MOLECULAR IDENTIFICATION AND TREATMENT OF …

THEILERIOSIS IN SMALL RUMINANTS OF NORTHERN
BALOCHISTAN
REQUIREMENTS FOR THE DEGREE
LAHORE
2016
To
Lahore.
We, the Supervisory Committee, certify that the contents and form of the thesis,
submitted by Mr. Mir Ahmad Khan Reg. No, 2005-VA-214, have been found satisfactory and
recommend that it be processed for the evaluation of External Examiner(s) for the award of the
degree.
=
Member:
Member:
Prof. Dr. Aftab Ahmad Anjum
In the name of Allah the most magnificent and the most beneficent.
All praise for ALLAH All Mighty who has the control and
command of each and every thing.
It is He who has sent down to you, [O Muhammad], the Book; in it are verses [that are]
precise - they are the foundation of the Book - and others unspecific. As for those in whose
hearts is deviation [from truth], they will follow that of it which is unspecific, seeking discord
and seeking an interpretation [suitable to them]. And no one knows its [true] interpretation
except Allah. But those firms in knowledge say, "We believe in it. All [of it] is from our Lord."
And no one will be reminded except those of understanding.
ii
ACKNOWLEDGEMENTS I am deeply grateful to my supervisor Prof. Dr. Muhammad Arif Khan, Professor, and
Chairman of Department of Clinical Medicine and Surgery, University of Veterinary and Animal
Sciences Lahore for providing me an opportunity to work with him. His keen interest, analysis of
my work and rigorous critique not only improved the quality of this dissertation but also my
overall understanding of the subject.
The enthusiasm towards science and your pursuit to do “good science” helped to shape
my own scientific value. I am also thankful to my co-supervisor, Prof. Dr. Muhammad Azam
Kakar, for his technical guidance and constructive criticism and friendly attitude during the
course of this study from University of LUAWMS UTAL, Balochistan.
I’ve been most fortunate to have the guidance of Prof. Dr. Muhammad Sarwar Khan,
Director, Advanced studies, University of Veterinary and Animal Sciences Lahore. I would like
to record my gratitude for his kind supervision as a member in my supervisory committee,
sympathetic attitude, constructive advices, and scientific discussions.
I wish to pay my gratitude to Prof. Dr. Aftab Ahmad Anjum, Department of
Microbiology, University of Veterinary and Animal Sciences, Lahore, as member in my
supervisory committee for his personal interest and valuable advice in my research project.
I feel a momentous pleasure in transcribing my whole hearted thanks to Dr Muhammad
Ijaz (Associate professor) Department of Clinical Medicine and Surgery, UVAS Lahore, Dr
Imtiaz Ahmad Suduzai (Assistant professor) The University of Poonch Rawalakot AJK.
I am greatly indebted to my great mother, wife, sisters, brothers, teachers and colleagues,
for their support, understanding, prayers, love, patience and sacrifices rendered to make this day
possible. Finally will pay love to my beloved kids Amir Hamza Yaseenzai, Bibi Safia kakar and
Saleha Kakar, nephews Hafiz Muhammad Awais, Fahadullah, Rizwanullah and Sher Baz Kakar.
At the end, as is customary all mistakes uncorrected are entirely mine,
Mir Ahmad Khan
1 INTRODUCTION 1
4 RESULTS 58
5 DISCUSSION 90
6 SUMMARY 104
3.2. Determination of DNA concentration through Nanodrop of Northern highland. 43
3.3. Determination of DNA concentration through Nanodrop of Suleiman Mountain Region. 44
3.4. Sets of primers used to amplify Theileria rRNA gene sequences. 48
3.5. Quantities of final PCR reaction mixture. 49
4.1. Regional prevalence of Theileriosis in Sheep and Goats in Northern Balochistan. 59
4.2. Union Council wise prevalence of Theileriosis in Sheep and Goats. 62
4.3. Species wise prevalence of Theileriosis in Sheep and Goats in Northern Balochistan. 65
4.4. Prevalence of Theileriosis in different breeds of Sheep in Northern Balochistan. 68
4.5. Seasonal Prevalence of Theileriosis in Sheep and Goats in Northern Balochistan. 71
4.6. Prevalence of Theileriosis in Sheep and Goats in different age groups. 74
4.7. Sex wise Prevalence of Theileriosis in Sheep and Goats in Balochistan. 77
4.8. Molecular identification of Theileria species causing Theileriosis in Sheep and Goats in
Balochistan.
82
4.9. Analysis of Hematobiochemical parameters of Sheep affected with theileriosis. 84
4.10. Analysis of Hematobiochemical parameters of Goats affected with theileriosis. 85
4.11. Efficacy of three drugs against Theileria in blood of Sheep and Goats affected with
theileriosis.
87
4.12. Comparison of efficacy of three drugs against Theileria in blood of Sheep and Goats
affected with theileriosis.
No. 3.1. Sample collection Districts and their Union Councils. 28
3.2. Schematic diagram indicating detailed sampling strategy for the study of Theileriosis in
sheep and goats in Northern Balochistan.
32
3.3. Clinical examination of animals for the presence of Ticks in sheep farm. 36
3.4. Clinical examination of animals for the presence of Ticks in sheep farm. 37
3.5. Clinical examination of ticks infested animal. 38
3.6. Quantification of genomic DNA of Theileria species. 46
3.7. Tagging of Animals for treatment trails. 52
3.8. Tagging of Animals for treatment trails. 53
3.9. Collection of leaves and flowers of Calotropis procera. 54
3.10. Calotropis procera leaves in powder form. 55
3. 11. Prepared Sachet of Calotropis procera leaves and flowers in powder form. 56
4.1. Prevalence of Theileriosis in Sheep and Goats in two Regions of Northern
Balochistan.
60
4.2. Union Council wise prevalence of Theileriosis in Sheep and Goats in Northern
Balochistan.
63
4.3. Species wise prevalence of Theileriosis in Sheep and Goats in Northern
Balochistan.
66
4.4. Prevalence of Theileriosis in 4 different breeds of Sheep and Khurasani breed of
Goat in Northern Balochistan.
69
4.5. Seasonal Prevalence of Theileriosis in Sheep and Goats in Northern Balochistan. 72
4.6. Prevalence of Theileriosis in Sheep and Goats in different age groups in
Northern Balochistan.
75
4.7. Sex wise Prevalence of Theileriosis in Sheep and Goats in Northern Balochistan. 78
4.8. Gel picture of T .ovis and T. lestoquardi from sheep and goats in Balochistan 80
4.9. Gel picture of T .ovis from sheep and goats in Balochistan. 80
4.10. Gel picture of T. lestoquardi from sheep and goats in Balochistan. 81
4.11. Graph showing efficacy of three drugs against Theileria in blood from sheep and
goats affected with theileriosis.
INTRODUCTION
Balochistan province is located in the north west of Pakistan, it shares borders
with Punjab and and Khyber Pakthoon Khwa (KPK) to the northeast, the Arabian Sea to the
south, Iran to the west, Sind to the southeast and Afghanistan to the north. Ecological distribution
of the Province has six zones, Balochistan Coastal Region, Suleiman Mountainous Region,
Northern highlands, Central Brahvi Highlands, Kachhi Basin Region and Chaghai Kharan desert.
The provincial economy is based on natural resources including livestock. The Province has
unique culture, extremely dry desert climate, and the Suleiman Mountains with monsoon tail
region. It covers an area of 347,190 square kilo meters constituting 44% of the country. The
climate is unique having very cold winters in highlands and hot summer in lowlands (Weiss et al.
2012).
The livelihood of the people of Balochistan depends on livestock especially on small
ruminants having 12.80 million sheep and 11.784 million goats (Livestock census 2006). The
Northern range lands constitute 38 % of the total area and are thickly populated with sheep and
goats having better grazing because of heavy rainfall. In these areas sheep and goats are reared
on large scales under range management system (Kakar, 2009). Livestock diseases are crucial in
the life of farmers which lower the production and weaken the economy. Mortality and
morbidity resulting from diseases deprives the farmer earnings by short term and long term
production losses. The diseases of livestock are mostly confined to tropical and subtropical
countries like Pakistan, where climatic conditions are suitable for growth and development of
many vectors as ticks. Theileriosis belongs to this complex and affects both large and small
ruminants with high morbidity and mortality rates resulting in high economical losses and thus
poses a serious risk to livestock production (Schnittger et al. 2000). Recently, interest has been
focused in the world on the sheep and goats infecting Theileria species which include T.
lestoquardi and China 1 which are reported highly pathogenic. The disease is characterized with
fever, weakness, anorexia, conjunctival petechae, swollen lymph nodes, anemia, and cough. The
later stages of the disease are associated with diarrhea, dysentery and recumbency (Schnittger et
al. 2000; Ahmed et al. 2002).
Malignant Ovine Theileriosis caused by T. lestoquardi infection is now considered one of
the major constraints for sheep production in many areas of the world. It has been reported that it
infects lymphocytes and little is known about the mechanisms involved in the pathogenesis. The
high mortality probably linked to the ability of T. lestoquardi to stimulate proliferation of the
infected leukocyte. As a result severe tissue destruction and pulmonary edema occurs leading to
respiratory failure (El-Imam et al. 2015). The disease was reported from different parts of the
world affecting large and small ruminants. In China the disease was found more serious in lambs
and exotic animals than native animals (Jianxun and Hong, 1997). 24.6% prevalence of
theileriosis was reported in sheep from Greece (Papadopoulos et al. 1996). The disease was also
found a serious threat to sheep and goats in Kingdoms of Saudi Arabia (El-Azazy et al. 2001),
Sudan (Salih et al. 2003), Iran (Razmi et al. 2006) and Turkey (Sayin et al.2009). In Pakistan
Nausheen et al. (2010) reported 43.37% prevalence of ticks in sheep and 41.53% in goats which
transmit different protozoal infections including theileriosis. Rhipicephalus was found to be the
most abundant tick spp infesting both sheep and goats. (Zia-ur-Rehman et al. 2010) reported
16.5% prevalence in sheep in the Okara district, Pakistan of which 65.1% were showed schizont
of thieleria in lymphocytes. The disease was also reported a serious concern in sheep and goats
from Lahore, Pakistan (Durrani et al. 2011).
