May 2013 FBN

VirgniaFarm Bureau News May 2013

VaFarmBureau.org

Gleaning helps farms Gleaning helps farms

share their bountyshare their bounty

Departments14 Viewing Virginia

20 Home Checkup Checklist

24 Good for You!

26 Heart of the Home

30 Marketplace

Contents 16 Gleaned farm fields yield fresh foods for people in need As much as 96 billion pounds of food are wasted each year in the United States. But a gleaning organization and thousands of farmers are doing something about it.

5 Arson on Eastern Shore was troubling to farmers A series of deliberately set fires in Accomack County became a common topic of discussion on Virginia’s Eastern Shore. And Virginia Farm Bureau investigators were a common sight after members filed claims.

14 Virginia sets another record for agricultural exports Virginia exported a record $2.61 billion worth of agricultural products in 2012— 12 percent more than in 2011.

Virginia Farm Bureau News (USPS 017-763) (ISSN 1525-528X) is published six times a year, January, March, May, June, August, September/October (combined issue). It is published by Virginia Farm Bureau Federation, 12580 West Creek Parkway, Richmond, VA 23238. Periodicals postage rate is paid in Richmond, VA. The annual subscription rate is $1.42 (included in membership dues).

Postmaster: Please send changes of address to, Virginia Farm Bureau Federation, Farm Bureau News, P.O. Box 27552, Richmond, VA 23261-7552; fax 804-290-1096. Editorial and business offices are located at 12580 West Creek Parkway, Richmond, VA 23238. Telephone 804-290-1000, fax 804-290-1096. Email address is [email protected]. Office hours are 8 a.m. to 4:30 p.m., Monday through Friday.

Members — Address change? If your address or phone number has changed, or is about to change, contact your county Farm Bureau. They will update your membership and subscription information.

All advertising is accepted subject to the publisher’s approval. Advertisers must assume liability for the content of their advertising. The publisher maintains the right to cancel advertising for non-payment or reader complaints about services or products. The publisher assumes no liability for products or services advertised.

Member: Virginia Press Association

editorial teamGreg Hicks Vice President, Communications

Pam Wiley Managing Editor

Kathy Dixon Sr. Staff Writer/Photographer

Sara Owens Staff Writer/Photographer

Bill Altice Graphic Designer

Maria La Lima Graphic Designer

Cathy Vanderhoff Advertising

On the CoverFarm-fresh tomatoes are among the products gleaned from farms and distributed to food banks by volunteers from the Virginia-based Society of St. Andrew (Photo courtesy of Society of St. Andrew).

16

virginia farm bureau federationOfficers Wayne F. Pryor, PresidentScott E. Sink, Vice President

Board of Directorsdirector district countyEmily Edmondson 1 TazewellRichcard L. Sutherland 2 GraysonEvelyn H. Janney 3 FloydGordon R. Metz 4 HenryStephen L. Saufley 5 RockinghamPeter A. Truban 6 ShenandoahThomas E. Graves 7 OrangeH. Carl Tinder Sr. 8 AlbemarleHenry E. Wood Jr. 9 BuckinghamRobert J. Mills Jr. 10 PittsylvaniaJ. M. Jenkins Jr. 11 LunenburgW. Ellis Walton 12 MiddlesexM. L. Everett Jr. 13 SouthamptonDavid L. Hickman 14 AccomackJanice R. Burton * HalifaxNathan A. Aker ** Wythe

*Women’s Committee Chairman**Young Farmers Committee Chairman

VirgniaFarm Bureau News

Volume 72, Number 3 May 2013

16

5

14

publication scheduleProducer members will receive their next issue of Virginia Farm Bureau News in June. The magazine is published six times a year.

VirginiaFarmBureau.com may 2013 3

Virginia Farm Bureau Federation has voiced approval of property rights bills that were successful in this year’s Virginia General Assembly. All three will take effect July 1.

“Our producer members have their livelihoods tied to their land and take particular interest in legislation that affects landowner rights,” said Trey Davis, VFBF assistant director of governmental relations. “Farm Bureau supported several property rights bills, and we are pleased that state legislators saw them as valuable protections of landowners’ rights.”

HB 2306, introduced by Del. David I. Ramadan, R-Prince William, provides that just compensation paid for property taken using eminent domain shall not be less than the property’s fair market value appraisal, if an appraisal is required, or the current assessed value for real estate tax purposes when the entire assessed parcel is being acquired, whichever is greater.

HB 2004, introduced by Del. Benjamin L. Cline, R-Amherst, provides that an owner of real private property owes no duty of care to a trespasser except in a few specific circumstances.

“At this time, landowners owe no duty of care to trespassers in the vast majority of situations where a trespasser comes onto their property,” Davis said. “This bill locks in those protections. Farmers should not have to be worried about being sued by individuals who knowingly trespass on their property.”

HB 1481, introduced by Del. Donald W. Merricks, R-Chatham, is intended to deter theft of scrap metal. Such thefts have been problematic in Virginia farming communities.

The bill provides that any person or business that purchases more than $20,000 worth of scrap metal in a 12-month period take and maintain for 30 days an image of any proprietary articles purchased. It also requires a purchaser to submit to local law

Farm Bureau applauds successful property rights bills

enforcement upon request a report of all purchases of certain items.

Overall, “we were able to prevail on 46 out of 49 policy issues,” said Martha Moore, VFBF vice president of governmental relations. “Some of those issues had the potential to provoke emotional responses and the potential to become very divisive, and I want to commend our members on their ability to stick to the facts in their communications with legislators.”

Farm Bureau supported the decisions of the state legislators to do the following:

• return authority to the Virginia Board of Soil and Water Conservation to administer the state’s nutrient management certification program, adopt regulations on nitrogen application rates and allocate general fund monies to soil and water conservation districts;

• maintain the administration of soil and water conservation district operations and programs at the Department of Conservation and Recreation;

• continue Virginia’s moratorium on the mining and milling of uranium;

• prohibit the use of tolls to Interstate 95 south of Fredericksburg;

• continue the peanut excise tax that the industry utilizes for research, education and promotion; and

• stop efforts to reinstate Virginia’s estate tax.

State budget includes funds to address wildlife damage on farms

The Virginia General Assembly adjourned Feb. 23 with an amended budget that included funding for an additional staff person to assist farmers with wildlife damage to crops and livestock.

Gov. Bob McDonnell added $72,525 to the budget to provide for another wildlife damage specialist who will provide direct assistance to producers through the U.S. Department of Wildlife Services to deal with nuisance species such as coyotes.

“Virginia’s coyote population has been on the rise for at least a decade,” said Martha Moore, VFBF vice president of governmental relations. “And that’s evidenced by the number of sheep and cattle killed on the state’s farms. Farm Bureau is pleased to see support for providing expanded assistance to farmers who want to protect their herds from coyotes.”

Legislators went a step further and provided $125,000 to Virginia State University for a Virginia Cooperative Extension wildlife specialist position. Those funds would match a grant from the state Department of Game and Inland Fisheries to also develop a call center for wildlife damage issues.

