E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 1 2 0 – 4 1 2 9

ava i l ab l e a t www.sc i enced i rec t . com

www.e l sev i e r. com/ loca te /yexc r

Research Article

Microcytosis in ank/ank mice and the role of ANKH inpromoting erythroid differentiation

John Wanga, Chen Wangb, Hing Wo Tsuia, Facundo Las Herasb, Emily Y. Chengc,Norman N. Iscoved, Basil Chiua, Robert D. Inmana,c,Kenneth P.H. Pritzkerb, Florence W.L. Tsuia,c,⁎aGenetics and Development Division, Toronto Western Research Institute, Toronto, Ontario, CanadabPathology and Laboratory Medicine, Mount Sinai Hospital and Department of Laboratory Medicine and Pathobiology, University of Toronto,Toronto, Ontario, CanadacDepartment of Immunology, University of Toronto, Toronto, Ontario, CanadadThe Ontario Cancer Institute and Department of Medical Biophysics, University of Toronto, Toronto, Ontario, Canada

A R T I C L E I N F O R M A T I O N

⁎ Corresponding author. Toronto Western HoE-mail address: ftsui@uhnres.utoronto.ca

0014-4827/$ – see front matter. Crown Copyrdoi:10.1016/j.yexcr.2007.09.008

A B S T R A C T

Article Chronology:Received 19 March 2007Revised version received11 September 2007Accepted 15 September 2007Available online 20 September 2007

Progressive ankylosis (Ank and the human homolog, ANKH) is a transmembrane proteinwhich regulates transport of inorganic pyrophosphate (PPi). ank/ank mice with a mutated ankgene, have calcification and bone ankylosis of the affected joints. In the course of studyingthese mutant mice, we found that they have microcytosis. These mutant mice have lowermean red blood cell volume (MCV) and lower hemoglobin content in red cells (meancorpuscular hemoglobin, MCH) than normal mice. Using quantitative real-time PCR analysis,we showed that Ank was expressed in the E/Meg bipotent precursor, BFU-E, CFU-E, but therewas no Ank expression in the hemoglobinizing erythroblasts. Stable ANKH transfectants inK562 cells highly expressed two immature erythroid cell markers, E-cadherin and endoglin.Enhanced Erythropoietin (Epo) expression and downregulation of SHP-1 were detected in thesetransfectants. Consequently, the autocrine Epo–EpoR signaling pathway was activated, asevidenced by higher p-Tyr JAK2, p-Tyr EpoR and p-Tyr STAT5B in the ANKH transfectants. Ourresults revealed anovel function of ANKH in thepromotionof early erythroid differentiation inK562 cells. We also showed that ank/ankmice have lower serum levels of Epo than the normallittermates, and this is the likely cause of microcytosis in these mutant mice.

Crown Copyright © 2007 Published by Elsevier Inc. All rights reserved.

Keywords:Ank miceMicrocytosisK562 transfectantsEarly erythroid differentiationAutocrine Epo–EpoR signalingSerum erythropoietin

Introduction

The mutated gene, ank, of the spontaneous mutant mice pro-gressive ankylosis, was first identified in 2000, and is a nonsensemutation in the exon 11 of the Ank gene [1]. Although the geneproduct is quite ubiquitously expressed, the only significantphenotype found in the homozygous mutant mice is charac-terized by pathologic calcium apatite crystal deposition in the

spital, Mc14-417, 399 Bath(F.W.L. Tsui)

ight © 2007 Published by

synovial and subsynovial spaces followed by chondro-osteo-phyte formation and eventual bony ankylosis of the affectedjoint. There was also a report on defective splenic T cell mito-genic response to PHA and ConA in these mutant mice [2].Heterozygous ank mice have a normal phenotype, but loss ofthe Ank function in homozygous ank mice causes increasedintracellular [PPi] (i[PPi]), and decreased extracellular [PPi](e[PPi]) levels [1]. Recently, an Ank null mouse was generated

urst Street, Toronto, ON, Canada M5T 2S8. Fax: +1 416 603 5745.

Elsevier Inc. All rights reserved.

4121E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 1 2 0 – 4 1 2 9

and the phenotype of the homozygous Ank null mice wasindistinguishable from that of ank/ank mice [3]. Furthermore,mice with joint-specific deletion of Ank alleles also showedjoint mineralization and ankylosis, indicating that Ank func-tion is required locally in joints to prevent mineral formationand ensure joint mobility and function [3].

The Ank protein is a multipass transmembrane proteinwhich regulates PPi export from the intracellular to theextracellular compartments. The human ANKH protein isvery similar to the mouse Ank protein, differing by nine of theentire 492 amino acids. Both Ank and NPP-1 were required toelevate e[PPi] constitutively and following TGFβ induction [4],suggesting that Ank may facilitate export of NTP, a substratefor NPP-1 on the outer cell membrane. A decrease inintracellular NTP would reduce the available intracellularNTP for intracellular hydrolysis to [PPi], lowering i[PPi] ande[PPi] levels. In humans, autosomal dominant craniometa-physeal dysplasia (CMD) is caused by ANKH mutations [5,6].Heterozygous ANKH mutations were detected in at least fivemultiplex families with chondrocalcinosis (calcium pyro-phosphate dihydrate deposition disease) [7–11]. It remainsunclear how these mutations lead to pathogenesis of thedisease, though they appear to be dominant negative muta-tions in CMD and gain-of-function mutations in chondrocal-cinosis [12].

The observation that Ank is a polypeptide growth factor-,serum- and tumor promoter-inducible gene in fibroblasts ledto the proposal that in cells with high metabolic activity,Ank is required for efficient removal of excess i[PPi] gene-rated by consumption of ATP [13]. The notion that Ank/ANKH might have function(s) additional to that of exportingPPi is not new. Upregulation of MMP13 expression wasinduced by over-expression of Ank in primary bovine chon-drocytes [4]. In the course of studying the ank/ank mice, wefound that they have microcytosis. In this study, wespecifically asked whether Ank/ANKH play a role in eryth-ropoiesis. We examined Ank expression in various differen-tiation stages of erythropoiesis. As redundancy of proteinswith similar functions might complicate the identification ofsome tissue-specific function(s) of Ank in the ank/ankmutant mice, instead of performing in vitro knock down ofAnk/ANKH in culture cells, we used the approach of over-expressing ANKH in specific cell types which might enablethe detection of novel ANKH function(s). K562 cells werederived from a patient with chronic myeloid leukemia (CML)in terminal blast crisis [14], and were commonly used as amodel for erythroid differentiation as these leukemic cellscan be induced to undergo erythroid differentiation byvarious agents such as hemin, butyrate, cisplatin and ara-C[15,16]. Here we report the generation of stable ANKH trans-fectants in K562 cells, and show that ANKH promotes earlyerythroid differentiation.

