,in effect, complaints about gender discrimination and barringthe empowerment of women working in this sector. The find-ings of the research show that, overall, there is quite a limitedawareness of gender equality in the research sector inGreece. In many cases, the assumed and indisputable genderneutrality of the practice of science is believed to act as theultimate safeguard against the imposition and reproductionof gender hierarchies in the research sector.

In reality, however, women researchers in Greece face signif-icant obstacles to career advancement in public researchinstitutions, particularly women with extended caringresponsibilities. These emanate, on the one hand, from thedual workload faced by these women researchers, and on theother, from the dominance of networks of male scientists,especially in the areas of decision-making and institutionalstrategy development (Katsiaboura and Vogt, 2012). As aresult, few women tend to reach high-rank positions and highcareer grades, while most women tend to avoid standing ascandidates for these positions in order to avoid the workoverload. Indeed, the extensive interviews conducted duringthe project showed that women researchers in Greece pre-dominantly believe that their gender is a barrier to theirrecruitment, to their selection as leaders of research teams,and to their career advancement.

The management of research teams is another major issue,which is not regulated or monitored by the Greek researchsystem. We can distinguish three approaches (Schiebinger,2008): (a) the masculinist approach, where private and

Link:

http://www.genderinscience.gr

References:

[1] Gianna Katsiaboura and Annete Vogt, eds: Gender studiesand science: problems, tasks, perspectives, Nissos 2012.

[2] Londa Schiebinger: Gendered Innovations in Scienceand Engineering, Stanford University Press, 2008

Please contact:

Pavlos Hatzopoulos, Nelli Kambouri, Kathy Kikis-Papadakis, IACM-FORTH, E-mail: [email protected],[email protected], [email protected]


family issues are silenced altogether and science is definedas a process of knowledge production without gender (b)the feminist approach, where the private sphere is inte-grated in the life of research teams and acts as a factor fordeveloping a climate of cooperation amongst research teammembers and for producing scientific results and (c) theintersectional approach, where the categories of gender,social class, nation and race are taken into account inrecruiting members of research teams and in establishingrelations of good cooperation amongst them. In Greece, thefirst, masculinist approach is overwhelmingly dominant,and this often leads to gross violations of labour rights ofprecarious female researchers.

In research centres of the Greek private sector the systems ofcareer advancement and payroll grades are linked to criteriaof productivity rather than scientific excellence. In privateresearch institutions gender inequalities are thus primarilyenacted through the division of scientific work into "female"and "male" areas, which correspond to differentiated workschedules, job responsibilities and salaries. In this system,conducting research is constructed as a "female" occupationthat remains very poorly paid in comparison to male mana-gerial roles. Job promotion and wage increases are thusdirectly associated with internal mobility schemes fromresearch to management areas, which are predominantly notaccessible to women researchers.

Promoting gender equality in research: policy challengesWomen researchers cannot easily challenge gender discrimi-nation in their workplace, since Greece lacks a comprehen-sive legal framework in respect to gender equality inresearch organizations. Even where legal stipulations are inplace for example, legislation regarding equal representa-tion of women on scientific management committees theseare only observed on an ad hoc basis without any actiontaken against noncompliant institutions. The lack of a com-prehensive legal framework leads to the multiplication ofgender inequalities, the intensification of direct and indirectdiscrimination, and the prolongation of offensive behaviourtowards women scientists stemming from dominant mas-culinist cultures.

In this context, the integration of gender in research institu-tions in Greece is a critical policy challenge. Positive policyactions that can promote gender equality in the researchsector could include: The adoption of gender action plans for the promotion of

gender equality by all research actors in the private andpublic sectors.

The adoption of statutes on the operation of researchteams, which will include in their central axes the dimen-sions of gender, social class, race, and ethnicity.

The provision of substantial training on the managementof research groups for men and women researchers.

The enactment of statutes on the labour of students andprecarious workers in research organizations with a goalto respect labor rights, including rights related to genderequality.

The financing and support of networking structures andinitiatives among female scientists.