INTRODUCTION
3
Tick-borne diseases can seriously affect the well-being of farmers. Impact on livestock, is
felt more in the tropical and subtropical parts of the world. Tick-borne diseases cause heavy
economic losses by decreasing milk production, weight loss and an estimated annual loss of
US$7,000 million was reported with significant population of cattle i.e. above 80 % at risk of
tick borne infections (Willadsen. 2005). Ticks also involve in increasing risk for bacterial, viral,
and fungal infections and are considered to be the second important vectors after mosquitoes of
human infectious diseases in the world (Jabbar et al. 2007,Hashemi-Fesharki, 1988).
The disease is now considered a serious threat to different species of animals in Pakistan
needs prompt action for in time diagnosis and tactical control measures (Zia et al. 2010). The
conventional method of diagnosis depends on Giemsa stained blood smears examination. The
presence of parasite in red blood cells along with the clinical examination was the method used
for so many years in the world which may lead to false morphological diagnosis and needs
special diagnostic skills. It is difficult to differentiate the species on the basis of morphology of
piroplasm and schizont stages, especially in mixed infections. An exact differentiation between
hemo-parasites is crucial for diagnosis and understanding the epidemiology of the disease.
Alternatively serological and molecular techniques were used in the world for accurate diagnosis
and better understanding of the epidemiological pattern of the disease. Amplification of parasite
DNA using Polymerase Chain Reaction (PCR) has advantages over the conventional methods of
detecting animals infected with Theileria and Babesia species. It is more sensitive and specific
than parasite detection by thin blood smears (Almeria et al. 2001; Aktas et al. 2004 and Aktas et
al. 2005). PCR and sequencing results showed that sheep were infected with T .lestoquardi, and
T ovis (Spitalska et al. 2004 Altay et al. 2007). T. luwenshuni and T. uilenbergi are reported
highly pathogenic for sheep and goats in China. As they are morphologically indistinguishable
INTRODUCTION
4
and poorly characterized, there is no easily applicable method available to differentiate between
these species. The specific PCR primers were found useful tools for the detection and
differentiation of different species in mixed infection in small ruminants (Yin, 2008). The advent
of molecular techniques, accurate identification of tick-borne pathogens and precise diagnosis of
disease is now available in the world (Ahantarig et al. 2008). PCR was reported more sensitive
and reliable detection tool for accurate diagnosis of theileriosis in sheep and goats as compared
to conventional diagnostic methods (Durrani et al. 2012).
To study the effect of the disease on hematological parameters different tests were made
in different animals like haemoglobin percentage (Hb%), packed cell volume (PCV), differential
leucocytic count (DLC), total leucocytic count (TLC) and total erythrocytic count (TEC), which
were found significantly decreased in bovine babesiosis (Sharma et al. 2000) might be equally
important in case of theileriosis. Comparison of these values with normal values in buffaloes
showed marked decrease in the PCV, TEC and Hb% suffering from theileriosis Durrani et al.
(2006) which are likely to be equally important in case of sheep and goats. The anemia is
considered as major manifestation of Theileriosis infection in animals (Glass, 2001; Preston et al.
2002), complemented by some factors such as corpuscular oxidation (Saleh et al. 2011) and
development of autoantibody IgG dependent phagocytosis (Shiono et al. 2004). Diagnosis of the
disease mainly depends upon clinical signs expressed during Theileriosis accompanied by
microscopic examination of Giemsa-stained blood smear examination (Cicek et al. 2009).With
the advent of the PCR the diagnosis has become more accurate for the detection of various
pathogens including Theileria species in livestock (Aktas et al. 2006; Galuppi et al. 2012; Li et
al. 2010).
Theileriosis was treated with different allopathic medicines especially in cattle and
buffaloes. Anti Theilerial drugs such as buparvaquone have been used effectively for many years
in the treatment of tropical theileriosis in the field and considered as a drug of choice (Qayyum et
al. 2010). However, data are lacking regarding its effectiveness in case of sheep and goats.
Efficacy of various antiprotozoal drugs like buparvaquone, imidocarb dipropionate and
Diminazene acceturate was proven in cattle and buffaloes with different concentrations (Akhter
et al., 2010) should be thoroughly investigated its effectiveness in small ruminants. Herbal plant
Calotropis procera, Family Asclepiadaceae (local name Spalmi or Aak) in the tropical countries
of Asia and Africa is a well-known wild plant with multifactor medicinal characteristics (Bharti
et al. 2010). Plant growth is reported throughout the year in arid and dry zones of Indian sub-
continent (Singh et al. 2005).
Calotropis procera, was also used as an alternative medicine in Pakistan by researchers in a
range of different animal diseases as an anti-inflammatory, anti bacterial, anthelmintic and
antiprotozoal in cattle and buffaloes (Zafar and Durrani et al. 2005). Use of medicinal plants and
ethno-veterinary practices are diminishing because of technological advancement. Affordability
of the modern allopathic drugs in Pakistan is one the important virtue of ethno-veterinary system.
Prices of these drugs and resistance support such practices.
6
Prevalence of Theileriosis and its Vector in Sheep and Goats
Prevalence of hemo-protozoan of sheep and goats in North Western part of Tamil Nadu,
India was reported by Velusamy et al. (2015). The prevalence recorded was 11% in sheep and
3% in goats. Statistically significant difference was observed between sheep and goats. Theileria
and Anaplasma specie of hemo-parasites were diagnosed in both species of animals. The
seasonal prevalence was found maximum in summer followed by winter and minimum in rainy
season. Yas et al. (2014) collected 500 blood samples of sheep male and female suspected for
theileriosis. 22.8% animals were found infected with Theileria and reported that most of the
cases were in chronic form of the disease. There was no significant difference among male and
female animals. It was noted that prevalence was significantly higher in summer and old age
groups. Razmi and Yaghfoori (2013) investigated prevalence of theileriosis in sheep and tick
vectors in the south of Khorasan Razavi Province, Iran. Blood samples were collected from 30
small and large flocks and ticks were sampled. Blood smears were stained with Giemsa stain and
examined microscopically. 18.6% blood smears were found positive for Theileria species. The
most prevalent ticks were Rhipicephalus turanicus.
Climate change and variability in different regions can change the parasites fauna and
their vectors. So the regular surveillance can be very useful for control strategies. Sheep with
clinical sign like fever, jaundice and anemia were tested for presence of Theileria and Babesia
using Giemsa staining method in Iran. Blood smears examination revealed Theileria was the
only parasite seen with 2% prevalence rate (Tahamtan et al. 2013).
REVIEW OF LITERATURE
7
Prevalence of Theileria hirci and Babesia motasi among goats in Duhok Governorate
were assessed by Zangana et al. (2011) from April to September 2010. A total 500 local black
breed were randomly selected from thirty five flocks. Animals were clinically examined and
blood smear were prepared. The result showed that T. hirci was 20.8% and B. motasi was 4% in
goats. The prevalence Theileria and Babesia infection was statistically significant between male
and female and different age groups of goats. Hematological findings revealed a significant
decrease in hemoglobin concentration, red blood cell count and packed cell volume. Macrocytic
and normochromic type of anemia was also observed. Ovine theileriosis were assessed in five
different regions in eastern half of Iran. A total of 220 Blood samples from sheep were examined
through nested-PCR and microscopically. Theileria spp were positive 60% by nested-PCR and
22.27% by microscopic examination, out of 132 positive blood samples, 55.3% were positive for
T. lestoquardi and 44.7% for T. ovis Heidarpour et al. (2010).
A survey was conducted by Irshad et al. (2010) on prevalence of tick infestation and
possible disease transmission of theileriosis in sheep and goats maintained at National
Agricultural Research Centre Islamabad, Pakistan and Barani Livestock Production Research
Institute Kherimurat, Attock, Pakistan. A total of 662 animals were screened 43.37% sheep and
41.53% goats were found infested. Prevalence of theileriosis in sheep was 7.36% and in goats
3.8%. A theileriosis of sheep and goats in China has been reported by (Yin et al. 2007) to be due
to T. lestoquardi. They reported additional ovine and caprine piroplasm species, designated T.
luwenshuni and T. uilenbergi. A study was carried out in Turkey by Sayin et al. (2009) to detect
Theileria infection in sheep and goats on the basis of different geographical and environmental
regions such as Central Anatolia, Eastern Anatolia and Southern Anatolia. A total of 687 sheep
and 89 goats suspected to have Theileria infection were examined. They reported 64.19 %
8
prevalence of infection with T. ovis in sheep and 12.36 % in goats. The sero prevalence was
found 60.26 % in sheep and 8.99 % in goats by Indirect Fluorescent Antibody Test. T.
lestoquardi was not found in any of the blood samples of sheep or goats. Durrani et al (2008)
recorded the prevalence in buffaloes through blood smear examination and PCR. The results
showed 39.9% prevalence through blood smear examination and 53.3% through PCR hence
stated that PCR is more reliable and sensitive technique for diagnosis of the disease. Ghosh et al.
(2007) were of the view that globally ticks transmit a variety of pathogenic microorganisms and
are among the most important vectors of diseases in livestock, human and companion animals.