Materials and methods

Breeding and maintenance of ank/ank mice

A breeding pair of ank/+ mice (C3FeB6-A/Aw-j –ank+/−) was ob-tained from the Jackson Laboratory (Bar Harbor, ME) and a

breeding colonywasmaintained in the animal facility, TorontoWestern Research Institute. ank/ank mice were initially gene-rated by crossbreeding heterozygous offspring of the breedingpairs. Later, heterozyotes from larger litters were used asbreeders, as in general, they givemoremutantmice.Miceweregenotyped using tail DNA as described by Ho et al. [1]. Wearbitrarily grouped the ank/ank mice into three stages accord-ing to the pathological process in the joints: Stage I, up to7 weeks old, when the manifestation of chondrocyte hyper-trophywas initially detected; Stage II, up to 17weeks old, whenprogressive changeswere observed in the jointswith increasedcalcified matrix and synovial cell proliferation; Stage III, 18weeks and older, with narrowing of synovial spaces, calcificdeposits and ankylosis.

Blood tests

EDTA–anti-coagulated blood samples were collected from themice (7- to 22-week-old mutants and normal littermates).Complete blood cell counts and red cell indices includingmeancorpuscular volume (MCV),mean corpuscular hemoglobin [Hb]concentrations (MCH, pg/cell, derived fromHb/RBC), andmeancorpuscular hemoglobin concentration (MCHC, g/l, derivedfrom Hb/hematocrit) were measured by an automated hema-tology analyzer (SysmexXE-2100)whichwas used routinely forclinical blood tests.

Real-time RT–PCR of Ank expression in mouse hematopoieticprecursors

A set of globally PCR-amplified 3′cDNA samples from thebipotent E/Meg, committed erythropoietic precursors (BFU-Eand CFU-E) and hemoglobinizing erythroblasts was providedby Dr. Iscove (OCI) [17]. Sequences of the primer-set usedfor PCR Ank expression are 5′-CAGGCTCGCATTTCCATTTC(forward primer) and 5′-GGAAGCACATAGGATTTGTTC (re-verse primer). These primer sequences are located at thelast 200 bp 5′ of the polyadenylation site of mouse Ank, asrequired for successful amplification of these globally PCR-derived 3′cDNA samples. Different dilution of the cDNAsamples were amplified in triplicates using iQ SYBR mix(BioRad). G3DPH expression was used for normalization. PCRconditions are as follows: 95 °C for 3.5 min; 40 cycles at 94 °C for15 s, 60 °C for 15 s and 72 °C for 15 s.Melt curveswere doneat theend of each PCR reaction. Relative quantification of geneexpression was carried out using the 2−ΔΔCt method [18], andeach sample was compared to the Ank expression in the E/Megbipotent precursor.

DNA transfection

ANKH cDNAswere cloned intomammalian expression vectors(pBABA neo vectorwith a β-actin promoter). DNA sequencing onthe cloned vector was carried out to ensure that there is nomutations introduced into the constructs. The construct(ANKH) or the empty vector (neo) was transfected into K562cells using FUGENE 6 (Invitrogen, CA) and the transfectantswere selected and maintained in G418. ANKH cDNA was alsosubcloned into pCMV Tag 5A (Stratagene) in frame with thec-myc tag at the 3′end and this construct or the empty vector

Table 1 – Sequences of the primer-sets used in RT–PCR of different genes

Gene 5′primer sequence (5′→3′) 3′primer sequence (5′→3′) RT–PCR product (bp)

ANKH GGACTATGGTGAAATTCCCG TCCCGTGCCTTATTCATTCTC 1492γ-globin AGGACAAGGCTACTATCACAA ATCTGGAGGACAGGGCACT 418α-globin CTGGAGAGGATGTTCCTGTCCTTG CAGCTTAACGGTATTTGGAGGTCAT 322Epo CTCCGAACAATCACTGCT GGTCATCTGTCCCCTGTCT 160SHP-1 TACAGAGAGATGCTGTCCCGT TCTGTCCATCGCGAAATGCT 1968G3DPH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA 452

4122 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 1 2 0 – 4 1 2 9

(neo) was transfected into HEK293 cells and selected for G418-resistant transfectants. For both K562 and HEK293 transfec-tants, to avoid clonal bias, populations of stable transfectants(pooled from two separate transfections) were used in allexperiments.

Real-time RT–PCR of α-globin and γ-globin expression in K562transfectants

RNAs from the K562 transfectants (untreated or treated withhemin) were prepared using the Trizol method. Oligo-dTprimers were used for reverse transcription (RT). The primersequences for amplification of α-globin and γ-globin transcriptsare shown in Table 1. Multiple dilutions of the RT mix wereused for amplification to ensure linearity. G3DPH expressionwas used for normalization. PCR reactions in at least triplicateswere carried out for each sample using iQ SYBR mix (BioRad).

Table 2 – Erythrocyte indices of ank/ank mice vs. normal litter

Genotype Gender Mouse ID Age and stage of disease(weeks/stage)

+/+ M I1 17/II 5V2 17/II 4V3 17/II 4AC2 17/II 4X1 21/III 5Z3 22/III 5

F L4 7/I 5J5 13/II 4Y5 18/III 5W4 21/III 5W5 21/III 5AA5 22/III 4Mean±SE 5

ank/ank M J4 13/II 4AC1 17/II 4X2 21/III 4AA3 21/III 4Z2 22/III 4

F K2 7/I 4V4 17/II 4V5 17/II 4W3 20/III 4Z5 22/III 4AB6 22/III 4AA8 22/III 4Mean±SE 4t-test p-value 0

MCV: mean corpuscular volume (fL). RBC: red blood cell (×1012/l). Hb: hemo(pg/cell, derived from Hb/RBC). MCHC: mean corpuscular Hb concentratio⁎ denotes significant p-value (0.05).