Farm Bureau also supported the following budget items:

• $125,000 restored to the Beehive Grant Program for the first year of the biennium;

• $200,000 restored—from the $400,000 previously cut—to the Office of Farmland Preservation for use in matching grants available for localities’ purchase of development rights;

• $300,000 for soil and water conservation districts’ operational funding assistance; and

• authorization for Virginia Tech to begin the final detailed planning for replacement dairy and livestock multi-use research facilities at Kentland Farm. The projects will be funded by bonds once the detailed planning is finalized.

‘Some of those issues had the potential to provoke emotional responses and the potential to become very divisive, and I want to commend our members on their ability to stick to the facts in their communications with legislators.’

>> Martha Moore VFBF vice president of

governmental relations

4 Virginia Farm Bureau News VaFarmBureau.org

Tran

spor

tati

on

Regu

lati

ons,

wat

er q

ualit

y, B

MPs

Inte

rnal

Com

mod

itie

s

Gam

e la

ws

Loca

l iss

ues

SCC

and

pub

lic u

tilit

ies

VDAC

S

Fed

eral

farm

pro

gram

Judi

cial

sys

tem

Pri

vate

pro

pert

y ri

ghts

Ani

mal

car

e an

d hu

sban

dry

Righ

t to

farm

Virg

inia

Tec

h an

d VS

U

Bal

anci

ng g

over

nmen

t bud

get

Labo

r is

sues

0

5

10

15

20

25

30

Additional issues discussed include ag education, taxes, organic fertilizers, renewable energy, direct sales, mandated programs, mining, and nontidal wetlands.

Frequently surfaced issues at spring policy development meetings

Nearly 350 county Farm Bureau leaders representing 79 county Farm Bureaus in Virginia attended regional policy development meetings between late February and late March.

Meeting participants discussed issues they believe should be monitored and addressed by Virginia Farm Bureau Federation. County Farm Bureaus will continue to develop VFBF policy recommendations through the fall.

The VFBF Legislative Committee will recommend long-term priority issues and long-term focus areas this spring and recommend short-term priority issues this fall. Those recommendations are subject to approval by the VFBF board in October.

The VFBF Resolutions Committee will meet to discuss and vote on proposed resolutions in early November, and county Farm Bureau delegates will discuss and vote on resolutions at the VFBF Annual Convention in early December.

Numerous issues discussed at policy meetings

The Virginia Farm Bureau Federation entered into an agreement March 14 to assume full ownership of the State Fair of Virginia and The Meadow Event Park from Universal Fairs LLC of Cordova, Tenn.

Farm Bureau, which had been a 50 percent owner since last July, entered into an agreement on the remaining 50 percent and will continue to operate the State Fair and other events on the historic 331-acre property in Caroline County.

This year’s fair will run from Sept. 27 to Oct. 6.

“This is a very proud day for Virginia Farm Bureau,” noted VFBF President Wayne F. Pryor. “Universal Fairs was a great partner for the first year, and the two groups were able to work together to continue uninterrupted operation of the State Fair after it had gone into bankruptcy just months earlier.

“And we part ways amicably,” he added. “Farm Bureau’s mission is to preserve, protect and promote agriculture, and help it prosper. We’ve realized there’s no better way to showcase this great industry than through the State Fair. Universal Fairs operates events across the country and did a great job in Virginia. They agreed to allow us to take full ownership so they could better focus on their many other events nationwide.

“We learned a lot and gained tremendous insight into how to operate a fair during 2012. Now, the pressure is fully on our shoulders,” Pryor said. “But we plan to expand and improve this wonderful event beginning this year and well into the future.

“We plan to carry this out through teaching exhibits, shows and competitive events that include livestock, dairy, equine, sheep and goats and much more. We also plan to continue the Skills USA competitions, as well as competitions for photography and arts and crafts and the ever-popular Educational Expo,” which hosts 14,000 schoolchildren who participate in a Standards of Learning-based program and tour.

Virginia Farm Bureau Federation acquires full ownership of State Fair of Virginia

ARSON ON EASTERN SHORE WAS TROUBLING TO PRODUCER MEMBERS

courtesy of virginia state police

BY SARA OWENS

A series of deliberately set fires in Accomack County are among incidents under study by Virginia Farm Bureau’s investigations staff. This unoccupied house burned on Dec. 20, 2012.


by sara owens

V irginia Farm Bureau’s Investigations Department was actively working with the Virginia State Police in

their investigation of more than 75 arson incidents in Accomack County. At least five Farm Bureau members were affected by the fires.

The first fires took place in November 2012. Farm-use buildings, abandoned houses, storage sheds, homes that were for sale or rent, and a former restaurant and motel were burned. On April 2, state police arrested Charles. R. Smith and Tonya S. Bundick, both of Accomack, who they believe are responsible for the majority of the fires.

“This is one of the largest serial arson cases we’ve seen in Virginia in many years,” said Frank Dunton, Farm Bureau vice president of investigations. “Thankfully no one was injured inside the buildings during the arsons, but it is still devastating to see something you owned, whether it was a building, shed, house or equipment, go up in flames.”

Lynn P. Gayle, president of Accomack County Farm Bureau, had three separate buildings burned—a barn, a storage shed and a farm labor house. The first fire occurred on Nov. 15, the second on Dec. 24 and the third on Feb. 2.

He said the arsons quickly became an everyday topic of discussion.

“Everywhere you go someone is

talking about it,” Gayle said earlier this year. “Many people in the community know I was victimized. After the fire on Christmas Eve, people were riding around and checking it out. It was a two-story barn, and it was just vaporized. There was absolutely nothing left except the metal roof.”

Gayle said the storage shed can be patched but the other two buildings were total losses.

“I was in the process of renting the labor house to someone else in the area for their use.”

Gayle had lights and a radio on in the house and a car parked in front of it to give the illusion that someone was living there.

“Farm Bureau has been very helpful with my claims,” he said. “I’m glad Farm Bureau investigators have been checking things out and helping with the cases. They’ve taken quick action to resolve any issues, which is a good thing because not all insurance companies do that.”

After many claims, Investigations Department is on the case

With nearly 90 years of investigation experience, Farm Bureau’s investigators work more than 1,000 cases each year.

“Every case we investigate is to help keep policyholders’ premiums down. If we’re paying money out on fraudulent claims, it can make the rates go up and

we’re all paying for the crime,” said Frank Dunton, vice president of Investigations.

The Investigations Department works a variety of cases from questionable documents, embezzlement and burglaries to arson, explosions and auto fraud.

“It’s our job to make sure our members’ claims are handled quickly and notify the Virginia State Police with any leads we may develop, and in the case of the arsons, any information on who could have burned our members’ property,” Dunton said. “We assist the police to determine the origin of fires and help collect evidence. We work our case parallel with law enforcement.”

Farm Bureau’s investigations staff have a good relationship with law enforcement because they are all certified fire investigators, Dunton said.