Tick-borne diseases affect 80% of the world animal population and are widely distributed
particularly in tropical and subtropical countries including Pakistan. In subcontinent the livestock
sector is suffering from a number of disease problems. The damage caused by Tick-borne
diseases is considered very high. (Altay et al.(2007) carried out a prevalence survey to determine
the incidence of Theileria T. ovis and T. lestoquardi in small ruminants through blood smear
examination and PCR in the Anatolia. Whole blood samples 677 sheep and 142 goats were
collected from Malatya. Thin blood smears of 656 sheep and 139 goats were examined.
Theileria were detected in 18.29% sheep and 2.88% goats. T. ovis was detected in 11.27% of
goats and 58.79% of sheep. T. lestoquardi was not detected in the animals. The prevalence of
theileriosis was studied in sheep in the South Khorasan province in Iran by Ramzi et al. (2006).
A total of 840 sheep from 34 flocks were examined and investigated through blood smears
examination. 11.9% sheep were found infected with Theileria spp. Difference in the infection
rates was significant among different areas. The difference of prevalence in males and females
and age groups were not found significant. The prevalence was highest in June (26.3%),
gradually decreased in July and August.
9
A study was conducted by Nagore et al. (2004) to investigate the prevalence of
Theileriosis and babesiosis in sheep population. Sheep 320 located in the Basque County Spain
were analyzed. They reported 64.7% prevalence of subclinical infections in sheep. Three
Theileria and two Babesia genotypes were also identified in the study. They also reported 78.7%
prevalence of piroplasmosis in another investigation. They also found that these piroplasm
species were significantly involved in abortion in the study area. Ramzi et al. (2003) conducted
a study to determine the population of ticks in sheep in Iran. Suspected cases of Theileriosis from
28 flocks of sheep were clinically examined and reported 36.17% prevalence of the disease in
sheep. Seasonally the prevalence was highest in June and July whereas lowest in September and
August. Sex wise prevalence of hemo-parasitism was generally higher in female animals. The
lower prevalence in young animals compared to adults can be attributed to the restricted grazing
of young animals which tends to reduce their chance of contact with the vectors of these
diseases. However, the parasitism effect on the mean PCV was deleterious in younger as
compared to adult animals Enwezor et al. (2009). The age groups and gender was not found
significantly affected. Guo et al. (2002) studied sheep Theileriosis in Gannan Tibet. The disease
was found endemic in Gannan. Seasonal prevalence was found higher in March to May and
lower in September and October. The incidence rate was 60.8% and mortality 81.5% in young
animals as compared to 17.12% and 65.78% in adult sheep. The mean incidence values were
40% and mortality 85.71%. The incidence rate for goats was 8.06% and the mortality was
73.33%. El-Azazy et al. (2001) stated that data are lacking about tick-borne diseases in sheep and
goats. They conducted a survey of vectors of malignant theileriosis of sheep in Saudi Arabia.
Samples were collected from animals at the Veterinary Diagnostic Laboratory in Jeddah,
Makkah and Bureida, Al-Qasim. Blood and lymph node smears were made and examined.
10
Disease was found 2.8% in Jeddah and 24% in Bureida. The infected sheep were infested with
Hylomma Ticks.
A study was carried out by Papadopoulos et al. (1996) on piroplasms of small ruminants
in the Macedonia region of Greece. A total of 721 serum samples were collected from sheep and
487 from goats. The prevalence of positive IFA titers for sheep and goats sera were 24.6% and
0.6% for T. ovis, 52.1% and 36.4% for B. ovis, 10.5% and 4.2% for B. motasi, 12.6% and 6.6%
for B. brassa and blood smears revealed the presence of T. ovis and B. ovis in sheep and
Anaplasma ovis in a goats.
The role of vector in the spread of Theileriosis was reviewed by Jongejan and Uilenberg
(1994). They discussed seven important genera of ticks Boophilus, Dermacentor,
Haemaphysalis, Hyalomma, Ixodes, Rhipicephalus and Amblyomma. They identified 840 tick
species involved in disease transmission in their hosts. Ixodids also called hard ticks comprised
80% of the total tick species population. Staining techniques were used to detect the parasites
infection in ticks for many years but today PCR is the more sensitive, quick and reliable
technique even to differentiate the protozoan spp. along with the prevalence and severity of
infection. Tick transmitted piroplasmosis was the important disease affecting cattle in the South
mountain pasture of Hunan province. In their study ticks were collected from cattle and
identified three genera and four species: Haemaphysalis vietuamensis, Haemaphysalis
longicornis, Ixodes sinensis and Boophilus microplus). The tick species were found potential
vector of T. sergenti. The disease affected calves from May to August reaching a peak in June or
July. In cattle, the disease occurred from June to September with a peak in September. The
pathological lesions observed were; subcutaneous hemorrhages in tissues and serosa, intestinal
11
mucosa and most prominently mesenteric lymph nodes, enlarged liver, gall bladder filled with
tawny colored bile, enlarged spleen and heart with numerous hemorrhagic foci in the auricle.
A survey was conducted in Layyah & Muzaffargarh districts of Punjab by Sohail et al.
(2008). They found that tick infestation is still a great threat to livestock and dairy industry of
Pakistan. The prevalence was calculated in 3500 cattle and buffaloes and found highest in cattle,
1076 (72.9%) whereas in buffaloes the prevalence rate of tick infestation was recorded as 957
(47.3%). Hyalomma anatolicum anatolicum was found more prevalent among 3500 animals
followed by Rhipicephalus sanguineus. The seasonal prevalence was noted high in the month of
July with no prevalence in January, February, March November, December. The importance of
ticks in disease transmission cannot be neglected in the world because they cause heavy
economic losses In Australia in 1974 losses caused by cattle tick (Boophilus microplus) were
calculated as USD 62 million Rajput et al. (2006) The importance of piroplasmosis was reviewed
by Bock et al. (2004) causing heavy losses to cattle industry. The studies shown economic value
by estimating 1.2 billion cattle exposed to babesia infection.
Theileriosis due to T. hirci and babesiosis due to B. ovis and B. motasi were the most
pathogenic protozoa of sheep. The major tick genera found were Hyalomma, Rhipicephalus,
Haemaphysalis, Ixodes and rarely Dermacentor distributed in all part of Iran. Yin et al (2002),
investegeted that the Hyalomma ticks transmit Theileria species in Gannan area of China. These
results shown that the ticks were infected with two species of Theileria. The species infective for
sheep could be related to the newly recognized, but not yet named, pathogen recently reported in
small ruminants in China. In another study Razmi et al. (2003) assessed the prevalence of
different genera of ticks in sheep causing ovine Theileriosis in an endemic area of Iran.188 sheep
were clinically examined from 28 flocks and reported 36.17% prevalence infected with T.
lestoquardi. 61.1% of the animals harbored Hyalomma a. anatolicum, 33.42% Rhipicephalus
sanguineus and 0.05% Hyalomma marginatum marginatum. The examination of 345 ticks
showed that 15% of salivary glands of H. anatolicum. anatolicum and 4% of R. sanguineus
contained Feulgen positive bodies. Seasonally, the prevalence of Theileria infection and ticks
was highest in July (62.5%) and June (23.6%), while a decrease was observed in September
(24.5%) and August (17.39%). Ticks were not only involved in disease transmission but also
allow development of the infectious agent inside. Singh and Girschick (2003). Ticks-borne
diseases assuming more importance as they cause major economic problems Makala et al.
(2003). A total of 109 species of ticks were identified by Yin and Luo (2007) in China. 45
species were found infest small ruminants and five involved in the transmission of tick-borne
diseases. Pathogenic microorganisms like protozoa, rickettsiae, spirochaets, and viruses were
transmitted to the animals by ticks and most important vectors of diseases affecting 80%
livestock in tropical and subtropical countries Ghosh et al. (2007). T. uilenbergi (China 1) the
most pathogenic heamo-parasite could be transmitted to small ruminants by at least two species
of ticks namely Haemaphysalis longicornis and Haemaphysalis qinghaiensis Youquan Li et al.
(2010). Ovine theileriosis is an important tick-borne disease of sheep in the tropical and
subtropical regions of the world Zia-ur-Rehman et al. (2010) caused by T. hirci (T. lestoquardi).
The disease is economically important in sheep and goats, causing clinical illness and mortalities
in Mediterranean Basin, west Asia, Middle East, Indian subcontinent, and parts of Africa.
A study was conducted by Hashemi and Goodarzai, (2016) in Lorestan province of Iran
to identify the vector of theileriosis in sheep through PCR. From April to July (2012), a total
number of 265 herd ticks were collected from different predilection sites of Theileria infected
sheep using a species specific primers for T .ovis and their result revealed that Rhipicephalus
13
sanguineus were positive for T.ovis as well as 21 (30.88) percent female ticks and 16 ( 19.04)
percent male ticks with a maximum numbers of R. sanguineus ticks (57.35) percent and least
number(3/01) percent of Haemaphysalis punctuat ticks were recorded in the study area in view
of that R. sanguineus is the primary vector of theileriosis in sheep in Lorestan Iran.
A survey was conducted by Razmi et al. (2011) to investigate the frequency of hard ticks
on sheep in Khorasan Razvi province of Iran. They collected and identified 812 ticks from sheep.
Five different species Rhipicephalus turanicus (59.23%), Hyalomma.marginatum turanicum
(25.73%), Hyalomma excavatum (14.8%), Hyalomma anatolicum (8.3%), and Dermacentor
niveus (4.8%) were reported. R. turanicuss and H. m. turanicum were predominant ticks in the
province. Hasson and Al-Zubaidi, (2012) conducted a study to investigate the prevalence of ticks
infestation in sheep and goats. 366 animals were examined, out of these 69 (18.85 %) were found
infested and infestation was more prevalent in sheep than goats. Ali et al. (2013) conducted a
survey to estimate the prevalence of ticks infestation in grazing sheep in Iran. The frequency
was Hyalomma 46.88%, Rhipicephalus 42.32 % and Haemaphysalis 10.78%.
Molecular Identification of Theileria in Sheep and Goats.