Melt curveswere done at the end of each PCR reaction. Relativequantification of gene expression was carried out using the2−ΔΔCt method [18], and each sample was compared to expres-sion of neo- K562 transfectants (untreated). Statistical signifi-cance (p-value<0.05) between the transfectantswas calculatedusing pair-wise t-test.

Semi-quantitative RT–PCR of Epo and SHP-1 expression inK562 transfectants

Table 1 summarizes the primer pairs used. Multiple dilutionsof the RT mix were used for amplification to ensure linearity(though not all products from various dilutions were shown inthe figures). TheRT–PCRproductswere run on agarose gelwithethidium bromide and the intensities of the DNA bands werequantified by imaging (BioRad, CA; Quantity-one software).G3DPH expression was used for normalization.

mateso

MCV RBC Hb Hct MCH MCHC

3.3 8.03 131 0.43 16.3 3069.2 8.47 126 0.42 14.9 3028.9 9.45 144 0.46 15.2 3129.3 6.55 150 0.49 22.9 4641.8 8.92 135 0.46 15.1 2920.3 9.14 140 0.46 15.3 3042.3 8.73 140 0.46 16.0 3066.7 8.99 134 0.42 14.9 3191.7 6.86 104 0.36 15.2 2932.1 8.85 138 0.46 15.6 2993.0 9.13 139 0.48 15.2 2878.7 9.57 144 0.47 15.0 3090.6±0.59 8.56±0.28 135±3.4 0.48±0.01 16.0±0.64 316±13.73.8 9.81 133 0.43 13.6 3093.9 10.16 144 0.45 14.2 3234.9 10.89 147 0.49 13.5 3012.0 8.69 110 0.37 12.7 3011.8 10.08 133 0.42 13.2 3166.2 9.73 143 0.45 14.7 3184.9 10.68 146 0.48 13.7 3043.4 11.29 150 0.49 13.3 3065.7 10.37 142 0.47 13.7 3003.4 10.26 140 0.45 13.6 3154.1 10.84 153 0.48 14.1 3202.8 10.86 144 0.47 13.3 3103.9±0.39 10.3±0.35 140±3.3 0.45±0.01 13.6±0.15 310±2.3.000 ⁎ 0.000 ⁎ 0.3 0.67 0.002 ⁎ 0.68

globin (g/l). Hct: hematocrit (l/l). MCH: mean corpuscular hemoglobinn (g/l, derived from Hb/hematocrit).

4123E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 1 2 0 – 4 1 2 9

Separation of transfectant lysates into the membrane andcytosolic fractions

The transfectants were first lysed with a hypotonic buffer(50 mM Tris, pH 8.0) by freeze–thawing for 3 times. Thecytosolic fractions were recovered from the supernatants aftercentrifugation at 6000 rpm in a microfuge at 4 °C. The pelletswere then washed and lysed with a detergent-containingbuffer (50 mM Tris and 150 mM NaCl, pH 8.0 with 1% NP-40).The supernatants, which contain the membrane fraction,were recovered after centrifugation at 14,000 rpm in amicrofuge at 4 °C. Anti-TNAP and anti-SHP-2 antibodies wereobtained from Santa Cruz Biotechnology Inc.

Immunoblotting

Unboiled cell lysates or membrane preparations were elec-trophoresed on SDS–PAGE and transferred to Immobilon-P.The blots were first stained with Ponceau S (Sigma) to ensureequal protein loading among samples. After washings, theblots were blocked with 3% BSA (Sigma) in TBST (10 mM TrispH 8, 500 mM NaCl, 0.1% Tween 20) for 1 h, incubated with anaffinity-purified goat anti-ANK antibody (kindly provided byDr. JA Winkles, American Red Cross; [19]) for 45 min and thenwith horseradish peroxidase (HRP)-conjugated anti-goat anti-body (Jackson) for 30 min. After washings, specific antibodysignals were detected by chemiluminescence using Super-signal® West Femto maximum sensitivity substrates (PierceBiotech., IL) and imaging (BioRad, CA).

Immunoprecipitation and immunoblotting

Lysates from the transfectants were incubated with each of thefollowing antibodies for 45 min at room temperature: anti-Jak2(UBI, VI), anti-EpoR (Santa Cruz, CA), anti-STAT-5A (UBI, VI),anti-STAT-5B (UBI, VI). Protein-G beads (Pierce Biotech., IL) wereadded for a further incubation of an hour at room temperature.The eluted antigen–antibody complexes were divided into twoaliquots and run on SDS–PAGE and transferred to Immobilon-P.One set of the blotswas probedwith anti-pTyr antibody and theother set probed with the corresponding antibody used for im-munoprecipitation. After incubation with HRP-conjugated sec-ondary antibodies, the blots were washed extensively beforeincubation with SuperSignal West Femto Maximum SensitivitySubstrate (Pierce Biotech., IL). Signals were visualized using animager (BioRad, CA).

Measurement of serum erythropoietin (Epo) and insulin-likegrowth factor-1 (IGF-1)

Sera were collected from mutant mice and the normal litter-mates (7–22weeks old). Mouse Epo and IGF-1 immunoassayswere used to quantitatively determine the Epo and IGF-1 con-centrations in the same serum samples (R&D Systems).

Fig. 1 – Relative expression of Ank transcripts in E/Meglineages, measured by real-time PCR and normalized withG3DPH expression. Each sample was compared to the Ankexpression in the E/Meg bipotent precursor.

Results

ank/ank mice have microcytosis

Blood was obtained from ank/ank and wild-type littermates(12 for each group) and erythrocyte indices are summarized in

Table 2. There were no age and gender differences in theseparameters with each group (mutant vs. wild-type mice).Compared to normal littermates, the mutant mice hadsignificantly lower mean corpuscular volume (MCV; 50.6±0.59 [normal] vs. 43.9±0.39 [mutant]; p-value<0.001) andmeancorpuscular hemoglobin (MCH [pg/RBC]; 16.0±0.64 [normal] vs.13.6±0.15 [mutant]; p-value=0.002) than those from normallittermates. However, therewasno significant difference in themean corpuscular hemoglobin concentration (MCHC [g/l]) innormal (316±13.7) vs.mutant (310±2.3)mice. Interestingly, themutant mice had significantly more RBC [×1012/l] (10.3±0.35[mutant] vs. 8.56±0.28 [normal]; p-value<0.001) and thus boththe mutant and normal mice had similar levels of hematocritand total hemoglobin (Table 2).