Women in IT Security

Research:

The Case of SBA Research

by Veronika Nowak

The low percentage of women in ICT professional fields

is a well-documented issue. With IT courses still being

dominated by male students for example, only 16% of

students in TU Wiens informatics programs are female

it is still a challenge for organizations to increase

numbers of female employees. How is a research

centre like SBA Research (Vienna, Austria) performing

in this regard?

SBA Research is a research centre for IT security, located inVienna, Austria. It was founded in 2006 and currentlyemploys a staff of approximately 100. It is Austrias biggestresearch centre, exclusively addressing issues of IT security,and working closely with several Austrian academic (e.g.,TU Wien, University of Vienna, Graz University ofTechnology) and numerous industrial partners.

SBA Research has always employed women, but in the earlydays of the company, women largely occupied administra-tive roles. Although some female Key Researchers joinedthe team early on, there was no targeted recruitment offemale Junior Researchers. Nevertheless, the share ofwomen on SBA Researchs staff has developed nicely overrecent years (Figure 1). After a slight drop from 2010 to 2012 mainly due to transfers to partner institutions or universi-ties the percentage of women amongst SBA Researchsemployees is increasing. It currently matches the averagereported by a survey performed on behalf of the AustrianMinistry for Transport, Innovation and Technology(BMVIT) [1], analysing data from non-university-researchorganizations (25-27% share of women).

The federal funding programme FEMtech [1] was particu-larly beneficial in increasing SBA Researchs recruitment ofwomen. The programme, funded by the Austrian Ministryfor Transport, Innovation and Technology (BMVIT), aims topromote the entry of young female scientists into a career in


ICT and to further womens participation in research andtechnology (industry and non-university-research). SBAResearch has so far hosted 15 FEMtech interns, five ofwhom ended up joining SBA Research as permanentemployees, while the remainder returned to their universitiesto finish their Bachelor of Science and Master of Sciencestudies. Those staying with SBA Research became juniorresearchers while pursuing their masters and Ph.D. degrees;one was recently selected as FEMtechs Expert of theMonth. Another intern joined the consulting department ofSBA Research, transferring her scientific knowledge to prac-tical applications in an industrial context.

The recruitment of female employees remains a challenge,owing in part to the still relatively low numbers of femalecompared with male ICT students. For example, at the nearbyTU Wien, females represented only 1,139 out of 7,173 stu-dents enrolled in study programs in the field of informaticsfor the autumn 2014 semester. Also, a recent study commis-sioned by the Kuratorium Sicheres sterreich (AustrianSafety Board) regarding women andcybersecurity shows that although 63% offemale students are interested in the topicof cybersecurity, only 24% actuallythought about working in this field andjust 5% already did so [2]. This raises thequestions: what can institutions like SBAResearch do firstly, to become known as apossible employer and secondly, to attractfemale applicants in particular? So far,SBA Research has been a regular partici-pant in job fairs of Austrias universitiesof applied sciences and awareness initia-tives such as the Young ResearchersDay which is organized by the AustrianComputer Society.

SBA Research strives to support femaleand male employees alike in their careers.Both male and female employees areinvited to apply for and have beengranted sabbaticals as well as researchstays abroad, e.g., in Boston and Tokyo.The matters of family and children have become an increas-ingly relevant topic amongst SBA Researchs staff. Since2012 in particular, increasing numbers of employees havefounded families, putting the issue of maternity and paternityleave, as well as part-time employment for young parents, onthe table. In addition to maternity leave, SBA Research has ahigh number of fathers taking time off to be with their chil-dren, in accordance with the respective Austrian legislation.Also, previously established working conditions facilitatinga good work-life balance (e.g., flexible time agreement) haveproven to be an asset to the employees including manage-ment when coordinating work and family matters.

SBA Research is also taking active steps to increase the visi-bility of women in ICT. In 2015, the second edition of ourbrochure Women and IT Security Research was issued,featuring 24 female employees and alumnae of SBAResearch in all kinds of professional fields. Femaleresearchers also take time to participate in initiatives such asTU Wiens techNIKE a series of workshops aimed specifi-

15

cally at girls. We furthermore regard our current and formerfemale employees teaching at universities and universities ofapplied sciences as role models, showing students that thereis a professional future for women in ICT.