Theileria are intracellular apicomplexan protozoan infecting a wide range of animals. In
the Caribbean Zhang et al. (2015) used genus-specific pan-Theileria FRET-qPCR to identify
infected animals. They found Theileria spp. in 9% of the samples of animals. Donkeys revealed
20.0% followed by sheep 17.4%, cattle 6.8%, goats 5.0% and horses 5.0%. They also
identified Theileria spp. OT3 in sheep and goats, T. equi in donkeys, cattle, goats, and sheep,
NG-2013 in cattle, YW-2014 in donkey and B15a in goats. Saeed et al. (2015) carried out a study
in Kohat and Peshawar districts of Pakistan to determine the prevalence of T. lestoquardi in
sheep and goats. They collected 165 blood samples were from sheep (n= 44) and goats (n= 121).
14
Data on the characteristics of animals and the herds five samples (3%) were found positive and
generated 730 bp product through PCR amplification of 18S SSU rRNA gene, specific for T.
lestoquardi. None of the samples from Peshawar district were found positive for this parasite. It
was observed that presence of tick on the domestic animals and dogs along with mixed flocks
were highly significant risk factor for the spread of ovine theileriosis. They concluded that PCR
is more sensitive and reliable diagnostic tool for detection of T. lestoquardi in blood samples of
sheep and goats.
A molecular study were conducted in China by Yang et al. (2014) and reported that
Theileria spp. can infect large and small ruminants causing diseases and heavy economic losses.
Diagnosis of infection on the species level is often challenging because identical parasites are
difficult to identify microscopically. It can be made easier while using PCR assays which can
identify Theileria spp. In their study they detected all recognized species of Theileria
successfully in whole blood samples from animals in China. DNA of Theileria was detected in
53.2% of the sheep, 44.4% of the goats and 30.8% of the cattle. Sequencing of some of the PCR
products showed T. ovis and T. luwenshuni were found in sheep and T. luwenshuni in goats.
Shahzad et al. (2013) used primers specific for Theileria spp to amplify small subunit ribosomal
RNA from Theileria species genomic DNA from blood samples of the sheep. A species specific
primer pair for T. ovis was also used in the study to amplify 520 bp product from T. ovis genomic
DNA. 37% samples were found positive for T. ovis. All positive samples were successfully
amplified using both primer pairs. PCR was found more sensitive and specific for disease
diagnosis and species identification of Theileria.
A molecular study was conducted by Ramzi and Yaghfoori (2013) in Iran to detect T.
ovis, T. lestoquardi in sheep and tick vectors. Blood samples were taken from sheep and salivary
15
glands of ticks were isolated and analyzed by PCR. PCR-RFLP was used to differentiate
Theileria species from PCR-positive samples. Microscopically detected 18.6% of blood smears
samples, 58.6% samples were identified as T. ovis and 6.6% as T. lestoquardi. In total, 169
Ixodids ticks were collected from different areas of the province. The most prevalent ticks
were Rhipicephalus turanicus (n = 155); followed by Hyalomma anatolicum anatolicum
and Hyalomma marginatum turanicum. 33 ticks were found positive for Theileria species by
semi-nested PCR.
In an experiment in Turkey Aydin et al. (2013) investigated the presence and distribution
of Theileria and Babesia species in sheep and goats in Turkey. The genomic DNAs were
extracted from blood samples of animals. 360–430-bp fragment 18S SSU ribosomal RNA gene
of Theileria and Babesia species was amplified using the genomic DNAs. 3.37 % animals
including 34 sheep and 4 goats were found positive for Theileria spp. Infection rates were
34.64 % in sheep and 10.04 % in goats, A Theileria sp. OT3 was also detected in 2.04 % of
animals; besides Theileria sp. Durrani et al. (2011) collected 200 whole blood samples along
with 100 samples of ticks from 20 different flocks of sheep in Lahore, Pakistan. The history of
fever and anemia were taken into consideration for screening of the animals. On microscopic
examination 22% samples were found positive for Theileria, while 35% blood samples were
found positive for Theileria species by PCR. T. ovis was found prevalent in 79% of the cases and
T. lestoquardi in 21% animals. In an experiment 250 sheep blood samples were taken from
during tick season. Microscopic examination revealed that 9.2% sheep were infected with
Theileria spp. Parasitemia was observed ranged 0.011% to 0.015%. The results of nested PCR
assessment of DNA samples, 32.8% sheep were found positive. The evaluation of positive
samples revealed, 54.8% and 40.2% T. lestoquardi and T. ovis respectively. Mixed infections
16
were found in 4.8% cases. Based on their PCR product digestion pattern they claimed that
mixture of T. annulata and T. lestoquardi was observed in some cases. The presence of T.
annulata was unreported by sequence analysis Zaeemi et al. ( 2011).
Theileria was reported very common and two species, T. lestoquardi and T. ovis, are
suspected in case of ovine theileriosis in Iran. The epidemiological aspects of the disease are
poorly understood and further investigations are required with more sensitive and precise
techniques. Theileria species were determined in sheep from five regions of Iran blood samples
were collected in EDTA and data revealed 60% infection rate by nested-PCR compared with
22.27% by microscopic examination. 55.3% samples were positive for T. lestoquardi and 44.7%
for T. ovis. Bami et al. (2010). Theileria species involved in sheep theileriosis were determined
in eastern half of Iran. Blood samples from 220 sheep obtained from five different regions. 60%
were found positive for Theileria spp. by nested-PCR compared with 22.27% by microscopic
examination. Two types of Theileria spp. T. lestoquardi (55.3%) and T. ovis (44.7%) were found
involved in the disease Heidarpour et al.2010). T. luwenshuni and T. uilenbergi were found
highly pathogenic for sheep and goats in China. The researcher stated that these two species of
Theileria are morphologically indistinguishable and poorly characterized. They used specific
PCR primers and successfully amplified the genomic DNA of the two species and declared that
there method was useful for the detection and differentiation of both species of Theileria in
mixed infection occurs in small ruminants Yin et al. (2008).
With the advent of molecular techniques, identification of tick-borne pathogens at species
level and the accurate diagnosis of the disease well in time are available in the world. Tick
transmitted diseases in animals like theileriosis were reported from different parts of the world.
Two types of Theileria species T. ovis and T. lestoquardi were found in ovine disease. Ahantarig
17
et al. (2008). In Italy and Iran PCR amplification of the target 18S rRNA gene, showed 78.7%
and 76.0% prevalence of the disease in sheep. The sequencing showed that they were two
species involved, T. ovis and T. lestoquardi Olivier et al. (2006). In Turkey a total of 218 blood
samples were collected from sheep. Theileria piroplasm DNAs, extracted from sheep blood, was
subjected to the polymerase chain reaction (PCR) procedures, using specific primers for
Theileria species and T. lestoquardi. Blood smears were examined for Theileria piroplasms by
microscopic observation. In PCR analysis, the expected amplicons were obtained from 41.2%
blood samples with a molecular size of 1098 bp for Theileria spp. whereas none were amplified
by T. lestoquardi-specific primers. Piroplasms of Theileria species were detected in 15.5% of the
blood samples Aktas et al. (2005). Specificity of molecular surveillance of tick-borne diseases
based on polymerase chain reaction showed 76.0% and 59.5% of blood and tick samples
respectively. 93.1% and 82.6% of the bacteria-positive blood and tick samples were also positive
for Piroplasmida. Sequencing results showed that sheep were infected with T. lestoquardi
Spitalska et al. (2004).
A nested PCR for the detection of T. ovis in sheep was used. Sensitivity of the nested
PCR for T. ovis was assessed that one infected cell in 107 sheep erythrocytes, equivalent to a
blood Parasitemia of 0.00001%, could be detected. This is more sensitive than examining 200
fields under light microscopic examination (ME). In addition, of the 124 field samples obtained
from sheep in eastern Turkey tested, 19.35% were positive for the presence of Theileria spp. by
microscopic examination compared to 54.03% positive for T. ovis by nested PCR Altay et al.
(2004). PCR detection of Theileria parasites in ticks was compared with conventional staining of
dissected salivary glands using methyl green pyronin and its comparative advantages are
discussed. Molecular epizootiology of piroplasmids i.e., Babesia spp and Theileria spp. was
18
studied in sheep and goats from Spain, Portugal and France by Criado-Fornelio et al. (2003).
Blood samples were taken from nine sheep and one goat. Piroplasmids detected in Sheep and
goat was B. ovis, B. bovis, which shows a relatively lower degree of homology (94%) with
regard to other B. bovis isolates from several countries. The same is true for B. ovis that showed
a 94% identity with regard to Babesia sp. from South African cow and a 92% with report to B.
bovis from Portugal.
Hematology.
A study was performed to assess the hematological parameters in sheep infected with
Theileria spp. after conformation of the infection by microscopic examination and PCR.
analysis. T. ovis was conformed in 88% of the inspected sheep by PCR, and 67.8%
microscopically. Hematological analysis showed that mean RBC, PCV, Hb, and MCHC were
significantly lower, whereas RDW and MCV were found higher compared to the uninfected
sheep Khaki et al. (2015). Ayesha et al. (2013 investigated hematological and biochemical
parameters in ten Sudanese desert ewes and compared with 10 clinically healthy ewes. Their
results showed a significant decrease in Hb%, PCV and WBC counts compared to the control
group. The decrease in Hb% and PCV was observed 7-10 weeks after tick application. It was
noted that there is marked decrease in WBCs occurred at week 5 and week 6. In another
experiment Rashid et al. (2010) evaluated the changes in blood parameters in animals affected
with piroplasms. Their investigations revealed a significant decrease in Hb% and Hematocrit
values for positive animals compared to healthy controls.