“We assist them and they assist us.”Robert F. Barnes Jr., a special agent

for the Virginia State Police’s Bureau of Criminal Investigation, said he and other agents are usually on the scene within 24 hours of a suspicious fire, sometimes sooner, so they’re able to share photos and other details with insurance investigators.

“We have the initial information that the investigator may not have because they couldn’t get to the scene as quickly as we can,” Barnes said. “For example we can show the investigator what was there before the fire and help them work the case. We work hand in hand and help each other. Often we can obtain additional

sara

ow

ens

The Dec. 20 fire in Accomack was one of more than 70 suspicious fires that occurred in the county between November 2012 and April 2.


information from the investigator after they’ve talked to their policyholders, and we share information back and forth, even if we’re in on a case for different reasons.”

Glenn Neal, another special agent with the Bureau of Criminal Investigation, said it is easy to see that Farm Bureau is invested in cases and helping their members.

“I personally see Virginia Farm Bureau’s investigators on the scene, working the case, gathering their own evidence and doing their own interviews,” Neal said. “We get calls from other insurance investigators, but we really only see Farm Bureau’s investigators on the scene. Most just want basic information and don’t investigate the case like Farm Bureau does. It really makes a difference to have their investigation unit assist us.”

In addition to working with the state police, Farm Bureau’s investigators have many contacts with local fire, police and sheriffs’ offices and other federal and state agencies.

“Having these contacts helps us work cases more efficiently and thoroughly, and it’s a win-win for our members,” Dunton said.

If you’ve been a victim of theft or fraud, Virginia Farm Bureau Investigations can help. Call 800-277-8323, and ask for Investigations.

FRAUD HOTLINE

Top three types of investigation cases at Farm Bureau:

1. Insurance fraud—a claim that has been over-exaggerated or is false

2. Theft, often of copper, guns, electronics and jewelry

3. Fire—incendiary, of unknown cause or due to product failures

sara

ow

ens

“It’s our job to make sure our members’ claims are handled quickly and notify the Virginia State Police with any leads we may develop on who could have burned our members’ property,” said Frank Dunton (left photo, center), Virginia Farm Bureau vice president of investigations.

cou

rtes

y o

f vi

rgin

ia s

tate

po

lice


» YOUNG FARMERS WINTER EXPO «

Young Farmers Summer Expo set for August in Wytheville

The Virginia Farm Bureau Federation Young Farmers Summer Expo will take place August 2-4 in Wytheville. It is open to anyone ages 18 to 35 and is geared to people who support agriculture through production, education, promotion and leadership. Anyone with an interest in agriculture is encouraged to attend.

More than 180 participants turned out for the 2012 Summer Expo, held in Lynchburg.

The expo also will include the Outstanding Young Agriculturalist Award finals, Outstanding Young Farm Employee Award finals, Excellence in Agriculture Award finals and annual Young Farmers Discussion Meet semifinals.

Registration includes all program events and most meals. Participants are required to make and pay for their hotel arrangements and any optional tours.

The final agenda and registration information should be available this month. For updated information, visit VaFarmBureau.org or VAFBYoungFarmers.com, email [email protected] or call 804-290-1032.


By Kathy Dixon

Two months after graduating from college, Virginia Commissioner of Agriculture and Consumer Services Matt Lohr got a call from Rockingham County Farm Bureau’s secretary.

She asked Lohr to chair a Young Farmers Committee. He inquired how many people were on the committee, and she said that as soon as he said ‘Yes,’ there would be one.

“True story,” Lohr said with a laugh as he told the tale Feb. 23 to those attending the 2013 Virginia Farm Bureau Federation Young Farmers Winter Expo in Harrisonburg. “I can trace everything I’ve done in my career back to that phone call from Charlotte.”

Lohr later served on the VFBF Young Farmers Committee with his late wife, Andrea, and the couple were the first winners of the American Farm Bureau Federation’s Young Farmer & Ranchers Excellence in Agriculture Award. He held elected offices in Rockingham County and then represented the Virginia House of Delegates 26th District in the state legislature for five years before being named agriculture commissioner in 2010.

Lohr told the young farmers they should constantly be on the lookout for opportunities to promote agriculture, which is Virginia’s largest industry.

He explained that 96 percent of the world’s population lives outside the United States, and that global population is expected to reach 9 billion by 2050. “As young farmers, the opportunities are endless to produce and market your products to the rest of the world,” he said.

He also advised the young farmers to be proactive and take a stand for agriculture. “I challenge you that if you’re asked to run for a public office that you take the opportunity to make a difference.”

Part of educating Americans about agriculture is understanding the message that’s being delivered to consumers. That’s why many participants attend the annual conference—to increase their knowledge of the agriculture industry and to get ideas from their peers.

This year, their event’s varied agenda included a history lesson about Cyrus McCormick’s reaper, as well as high-tech fertilizer application using GPS. Expo participants toured the Shenandoah Valley Agriculture Research & Extension Center, built on McCormick’s farm. Today, researchers there are partners in the Pasture Based Beef Systems for Appalachia project, which studies the effect of various forage systems on cattle.

At Houff ’s Feed and Fertilizer, the young farmers learned how the business has diversified to include biosolids, fertilizer, seeds and transportation products. Farms that utilize the company’s fertilizer service are categorized by GPS, and the information allows a computer to determine exactly which and how much fertilizer is needed for application on each field on a property.

“This is the cutting edge of fertilizer application technology,” fertilizer plant manager Duane Harlow told the young farmers on that tour.

Expo attendees also learned about preventing soil erosion during a demonstration from Chris Lawrence of the U.S. Department of Agriculture’s Natural Resources and Conservation Services. “When you stop erosion, you’re opening the door to building or rebuilding your soil,” Lawrence explained.

Information also was shared about Virginia’s Beginning Farmer & Rancher Coalition, which helps beginning farmers establish their operations. Farm Bureau is a member of the coalition.

Involvement can be a stepping stone, Young Farmers told


Involvement can be a stepping stone, Young Farmers told

T

Young Farmers Winter Expo participants learned about cattle forage research at the Shenandoah Valley Agricultural Research and Extension Center.

pho

tos

kath

y d

ixo

n


Documentary about young American farmers plannedOscar-winning and two-time Emmy-winning filmmaker James Moll has announced plans

to produce a feature-length documentary about the next generation of American farmers and ranchers.

The yet-to-be-titled documentary will profile farmers and ranchers in their 20s, all of whom have assumed the generational responsibility of running the family business.

Made in cooperation with the U.S. Farmers & Ranchers Alliance, the film will give us an up close and personal look at some of the young farmers and ranchers who grow and raise the food Americans consume daily—and a look into the latest practices of modern agriculture.

Virginia Farm Bureau Federation is a USFRA member.


Discussion Meet gives participants a different view of Farm Bureau, agriculture

The Young Farmers Discussion Meet competition takes place every year, beginning at the Young Farmers Summer Expo.

The competition is designed to build members’ ability to analyze agricultural issues and decide on solutions that best meet their collective needs. The Discussion Meet is not a debate. Instead, it emphasizes active participation from each person involved.