In summary, SBA Research considers the current situation tobe much better than even five years ago; nevertheless, a lotremains to be done. In order to increase the number ofwomen working in ICT, it seems feasible to implement fur-ther strategies to attract undergraduate students to computerscience programs in academia and female professionals to acareer in the respective fields. In addition to public fundingprogrammes, it might be helpful to adjust the scope of ICTprojects or conferences [3].

SBA Research will continue to actively encourage women tofirst study and then work in ICT by making use of respectivefunding schemes and offering a company culture favourableto integrating the professional and personal goals of femaleand male researchers.

Links:

SBA Research Women and IT Security Research, 2015:http://kwz.me/RoFEMtech programme:http://www.femtech.at/en/femtech.htmltechNIKE: http://kwz.me/RO

References:

[1] http://www.femtech.at/sites/default/files/Slide_Gleich-stellungserhebung_0.pdf

[2] Kuratorium Sicheres sterreich. Female Cyber Mentor-ing, 2015 (to appear).

[3] C. Alvarado and E. Judson, Using Targeted Conferencesto Recruit Women into Computer Science. Communica-tions of the ACM 57(3):70-77, 2014.

Please contact:

Veronika NowakSBA Research, Vienna, AustriaE-mail: [email protected]

Figure 1: Changes in percentage of female SBA Research staff over three years.

Introduction to the Special Theme

Tackling Big Data in the Life Sciencesby the guest editors Roeland Merks and Marie-France Sagot

The Life Sciences are traditionally a descriptive science, in which both data collection and dataanalysis both play a central role. The latest decennia have seen major technical advances, which havemade it possible to collect biological data at an unprecedented scale. Even more than the speed atwhich new data are acquired, the very complexity of what they represent makes it particularly diffi-cult to make sense of them. Ultimately, biological data science should further the understanding ofbiological mechanisms and yield useful predictions, to improve individual health care or public healthor to predict useful environmental interferences.

Biologists routinely measure DNA sequences, gene expression, metabolic profiles, and protein levels,infer molecular structures, visualize the positions and shape of cells in developing organs and wholeembryos over time, rapidly screen the phenotypic effects of gene mutations, or they monitor the posi-tions of species and individual animals and plants in whole ecosystems or herds, to name just a few.

The resulting datasets yield new insight into biological problems, while at the same time they pose newchallenges to mathematicians and informaticians. How do we store these large bodies of data in an effi-cient manner and make sure they remain accessible in the future, while at the same time preserving pri-vacy? How do we search through the data, spot interesting patterns and extract the biologically relevantinformation? How do we compare data of different conditions or species? How do we integrate datafrom different sources and across biological levels of organization to make new predictions? Can wethen use the resulting patterns to solve the inverse problem and derive meaningful dynamical mathe-matical models from kinetic datasets? How do we model complex and/or large biological systems,e.g., whole cells, embryos, plants or ecosystems? What are the challenges to multiscale modeling?

Given the great variety of topics that such general questions cover, this Special Theme of ERCIMNews could only highlight a few, in a selection of nineteen papers. These provide an overview of thelatest techniques of data acquisition at the molecular level, address problems of data standardisationand integration, and propose sophisticated algorithms for analysing complex genetic features. Suchalgorithms help to infer the rules for predictive, dynamical modelling, by characterising genetic inter-actions, as well as molecular and cellular structures from noisy and incomplete data. They also pro-vide key data for modelling multiscale systems at the multicellular or ecosystem level. Alongside datamining approaches, such dynamical models are a useful aid for proposing new control strategies, e.g.,in personalised medicine or to help improve medical diagnostics. A further selection of articles dis-cusses visualisation methods for big and noisy data, or suggest to make use of new communicationtechniques, such as Twitter, to help in quick management of health. Overall these approaches illus-trate the breadth and the beauty of the mathematical and computational approaches that have beendeveloped to cope with the challenges that biology poses to data science. These challenges will onlycontinue to grow in the foreseeable future, as the volume, quality and types of biological data keepon expanding.