Ank is expressed in erythropoietic precursors but not inmature erythrocytes

Global cDNAs from four erythropoietic stages were previouslyamplified from single cells and the assignments of thepluripotential intermediates were confirmed by expressionprofiling of cytokine receptor transcripts [17]. Quantitativereal-time PCR was used to assess the relative Ank expressionin the E/Meg bipotential precursors, BFU-E, CFU-E and thehemoglobinizing erythroblasts (E). As summarized in Fig. 1,BFU-E and CFU-E had more Ank transcripts (27- and 10-fold,respectively) than the E/Meg precursor. Interestingly, no Anktranscripts were detected in hemoglobinizing erythroblasts.

ANKH proteins promoted early erythroid differentiation inK562 transfectants

K562 cellsmimic E/Meg bipotential precursors as they could beinduced to differentiate either to the erythroid or to the

Fig. 2 – Expression of ANKH transcripts (A) and ANKH proteins (B) in K562 transfectants. (A) ANKH transcripts weredetected by RT–PCR. Two concentrations of the RT mix were used for amplification of ANKH transcripts to ensure linearity.After normalization with G3DPH expression, ANKH transfectants showed 4× more ANKH transcripts than that of neotransfectants. (B) ANKH proteins in the membrane vs. cytoplasm fractions of the transfectants were detected by Westernblot analysis using an anti-Ank antibody (gift from Dr. Winkles). The purity of the membrane fractions was confirmed by thelack of SHP-2 (a cytoplasmic phosphatase) expression in the membrane fractions. Another phosphatase (TNAP, tissuenon-specific alkaline phosphatase) was used to show equal loading of proteins in both membrane and cytoplasmic fractions.

4124 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 1 2 0 – 4 1 2 9

megakaryocytic lineages [15,16,20]. To assess the role of ANKHin erythroid differentiation, we generated stable transfectantsin K562 cells bearing either the empty vector neo (as a control),or ANKH driven by a β-actin promoter. Fig. 2A showed that byRT–PCR, the K562 ANKH transfectants had 4-fold more ANKHtranscripts compared to that of the K562 neo control transfec-tants.Wealso assessed the level ofANKHproteinexpression (byWestern blotting) in the membrane vs. cytoplasmic fractionsof the ANKH vs. control transfectants and found that therewere3- and 2-fold more ANKH proteins on the membrane andcytoplasmic fraction, respectively, from theANKH transfectants(Fig. 2B). The purity of themembrane and cytoplasmic fractionswas demonstrated by the detection of a cytosolic protein tyro-sine phosphatase SHP-2 only in the cytoplasmic fractions andits absence in the membrane fractions (Fig. 2B). To show equalloading of proteins, another phosphatase (TNAP, tissue non-specific alkaline phosphatase) was equally expressed in bothtransfectants (in membrane as well as cytoplasmic fractions;Fig. 2B).

To check for spontaneous erythroid differentiation in thetransfectants, we assessed the α- and γ-globin transcript levelsby real-time RT–PCR. After normalization usingG3DPH expres-sion, the resultswere expressed as fold-changes relative to theexpression in K562 neo transfectants. K562 cells transfectedwith ANKH showed a 1.4-fold increase in α-globin expressioncompared to that of the control transfectants ( p-value=0.007;Fig. 3A). There was no significant difference in γ-globinexpression between the two transfectants. As the difference

in the levels of α-globin transcript found in the transfectantswas quite low, we asked whether hemin treatment of thesetransfectants leads to higher expression of α- and γ-globinmRNAs. As expected, neo- transfectants treated with 30 μMhemin for 72 h had a 3-fold increase in both α- and γ-globinexpression. There were a corresponding 14.3- and 8.5-foldincrease respectively in α- and γ-globin expression in hemin-treated ANKH transfectants (p-values=0.015 and 0.017 forα-globin and γ-globin expression, respectively; Fig. 3A). Theseresults suggested that the K562 ANKH transfectants are onlyat the early stages of erythroid differentiation. This issupported by the lack of morphological features of erythroidmaturation of these cells and the lack of spectrin proteinex>pression (a late erythroid differentiation marker) in bothtransfectants [data not shown].

E-Cadherin [21,22] and endoglin [23] are known markersof immature erythroid cells. A pronounced upregulation ofE-cadherin and endoglin proteins were detected in ANKHtransfectants (Fig. 3B), indicating that these transfectantswere at the early stages of erythroid differentiation.

The autocrine Epo–EpoR signaling pathway was activated inK562 ANKH transfectants

K562 cells express both Epo and EpoR [24]. Thus, we assessedwhether the autocrine Epo–EpoR signaling pathway wasactivated in these ANKH transfectants. (1) We used RT–PCRto measure semi-quantitatively the level of Epo transcripts in

Fig. 3 – Characterization of the K562 transfectants (ANKH vs. neo controls). (A) Relative expression of α- and γ-globin in theK562 transfectants in the absence (untreated) or presence of hemin (30 μM hemin for 72 h), using real-time RT–PCR.Expression of G3DPH was used for normalization. The results were expressed as fold-changes relative to the expression inuntreated K562 neo transfectants. * Indicates significant difference (p-value<0.05). (B) Western blots showing the expressionof immature erythroid cell surface markers, E-cadherin and endoglin, on the K562 transfectants (ANKH vs. neo controls).(C) Activation of the autocrine Epo–EpoR pathway in K562 ANKH transfectants. Expression of Epo in the transfectants (ANKH vs.neo controls) was assessed by RT–PCR. Expression of the Epo transcripts was normalized with G3DPH expression. Westernblots were used to compare the level of tyrosine phosphorylation (p-Tyr) of JAK2, EpoR, STAT5A and B in the transfectants.