A study were conducted by Khan et al. (2011) and studied blood hematological and
biochemical parameters in cross bred cattle naturally infected with theileriosis in semi arid zone
of Pakistan. Study comprised of 50 cross bred cattle ranging from 2-5 years in age. The clinical
19
signs observed were rise in body temperature, swollen lymph nodes, mucosal hemorrhages and
conjunctivitis. A statistically significant decrease in TEC, PCV, hemoglobin concentration,
serum total proteins, albumin, globulins, glucose, calcium, phosphorus, cholesterol and
triglycerides concentrations was recorded in affected cattle while significant increase was
observed in levels of serum bilirubin and ALT of affected cattle compared with healthy cattle.
Similar results were reported by Shahnawaz et al. (2011) in cattle and buffaloes affected with T.
annulata in Punjab, Pakistan. Biochemical investigation revealed a significant decrease in values
of hemoglobin and glucose in infected cattle. Concentrations of serum ALT, AST, LDH and
cholesterol in infected cattle was higher as compared to that of non-infected cattle. Sulaiman et
al. (2010) examined 175 goats, 27 were found infected with Babesia spp. When hematology was
performed, statistically significant decrease in TEC, Hb%, PCV and platelets counts were noted.
A significant increase in ESR and WBCs was recorded along with significant increase in
lymphocytes and neutrophils. Zia-ur-Rehman et al. (2010) studied the impact of ovine
theileriosis on certain blood values. A total of 400 sheep were examined for the presence of
Theileria spp in thin blood smears. A mild to severe anemia in the infected animal was observed.
There was a marked decrease in total leukocyte count and hemoglobin percentage noted along
with significant increase in total leukocyte count.
A study of hematological parameters in buffaloes suffering from theileriosis in different
areas of Punjab, Pakistan Durrani et al. (2006) reported mean values of PCV, TEC and
hemoglobin concentration (Hb%). The overall mean values of these three hematological
parameters were 0.15 l/l, 3 X10 12
and 64.5 gm/l respectively. Comparison of recorded values
from diseased animals with normal values in buffalo showed a marked decrease in the PCV, total
animal blood parameter values were found to be statistically significant.
In an experimental study Singh et al. (2001) evaluated blood samples collected from
experimentally infected calves with an average age of 53 days. The percentage paracitemia was
71.7%± 3.3% recorded after 20 days of inoculation. Giemsa stained thin blood smear
examination revealed macroschizonts in monocytes & lymphocyte. A significant decrease in the
Hb% and PCV was observed after 20 days. Biochemical analysis showed a marked decrease
(P<0.05) in the concentrations of calcium, and triglycerides along with an increase (P<0.05) in
the concentration of blood urea nitrogen as compared to day 0 values. Statistically significant
decreases were measured in the total serum proteins and albumin. Increased osmotic fragility of
erythrocytes during terminal stages of disease was observed along with morphological alterations
in erythrocytes.
Researcher Friedhoff (1997) findings displayed general anemia along with steady
decrease in total erythrocyte count (RBC) and hemoglobin (Hb) concentration. (Dhar et al. 1986;
Mishra et al. 1994) findings of hematology analysis revealed significant decrease in total
erythrocyte count, hemoglobin and total leukocyte count in experimentally infected calves,
Similar findings Durrani and Kamal (2008) reported significant decrease in Hb, WBC and total
leucocytes count in both affected Cross bred and Sahiwal cattle. Goddeeris, (2000) also
described that there are significant difference in total leukocyte count, hemoglobin and red blood
cell count concentration. Similar findings have also been described by Kumar and Malik (1999)
who reported that heamoglobin, total leukocyte count and packed cell volume decreased post-
infection. Osman and Al-Gaabary (2007) reported significant decrease in hemoglobin, total
leukocyte count and erythrocytes count in buffaloes infected with Theileria compared to control.
21
A decrease in leukocytes count was noticed as a result of devastation of lymphocytes in
lymphoid organs as well as dissemination of infiltration of these into different organs cells
(Beniwal et al. 2000; Omer et al. 2002). Hematocrit values and TEC were found decreased in
Theileria infected animals as compare to healthy animals Hasanpour et al. (2008). In Egypt
Mahmmod et al. (2011) investigated the hematological findings besides clinical disease
manifestations in the crossbreed cattle and water buffaloes naturally infected with T. annulata.
Their hematological findings showed significant decreased in blood parameter including PCV %,
RBCs count, WBCs count and hemoglobin amount in diseased animals as compared to control
ones.
Serum AST and ALT concentrations are the indicators of hepatic function as described
by Forsyth et al. (1999). Some authors Sandhu et al. (1998) attributed the abnormally high level
of Creatinine kinase Aspartate Aminotransferase, Gamma-glutamyltransferase and Alanine
aminotransferase and in the measurements of blood urea nitrogen, bilirubin and uric acid in
Theileria infected calves. In accordance to them abnormally high level of AST and ALT in
animals infected with Theileria infection was reported by (Shahnawaz et al. 2011; Yadav and
Sharma, 1986). They reported alteration in these biochemical reactions occurred due to indirect
damage of kidney and liver tissues. Similar findings were described by (Hasanpour et al., 2008;
Singh et al., 2001b).
Therapeutic Trails against Theileriosis
An outbreak of theileriosis was investigated and treated in exotic cows in India. Theileria
positive animals were treated with Butalex (Ranbaxy, India) intramuscularly at the dose of 2.5
mg/kg body weight. Healthy cows were also given Butalex as prophylactic measures. Since the
temperature and humidity in the months of July, August and September was very high, the cows
22
were kept in an air-conditioned room. Second injection of buparvaquone given after 48 hours of
first treatment. After some recovery supportive therapy with B complex and iron sorbitaol plus
Folic acid and Hydroxycoblamin was given intramuscularly. At the end 4 animals, 4 calves died
in spite of the treatment Kohli et al. (2014), Osman and Al-Gaabary (2007) reported that
excellent result of buparvaquone was observed in early treatment of 30 naturally infected water
buffalos recovered soon from clinical state whereas in later stages of disease low efficiency of
buparvaquone recorded.
Efficacy of drugs was measured by Ijaz et al. (2013) and they revealed that the treatment
of 80 animals sheep (n=40) goats (n=40) positive for babesiosis. The diseased animals were
divided into four groups A, B, C and D equally. The group A were treated with imidocarb
dipropionate (Imizol® ICI, Pakistan) @ 2 mg/kg body weight intramuscularly and
oxytetracycline @ 10 mg/kg body weight IM, group B was treated with imidocarb dipropionate
alone, group C was given Diminazene aceturate (Fa-try.banil; Prix Pharma, Pakistan) @ 3.5
mg/kg body weight intramuscularly and oxytetracycline @ 10 mg/kg body weight. While group
D was treated with Diminazene aceturate alone. Efficacy of drugs was measured on the basis of
disappearance of clinical signs and negative blood smear examination at day 2, 4, 6 and 10 post
treatments. Combine treatment of imidocarb dipropionate and oxytetracycline was proven the
most effective treatment in sheep and goats followed by combination of Diminazene aceturate
with oxytetracycline.
A therapeutic study was conducted by Basheir et al. (2012) and they recorded 32 vector
borne animal diseases prevalent in South Kordofan State Sudan. Traditional treatment was
found to be a common practice particularly treatment with herbal medicines and plants. Their
study revealed that infection with blood parasites was common. They found 70% of blood
23
smears were positive for the blood parasites. In sheep and goats Theileria spp. were found
common infections causing economic losses. In India the calves infected with theileriosis were
treated with buparvaquone at a dose rate of 2.5 mg/kg body weight along with Haemoferron 2 ml
IM and Artizone 2 ml IM, injected one week of treatment. They used buparvaquone IM for the
successful treatment Naik et al. (2010). Clinically infected cattle (n=35) with theileriosis were
subjected for the clinical therapeutic trail by Al-Hosary et al. (2010). Different age groups of the
infected animals were used in the trails. Buparvaquone Injection used for the treatment which
gave 91.4 % accuracy rate. They further stated that the treatment accuracy may reach 100% if
given at the start of infection. In case of respiratory complications or secondary bacterial
infections antibiotics should be incorpoarated in the treatment. Their trails showed excellent
results when combine treatment of buparvaquone and Marbofloxacine was given.
Efficacy of various antiprotozoal drugs on bovine theileriosis was investigated in 38
buffaloes. Group-A was treated with a single dose of imidocarb dipropionate (3 mg / kg body
weight intramuscular. In Group A-I one animal recovered completely, 02 moderately while
remaining 02 animals did not respond. The later 02 animals recovered completely after
additional 02 doses of 4 mg/kg body weight. In case of group A-II complete recovery was
recorded in one animal, moderate recovery in three animals while one animal showed no
response. Group B was treated with Diminazene acceturate (3.5 mg / kg body weight IM,
administered as single dose. Six animals recovered completely, 02 moderately while 02 animals
showed no response. Group C was treated with a single dose of Butalex (2.5 mg / kg body
weight) IM, complete recovery was recorded in 4 animals, 2 animals showed no response, while
2 animals with severe infection died after 24 hours. (Akhter et al., 2010). A total of 310 blood
samples of sheep were collected for treatment by Rashid et al (2010) from Livestock Experiment
Station, Qadirabad, Sahiwal district, Pakistan. Microscopically 9.67% samples were positive for
piroplasm (babesia). The diseased animals were divided into two groups for chemotherapy. One
group was treated with Diminazene diaceturate while other with imidocarb dipropionate.
Negative blood smear determined drug efficacy. Diminazene diaceturate proven effective (80%)
against babesiosis compared to imidocarb dipropionate was 100%. Hematological studies
revealed a significant decrease in Hb% and Hematocrit values. An experiment was conducted by
Sing et al. (1993) in which bovine theileriosis was treated with buparvaquone (n=86) and
oxytetracycline (n=23) in India. The diseased animals ranged 6 days to 3 years of age.