Please contact:

Roeland Merks, CWI, The [email protected]

Marie-France Sagot, Inria, [email protected]

16

Special Theme: Tackling Big Data in the Life Sciences


High-throughput technologies are gen-erating more and more measurements ofcellular processes in health and disease,leading to ever-increasing amounts ofomics data. The main challenge isnow to interpret and understand thesemassive data sets in order to ultimatelyanswer important biological and bio-medical questions. This is a complexchallenge, however, because importantsignals are hidden by high noise levelsand heterogeneity of samples and dis-eases. Inspecting big life sciences data inthe context of biological networks helpsto address this challenge. To this end,researchers at CWI in Amsterdam aredeveloping the Heinz family of algo-rithms to analyse and explore genome-scale measurements within biologicalnetworks.

The Heinz family of algorithmsThe Heinz project started in 2007 as acollaboration with University ofWrzburgs Biocenter. The first algo-rithmic prototype, Heinz 1.0 [1], waspresented in 2008 at ISMB, the premierconference on computational biology.There, the work received the out-

standing paper award for achieving abreakthrough in computing optimalsubnetwork modules by introducingand exploiting a relation to graphtheory. Since then, the method has beenimproved and several variations havebeen presented: Heinz, the workhorse method, is cur-

rently at version 2.0 [L1]. It takes asinput a set of gene scores and finds anoptimal active subnetwork modulewith respect to these scores. This is aconnected subnetwork where the sumof the gene scores is maximal. Find-ing such a module is an NP-hardproblem. Heinz computes provablyoptimal modules using advancedtechniques from mathematical opti-mization. While Heinz 1.0 exploitedthe close relation of the underlyingMaximum-Weight Connected Sub-graph (MWCS) problem to the Prize-Collecting Steiner Tree (PCST) prob-lem and relied on PCST codes, Heinz2.0 directly solves MWCS using arecursive graph-decompositionscheme into bi- and tri-connectedcomponents and a dedicated branch-and-cut algorithm.

BioNet [L2] is an R package that pro-vides an easy-to-use interface toHeinz. Provided with raw data, e.g.,from RNA-Seq measurements, itgenerates the input score files neededby Heinz. The scores are based on astatistically sound decomposition ofp-values describing the measure-ments into signal and noise compo-nents.

Heinz has been adapted to answer avariety of research questions involv-ing the interpretation of differentialgene expression, GWAS,metabolomics, proteomics andmetagenomics data.

xHeinz [L3] is a recent addition thatcomputes conserved cross-speciesmodules. In a cooperation with theNetherlands Cancer Institute (NKI),xHeinz was used to provide evidencethat the differentiation process of therecently discovered Th17 cell type,which plays an important role for theimmune system, is conservedbetween mouse and human [2].

eXamine, a visual analytics app forexploring Heinz results in the popularCytoscape visualization platform,

Networks to the Rescue from Big omics

Data to Targeted hypotheses

by Gunnar Klau

CWI researchers are developing the Heinz family of algorithms to explore big life sciences data in

the context of biological networks. Their methods recently pointed to a novel hypothesis about how

viruses hijack signalling pathways.

Figure 1: Optimal Heinz module along with enriched functional and pathway categories using eXamine.

was developed in a cooperation withEindhoven University of Technology.The tool makes it easy to exploreannotated Heinz modules, for exam-ple, in the context of Gene Ontologyor pathway enrichment.

All software in the Heinz family is opensource.

