Modern Genetics Textbook Chapters 12-13 Review Book Topic 3.
-
date post
19-Dec-2015 -
Category
Documents
-
view
225 -
download
0
Transcript of Modern Genetics Textbook Chapters 12-13 Review Book Topic 3.
Cellular Genetics
• How do we know DNA is our cells genetic material?
• By 1950, based on the work of many scientists, we knew chromosomes carried our hereditary information
• Hereditary information on chromosomes is in the form of genes
• Friedrich Miescher (1869)
– Isolated material from the nuclei of fish sperm
– Composed of carbon, hydrogen, oxygen, nitrogen and phosphorous
– Named it “nucleic acid”
– Later we discovered there were two forms: DNA (in nucleus) & RNA (in cytoplasm)
• By 1920
– We knew chromosomes contained DNA & proteins
– Structure of DNA is unknown
– Scientists believed proteins not DNA carried the genetic material !!
Proteins vs. Nucleic Acids
• Frederick Griffith (1928)
– English bacteriologist
– Trying to find a vaccine against pneumonia
– He knew there were two types of bacteria
•Type S – Bacteria was surrounded by a capsule– Causes severe pneumonia
•Type R– No capsule– Does not cause pneumonia
• If injected bacteria into mice:
– Type S: pneumonia and death (a)
– Type R: no effect (b)
– Dead Type S: no effect (c)
– Dead Type S + live Type R: pneumonia and death (d)
• Tissues of dead mouse showed live Type S
• When combined some factor from dead Type S changed Type R bacteria into Type S
• Avery, MacLeod & McCarty (1944)
– Identified the transforming material in Griffith’s experiment as DNA
– DNA produced the new inherited traits in Type R bacteria when mixed with dead Type S
– Most scientists still thought proteins carried hereditary information
• Hershey & Chase (1952)
– Used bacteriophages (viruses that infect bacteria)
– Has DNA within a protein coat
– Use bacteria cell to reproduce viruses
– Was it the protein coat or the DNA which was used to produce the new viruses?
– Tagged DNA and protein with different radioactive elements
– Tested infected bacteria’s cytoplasm for radioactivity
– Showed radioactive DNA was present, not radioactive protein
– DNA is the genetic material of a cell
Hershey-Chase Experiment Animation
Deoxyribonucleic Acid (DNA)
• Each DNA molecule consists of a chain of nucleotides
• Composition of a nucleotide
– Sugar: deoxyribose (5-carbon)
– Phosphate group
– Nitrogenous base• Adenine• Guanine• Cytosine• Thymine
• Structure
– James Watson & Francis
Crick (1953)
• American biochemist &
English physicist
– Used information from other scientists
• Maurice Wilkins & Rosalind Franklin
–X-ray images of DNA showing a
helical form
–Took numerous tries which were rejected by
other scientists
– Watson, Crick, and Wilkins received the
Nobel Prize in 1962
– Two chains of a sugar phosphate backbone running parallel to each other (5’ to 3’ end)
– Pairs of nitrogenous bases link the chains together
– Helix was twisted and coiled forming a double helix (looked like a spiral staircase or twisted ladder)
– Complementary bases between the strands
• Adenine pairs only with thymine
• Guanine pairs only with cytosine
DNA Replication (DNA DNA)
• Weak bonds between the bases that connect the two strands together are broken
• Strands separate, exposing each base
• Free floating bases in the nucleus match and bond to the exposed bases on the DNA strand
– A goes with T
– C goes with G
• When bases join together, a complete complementary strand is made
– One strand is old DNA, one strand is new DNA
• Two double stranded DNA copies are produced
• Replication occurs at the same time at many different points on the DNA allowing it to occur faster
• Enzymes are used to link the smaller segments of DNA together to create one large strand
– DNA helicase: unwinds and unzips DNA
– DNA polymerase: adds nucleotides of the new strand and fixes any mistakes in the DNA
– DNA ligase: used to connect fragments of new strand together
Replication Practice
ACCTAGCATTGGCACTGACTGA
TGGATCGTAACCGTGACTGACT
• If this double stranded DNA molecule was replicated, what would the resulting strands look like?
• Replicate this double-stranded DNA segment….