4125E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 1 2 0 – 4 1 2 9

K562 neo vs. ANKH transfectants and detected 2-fold moreEpo transcripts in the ANKH transfectants (Fig. 3C). (2) It iswell established that Epo binding to its receptor induces theactivation of the receptor-associated JAK2 tyrosine kinaseand stimulates tyrosine phosphorylation of the receptor itselfand other proteins. Thus, we asked whether both JAK2 andEpoR were activated in the ANKH transfectants. We im-munoprecipitated either JAK2 or EpoR from ANKH vs. neotransfectant lysates and each immunoprecipitate (IP) wasdivided into two aliquots, ran on SDS–PAGE and transferredto two Western blots. One blot was probed with anti-p-Tyrwhile the other was probed with either anti-JAK2 or anti-EpoR. Though similar amounts of JAK2 and EpoR proteinswere present in both the neo and ANKH transfectants, both ofthem were much more highly tyrosine-phosphorylated (Fig.3C) in the ANKH transfectants compared to that of the neotransfectant control. (3) Epo is also well known to activateSTATs molecules [25]. Thus, we asked whether any STATproteins were activated in the K562 ANKH transfectants.Though both STAT5A and STAT5B proteins were similarlyexpressed in ANKH and neo transfectants, STAT5B proteinswere tyrosine-phosphorylated in ANKH but not in neotransfectants, while STAT5A proteins were not tyrosine-phosphorylated in both transfectants (Fig. 3C). Collectively,these data suggested that the autocrine Epo–EpoR signalingpathway was activated in the K562 ANKH transfectants,leading to the initiation of erythroid differentiation in thesetransfectant cells.

SHP-1 was downregulated in the K562 ANKH transfectants

SHP-1, a protein tyrosine phosphatase with two SH2 domains,has been shown to inhibit Epo-induced globin expression intwo erythroleukemic cell lines (SKT6 and J2E) [26,27]. Inaddition, SHP-1 is a negative regulator of EpoR signaling [28].We thus assessed the expression of SHP-1 in both K562 trans-fectants. As shown in Figs. 4A and B, both SHP-1 transcriptsand SHP-1 proteins were specifically downregulated in theK562 ANKH transfectants. Another phosphatase, SHP-2,however, was equally expressed in both K562 transfectants(neo and ANKH; Fig. 4B). Furthermore, this downregulation ofSHP-1 expression in K562 ANKH transfectants was lineage-specific as it was not observed in ANKH transfectants inHEK293 cells (Fig. 4C). As with SHP-1, SHP-2 was also equallyexpressed in both HEK293 transfectants.

ank/ank mice have lower serum Epo levels than the normallittermates

As the K562 ANKH transfectants had higher levels of Epotranscripts than the neo control transfectant, it is possible thatmicrocytosis in the ank/ank mice might be related to an ankeffect on Epo production. To test this hypothesis, wecompared the serum Epo levels in ank/ank mice vs. normallittermates. ank/ankmice had significantly less Epo in the sera(134.2 pg/ml±10; n=13) than the normal littermates (182.6 pg/ml±10; n=23; p-value=0.028; Table 3). As shown previously,

Fig. 4 – Expression of SHP-1 transcripts and SHP-1 proteins in K562 transfectants (A and B) and expression of SHP-1 proteinsin HEK293 transfectants (C). (A) SHP-1 transcripts were detected by RT–PCR. Three concentrations of the RT mix were usedfor amplification of SHP-1 transcripts to ensure linearity. After normalization with G3DPH expression, ANKH transfectants hadtwo-fold less SHP-1 transcript than that of the neo controls. (B) Western blot of SHP-1 and SHP-2 in K562 transfectants.(C) Western blot of SHP-1 and SHP-2 in HEK293 transfectants.

4126 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 1 2 0 – 4 1 2 9

ank/ankhad significantlymore RBC and thus had similar levelsof hematocrit and total hemoglobin as the normal littermates.As both Epo and IGF-1 stimulate erythroid colony-formingunits in themouse [29], and in adult mice IGF-1 stimulates redcell production [30], we asked whether IGF-1 might be thecompensatory factor in themutantmice.Wemeasured serumIGF-1 levels in the samples that we obtained Epo levels andfound that there was no significant difference in the serumIGF-1 levels in normal (571.43 ng/ml±37; n=23) vs. mutant(539.3 ng/ml±52; n=13) mice (Table 3).

Discussion

In this study, we showed that ank/ankmicewhich have a loss ofAnk function develop red cell microcytosis. Inflammation is apotential factor whichmight influence red cell size and number[31]. In the literature, both the presence of joint inflammation[32,33] and the lack of evidence of inflammation in the joints ofank/ank mice [34] were reported. In our colony of ank/ank mice,we observed synovial proliferation, increase of calcified matrix,joint narrowing and small calcific deposits (SupplementaryFig. 2, top right panel). There were no signs of inflammation inthe synovial lining (Supplementary Fig. 2,middle right panel) orin the joint cavity. In addition, none of themutantmice listed inTables 2 and 3 were severely ill or cachexic when they weresacrificed, though all of themshowed ankylosis. For this reason,our observedmildmicrocytosis in our colony of ank/ankmice islikely intrinsic to the Ank defect and is not a secondary con-sequence of inflammation.

It is likely thatmature erythrocytes do not express Ank.Wefound that there was no Ank transcripts in hemoglobinizing

erythroblasts and a recent publication on an in-depth analysisof the proteomeof red blood cells did not reveal the presence ofANKH (progressive ankylosis) protein [35]. Thus, it is unlikelythat microcytosis in these mutant mice was due to defectivePPi export in RBC. In view that our K562 ANKH transfectantshad higher levels of Epo transcripts than the neo controltransfectants, it is likely that microcytosis might be related toan Ank effect on Epo production. Indeed, we showed that ank/ank mice have significantly lower serum Epo levels thannormal mice, though it remains unclear the mechanism bywhich ANKH upregulates Epo expression in the K562 transfec-tants. We also observed an increase in red cell number in ank/ank mice. It is possible that in the mutant mice, the lower Hblevels in individual red cells led to an increase in red cellnumber as a compensatory process. As a result, with moreRBCs, even though Hb per RBC is lower, the overall Hb levels inthe ank/ank mice were similar to those of the normallittermates. In contrast to serum Epo levels, IGF-1 levels inank/ankmice were similar to that of normal mice. It is possiblethat IGF-1 in themutantmice stimulates slightlymore red cellproduction and thusmight be oneof the compensatory factors.However, we found no significant changes in the bonemarrowof these mutant mice. ank/ank bone marrow showed normalcellularity and normal morphology and histology. The ratio oferythroid lineage to granulocytic lineage was normal. Eryth-ropoiesis is morphologically normal in maturation (Supple-mentary Fig. 2). Althoughno gross abnormalitieswere found inank/ank bone marrow, it is difficult to make quantitativeassessments of erythropoiesis on bone marrow histology.Because of the variability of normal cellularity and lineagedistribution in bone marrows, a slight increase in erythroidproliferation may present with the normal marrow histology.