Case study on virally deregulated signalling The Human Cytomegalovirus (HCMV)is a specific type of herpes virus with ahigh prevalence of 60% among humans.The interplay of HCMV infections withmany diseases, including cancer, is animportant topic of biomedical research.In a collaboration within theAmsterdam Institute for Molecules,Medicines and Systems, Heinz andeXamine were used to study a modulethat is activated by an HCMV-encodedG-protein coupled receptor. See Figure1 for an illustration of the optimal Heinzmodule along with enriched functional

and pathway categories using eXamine.Using the tools from the Heinz family,the researchers have been able to for-mulate a new hypothesis aboutderegulated signalling of -catenin byviral receptor proteins. Parts of this newhypothesis have now been verifiedexperimentally and have led to targetedfollow-up studies, which are currentlyunder way.

FutureCurrent research includes the applica-tion to cancer genomics data. Here, thetask is to extract subnetworks that showexclusive mutation patterns in the sam-ples. A long term research goal is tomove towards more dynamic descrip-tions of cellular mechanisms.

Links:

[L1] http://software.cwi.nl/heinz[L2] http://bionet.bioapps.biozentrum.

uni-wuerzburg.de[L3] http://software.cwi.nl/xheinz

References:

[1] M. Dittrich et al.: Identifyingfunctional modules in protein-pro-tein interaction networks: an inte-grated exact approach, Bioinfor-matics 24(13):i223-i231, 2008.

[2] M. El-Kebir et al.: xHeinz: analgorithm for mining cross-speciesnetwork modules under a flexibleconservation model, Bioinformat-ics 31(19):3147-55, 2015.

[3] K. Dinkla et al.: eXamine: Explor-ing annotated modules in net-works, BMC Bioinformatics15:201, 2014.

Please contact:

Gunnar W. KlauCWI, currently Fulbright VisitingProfessor at Brown UniversityTel: +31 20 592 4012E-mail: [email protected]



Life science research institutes conducthigh-content experiments investigatingnew active substances or with the aim ofdetecting the causes of diseases such asAlzheimers or Parkinsons. Data frompast experiments may contain valuableinformation that could also be helpfulfor current research questions.Furthermore, the internal data needs tobe compared with other datasets pro-vided by research institutes around theworld in order to validate the results ofthe experiments. Ideally, all data wouldbe integrated in a comprehensive data-base with a nicely integrated schemathat covers all aspects of research data.However, it is impossible to constructsuch a solution since schemas and

analysis requirements are frequentlychanging in a research environment.The a-priori construction of integratedschemas for scientific data is not pos-sible, because the detailed structure ofthe data to be accumulated in futureexperiments cannot be known inadvance. Thus, a very flexible andadaptable data management system isrequired in which the data can be storedirrespective of its structure.

The core idea of the HUMIT project isillustrated in Figure 1. Data manage-ment in life science is often file-based,as the devices (e.g., an automatedmicroscope or a reader device) in a labgenerate files as their main output.

Further data processing is often donein scripting languages such as R orMATLAB by reading and writing thedata from/to files. Therefore, theHUMIT system currently targets filesas data sources, but database systemsand other types of data sources can beintegrated into the system later withoutchanging the basic architecture. In afirst step, a shallow extraction will bedone for the input files in which themetadata of the source files isextracted and loaded into the data lake.Data lake is a new buzzword whichrefers to systems in which the datafrom the sources is copied, retaining itsoriginal structure, to a repository [3].This idea is also applied in HUMIT:

Interactive Pay-As-you-Go-Integration of Life

Science Data: The hUMIT Approach

by Christoph Quix, Thomas Berlage and Matthias Jarke

Biomedical research applies data-intensive methods for drug discovery, such as high-content

analysis, in which a huge amount of substances are investigated in a completely automated way.

The increasing amount of data generated by such methods poses a major challenge for the

integration and detailed analysis of the data, since, in order to gain new insights, the data need to

be linked to other datasets from previous studies, similar experiments, or external data sources.

Owing to its heterogeneity and complexity, however, the integration of research data is a long and

tedious task. The HUMIT project aims to develop an innovative methodology for the integration of life

science data, which applies an interactive and incremental approach.

http://bionet.bioapps.biozentrum. uni-wuerzburg.de


the source files will be copied to therepository and stored with a bi-direc-tional link to their metadata. Theobjects in the repository are immutableand only an append operation will besupported (no updates or deletes), asreproducibility and traceability is animportant requirement for data man-agement in life science.