Buparvaquone cured 98.8% animals while oxytetracycline cured 30.4% of the animals treated.
Treated animals remained free of infection for 12 to 18 months following recovery. In another
study long-acting Oxytetracycline injected intramuscularly at 20m/kg by Singh et al. (1993). The
drug was not found effective on day 8, 10 and 12 post-infection. Their findings showed that
Halofuginone lactate was effective. Buparvaquone at dose rate of 20 mg/kg body weight
intramuscularly on day 11 post-infection showed significant effect when compared to
parvaquone. Their findings suggested single treatment with buparvaquone, either at 5 mg/ kg or
2.5 mg/ kg intramuscularly, rapidly eliminated schizont and piroplasms of T annulata. At 5 mg/
kg, it resulted in rapid recovery of all the treated calves.
A study carried out in Kenya by Muraguri et al. (1999) in which buparvaquone drug was
used. According to their findings in naturally infected animals efficacy of the buparvaquone and
parvaquone was 90 percent and 80 percent respectively.
Calotropis procera is a wild growing plant of family Asclepiadaceae. The medicinal
activity of this plant is well known. Different parts of the plant have been reported as an
excellent anti-inflammatory, analgesic, and antioxidant properties. The antimicrobial activity of
25
Calotropis procera admitted in different reports Verma et al. (2010). In another study Durrani et
al. (2009) carried out therapeutic trials of C. procera and buparvaquone (Butalex) in cross bred
cattle after experimental infection with Theileria annulata. The results of the trials indicated that
C. procera was effective in the treatment of theileriosis in cattle. Liver and kidney function tests
after treatment with C. procera showed no toxicity at the dose rate of 0.3 mg/Kg orally. The
efficacy of C. procera was noted higher than buparvaquone on 21 day post treatment. C. procera
is a wild flowery plant all around the world in Tropical areas. In Pakistan, C .procera was
successfully used as an anthelmintic in small ruminants in crude powder mixed with jiggery. The
plant was also used for treatment of cattle infected with Theileria Farah et al. (2014).
The antimicrobial effect of leaf and latex of Calotropis procera (ethanol, aqueous and
chloroform extracts) were studied. The results of the study revealed that ethanol was the best
extractive solvent. The extracts of C. procera latex gave the widest zone of inhibition against E-
coli. Similar results were obtained in case of fungi. The MIC (minimum inhibitory
concentration) for the ethanol extract was 5.0 and 20.0 mg/ml for fungi. This study revealed that
the C. procera latex had a strong inhibitory effect on the test organisms Kareem et al. (2008). A
trail was conducted by Mirzaiedehaghi, (2006) in naturally infected sheep Theileriosis with
chloroform extract of Pegnum harmala for 5 days at dose rate of 5mg/day 65% of the cases of
sheep were recovered. In another study in Pakistan the cows affected with theileriosis was
treated with Buparvaquone (Butalex) injection @ 5 ml/100 kg body weight IM. The drug showed
100 percent effectiveness Zahid et al. (2005).
Anti-ticks activity of the different aqueous extracts of the medicinal plants (Azadirachta
indica leaves, Nicotiana tabacum leaves, Calotropis procera flowers and Trachyspermum ammi
seeds) was evaluated in Pakistan. At a dose rate of 50mg/ml of the extract affected egg laying,
26
hatchability and total larval motility of the ticks. The suspension of the plants reduced the tick
infestation intensity on the calves topically. The response against the Rhipicephalus microplus
(Boophilus) of the plant extract was both dose dependent and time dependent Zaman et al.
(2012). In Nigeria, Trypnocidal activity of the hydro ethanol extract of the Calotropis procera
was studied by Hassan et al. (2013) in albino rats having the infection of Trypnosoma brucei
brucei. The rats were treated with the dose rate of 200mg of extract for seven days. The results
showed that the root extract of the Calotropis procera was 96.43% effective as compared to the
Diminazene aceturate (barenil). Significant changes were also observed on PCV in animals
which were treated with the Calotropis procera and Diminazene, The WBCs and DLC were not
decreased by the Calotropis procera root extract and berenil. The leaf extract of the Calotropis
procera showed the opposite effect of the above.
C. procera displayed the presence of cardiac glycosides, sterols, alkaloids, flavonoids and
triterpenes. Saponins, cardenolides and flavonoids after the phytochemical study of C. procera
Moustafa et al. (2010), Kumar et al. (2001) investigated C. procera dry latex effect on rodents
and reported significant decreased in severity of diarrhea. Previous studies Ahmed et al. (2004)
showed that C. procera orally administration at dose of 300 mg/kg body weight to rats protect
significantly from myocardial damage induced by isoproterenol. Several authors (Alencar et al.
2004; Basu and Chaudhuri, 1991; Kumar and Basu, 1994) reported that C. procera have a
potentially anti-inflammatory activity Larhsini et al. (2002) reported antipyretic effect of C.
procera comparable to the standard drugs such as acetylsalicylic acid. Antioxidant activity of C.
procera was also reported by Olalye and Rocha, (2007).
Statement of the problem
Theileriosis affects both large and small ruminants with high morbidity and mortality
rates resulting in high economical losses and thus poses a serious risk to livestock production
(Schnittger et al. 2000). Recently, interest has been focused in the world on the sheep and goats
infecting Theileria species which include T. lestoquardi and China 1 which are reported highly
pathogenic. Ovine Theileriosis caused by T. lestoquardi infection is now considered one of the
major constraints for sheep production in many areas of the world. The disease was also found a
serious threat to sheep and goats in Kingdoms of Saudi Arabia El-Azazy et al. (2001), Sudan
Salih et al. (2003), Iran Razmi et al. (2006) and Turkey Sayin et al. (2009). Caprine and ovine
theileriosis is an important tick-borne disease caused by Theileria hirci (T. lestoquardi) causing
clinical illness and mortalities. The disease is now considered a serious threat to these species of
animals in the Pakistan needs prompt action for in time diagnosis and tactical control measures
Zia et al. (2010). The advent of molecular techniques, accurate identification of tick-borne
pathogens and precise diagnosis of disease is now available in the world Ahantarig et al. (2008).
Keeping in view the importance of this disease and population of small ruminants in Balochistan
this study was designed with following objectives;
1- Prevalence of Theileriosis in sheep and goats and associated risk factors in Balochistan.
2- Molecular identification of Theileria species in study area.
3- Effect of disease on different hematological parameters.
4- Therapeutic trails against Theileriosis in sheep and goats.
28
MATERIALS AND METHODS
The present study was accomplished in a series of four components for assessment of
Theileriosis intensity, diagnostic options, health effects and control in small ruminants at two
ecological zones (northern highland and suleiman mountainous region) of northern Balochistan,
Pakistan.
Part-1. Prevalence of Theileriosis in sheep and goats: associated risk factors in Balochistan.
Part-2. Molecular identification of Theileria species in study area.
Part-3. Effect of disease on different hematological parameters.
Part-4. Therapeutic trails against Theileriosis in sheep and goats
3.1. Study Area
The Balochistan province of Pakistan comprises of six agro-ecological zones
(Balochistan Coastal Region, Suleiman Mountainous Region, Northern highlands, Central
Brahvi Highlands, Kachhi Basin Region and Chaghai Kharan Desert) and six divisions namely
Kalat, Makran, Naseerabad, Quetta, Sibi and Zhob. Among these, two divisions like Quetta
(northern highland) and Zhob (suleiman mountainous region) were included in present study. On
the basis of animal population, suitable environment for vectors of Theileria, three Union
Councils where the facility of veterinary hospital was available from district Quetta (Quetta
Division) and three from district Loralai (Zhob Division) were marked for sample collection
(Fig.3.1)
latitude and 67.0252 o longitude.
The geographical character of this district is mountainous and the climate is dry and cold.
Temperature ranges between -7 to15 o C in winter and relatively mild 32 to 35
o C in summer. The
average annual rainfall is 226mm. The heaviest rainfall and snowfall occurs in January and
February. The total geographical area of the district is about 2653 Km 2 which is generally
covered with different mountain i.e. Murdar, Chiltan and Zarghoon. The elevation of hills may
vary from about 1254-3500 Meters. Because of its natural beauty the people used to call it little
Paris/small London. and the famous lake in the district Quetta is Hanna Jheel.
The district Loralai of Suleiman mountainous region lies between 30.3852° latitude and
68.6000° longitude and an altitude of 3873 to 4350 feet. The climate varies with elevation, at
higher altitudes cold and dry with occasional snowfall. The district lies outside the range of
monsoon. However, along the eastern belt on Suleiman range, weather is dominantly influenced
by the monsoon season during the months of July and August respectively. (Anonymous, 1997a
and Anonymous, 1997b).
30
PART-I. Prevalence of Theileriosis in sheep and goats and associated risk factors in
Northern Balochistan.
In this part of the study, prevalence of Theileriosis in sheep and goats and its associated
risk factors from three Union Councils (Table 3.1) of the two districts were studied. The
selection of the Union Councils was made on the basis of animal population, availability of
veterinary hospital and resources.
Selection of Animals
A total of 2870 small ruminants were randomly included in the study from northern
highland and suleiman mountainous region of northern Balochistan. Four sheep breeds among
them two local (Bibrik and Harnai), and two exotic (Karakul, and Shinwari (Rastha)) along with
one goat breed (Khurasani) of either sex from their home tract districts in the target area were
studied. These animals were divided into three age groups that were, Less than one year old, one
to two years old and above two years old.
Selection of herds
In the prevalence of theileriosis in sheep and goats of targeted area a total of 200
farmer`s herds belonging to twenty villages of district Quetta and twenty villages of district
Loralai zones of northern upland of Balochistan were randomly selected. It was kept in mind
during the selection of sheep and goat herds that the herds might contain major figure of breeds
of study interest. Herd selection was also based on the animal`s age group, sheep and goat herds
with maximum number of predetermined age groups were preferably selected for study.