Table 3 – Serum erythropoietin (Epo) and insulin-likegrowth factor-1 (IGF-1) levels in ank/ank mice vs. normallittermates

Genotype Gender Mouse ID Age and stageof disease

(weeks/stage)

Epo IGF-1

+/+ M AI3 7/I 132 573AL1 12/II 232 381AU1 12/II 157 297BE2 12/II 193 522BF4 12/II 142 651BK3 13/II 142 490BK4 13/II 154 467BL5 13/II 189 486AJ2 14/II 216 467AO3 14/II 217 419AO4 14/II 172 539AM1 15/II 152 509AY1 20/III 230 438AW2 21/III 168 888

F AL2 12/II 136 597BB4 12/II 315 651BJ6 13/II 169 656BL9 13/II 291 716AX2 14/II 216 614AM2 15/II 167 1156AL5 16/II 137 536AL6 16/II 144 450AX3 21/III 128 640

n=23 Mean±SE 182.6±10.5

571.4±37.2

ank/ank M BH1 13/II 151 495BJ1 13/II 134 467BK2 13/II 135 434BL1 13/II 146 503AE3 21/III 212 669AW1 21/III 132 724

F BG3 13/II 190 680BI3 13/II 78 494BI5 13/II 123 430BL7 13/II 130 501W6 19/III 108 448W7 19/III 99 197AZ6 20/III 106 970

n=13 Mean±SE 134.2±10.0

539.3±51.7

Wilcoxon'sTest p-value

0.028⁎ 0.35

* denotes significant p-value (0.05).

4127E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 1 2 0 – 4 1 2 9

The mechanism of microcytic red cells leading to a compen-satory process and the degree of erythroid hyperplasia remainunclear.Alternatively, it ispossible that the increasedRBCcountsin the ank/ankmice is not due to increased red cells proliferation,but rather,mightbedue toan increasedhalf-lifeof thecirculatingRBCs. This is an area which warrants further investigation.

Epo is mainly synthesized in kidney and liver. We havesome preliminary real-time RT–PCR data showing that normalkidneys had 3- to 8-fold more Epo transcripts than those fromkidneys of ank/ank mice (3 normal and 3 mutant mice wereanalyzed). Thus, in addition to autocrine effects as predictedin the erythroid lineage, endocrine activation of target cells bylower levels of Epo could also be compromised in the ank/ankmice. It remains unclear whether lower Epo levels in the ank/

ank mice is mainly responsible for the lower MCV observed. Itwill be of interest to assess whether Epo injections can ame-liorate microcytosis in these mutant mice. As Epo also workssynergistically with SCF, GM-CSF and IL-3 [25], the levels ofthese cytokines should also be assessed in the ank/ank mice.

In human models, low MCV is mostly seen in cases withdefective Hb synthesis such as thalassemia [36] or defects iniron metabolism [37,38]. Microcytic RBC due to iron deficiencyis usually accompanied by anemia. However, ank/ank micehave normal overall Hb levels which argues against iron defi-ciency in these mutant mice. Nevertheless, analyses on thephysiological iron metabolism parameters and Hb biosynthe-sis in the ank/ank mice are required.

In this study, we have demonstrated a novel function ofANKH:promotionof early erythroiddifferentiation. In theK562neo transfectants, both Epo and EpoR were expressed, thoughthese cells did not undergo erythroid differentiation, presum-ably due to insufficient Epo expression and inhibition of Epoinduced erythroid differentiation by SHP-1, a protein tyrosinephosphatase. In the K562 ANKH transfectants, more Epotranscripts were detected and SHP-1 expression was downre-gulated, the latter was a lineage-specific event, as we did notfind downregulation of SHP-1 in HEK293 cells overexpressingANKH. Consequently, the autocrine Epo–EpoREpo–EpoR sig-naling pathway was activated (higher p-Tyr JAK2, p-Tyr EpoR,and p-Tyr STAT5Bwere found in theANKH transfectants). Themechanisms whereby ANKH upregulated Epo and downregu-lated SHP-1 expression respectively in K562 cells currentlyremain unclear. It is possible that SHP-1 expression wasdownregulated as a result of increased levels of Epo transcripts.SOCS3 has also been shown as a negative regulator of Eposignaling by binding to both the EpoR and the Epo-R associatedJAK2 [39]. However, unlike SHP-1, the level of SOCS3 transcriptswere similar in both K562 transfectants (neo and ANKH) [datanot shown], suggesting that in K562 cells, SHP-1 is the negativeregulator of Epo–EpoR signaling.

It is unclear why the K562 ANKH transfectants remained attheearly stages of erythroiddifferentiation (as evidencedby thehigh expression of two known markers of immature erythroidcells, E-cadherin, and endoglin). Hemin treatment resulted in afurther increase in α- and γ-globin expression in both transfec-tants, though more α-globin transcripts were detected in theuntreatedANKH transfectants. It is possible that ANKH failed tostimulate the expression of various differentiation factors,some of which are hemin-inducible, and thus spontaneousdevelopment to more mature erythroid stages was preventedin the ANKH transfectants. Alternatively, the production ofsome factors important for the more mature erythroid stageswere inhibited by the overexpression of ANKH inK562 cells.Wefavor the latter scenario as IL8 transcripts which wereupregulated by hemin treatment in K562 cells [20,40], wereless abundant in K562 ANKH transfectants (no hemin treat-ment) compared to that of the K562 neo controls [data notshown]. In view of the subtle erythroid abnormalities in theank/ank mouse, it is possible that minor erythroid abnorma-lities might be found in patients with ANKH mutations.

In summary, this study showed that Ank/ANKHplays a rolein red cell physiology. In addition to being a PPi transporter inother cell lineages, the Ank/ANKH protein has a novel functioninvolving the erythroid lineage; i.e. to promote early erythroid

4128 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 1 2 0 – 4 1 2 9

differentiation. Future efforts will be focused on examinationof committed erythropoietic precursors (BFU-E and CFU-E)from ank/ankmice, amore detailed analysis on themechanismof microcytosis and the compensatory process leading to anincrease in red cell number in these mutant mice.