The metadata will be provided to theuser for exploration. By browsingthrough the metadata repository, theuser can see what kind of data is avail-able and incrementally construct a datamart in which data for her specificrequirements are collected. Data inte-gration takes place at this stage. Thistype of integration is referred to aspay-as-you-go-integration [2], sinceonly the part of the data lake requiredfor a particular application is integrated,and the integration is done while theuser is exploring the data. The extrac-tion of the detailed data from the sourcefiles (known as Deep Extraction) willalso be done at this stage if the data isrequired in the data mart. During theconstruction of the data mart, the userwill be supported in the definition ofdata integration mappings by (semi-)automatic tools (e.g., for schemamatching or entity resolution). Existingmappings can be also exploited for thedefinition of new mappings.

The requirements analysis for theproject has been completed and a firstversion of the metadata management

system is available. Metadata can beextracted from various file types and isstored in a generic metamodel, which isbased on our experiences in developingthe GeRoMe metamodel [1]. Theframework for metadata extraction isextensible and can be easily adapted tonew file types. The design of the inter-active data exploration component iscurrently underway and will be one ofthe core components of the system.

The HUMIT project [L1] is coordinatedby the Fraunhofer Institute for AppliedInformation Technology FIT andfunded by the German Federal Ministryof Education and Research. Further par-ticipants are the Fraunhofer Institute forMolecular Biology and AppliedEcology IME and the German Centerfor Neurodegenerative Diseases(DZNE) as life science research insti-tutes, and soventec GmbH as industrypartner. The project started in March2015 and will be funded for three years.

Link:

[L1] http://www.humit.de

References:

[1] D. Kensche, C. Quix, X. Li, Y. Li,M. Jarke: Generic schema mappingsfor composition and query answer-ing. Data Knowl. Eng., Vol. 68, no.7, pp. 599-621, 2009.

[2] A.D. Sarma, X. Dong, A.Y. Halevy:Bootstrapping pay-as-you-go dataintegration systems, in Proc. ofSIGMOD, pp. 861-874, 2008.

[3] I. Terrizzano and Peter M. Schwarzand Mary Roth and John E. Colino:Data Wrangling: The ChallengingYourney from the Wild to the Lake,in Proc. of CIDR, 2015.

Please contact:

Christoph Quix, Thomas Berlage,Matthias JarkeFraunhofer Institute for AppliedInformation Technology FIT, GermanyE-mail:[email protected],[email protected],[email protected]

Figure 1: The HUMIT system.

In 2007, the advent of "next-generationsequencing" technologies revolution-ized the field of genomics. It finallybecame affordable to analyse largenumbers of individual genomes, bybreaking the corresponding DNA intofragments and sequencing those frag-ments, yielding sequencing reads. Allof this is now happening at surprisingly nearly outrageously low cost andhigh speed. Advances in terms of costand speed, paired with the relativelyshort length of the fragments (in com-parison to first-generation sequenc-ing) comes at a price, however. First,the rapid pile-up of sequencing readsmakes for a genuine big data prob-lem. Second, the reduced fragmentlength yields even more complex scien-tific riddles than in first-generationsequencing times. Overall, the result-ing computational problems are nowharder both from theoretical and practi-cal points of view. Despite or possiblyowing to the incredible mass of data,certain genetic variants stubbornlyresist detection and form blind spots ofgenetic variant discovery due to experi-mental and statistical limitations.

Note that, in the absence of adequatemethods to detect them, the first ques-tion to ask is: do these variants evenexist in nature?

The presence of possible blind spots hasnot kept researchers from analysingthese gigantic haystacks of sequencefragments. A prominent example ofsuch an effort is the "Genome of theNetherlands" project [2], which hasaimed at providing an exhaustive sum-mary of genetic variation for a consis-tent population. Launched in 2010, it isboth one of the earliest population-scalesequencing projects, and still one of thelargest of its kind -- overall, the frag-ment data amounts to about 60 ter-abytes. The analysis of sequencing datais further enhanced by sequencingrelated individuals either family triosor (twin) quartets which allows theresearchers to study transmission ofvariants and variant formation withinone generation [3]. The resulting cata-logue of variants establishes an invalu-able resource, not only for the Dutch,but also for closely related Europeanpopulations regarding association of

disease risks with DNA sequence vari-ation, and personalized medicine ingeneral.