Participants are judged on their ability to listen, share insights, offer constructive criticism and lead the group toward consensus on agricultural issues. Discussion topics are determined each year by the American Farm Bureau Federation.

To enter the Discussion Meet, contact Ron Saacke at 804-290-1032 or [email protected]. He will provide participants with resource materials for competition.

The competition is open to Farm Bureau members between the ages of 18 and 35. Semifinals will be held Aug. 3 at the Young Farmers Summer Expo in Wytheville. All cash prizes and incentives for competing at the Summer Expo are sponsored by the Virginia Farm Bureau GM Discount Program.

The final round will be held in December at the VFBF Annual Convention in Richmond. The state-level winner will receive a John Deere Gator utility vehicle and an expense-paid trip to the 2014 American Farm Bureau Federation Annual Convention in San Antonio. The first runner-up also will receive a travel package to the AFBF convention.

National competitionThe AFBF Young Farmers & Ranchers

Discussion Meet winner will receive a choice of either a 2014 Chevrolet Silverado or 2014 GMC Sierra, courtesy of GM, as well as an expense-paid trip to the 2014 AFBF Young Farmers & Ranchers Leadership Conference.

Three runners-up will receive a Case IH Farmall 55A, courtesy of Case IH, a Stihl Farm Boss, courtesy of Stihl, and $2,500.

Matt Lohr, Virginia’s commissioner of agriculture and consumer services, spoke at the Expo. Tours during the event included the McCormick gristmill (left) at the Shenandoah Valley AREC and Houff’s Feed & Fertilizer in Augusta County.


Participants of the Virginia Farm Bureau Federation Women’s Conference March 22-24 in Roanoke were encouraged to ‘get connected’

and ‘get moving’ in support of agriculture and their own well-being.

More than 300 participants attended workshops on how to better engage with consumers about agriculture and how to live a healthier and happier life.

In “U.S. Farmers & Ranchers Alliance: Getting the Conversation Started,” workshop attendees learned more about USFRA, which was created by farmers and agricultural groups in 2011 to spearhead a national dialogue between consumers and producers.

“USFRA has gone where no other agricultural group has gone,” said speaker Kathy Dixon, who works for the Virginia Farm Bureau Federation—a member of USFRA. “The group has attracted more than 1 million visitors to its website, and USFRA’s Facebook page has gotten 198,000 ‘likes.’

“But what’s even more encouraging is the amount of engagement that is happening on those sites. People are engaging in conversations, and non-farmers are learning about agriculture from actual farmers who are taking the time to tell consumers about their industry.”

In addition to the online engagement, USFRA has partnered with Anderson Cooper Live to televise audience members visiting farms and reporting on their experiences. The group also has been mentioned in tweets by celebrity chefs, CNN’s food blog, SELF magazine and an Emmy Award-winning filmmaker. Additionally, USFRA’s town hall meetings called “Food Dialogues” have received coverage in Newsweek and The New York Times and on National Public Radio.

“I think it’s pretty exciting that USFRA and farmers are getting their name out there,” Dixon said. “We want to make farmers the accepted resources on all

Women’s Conference participants encouraged to

‘Get Connected—Get Moving’things agriculture so that consumers are getting accurate information about our industry.”

Dixon encouraged workshop attendees to have conversations using E.A.S.E.:• Engage consumers in

conversations about agriculture.

• Acknowledge that consumers are concerned about their food supply.

• Share your experiences on the farm.

• Earn trust.

In “A Happier, Healthier You,” Dr. Megan Seibel, a registered nurse and faculty member in Virginia Tech’s College of Agriculture and Life Sciences, and Jennifer Helms, a doctoral candidate in agricultural and extension education at Virginia Tech, shared information on how to find balance and focus when it comes to food and fitness.

“In our society, food is central to our activities and associations with others and is directly linked to how we feel and function,” Seibel said. “Words like ‘diet’ are temporal. Being nourished is about life and longevity and fellowship and fulfillment. There are ways to accomplish this even in our very busy routines, and our families will thank us for it.”

Seibel and Helms discussed mindful eating, which is paying attention to hunger cues, fullness and making pleasurable and nutritious food choices based on taste and hunger instead of eating out of boredom or distraction or to regulate emotions.

“Food cravings can happen in seconds and can be powerful. It seems no matter how committed we are to healthy and mindful eating, we can easily slip back into old eating patterns,” Seibel said. “It

is important that we eat to feel nourished. It is more about how food choices make us feel and where and with whom we find fellowship in food.”

Helms and Seibel suggested adding foods such as green tea, avocados, apples, baby portabella mushrooms and beans to a healthy diet to pack a bigger nutritional punch.

They also shared the following tips for creating a healthier lifestyle:• Avoid high sugar in foods if you are

overweight.

• Add flax seed oil to your diet. It’s a known cancer fighter that can decrease arthritic pain and lower cholesterol.

• Avoid carbohydrates after lunchtime.

• Eat Omega-3 fats to lower bad cholesterol, blood pressure, triglycerides and blood sugar levels and raise good cholesterol.

• Consume 50 percent of your daily calories during breakfast.

• Drink green tea to lower body fat, fight viruses and prevent cancer.

• Avoid orange juice and other fruit juices, as they increase triglycerides and blood sugar.

—2013 Women’s Conference—


Waddle and her husband, Wayne, operate an 800-head purebred Angus cow-calf operation in Chilhowie. She has worked full time on the farm for 37 years.

“After my first son was born and my husband’s job required him to be away from home a lot, I decided to stay home and run what was then our 100-head commercial cow-calf operation,” Waddle said.

Her duties on the farm include feeding the cattle; operating farm machinery; making hay; building fences; vaccinating cattle and monitoring the herd’s medical health; and keeping records. She also assists with the family’s fencing business.

Waddle serves on the Smyth-Washington Farm Service Agency board and is an active member of the Southwest Angus Association, Abingdon Feeder Cattle Association, Smyth County Farm Management Club and Smyth County Farm Bureau Women’s Committee.

She received $500 from the Virginia Farm Bureau Mutual Insurance Co.

Louisa woman named Farm Bureau Ambassador

Whitney Perkins of Louisa County was named the 2013 Virginia Farm Bureau Ambassador on March 23.

Perkins will receive a $3,000 scholarship from Virginia Farm Bureau Federation and the VFBF Women’s Committee. She will make public appearances and serve as an advocate for agriculture and Farm Bureau.

Perkins said she plans to “speak loud and proud about the accomplishments of the industry.”

The past state FFA officer said it’s important to reach out to elementary school students and she will work with Virginia’s Agriculture in the Classroom program to help do that.

“Together we can feed the young minds of the children of this commonwealth,” she said.

Perkins grew up on a beef cattle farm where her responsibilities included feeding and watering animals; bottle-feeding and caring for calves; and working in the family garden. She attends Virginia Tech, where she is majoring in agricultural sciences with

Seibel noted that fitness is not only physical, but emotional, intellectual and spiritual. A healthy lifestyle, she said, contributes to a happy lifestyle.