TACGTTGACTGTAACGTACGGATCGATGCA
ATGCAACTGACATTGCATGCCTAGCTACGT
TACGTTGACTGTAACGTACGGATCGATGCA
ATGCAACTGACATTGCATGCCTAGCTACGT
TACGTTGACTGTAACGTACGGATCGATGCA
ATGCAACTGACATTGCATGCCTAGCTACGT
Central Dogma
• DNA serves as a genetic code for the synthesis of proteins
– Proteins are our bodies structural and functional building blocks
• DNA RNA Protein
Ribonucleic Acid (RNA)
• Sugar: Ribose
• Base uracil replaces thymine
• Single stranded
• Types:
– Messenger RNA (mRNA)
– Ribosomal RNA (rRNA)
– Transfer RNA (tRNA)
Name mRNA rRNA tRNA
Function • Copied from
DNA
• Travels from
nucleus to
cytoplasm
• Is translated
into a protein
• Part of a
ribosome
• Transports
amino acids to
the ribosome
Example
Transcription (DNA RNA)
• Occurs in the nucleus
• Process of copying a segment of DNA (gene) to produce a complementary strand of RNA
• Enzyme used: RNA polymerase
• RNA polymerase binds to the start of a gene on the DNA strand (unwinds and separates DNA)
• RNA polymerase uses one side of the DNA as a template to make a complementary segment of RNA– C : G– A : U
• RNA detaches, DNA “re-zips”
itself back together
• RNA is then processed and
released into the cytoplasm
Transcription Practice
• Given the DNA strand below, construct the complementary RNA strand
ACTTGCTGGATGCTACCGCACGTA
Replication versus Transcription
• Similarities:
– Both occur in the nucleus
– Unwind DNA with DNA helicase
– Use polymerases to attach nucleotides together
– Use complementary base pairing rules
• Differences:
– Replication makes a complete copy of DNA
• Transcription only copies segments of DNA
– Replication occurs only once
• Transcription occurs over and over again
Translation (RNA Protein)
• Cells translate RNA into amino acids (the building blocks of proteins)
• A chain of amino acids is known as a polypeptide
• Polypeptide chains are created by a ribosome and tRNA
• Genes (segments of DNA) describe how to make proteins by putting the correct amino acids in order
• Translation (“language of proteins”) uses 20 amino acids (“words”)
– Considered the “universal” genetic code which suggests common ancestry among all organisms
– Scientists can insert a gene from one organism into another organism to make a functional protein !
• Codon
– A sequence of three nucleotides that codes for an amino acid
– An amino acid can be represented by more than one codon
– Start codon (AUG) signals the start of translation
• Always begins with the amino acid methionine (Met)
– Stop codons signal the end of the amino acid chain
– Read in a series of three nucleotides (reading frame)
• If changed, resulting protein changes
Translation Practice
• Using the mRNA strand below, decode the following into its corresponding amino acid sequence
UGAACGACCUACGAUGGCGUGCAU
Codon Bingo
• On your bingo board, list all 20 of the amino acids
• Each row must have ONLY 1 free space
• I will call out three nucleotides
• Using your codon chart, identify the amino acid
• Use colored paper bingo chips to mark the amino acid called
• When you get bingo SHOUT IT!!
Mutations
• When mistakes or changes occur in an organism’s DNA, they are called mutations
• Cells have evolved a variety of methods to deal with or even prevent mutations
• Some mutations affect a single gene, while others affect an entire chromosome
Gene Mutations
• Usually happens during replication
• Point mutation
– One nucleotide is substituted for another
– Can be fixed by DNA polymerase
– Can change an organism’s DNA permanently
• Frameshift mutation
– Insertion or deletion of a nucleotide
– Causes more of an affect than a point mutation
– Shift the entire sequence of nucleotides (changes amino acids being coded for)
– THE CAT ATE THE RAT (Letter E is deleted from the first codon) : THC ATA TET HER AT…
Chromosomal Mutations
• Usually happens during meiosis
– Chromosomes do not align properly (non-homologous pair up during prophase)
– Gene duplication – one chromosome may have two copies of a gene
– Translocation – non-homologous chromosomes exchange segments with each other
Mutations Continued
• Mutations may or may not affect how an organism looks
– Depends on the number of genes involved and the location of the mutation
– Loss of gene function or creation of new hybrid gene can occur
– Silent mutation – does not affect the resulting protein (amino acid has multiple codon variations)
– Mutations in body cells affect only the organism in which it occurs
– Mutations in gametes may be passed on to offspring• Source of genetic variation among organisms• Can be beneficial or harmful
• Mutations can be caused by several factors
– Mutations are not uncommon during an organisms lifetime
• Events and substances can make mutations happen faster than the body’s repair system can handle (aging)
– Replication errors• DNA polymerase has a built-in proofreading
function• Small replication errors are not always fixed
Mutagens
• Agents in the environment that can change DNA– Speed up the rate of replication errors– Can break DNA strands
• Some occur naturally– UV light in sunshine
• Some are artificial– Industrial chemicals– X-ray machines
• If ruin repair mechanisms, may result in cancer
– Some cancer drugs cause mutations in cancer cells at such a high rate the cancer cells can no longer function
Mutation Type Analogy Example of Genetic Disease
Normal THE BIG FAT CAT ATE THE WET RAT
Substitution – Point THE BIZ FAT CAT ATE THE WET RAT Muscular DystrophySickle-Cell Anemia
Deletion – Frameshift THB IGF ATC ATA TET HEW ETR AT Cystic Fibrosis
Insertion - Frameshift THE BIG ZFA TCA TAT ETH EWE TRA Crohn’s Disease
Duplication THE BIG FAT FAT CAT ATE THE WET RAT
Fragile-X Syndrome
Repeats THE BIG FAT CAT CAT CAT ATE THE WET CAT
Huntington’s Disease