At CWI, as members of the Genome ofthe Netherlands project, we have suc-ceeded in eliminating a prominent dis-covery blind spot, thereby contributinglarge numbers of previously undiscov-erable genetic variants. We achievedthis by reversing a common variant dis-covery workflow usually, largeamounts of seemingly ordinary lookingsequence fragments are removed, whichturns a big into a small data problemand renders fragment analysis a loteasier. In contrast, we process all data[1]: in other words, instead of removinglarge amounts of hay and, with it, con-siderable amounts of needles that aretoo tiny to be easily spotted, we re-arrange the entire haystack such thateven the tiny needles stick out. We havedeveloped a "statistical magnet" thatpulls the tiny needles to the surface.

The key to success has been the devel-opment of an ultra-fast algorithm thatempowers the application of this



Eliminating Blind Spots in Genetic Variant

Discovery

by Alexander Schnhuth and Tobias Marschall

Detecting genetic variants is like spotting tiny sequential differences among gigantic amounts of text

fragment data. This explains why some variants are extremely hard to detect or have even formed

blind spots of discovery. At CWI, we have worked on developing new tools to eliminate some of these

blind spots. As a result, many previously undiscoverable genetic variants now form part of an

exhaustive variant catalogue based on the Genome of the Netherlands project data.

CCCAGCACTTTGGGAGGCCAAGGTGGGGGGAGGAAATTGCTTAAGCCCAGGAGT

CCCAGCACTTTGGGAGGTCAAGGTGGGGGGAGGAAATAGCTTAAGCCCAGGAGT

Point mutations (SNPs)


CCCAGCACTTTGGGAGGCCAAGGTGGGAATTGCTTAAGCCCAGGAGT

Deletion


CCCAGCACTTTGGGAGTTATGCCAAGGTGGGGGGAGGAAATTGCTTAAGCCCAGGAGT

Insertion


CCCAGCACTTTGGGAGAGGTGGGGGGAGGAAATGCCATGCTTAAGCCCAGGAGT

Translocation

Further variants: inversions, duplications, ...

Structural variants (SVs)

extractDNA

fragme

nt

one "paired-end read" per fragment

TGCTTAAGCCCCAGCACTTT

cells

DNA fragments

Figure 1: Left: Different classes of genetic variants in human genomes. Right: Next-generation sequencing, only after breaking up DNA in small

fragments, one can read the DNA however, deletions and insertions of length 30-200 letters now are very difficult to spot. We have eliminated this

blind spot in discovery by developing new algorithms.

magnet even on such massive amountsof sequence fragments. In summary, thecombination of a sound statisticalmachinery with a highly engineeredalgorithm allows for implementation ofa reversed discovery workflow.

As a result, the Genome of theNetherlands project is the first of itskind to exhaustively report on the corre-sponding class of genetic variants, pre-viously termed twilight zone deletionsand insertions, but which now enjoysomewhat more daylight.

In future work, we are also planning toeliminate this blind spot in somaticvariant discovery, which will likelyreveal large amounts of so far unde-tected cancer-causing genetic variants,and will hopefully shed considerablelight on cancer biology as well.

Links:

http://homepages.cwi.nl/~ashttp://www.nlgenome.nl

References:

[1] T. Marschall, I. Hajirasouliha, A.Schnhuth: MATE-CLEVER:Mendelian-inheritance-aware dis-covery and genotyping of midsizeand long indels, Bioinformatics29(24):3143-3150, 2013.

[2 ]The Genome of the NetherlandsConsortium: Whole-genomesequence variation, populationstructure and demographic historyof the Dutch population, NatureGenetics 46(8):818-825, 2014.