“It is about finding balance. You can’t deprive yourself, and you can’t overindulge with food or anything else in life. Talk about diet and exercise decisions with your family, your friends, your children and your healthcare provider in order to have the support you need.”

Women raise more than $38,000 for Agriculture in the Classroom

Virginia’s Agriculture in the Classroom program received generous support from Virginia Farm Bureau Federation Women’s Program participants at the 2013 Women’s Conference.

A total of $38,365 was raised for AITC during the conference. Two auctions and a raffle raised $6,265, and county Farm Bureau women’s committees donated $32,100.

“We are so thankful for county Farm Bureau women’s committees,” said Tammy Maxey, AITC senior education programmer. “They are by far our biggest supporters, and we couldn’t do what we do without their support.”

Surge in female farmers changing face of U.S. agriculture

According to the 2007 U.S. Census of Agriculture, the most recent census for which findings have been released, female farm operators increased 19 percent from 2002, outpacing the 7 percent increase in the number of farmers overall.

Women were found to be principal operators of 14 percent of U.S. farms and ranches, compared to 11 percent in 2002.

Smyth County producer named Farm Woman of the Year

Donna Waddle of Smyth County was named Virginia Farm Bureau Federation’s 2013 Farm Woman of the Year March 23 during the Women’s Conference.

Judging for the designation is based on participants’ contributions to family, home, farm business, community and Farm Bureau.


Darlene Parnell (left), Robin Tudor (center) and Debbie Dianis of the Greensville County Farm Bureau Women’s Committee were among the most dramatically dressed Women’s Conference participants. A color was assigned to each district, and some conference-goers made the most of it.

pho

tos

kath

y d

ixo

n


“

minors in animal and poultry sciences, as well as in leadership and social change. She aspires to become an agriculture educator upon graduation.

Runner-up Lacey Koontz of Rockingham County received $500 from the VFBF Women’s Committee.

County committees honored with Outstanding Women’s Activity Awards

Virginia Farm Bureau Federation Women’s Program participants were recognized for community outreach programs and for educating Virginians about agriculture during the Women’s Conference.

Winners of the district and state Outstanding Women’s Activity Awards were announced, along with the winner of the Chairman’s Award for the most-improved committee.

The awards recognize excellence among activities that promote agriculture, educate communities on the importance of the industry and recruit new committee members.

Eastern District – state winnerThe Essex County Women’s Committee

put together a scavenger hunt called “Pick the Good Stuff at the Tappahannock Farmers’ Market.” Participants were encouraged to find all the products on a list by visiting market vendors’ booths.

Capital DistrictThe Powhatan County Women’s

Committee created a farm-related summer reading program for fourth graders and their parents. Students read agriculture-related books and were able to tour farms in the county.

Central DistrictThe Fluvanna County Women’s

Committee held a “Farm Woman’s Night Out!” event to promote agriculture and allow women in the county to enjoy speakers and discuss farm-related topics.

Midwest DistrictThe Floyd County Women’s Committee

conducted their 11th annual Agriculture & Natural Resources Field Day for the county’s third graders.

Northern DistrictThe Shenandoah County Women’s

Committee provided agriculture-themed children’s books and activities at the

Woodstock Farmers’ Market each Saturday during the summer.

Southwest DistrictThe Southampton County Women’s

Committee held an estate planning workshop to build awareness of the importance of estate planning and helping preserve family farms.

Southside DistrictThe Lunenburg County Women’s

Committee partnered with Virginia Cooperative Extension in an agriculture literacy summer program to help participants gain a better understanding of how their food is produced.

Valley District The Botetourt County Women’s

Committee taught consumers how to grow their own produce through a program called “Planting the Seed.”

Chairman’s AwardThe Lee County Women’s Committee

purchased a one-hour weekly radio time slot to help share information about agriculture issues via a program called Getting Out the Word by Radio.


‘We are so thankful for county Farm Bureau women’s committees. They are by far our biggest supporters, and we couldn’t do what we do without their support.’

>> Tammy Maxey AITC senior education programmer

Shirley Pratt (left) and Bobbie Harden of the Smyth County Farm Bureau Women’s Committee checked out auction items that helped raise more than $6,000 for Agriculture in the Classroom.


Viewing Virginia

Farm exports ‘front and center’ as global market expandsBy Kathy Dixon

U.S. farmers will need to pay more attention to overseas markets in the coming years, speakers at a recent agricultural trade conference said.

According to projections, 80 percent of the world’s purchasing power will come from outside the United States, “so we either focus on future growth in the world economy or we don’t,” said New Zealand Ambassador Mike Moore March 7 at Virginia’s fifth annual Governor’s Conference on Agricultural Trade.

Moore said agricultural producers need to expand their markets out into the world. If the Trans-Pacific Partnership, or TPP, is passed, it will help them by eliminating tariffs on agricultural goods.

“Agriculture will be front and center of these negotiations,” said Ambassador Islam Siddiqui, chief agriculture negotiator for the Office of the U.S. Trade Representative. “President Obama has said that the TPP is a top trade priority.”

The TPP seeks to increase exports to a region that represents more than 40 percent of global trade. The United States is negotiating the TPP with Australia, Brunei, Canada, Chile, Malaysia, Mexico, New Zealand, Peru, Singapore and Vietnam.

As a group, the TPP countries are the United States’ largest goods and services export market. U.S. goods exports to the broader Asia-Pacific region totaled $895 billion in 2011, representing 60 percent

of total U.S. goods exports. U.S. exports of agricultural products to the region totaled $98 billion in 2011, which was 72 percent of total U.S. agricultural exports.

Virginia agricultural exports are an important contributor to that amount. The state’s agriculture and forestry industry set another record in 2012 with $2.61 billion in exports, Gov. Bob McDonnell announced at the trade conference. That’s a 12 percent increase over the previous record of $2.35 billion in 2011.

“Virginia is well-situated for continued exponential growth in agricultural exports,” McDonnell said. “Negotiating the TPP will help level the playing field.”

Panama Canal expansion significant for state

Virginia farmers also stand to benefit from a current expansion of the Panama Canal.

“We are keenly interested in the Panama Canal expansion,” said Rodney Oliver, interim executive director of the Virginia Port Authority, who also spoke at the conference. The port authority operates six terminals, including Norfolk’s Port of Virginia, the nation’s fifth-largest and the East Coast’s third-largest container port.

“We have lots of optimism for the Port of Virginia because of the Panama Canal expansion,” Oliver said.

The expansion is expected to be finishedin May 2015. The canal will go from handling ships loaded 13 containers wide to accommodating those that are loaded 18 wide. Additionally, its depth will increase to nearly 50 feet.

The Port of Virginia is the only East Coast port that can handle ships built for water that deep, Oliver said.

Expansion of the Panama Canal, scheduled for completion in 2015, is expected to benefit the Port of Virginia.


Viewing Virginia

Producers network, share experience at local foods conference

More than 140 producers who sell food in their communities participated in the second annual Local Foods Network Conference, held in February at Virginia Farm Bureau’s headquarters in Goochland County. The event theme was “Building Your Business Safely.”