Acknowledgments

Supported by grants from the Canadian Institutes of HealthResearch, and the Arthritis Center of Excellence.

We wish to thank Dr. JA Winkles (American Red Cross) forhis gift of anti-Ank antibodies, and Dr. R. Reithmeier (Univer-sity of Toronto) for helpful discussions on the RBC proteome.

We also thank Gordana Kuruzar for the technical help inthe collection of blood samples from the mice.

Appendix A. Supplementary data

Supplementary data associated with this article can be found,in the online version, at doi:10.1016/j.yexcr.2007.09.008.

R E F E R E N C E S

[1] A.M. Ho, M.D. Johnson, D.M. Kingsley, Role of the mouse ankgene in control of tissue calcification and arthritis, Science289 (2000) 265–270.

[2] H.E. Krug, M.L. Mahowald, H.C. Clark, Progressive ankylosis(ank/ank) in mice: an animal model of spondyloarthropathy:III. Proliferative spleen cell response to T cell mitogens, Clin.Exp. Immunol. 78 (1989) 97–101.

[3] K.A. Gurley, H. Chen, C. Guenther, E.T. Nguyen, R.B. Rountree,M. Schoor, D.M. Kingsley, Mineral formation in joints causedby complete or joint-specific loss of ANK function, J. BoneMiner. Res. 21 (2006) 1238–1247.

[4] K. Johnson, R. Terkeltaub, Upregulated ank expression inosteoarthritis can promote both chondrocyte MMP-13expression and calcification via chondrocyteextracellular PPi excess, OsteoArthr. Cartil. 12 (2004) 321–325.

[5] P. Nurnberg, H. Thiele, D. Chandler, W. Höhne, M.L.Cunningham, H. Ritter, G. Leschik, K. Uhlmann, C. Mischung,K. Harrop, J. Goldblatt, Z.U. Borochowitz, D. Kotzot, F.Westermann, S. Mundlos, H.-S. Braun, N. Laing, S. Tinschert,Heterozygous mutations in ANKH, the human ortholog ofthe mouse progressive ankylosis gene, result incraniometaphyseal dysplasia, Nat. Genet. 28 (2001)37–41.

[6] E. Reichenberger, V. Tiziani, S.Watanabe, L. Park, U. Yasuyoshi,C. Santanna, S.T. Baur, R. Shiang, D.K. Grange, P. Beighton, J.Gardner, H. Hamersma, S. Sellars, R. Ramesar, A.C. Lidral, A.Sommer, C.M. Raposo do Amaral, R.J. Gorlin, J.B. Mulliken, B.R.Olsen, Autosomal dominant craniometaphyseal dysplasia iscaused by mutations in the transmembrane protein ANK, Am.J. Hum. Genet. 68 (2001) 1321–1326.

[7] A. Pendleton, M.D. Johnson, A. Hughes, K.A. Gurley, A.H. Ho,M. Doherty, J. Dixey, P. Gillet, D. Loeuille, R. McGrath, A.Reginato, R. Shiang, G. Wright, P. Netter, C. Williams, D.M.Kingsley, Mutations in ANKH cause chondrocalcinosis, Am.J. Hum. Genet. 71 (2002) 933–940.

[8] C.J. Williams, Y. Zhang, A. Timms, G. Bonavita, F. Caeiro, J.Broxholme, J. Cuthbertson, Y. Jones, R. Marchegiani, A.Reginato, R.G.G. Russell, B.P. Wordsworth, A.J. Carr, M.A.

Brown, Autosomal dominant familial calcium pyrophosphatedihydrate deposition disease is caused by mutation in thetransmembrane protein ANKH, Am. J. Hum. Genet. 71 (2002)985–991.

[9] C.J. Williams, A. Pendleton, G. Bonavita, A.J. Reginato, A.E.Hughes, S. Peariso, M. Doherty, D.J. McCarty, L.M. Ryan,Mutations in the amino terminus of ANKH in two US familieswith calcium pyrophosphate dihydrate crystal depositiondisease, Arthritis Rheum. 48 (2003) 2627–2631.

[10] Y. Zhang, K. Johnson, R.G.G. Russell, B.P. Wordsworth, A.J.Carr, R.A. Terkeltaub, M.A. Brown, Association of sporadicchondrocalcinosis with a 4-basepair G-to-A transition in the5′-untranslated region of ANKH that promotes enhancedexpression of ANKH protein and excess generation ofextracellular inorganic pyrophosphate, Arthritis Rheum.52 (2005) 1110–1117.

[11] S. McKee, A. Pendleton, J. Dixey, M. Doherty, A. Hughes,Autosomal dominant early childhood seizures associatedwith chondrocalcinosis and a mutation in the ANKH gene,Epilepsia 45 (2004) 1258–1260.

[12] R.J. L.A.Gurley, D.M. Reimer, Biochemical and genetic analysisof ANK in arthritis and bone disease, Am. J. Hum. Genet.79 (2006) 1017–1029.

[13] Y. Guo, D.K.W. Hsu, S.-L. Feng, C.M. Richards, J.A. Winkles,Polypeptide growth factors and phorbol ester induceprogressive ankylosis (ank) gene expression in murine andhuman fibroblasts, J. Cell. Biochem. 84 (2002) 27–38.

[14] C.B. Lozzo, B.B. Lozzio, Human chronic myelogenousleukemia cell-line with positive Philadelphia chromosome,Blood 45 (1975) 321–334.

[15] H. Kamano, T. Tanaka, H. Ohnishi, Y. Kubota, K. Ikeda, J.Takahara, S. Irino, S. Ottalenghi, Effects of the antisense mybexpression on hemin- and erythropoietin-induced erythroiddifferentiation of K562 cells, Biochem. Mol. Biol. Int. 34 (1994)85–92.

[16] K. Takagaki, S. Katsuma, Y. Kaminishi, T. Horio, T. Tanaka, T.Ohgi, J. Yano, Role of Chk1 and Chk2 in Ara-C-induceddifferentiation of human leukemia K562 cells, Genes Cells10 (2005) 97–106.

[17] F. Billia, M. Barbara, J. McEwen, M. Trevisan, N.N. Iscove,Resolution of pluripotential intermediates in murinehematopoietic differentiation by global complementary DNAamplification from single cells: confirmation of assignmentsby expression profiling of cytokine receptor transcripts, Blood97 (2001) 2257–2268.