[3] W. Kloosterman, et al.: Character-istics of de novo structural changesin the human genome, GenomeResearch 25:792-801, 2015.

Please contact:

Alexander SchnhuthCWI, The NetherlandsE-mail: [email protected]

Tobias Marschall was a postdoc at

CWI from 2011-2014. Since 2014, he

holds an appointment as assistant

professor at the Center for

Bioinformatics at Saarland University

and the Max Planck Institute for

Informatics in Saarbrcken,

Germany


High-throughput DNA sequencing hasenabled a number of recent techniques(Chromosome Conformation Captureand similar) by which the entire genomeof a homogeneous population of cellscan be split into high-resolution frag-ments, and the number of times anyfragment is found in contact with anyother fragment can be counted. Inhuman cells, the 46 chromosomes con-tain about three billion base pairs (3Gbp), for a total length of about 2 m, fit-ting in a nucleus with a radius of 5 to 10microns. As a typical size for the indi-vidual DNA fragments is 4 kbp, up toabout 750,000 fragments can be pro-duced from the entire human genome.This means that there are more than 280billion possible fragment pairs. Even ifthe genomic resolution is substantiallylowered, the resulting data records arealways very large, and need to be treatedby extremely efficient, accurate proce-dures. The computational effort neededis worthwhile, however, as the contact

data carry crucial information about the3D structure of the chromosomes:understanding how DNA is structuredspatially is a step towards under-standing how DNA works.

In recent years, a number of techniquesfor 3D reconstruction have been devel-oped, and the results have been vari-ously correlated with the available bio-logical knowledge. A popular strategyto infer a structure from contact fre-quencies is to transform the number oftimes any fragment pair is found in con-tact into the distance between the com-ponents of that pair. This can be doneusing a number of deterministic orprobabilistic laws, and is justified intu-itively, since two fragments that areoften found in contact are likely to bespatially close. Once the distances havebeen derived, structure estimation canbe solved as a distance-to-geometryproblem. However, translating contactsinto distances does not seem appro-

priate to us, since a high contact fre-quency may well mean that the twofragments are close, but the converse isnot necessarily true: two fragments thatare seldom in contact are not necessarilyphysically far from each other.Furthermore, we checked the topolog-ical consistency of the distance systemsobtained from real data, and found thatthese are often severely incompatiblewith Euclidean geometry [1].

For these reasons, we chose to avoid adirect contact-to-distance step in ourtechnique. Another problem we had toface when trying to estimate the chro-mosome structure was the above-men-tioned size of the data record, and therelated computational burden. The solu-tion we propose exploits the existenceof isolated genomic regions (theTopological Association Domains, orTADs) characterized internally byhighly interacting fragments, and byrelatively poor interactions with any

Computational Estimation of Chromosome

Structure

by Claudia Caudai and Emanuele Salerno

Within the framework of the national Flagship Project InterOmics, researchers at ISTI-CNR are

developing algorithms to reconstruct the chromosome structure from "chromosome conformation

capture" data. One algorithm being tested has already produced interesting results. Unlike most

popular techniques, it does not derive a classical distance-to-geometry problem from the original

contact data, and applies an efficient multiresolution approach to the genome under study.

other segment of the genome. Thisallows us to isolate each TAD andreconstruct its structure from the rele-vant data set, independently of the restof the genome, then lower the resolu-tion, considering each TAD as a singlechain element, and then take the weakerinteractions between TAD pairs intoaccount, in a sort of recursive, multires-olution approach.

The result is an algorithm (CHROM-STRUCT [2]) characterized by: A new modified-bead-chain model of

the chromosomes; A set of geometrical constraints pro-

ducing solutions with consistentshapes and sizes;

A likelihood function that does notcontain target distances deri

Number 104 January 2016 ERCIM NEWS - Credential · ERCIM NEWS 104 Janaury 2016 21 Computational...

Documents

Transcript of Number 104 January 2016 ERCIM NEWS - Credential · ERCIM NEWS 104 Janaury 2016 21 Computational...