Matt Lohr, Virginia’s commissioner of agriculture and consumer services, noted in his welcoming remarks the growing numbers of young adults, retirees from other professions and veterans who are starting to farm. “The changing dynamics of this industry are exciting, because we’re attracting so many new faces,” he said.

Commitment to food safety means “you really have to step up”

Meat, dairy, poultry and egg producers addressed a variety of topics and issues in a panel discussion, from product traceback, meat transportation and where to go for kosher processing to a start-up question prefaced with “I started raising chickens as a hobby, and it’s gotten out of control.”

Panelist David Fitzgerald, who began raising honeybees and poultry in Goochland County after retiring from a career in law enforcement, said quality and safety are paramount for successful direct marketing. He noted that his own family gets their meals from the same freezer in which he stores meat he sells.

“If I wouldn’t give it to them, I wouldn’t sell it to you,” he said.

(continued on page 23)

Virginia Farm Bureau Federation has announced the purchase of the Virginia Equine Extravaganza, a major horse industry exposition for the Mid-Atlantic region.

The new permanent location for the three-day equestrian trade show will be The Meadow Event Park in Caroline County, the birthplace of Secretariat. The dates for this year’s show are November 1-3.

Farm Bureau recently entered into an agreement to assume full ownership of The Meadow Event Park. Jeff Dillon, VFBF treasurer and senior vice president of finance & business services, said the organization recognizes “the tremendous potential of The Meadow to become a major equine events facility for this region. Our purchase of the Equine Extravaganza is a big step in that direction, and we intend to create a fitting home for the Extravaganza and other events of its caliber.

“We are pleased to bring to the table an adaptable event space and equine complex, a strategic location on the I-95 corridor and the unique historic significance of the property.”

The Virginia Equine Extravaganza provides a wealth of educational and entertainment activities to thousands of attendees. It typically features leading experts in the industry who offer dozens of clinics, demonstrations and exhibits on horse training and management. It also showcases a wide variety of horse breeds and riding disciplines and offers lively family entertainment and a trade show that features more than 100 vendors.

Details about the 2013 Virginia Equine Extravaganza will be shared at EquineExtravaganza.com as they become available.

Farm Bureau acquires Virginia Equine Extravaganza; event will run Nov. 1-3

Opportunities for selling farm products locally continue to emerge.

In addition to being careful about his products, Fitzgerald is careful about his property, which people visit to buy food and to use or borrow his processing equipment. He meets twice a year with his insurance agent, he said. “We start at one gate and walk to the other gate, and we

tell them everything we do and how we do it.”

Renard Turner, who operates Vanguard Ranch Ltd. In Louisa County with his wife, recounted how they determined over time that meat goats and organic vegetables were optimal products for their land. Turner retired from a health-related career and said he is determined to offer healthful foods. Part of that, he said, is being careful about regulations.

“It really means that you have to step up and have all the right answers when (inspectors) knock on your door. … There’s no wiggle room. I would feel terrible if anyone had a problem with anything I produced.”

GAP certification becoming “the cost of doing business”

In a panel discussion for produce growers, participants said they are seeing more reasons to become Good Agricultural Practices-certified.

Amy Hicks grows organic produce on her Charles City County farm and sells it at farmers’ markets, through subscriptions and to local grocers. While she has been certified organic since 2000, she is not GAP-certified.

“Being certified organic adds value to my operation, so I will probably become GAP-certified soon because I feel like that would add more value to my operation,” she said.

Jim Saunders of Saunders Brothers in Nelson County grows peaches, apples and Asian pears along with some vegetables, to sell at his family’s farm market and area farmers’ markets and to re-wholesalers.

By Kathy Dixon

As much as 96 billion pounds of food are wasted every year, according to the U.S. Department of Agriculture.

But one organization and thousands of farmers across the country are doing something about that.

“Farmers don’t like food to go to waste, and they’re happy to have us distribute it for them,” said Mike Waldmann, executive director of the Society of St. Andrew, which applies the biblical practice of gleaning surplus food from farm fields. Its national headquarters is in Bedford Country.

Since 1983, SOSA volunteers have salvaged fresh, nutritious produce from American farms and orchards and delivered it to agencies that serve individuals and families in need of food.

“I’m happy to see the produce used; it’s just ridiculous to disk it up,” said John Cromwell Jr., owner of Bay Spring Farm in Virginia Beach. SOSA volunteers have been gleaning his fields since 1986.

“It’s kind of a feel-good thing, and today we get a tax credit for it as well,” said Cromwell, who grows a wide variety of produce. Every harvest season, groups of volunteers come to his farm to glean.

He said the process starts in the spring with volunteers gleaning collards and kale that have over-wintered. In the summer, they pick snap beans and sweet corn.

SOSA’s gleaning coordinator meets with farmers in advance to ask what produce they want picked and which fields or orchards they want gleaned. Volunteers attempt to leave fields as untouched as possible. “We really are careful and look after the farm,” Waldmann said. “And we’ve never had a farmer who only let us come out [to glean] once.”

After volunteers have finished working, Cromwell said, “I’ve been very impressed with the way they leave the fields.”

Waldmann said some participating farmers have crops that are machine-harvested, and the equipment is calibrated to pick a certain size vegetable. Produce that has nothing wrong with it but is smaller is left in the field.

Other farmers have laborers who pick by hand and are given certain specifications. Without gleaning, whatever produce doesn’t meet those specifications is left to rot.

“Anyone would be happy to eat any of the food we get,” Waldmann said. “There’s nothing wrong with it; the farmer just can’t sell it.”

Last year SOSA volunteers gleaned 2.5 million pounds of fresh fruits and vegetables in Virginia, Waldmann said. Nationally, they collected 33.5 million pounds.

In addition to gleaning from farms, SOSA picks up unwanted produce and redelivers it to food banks and shelters.

Mary West, who operates Mt. Olympus Berry Farm in Caroline County, sells most of her berries and other produce at a farm stand and farmers’ markets between Thursdays and Sundays. On Mondays she sells at a reduced price to local customers. On Tuesday mornings, a SOSA representative picks up what’s left.

“We donated 20,000 pounds to the Society of St. Andrew last year,” West said. “We’ve found other outlets to donate our excess, but the bulk has gone to the society for the past few years.”

All food gleaned by SOSA is donated to food banks and other agencies it helps. The organization is funded by private donations from churches, individuals and corporations.

Want to know more?

For more information on having a field or orchard gleaned, or to donate excess produce, visit endhunger.org or call Sarah Ramey at 434-299-5956.

G L E A N E Dfarm fields provide

fresh fruits, veggies

for people in need



Volunteers from the Society of St. Andrew gleaned 2.5 million pounds of fresh produce in Virginia last year.

pho

tos

cou

rtes

y o

f so

ciet

y o

f st

. an

dre

w


AGRICULTURE IN THE CLASSROOMwww.agintheclass.org

Volunteers from Farm Bureau and other agriculture organizations turned out in force to read to children during Virginia’s third annual Agriculture Literacy Week, March 17-23.