[18] T.D. Schmittgen, B.A. Zakrajsek, A.G. Mills, V. Gorn, M.J.Singer, M.W. Reed, Quantitative reversetranscription–polymerase chain reaction to study mRNAdecay: comparison of endpoint and real-time methods, Anal.Biochem. 285 (2000) 194–204.

[19] M. Yepes, E.Moore, S.A. Brown, H.N. Hanscom, E.P. Smith, D.A.Lawrence, Progressive ankylosis (Ank) protein is expressed byneurons and Ank immuno-histochemical reactivity isincreased by limbi seizures, Lab. Invest. 83 (2004) 1025–1032.

[20] L.T. Lam, C. Ronchini, J. Norton, A.J. Capobianco, E.H.Bresnick, Suppression of erythroid but not megakaryocyticdifferentiation of human K562 erythroleukemic cells bynotch-1, J. Biol. Chem. 275 (2000) 19676–19684.

[21] H.J. Buhring, T. Muller, R. Herbst, S. Cole, I. Rappold, W.Schuller, X. Zhu, U. Fritzsche, C. Faul, S. Armeanu, A. Ullrich,G. Klein, H. Schmidt, The adhesionmolecule E-cadherin and asurface antigen recognized by the antibody 9C4 areselectively expressed on erythroid cells of definedmaturational stages, Leukemia 10 (1996) 106–116.

[22] S. Armeanu, H.J. Buhring, M. Reuss-Borst, C.A. Muller, G.Klein, E-Cadherin is functionally involved in the maturationof the erythroid lineage, J. Cell Biol. 131 (1995) 243–249.

[23] H.J. Buhring, C.A. Muller, M. Letarte, A. Gougos, A. Saalmuller,A.J. van Agthoven, F.W. Busch, Endoglin is expressed on a

4129E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 1 2 0 – 4 1 2 9

subpopulation of immature erythroid cells of normal humanbone marrow, Leukemic 5 (1991) 841–847.

[24] T. Stopka, J.H. Zivny, P. Stopkova, J.F. Prchal, J.T. Prchal,Human hematopoietic progenitors express erythropoietin,Blood 15 (1998) 3766–3772.

[25] J.W. Fisher, Erythropoietin: physiology and pharmacologyupdate, Exp. Biol. Med. (Maywood) 228 (2004) 1–14.

[26] E.R. Sharlow, R. Pacifici, J. Crouse, C.J. Bata, K. Todokoro, D.M.Wojchowski, Hematopoietic cell phosphatase negativelyregulates erythropoietin-induced hemoglobinization inerythroleukemic SKT6 cells, Blood 90 (1997) 2175–2187.

[27] T. Bittorf, J. Seiler, Z. Zhang, R. Jaster, J. Brock, SHP1 proteintyrosine phosphatase negatively modulates erythroiddifferentiation and suppression of apoptosis in J2Eerythroleukemic cells, Biol. Chem. 380 (1999) 1201–1209.

[28] U. Klingmuller, U. Lorenz, L.C. Cantley, B.G. Neel, H.F. Lodish,Specific recruitment of SH-PTP1 to the erythropoietinreceptor causes inactivation of JAK2 and termination ofproliferative signals, Cell 80 (1995) 729–738.

[29] S.H. Boyer, T.R. Bishop, O.C. Rogers, A.N. Noyes, L.P. Frelin, S.Hobbs, Roles of erythropoietin, insulin-like growth factor 1,and unidentified serum factors in promoting maturation ofpurified murine erythroid colony-forming units, Blood80 (1992) 2503–2512.

[30] S. Halvorsen, A.G. Bechensteen, Physiology of erythropoietinduring mammalian development, Acta Paediatr., Suppl.91 (2002) 17–26.

[31] T. Houston, M. Moore, D. Porter, R. Sturrock, E. Fitzsimons,Abnormal haem biosynthesis in the chronic anaemia ofrheumatoid arthritis, Ann. Rheum. Dis. 53 (1994) 167–170.

[32] F.T. Hakim, R. Cranley, K.S. Brown, E.D. Eanes, L. Harne, J.J.Oppenheim, Hereditary joint disorder in progressive ankylosis

(ank/ank) mice: I. Association of calcium hydroxyapatitedeposition with inflammatory arthropathy, Arthritis Rheum.27 (1984) 1411–1420.

[33] M.L. Mahowald, H. Krug, P. Halverson, Progressive ankylosis(ank/ank) in mice: an animal model of spondyloarthropathy:II. Light and electron microscopic findings, J. Rheumatol.16 (1989) 60–66.

[34] H.O. Sweet, M.C. Green, Progressive ankylosis, a new skeletalmutation in the mouse, J. Heredity 72 (1981) 87–93.

[35] E.M. Pasini, M. Kirkegaard, P. Mortensen, H.U. Lutz, A.W.Thomas, M. Mann, In-depth analysis of the membrane andcytosolic proteome of red blood cells, Blood 108 (2006)791–801.

[36] S. Mach-Pascual, R. Darbellay, P.A. Pilotto, P. Beris,Investigation of microcytosis: a comprehensive approach,Eur. J. Haematol. 57 (1996) 54–61.

[37] B. Galy, D. Ferring, B. Minana, O. Bell, H.G. Janser, M.Muckenthaler, K. Schumann, M.W. Hentze, Altered body irondistribution and microcytosis in mice deficient in ironregulatory protein 2 (IRP2), Blood 106 (2005) 2580–2589.

[38] G. Weiss, L.T. Goodnough, Anemia of chronic disease.Anemia of chronic disease, N. Engl. J. Med. 352 (2005)1011–1023.

[39] A. Sasaki, H. Yasukawa, T. Shouda, T. Kitamura, T. Dikic, A.Yoshimura, CIS3/SOCS-3 suppresses erythropoietin (EPO)signaling by binding the EPO receptor and JAK2, J. Biol. Chem.275 (2000) 29338–29347.

[40] A. Sankar, M.A. Keller, K. Delgrosso, C.M. Ponte, R. Vadigepalli,G.E. Gonye, S. Surrey, Erythroid-induced commitment of K562cells results in clusters of differentially expressed genesenriched for specific transcription regulatory elements,Physiol. Genomics 19 (2004) 117–130.