Farmers/related persons were interviewed according to already developed questionnaire.
Conducted different meetings with local farmers, livestock traders and villagers at different
places of the targeted villages of district Quetta and district Loralai regarding theileriosis in
sheep and goat in that order during the study period.
31
Prevalence
Occurrence of disease in respective area for a period of one year was referred as
prevalence, without differentiation in between old and new cases were calculated as per formula
described by Thrusfield, (2002).
No. of individual having a disease at a particular point in time
P = ______________________________________________________x100
No. of individuals in the population at risk at that point in time
Table 3.1. Sample collection Districts and their Union Councils.
Region Name of
Northern Highland (NHL) Quetta Quetta Kuchlak, Hanna Urak, Aghberg
Suleiman Mountainous
Region (SMR)
Sinjavi
Animals suffering from theileriosis showing clinical signs as pyrexia, anorexia, swollen lymph
nodes, weight loss, weakness, conjunctival petechial, anemia, cough and presence of ticks on the
body were selected for blood collection. The blood was analyzed for both hematological
examination and molecular identification of different Theileria species responsible for the
disease in the targeted area of northern Balochistan province.
Figure 3.2. Schematic diagram indicating detailed sampling strategy for the study of
Theileriosis in sheep and goats in Northern Balochistan.
TOTAL
SAMPLES
3.1.2. Collection of Samples
Samples were taken from the target population of sheep and goats from three union
councils each of the two districts. The sampling was performed from veterinary hospitals,
dispensaries and during clinical examination of the animals in sheep goat farms during the year
March 2012 to February 2013. During four seasons, Blood samples were taken from sheep and
goats marked with number date of collection and other related information according to
especially designed questioners (Annexure 1). The samples were taken from sheep and goats
with the following methods.
Ear tip puncture collection procedure
a) The hairs on area of ear tip were trimmed and sterilized with methylated spirit swab then
pressed the area of ear tip between thumb and index finger of one hand.
b) The ear tip was punctured by a sterilized needle.
c) Drop of blood from punctured tip was taken on glass slide for thin blood smear
preparation.
Jugular vein protocol
A) The jugular vein was raised and the area of collection was disinfected.
B) 5 ml of blood was drawn gently into the sterile syringe.
C) To stop further bleeding area was plugged with cotton.
D) Then the blood was immediately transferred to the 15 ml Falcon tubes containing 200 µl
anticoagulant i.e. Ethylene diamine tetra-acetic acid (0.5 M EDTA), for hematological
examination, PCR experiments and Giemsa staining analysis.
E) The temperature of the collected blood samples tubes was immediately maintained at 4°C
to preserve the collected samples during transportation.
3.1.3. Preparation of blood smears
The thin blood smear was prepared and processed on clean glass slides from jugular vein
blood samples and ear tip blood samples according to Benjamin (1986). A small drop of blood
dropped on clean glass slid near one end of the slide. Then using another glass slide the smear
was spread holding it firmly at an angle of 45° before the drop of blood.
The spreader slide was pushed back gently to the drop of blood to spreads along two third
of the width by capillary action to the far end with steady even motion. The smear was dried in
air and fixed. The dried blood smears fixed in absolute methyl alcohol for 1 minute.
3.1.4. Staining of fixed blood smear
I- One part of the stock solution of Giemsas stain was taken and diluted with four parts of
distilled water.
II- The fixed blood smears were placed on the staining racks and the diluted stain was
poured on them and stained for 4 minutes.
III- Smears were washed with distilled water gently and thoroughly and dried.
3.1.5. Examination of stained blood smears
A small drop of cedar wood oil was placed on the thin end of the smear and then
observed with the help of oil immersion lens (100X) to detect the presence of Theileria in the
RBCs and identified according to Urquhart et al. (2002) and prevalence of the disease was
calculated as described by Thrusfield (2002).
A. Species
Two species of the target population were analyzed for prevalence of the disease
a) Sheep
b) Goats
B. Season
Four seasons from the year 2012- 2013 were divided into
i) Spring (March-April)
ii) Summer (May-August)
C. Age
Samples were taken from three different age groups of sheep and goats to analyze the
susceptibility of the age group of the animals. For this purpose, the animals were divided
into following 3 age groups;
1. <1 year
D. Gender
Male and female groups of sheep and goats were analyzed for susceptibility to
Theileriosis.
36
Figure 3.3. Clinical examination of animals for the presence of Ticks in sheep farm
37
Figure 3.4. Clinical examination of animals for the presence of Ticks in sheep farm
Part-2: Molecular Diagnosis and identification of Theileria.
The blood samples collected from sheep and goats from various geographical locations of
Northern Balochistan were processed by polymerase chine reaction (PCR) for further
confirmation and identification of the Theileria species, T. ovis and T. lestoquardi. To test the
molecular prevalence separately of two infectious agents, we need to design specific primer set
for each species.
Frozen DNA
Lysis buffer, Tris HCL 10mM, EDTA 0.2 mM, pH 8
TNE buffer, Tris HCL 10mM, NaCl, EDTA 0.2 mM pH 8
10% SDS
DEPC water
The following detailed steps were used to extracted the genomic DNA of Theileria
species through organic Method described by Sambrook and Russel (2001).
A. RBCs Lysis step
The frozen DNA samples were thawed and mixed well at room temperature before the
DNA extraction.
Five ml blood for total genomic DNA extraction was transferred into 50 ml
polypropylene tube and add 40 ml TAE buffer, vertex for 10 seconds and centrifuge for
4000 rpm at 4°Casss for 15 minutes.
The supernatant was discarded and pellet was broken by tapping and vortex and again
mixed with 40 ml of TAE buffer, vortex well and centrifuge it as mentioned in step 2.
Four and five steps repeated, until the pellet become whitish in color. At the end the
supernatant was carefully discarded.
The following three chemicals were added into the washed pellet
30 µl 10% SDS
15 µg proteinase K
5 ml TNE buffer
The mixture was mixed well and incubated at 50°C in water bath overnight for complete
digestion of blood leukocytes.
C. Separation step
500 µl phenol: chloroform was added in the digested mixture and was vortexed until the
emulsion formed.
The mixture was incubated at room temperature for 10 minutes
Centrifuged the mixture at 12,500 rpm for 15 minutes at 4°C. The organic and aqueous
phases were separated well.
Transfer 500 µL upper phase (aqueous phase) carefully into new polypropylene tube.
D. Precipitation step
Equal amount of isopropanol was added into the upper phase containing DNA.
The mixture inverted gently until the threads of DNA visible and incubated the mixture
for 15 minutes at room temperature.
The mixtures were centrifuged at 10,000 rpm for 15 minutes at 4°C.
The supernatant was discarded carefully and X pellet remained in the tube.
E. Washing step
Precipitated pellet was washed with 70% ethanol; 1ml diluted ethanol was added and
mixed the pellet well and incubated at room temperature for 20 minutes.
Centrifuge the solution at 5000 rpm for 5 minutes at 4°C. The diluted ethanol was
discarded carefully and let pellet dried well.
The dried pellet was dissolved with 100 µl DEPC water and checked the confirmation
and concentration by following procedure and stored at -20°C until the PCR was run.
3.2.2. Quantification of DNA
The extracted DNA was quantified by using Nanodrop spectrophotometer (Thermo
Scientific) and further confirmed through 0.8% agarose gel. 1µl of DNA was used for
Nanodrop and concentration was noted by ng/µL and purity by 260/280 nm ration (1:8). Few
positive DNA samples values acquired by Nanodrop are described below in (Table 3.2 and
Table 3.3).
Table 3.2. Determination of DNA concentration through Nanodrop of Northern highland.
S. No. Sample Lab No. Species Conc. ng/uL 260/280 ratio
1 NHQ/001 Sheep 541 1.71
2 NHQ/002 Sheep 678 1.74
3 NHQ/003 Sheep 492 1.45
4 NHQ/004 Sheep 533 1.63
5 NHQ/005 Sheep 327 1.25
6 NHQ/006 Sheep 412 1.35
7 NHQ/007 Sheep 396 1.39
8 NHQ/008 Sheep 432 1.40
9 NHQ/009 Sheep 510 1.62
10 NHQ/010 Sheep 576 1.75
11 NHQ/011 Sheep 365 1.37
12 NHQ/012 Sheep 424 1.38
13 NHQ/013 Sheep 534 1.67
14 NHQ/014 Goat 614 1.73
15 NHQ/015 Goat 601 1.70
16 NHQ/016 Goat 485 1.43
17 NHQ/017 Goat 356 1.36
18 NHQ/018 Goat 280 1.24
19 NHQ/019 Goat 335 1.33
20 NHQ/020 Goat 515 1.62
Table 3.3. Determination of DNA concentration through Nanodrop of Suleiman
Mountain Region.