Volunteers from 79 county Farm Bureaus, the Virginia Department of Agriculture and Consumer Services, Farm Credit of the Virginias, Southern States, Bayer CropScience and several 4-H and FFA chapters, along with AITC and Virginia Farm Bureau Federation board members and staff, marked the week by reading books about agriculture to more than 50,000 students in their local schools.

Many read the book Kelly’s Big Day, by Tammy Maxey, Virginia AITC senior education program coordinator. Nearly 1,900 copies of the book were purchased to be shared with school and classroom libraries.

Some volunteers have plans to read between now and the end of the school year in their communities, after weather and scheduling conflicts kept them from visiting in mid-March.

Third Agriculture Literacy Week reaches 50,000 children

Mecklenburg County Farm Bureau has undertaken a “Tractors for Ag in the Classroom” fundraiser to benefit the Virginia Foundation for Agriculture in the Classroom.

The organization’s board members were asked to select one of their primary tractors, monitor the hours it is in operation between March 1 and Nov. 15, and pledge a per-hour monetary donation to AITC.

At a February board meeting, 14 directors signed up to participate and agreed to contribute 50 cents per hour.

Mecklenburg Farm Bureau President Jim Jennings has challenged other county Farm Bureaus to adopt the fundraiser model as well. In a letter to other county presidents, he said the project “has the potential to get many individual farmers involved in supporting AITC and to create a positive energy aboutFarm Bureau in our community. … Our goal is that this project will extend beyond 2013, and we hope that in coming years we can solicit the support of tractor manufacturers” as well.

Happy farming, Mecklenburg!

Mecklenburg fundraiser based on tractor hours

Fans of Virginia’s equine industry made the largest amount of contributions during Agriculture in the Classroom’s first “Agricultural March Madness” competition to help put books in Virginia schools.

Visitors to the AITC website at AgInTheClass.org this winter had the opportunity to donate $10 or more and cast a vote in support of one of seven Virginia farm commodities.

In return, AITC will be distributing a horse-related book to schools across the state and creating a related classroom activity for teachers. AITC also will display signage with facts about the equine industry at this year’s State Fair of Virginia, and lesson plans provided to teachers who attend the fair will have an equine focus.

Equine enthusiasts pony up during ‘March Madness’ contest

Virginia Farm Bureau Federation President Wayne F. Pryor read to children at Mt. Gilead Baptist Preschool in Goochland County during Agriculture Literacy Week.

sara

ow

ens


New benefit offers discounts on Case IH equipmentA new partnership between Case IH and the American Farm

Bureau Federation gives Farm Bureau members in Virginia access to manufacturer’s incentive discounts on qualifying Case IH products and equipment when they buy from participating dealerships.

Eligible individuals, family or business members will receive the following discounts on purchases of these qualifying products:

• Case IH Farmall compact tractors (A & B) – $300 per unit;

• Case IH Farmall utility tractors (C, U, J Series) – $500 per unit;

• Case IH Maxxum Series tractors – $500 per unit;

• Case IH Farmall 100A Series tractors – $500 per unit;

• Case IH self-propelled windrowers – $500 per unit;

• Case IH large square balers – $500 per unit;

• Case IH round balers – $300 per unit;

• Case IH disc mower conditioners – $300 per unit;

• Case IH sickle mower conditioners – $300 per unit; and

• Case IH Scout utility vehicles – $300 per unit.

Members will need to present a current Farm Bureau membership verification certificate to their Case IH dealer in advance of product delivery to receive the discounts. Certificates can be obtained online at fbadvantage.com/Deals/Case and members without Internet access can receive assistance at their county Farm Bureau offices.

“There is no limit to the number of incentive discounts that a Farm Bureau member may use as long as it is no more than one per unit, and the equipment included provides opportunities for small landowners to larger, professional producers ,” said Zach Hetterick, Case IH livestock marketing manager. “This discount is also stackable, meaning it can be used with other discounts, promotions, rebates or offers that may be provided by Case IH or a Case IH dealership.”

U.S.-based Case IH has a network of dealers and distributors in more than 160 countries. Find a dealership near you at caseih.com.

Virginia Farm Bureau Federation has joined forces with Life Line Screening, the nation’s leading provider of preventive screenings, to provide a new screening service to members at a discounted rate.

Life Line Screening offers four vascular screenings and one osteoporosis screening. Its goal is to support physicians’ efforts to protect patients from stroke, heart attack and bone fractures by providing accurate ultrasound screening for at-risk patients.

The vascular screenings are available to members for $145—with no charge for the osteoporosis screening. Details are available from county Farm Bureau offices and will be mailed to members in the near future.

> Carotid artery screening uses painless, non-invasive Doppler ultrasound to visualize the carotid arteries, which carry blood to the brain. A majority of strokes are caused by plaque build-up in those arteries.

> Abdominal aortic aneurysm screening uses ultrasound to visualize the abdominal aorta, the largest artery in the body, to measure its diameter. That measurement can indicate whether there is a weakening in the aortic wall that could cause a ballooning effect known as an aneurysm. Aneurysms can burst, which generally is fatal.

> Atrial fibrillation, or “afib,” screening uses an EKG machine to identify an irregular heart rhythm. During “afib,” the blood might not pump out of the heart completely, instead pooling in the heart chambers and forming a clot. The clot can then travel to the brain, where it has the potential to cause a stroke, or travel elsewhere to block arteries to the arms, legs, kidneys or other organs. Individuals with atrial fibrillation have a five-fold increased risk of stroke.

> Peripheral arterial disease, or PAD, screening reads the systolic pressure in the ankle and arm for a measurement known as the “ankle-brachial index.” PAD also is known as “hardening of the arteries,” and sufferers have a 4- to 6-fold increased risk of cardiovascular disease.

> Osteoporosis screening uses ultrasound to estimate the bone density of the heel. That estimate can indicate whether there is a reduction in bone density, which can indicate the presence of osteoporosis. The heel is used because it is similar in composition to the hip, where disabling fractures often occur.

Strokes affect nearly 800,000 Americans every year. Abdominal aortic aneurysms, peripheral vascular disease and atrial fibrillation, as well as high blood pressure, are silent conditions that people often do not know they have until it is too late.

Members now can save on health screenings from Life Line


Landscaping■ Check trees that surround your home for things like cracks in

the trunks or major limbs; hollow or rotten trunks or limbs; trees that lean or are heavily weighted on one side; forks that are “V”-shaped rather than “U”-shaped; or limbs that are close to power lines.

■ Consider replacing rock landscaping materials with mulch or other soft materials.

Electrical and plumbing■ Have a licensed electrician determine whether your incoming

line and disconnect box are properly grounded. If not, have them provide the proper grounding.

■ Install surge protectors at the main electrical panel and at outlets in your home. They can prevent sudden spikes in electrical current, which could result in damaged electronics.

■ If you have lightning rods installed on your home, make sure you maintain them and keep all connections tight. Have an electrician check them periodically.

■ Learn how and where to turn off utilities to your home. You might need a special tool to turn off some utilities, and that should be part of your emergency kit.