21 SMRL/021 Sheep 680 1.75
22 SMRL/022 Sheep 494 1.45
23 SMRL/023 Sheep 536 1.68
24 SMRL/024 Sheep 437 1.39
25 SMRL/025 Sheep 417 1.32
26 SMRL/026 Sheep 400 1.30
27 SMRL/027 Sheep 432 1.41
28 SMRL/028 Sheep 518 1.63
29 SMRL/029 Sheep 578 1.76
30 SMRL/030 Sheep 362 1.33
31 SMRL/031 Sheep 429 1.39
32 SMRL/032 Sheep 536 1.68
33 SMRL/033 Sheep 620 1.74
34 SMRL/034 Sheep 600 1.70
35 SMRL/035 Sheep 488 1.42
36 SMRL/036 Sheep 359 1.35
37 SMRL/037 Sheep 286 1.26
38 SMRL/038 Goat 432 1.40
39 SMRL/039 Goat 489 1.47
40 SMRL/040 Goat 365 1.34
41 SMRL/041 Goat 299 1.27
42 SMRL/042 Goat 364 1.35
43 SMRL/043 Goat 500 1.62
44 SMRL/044 Goat 539 1.65
45 SMRL/045 Goat 422 1.26
46 SMRL/046 Goat 418 1.33
47 SMRL/047 Goat 398 1.39
48 SMRL/048 Goat 432 1.40
49 SMRL/049 Goat 552 1.73
50 SMRL/050 Goat 500 1.62
45
The samples were further confirmed through 0.8% agarose gel. Agarose gel was prepared
by boiling 0.8g agarose powder in 100 ml TAE 1X buffer (Tri base, acetic acid and EDTA 0.5
M), when the temperature reduced to 60°C, 10 µL ethidium bromide (conc. 15 mg/ml) was
added and mixed well before poured into casting tray. The agarose gel was got solidified and
transferred into the electrophoresis tank; it was filled with 1X TAE buffer. 3 µL of DNA was
mixed with 3 µL 3 X bromophenol blue dyes and run in their respective wells. The DNA result
was seen under UV light in gel documentation system (BioRad, USA). The image was taken and
saved it in the system (Fig.3.6).
A) Primer designing
The Theileria species were identified though 18S ribosomal RNA. Strains specific
primers were designed for T.ovis and T. lestoquardi by using primer 3 software (Table 3.4). The
Gen Bank accession number GU7269901 was used for the primer designing of T. ovis and
accession number GU7269902 was used for the primer designing of T. lestoquardi. Both primer
sets were checked for self-complementary and hairpin structure through Oligo calc. please add
some here
48
Table 3.4. Sets of primers used to amplify Theileria rRNA gene sequences.
Species Primer Sequence TM
Forward CGGAGTTTCTTTGTCTGA 52
Reverse GAAGGAGTCGTAAAAACTGA 56
B) Both set of primers were optimized by gradient PCR using Bio-Rad thermos cycler. Both
primer amplification was performed with final reaction volume of 25 µL, including template
DNA 5 µL, MgCl2(25mM/µL) 2.5 µL, 10X Ammonium sulphate buffer 2.5 µL, dNTPs 2.5µL
(2.5mM), Forward primer 1 µL (10mM), Reverse primer 1 µL (10mM), Taq DNA polymerase
(5U/µL) 0.2 µL, and water 10.3 µL (Table 3.5).
Reagents Quantity (µL) Concentration
MgCl2 2.5 25mM
Buffer 2.5 10X
Water 10.3 -
Total 25 -
*All the DNA samples were diluted and brought them to almost 50ng/µL
C) Both primers were optimized through gradient PCR at a range of 50-60°C. The PCR was
done for T. ovis by using the initial de naturation temperature 95°C for 5 minutes, and 35 cycles
were carried out, each comprised denaturation at 95°C for 30 seconds, annealing at 56°C for 30
seconds and extension at 72C for 1 minute and final extension at 72°C for 10 minutes and store
at 4°C. The PCR was done for T. lestoquardi was using the same condition as revealed above;
however the annealing temperature was 55°C.
D) The PCR products were run on 1.5% agarose gel, 10 µL of PCR product was mixed with
5 µL 3 X bromophenol blue dyes and the electrophoresis was done at constant voltage 100V for
40-50 minutes in 1X TAE buffer. 50 bp or 1kb ladder was also run along with PCR products to
confirm the species specific amplification.
3.3.1. Haematological examination
Animals positive with theileriosis were confirm by making thin blood smear microscopic
slide and was examined. The samples of the animals conformed for the presence of Theileria in
RBCs was immediately transported in ice boxes to Provincial Disease Investigation Laboratories
of Quetta, Bolan Medical Complex Hospital and Fatima Jinnah TB Sanatorium for hematology.
Each sample was labeled as per determined information that is famer name, animal species, sex,
breed and age. 5ml blood samples from each sheep (n= 60 infected,. n= 18 healthy); and goat
(n= 36 infected, n= 9 healthy) were collected directly from the jugular vein into sterilized falcon
tube with anticoagulant coated with EDTA @ 1 mg/ml of blood. Each blood sample collected
was analyzed for different hematological factors RBC, Hb%, PCV, Platelets, WBC, MCV and
MCHC by using hematological analyzer as per Hasanpour et al. (2008). Changes in biochemical
values as AST, ALT, BUN, Bilirubin and Creatinine were also analyzed.
Part. 4. Therapeutic trails against Theileriosis in sheep and goats
Therapeutic trials
A total of 80 animals (sheep=40) and (goats 40) declared diseased, showing clinical signs
and microscopically positive for theileriosis, were divided into four groups A. B. C and D. These
animals were diagnosed Theileria positive in the field conditions and tagged there for the treatment
trails with the consent of the owners of the animals. The medicines for trails were provided by the
researchers free of cost and the diseased animal kept as control were discussed with the owner and
kept under observation for 10 days in the larger interest of the area.
The animals of group A (sheep 10; goats 10) were treated with Buparvaquone (Butalex®,
ICI, Pakistan) @ 2.5 mg/kg BW I/M. single dose.
The animals of group B (sheep 10; goats 10) were treated with Imidocarb dipropionate
(Imizol®, ICI, Pakistan) @ 2 mg/kg BW I/M. single dose
The animals of group C (sheep 10; goats 10) were treated with Calotropis procera,
(locally known as Spalmi, Akk) flowers and buds as a local treatment in dried powder
form at the dose rate of 0.3mg/ kg BW, twice daily for 5 days (Durrani et al. 2009).
The animals of group D (sheep 10; goats 10) were kept as positive control.
Efficacy of all three drugs was measured on the basis of Theileria clear blood smear examination
at day 10 post-medication.
Figure 3.9. Collection of leaves and flowers of Calotropis procera
56
Figure 3. 11. Prepared Sachet of Calotropis procera leaves and flowers in powder form.
STATISTICAL ANALYSIS
The map of the study area was prepared using Quantum Geographical Information
System (QGIS). For test of significance Chi square analysis was used for epidemiological
factors. These factors include Region, Districts, Union Councils, species, breeds, season, gender,
age, Chi square was used on Epi Info TM
7 (Centers for Disease Control, Atlanta, GA, USA). Two
districts from each region and three Union Councils from each district along with two species
Sheep and Goats were divided into three age groups (A) less than one year old, (B) one to two
year old, and (C) above two year old. Four seasons Spring, Summer, Autumn and Winter along
with four breeds of sheep and one breed of goat were analyzed for association with disease. The
strength of association of all factors with Theileriosis in sheep and goats was estimated through
odds ratio and the corresponding 95% confidence intervals. P-value less than 0.05 were taken as
significant. Mean along with standard error was calculated in Microsoft excel (2007). T Test
was used to test the difference between the normal and infected animals on SPSS 16 (Statistical
Package for Social Sciences 16). In order to calculate the efficacy of drugs against Theileria
parasite and ticks (the outcome variables was binomial with presence or absence of parasites in
microscopy and presence or absence of ticks post treatment at different days post treatment) the
Chi Square for trends was used to test the significant difference between medicines at different
post treatment exposure time and odds ratio were calculated against each post treatment exposure
time on Epi Info TM
7 (Centers for Disease Control, Atlanta, GA, USA). P value less than 0.05
was considered as significant.
RESULTS
The present study was conducted to investigate the prevalence of Ovine and Caprine
Theileriosis at two different regions of Northern Balochistan, namely Northern Highland (NHL)
and Suleiman Mountainous Region (SMR) in the year 2012-2013. Samples were collected from
2870 animals Sheep (n= 2200) and Goats (n= 670) for screening of the disease. The samples
were collected and processed in Regional Disease Investigation Laboratory, Department of
Livestock and Dairy Development Balochistan, T.B. Sanatorium Hospital Quetta and Medicine
Laboratory, Department of Clinical Medicine and Surgery, University of Veterinary and Animal
Sciences, Lahore.
4.1.1. Regional Prevalence
Data on overall regional prevalence of theileriosis revealed 19.19% in Northern
Highlands and 17.48% in Suleiman Mountain Region (Fig. 4.1). Chi-square analysis showed
non-significant (p>0.05) difference in the prevalence of the disease in two regions of Balochistan
(Table 4.1).
ANNEXURE
59
Table 4.1. Regional prevalence of Theileriosis in Sheep and Goats in Northern Balochistan
Region District Total
1.12 0.93-1.36 1.38 0.24 Suleiman
Mountainous
Region
ANNEXURE
60
Figure 4.1. Prevalence of Theileriosis in Sheep and Goats in two Regions of Northern
Balochistan
RESULTS
61
4.1.2. Union Council wise Prevalence.
Three Union Councils from each district were compared for the prevalence of the disease
in sheep and goats. Statistical analysis of the data showed highest prevalence (22.71%) in Union
Council Kuchlak of district Quetta (Table 4.2) followed by Aghberg (18.42%) and Hanna Urak
(15.53%). Statistically the data for district Loralai showed highest prevalence in Union Council
Zangiwal Jogezai (19.83%) followed by Kach Amaqzai (16.30%) and Sinjavi (15.92%). Chi-
square analysis of the data showed significant difference (p<0.05) in comparison of different
Union Councils.
ANNEXURE
62
Cable 4.2. Union Council wise prevalence of Theileriosis in Sheep and Goats.
District Union Council Total
Hanna Urak 380 59 15.53 0.62 0.44-0.89 6.96 0.0083
Aghberg 380 70 18.42 0.77 0.55-1.07 2.36 0.12
Lorlai
Sinjavi 490 78 15.92 0.64 0.47-0.89

MOLECULAR IDENTIFICATION AND TREATMENT OF …

Documents

Transcript of MOLECULAR IDENTIFICATION AND TREATMENT OF …