HOME CHECKUP CHECKLIST

Essential Items■ Get a NOAA radio with tone alert, and program it for your

locality and surrounding areas. Place it where it can be heard throughout your home.

■ If you don’t have home fire extinguishers, get some! Check the ones you have to make sure their gauges indicate they’re still usable. If you have had an extinguisher more than five years, consider having it serviced or replacing it. Make sure fire extinguishers are in a handy location—not in a closet or next to the stove.

Be informed■ Talk with your insurance agent about your policy and what it

covers, as well as exclusions or riders that might be available.

■ Educate yourself about local emergency plans, as well as weather terminology.

Have a plan■ Develop an emergency evacuation plan, and designate a safe

area in your home.

■ Develop a family communication plan. Your family might not be together when disaster strikes, so plan how you will contact each another in different situations.

■ Create a home inventory to document your belongings.

■ Put together an emergency kit – water; non-perishable food; flashlights; batteries; battery powered radio; cell phone chargers; screwdrivers; wrenches; pliers; hammer; nails; several 10-feet by 10-feet tarps; duct tape. See FarmBureauAdvantage.com/safety for more information.

Take Action■ If a storm is imminent bring in or secure outdoor items like

patio furniture, grills, toys and garbage cans.

Roof■ Check the roof from the inside: Look for signs of water on the

attic ceiling, plywood delaminating or OSB (chipboard) swelling.

■ Next, check the roof outside for loose or damaged shingles. Have those repaired as soon as possible.

Windows■ Install wind (hurricane) shutters that are designed to completely

cover a window opening. If you decide to use plywood before a storm, use at least 5⁄8-inch exterior-grade plywood.

One of the best ways to weather a severe storm is to be ready for it in advance. These are simple steps to take to protect your family, your home or business and your property.

Assembling some basic items can help keep your family safe and comfortable during and immediately after severe storms.

Storm brewing? Look for what could blow down, off or away

By Sara Owens

While April showers may bring May flowers, those showers can turn into storms with high winds damaging homes, other buildings and property.

“Spring storms can cause a lot of high winds, which can result in a lot of property and building damage,” said Jimmy Maass, safety manager for Virginia Farm Bureau. “While you may think that most damage is caused during storms by rain and lightning, wind is often the culprit.”

Most windstorms primarily damage roofs, windows and trees.

For all structures and property insured on a Virginia Farm Bureau Mutual Insurance Co. homeowner, business owner, farmowner, dwelling fire and commercial fire policy, wind coverage is automatically included for those structures and their contents.

“It really doesn’t get any simpler than that,” said Sam Rooks, vice president of underwriting and policy services. “You’re covered as long as you have one of our policies; however, be sure to review your policy each renewal to make sure your home, property, barns and other buildings have the proper amount of coverage.”

Red Cross now offers Tornado AppSmartphone users: While getting your home ready for spring storms, consider downloading the official Tornado App from the American

Red Cross.It allows users to receive audible siren alerts during tornado warnings, even if the app is closed. They also can receive notifications when

warnings have expired—important information for families waiting inside a safe location.For more information or to download the app, visit redcross.org/mobile-apps/tornado-app.

• Examine trees for trunks that lean or have cracks or decay, mushrooms growing from bark, “V”-shaped forks rather than “U”-shaped ones, or crossing branches that rub or interfere with one another. Prune problem areas, and remove diseased, damaged or dead trees.

• Trim overgrown shrubs, and cut weak branches.

• Remove any overhanging tree branches near structures.

• Clean gutters, removing any debris that could cause damage during a storm.

• Secure loose roofing materials such as loose shingles.

• Move loose objects in yards and on decks,

patios, porches and balconies to a garage or basement. That should include light lawn furniture, toys, flags or anything else that could blow away easily.

• Secure larger objects such as heavier grills and outdoor furniture.

• Secure satellite dishes whether they are on the roof or in the yard.

• Secure all shed and garage doors.

• Check the attic for leaks on the ceiling that could become worse during a strong storm; have them repaired as soon as possible.

Before a storm rolls in, take these steps to secure and protect your property:

Much of the damage caused by a spring storm is wind-specific. Damage to roofs, windows and trees is common.



Affordable Care Act—What happens now?The Patient Protection and Affordable Care Act refined what

kind of insurance plan can be sold in the United States. The new plan categories are distinguished by their “actuarial value.”

Actuarial value refers to the proportion of medical expenses an insurance plan is expected to cover; an actuarial value of 100 means that a plan would pay all of the medical expenses for the average population. The higher the actuarial value of a plan, the lower the out-of-pocket costs for the plan member.

To help consumers distinguish between high and low levels of actuarial value, the Affordable Care Act named plans according to precious metals. Coverage levels are as follows:

• Bronze Plan: 60 percent of the actuarial value with respect to essential benefits;

• Silver Plan: 70 percent of the actuarial value with respect to essential benefits;

• Gold Plan: 80 percent of the actuarial value with respect to essential benefits; and

• Platinum Plan: 90 percent of the actuarial value with respect to essential benefits.

In practice, this means a consumer is expected to understand that a Gold Plan pays more insurance expenses than a Silver Plan or Bronze Plan but not as much as a Platinum Plan.

In the marketplace, it is expected that an insurer will charge progressively higher premiums among the plans, with Bronze Plans having the lowest premiums and Platinum having the highest. It is likely, however, that one insurance company’s Silver Plan could be less expensive than another company’s Bronze Plan.

All plans will have a shared maximum out-of-pocket amount that an enrolled individual may pay in a calendar year.

All non-grandfathered insurance plans sold to individuals or businesses with at least 50 employees must offer specific essential health benefits. Plan providers also can choose to offer additional benefits.

The ACA identifies 10 statutory essential health benefit categories:

• ambulatory patient services;

• emergency services;

• hospitalization;

• maternity and newborn care;

• mental health and substance use disorder services, including behavioral health treatment;

• prescription drugs;

• rehabilitative and habilitative services and devices;


• laboratory services;

• preventive, wellness and chronic disease management; and

• pediatric service, including oral and vision care.

It is important to note that, since plans differ by the amount of costs they cover, they may all cover the essential health benefits but can cost a member different amounts due to the differences in insurance expenses paid for by the plans.

Individual insurance companies are not required to offer all four plans. At a minimum, they must offer the Bronze Plan and the Gold Plan. There is also a catastrophic plan for individuals who can demonstrate problems affording a Bronze Plan.

Beginning in 2014, tax credits will be available to U.S. citizens and immigrants of legal status who purchase coverage in the new health insurance exchanges and who have income up to 400 percent of the federal poverty level ($45,960 for an individual or $94,200 for a family of four in 2013). To be eligible for the premium tax credits, individuals must not be eligible for public

coverage—including Medicaid, the Children’s Health Insurance Program, Medicare or military coverage—and must not have access to a qualified health insurance plan through an employer (There is an exception in cases where the employer plan does not cover at least 60 percent of covered benefits on average or the employee share of the premium exceeds 9.5 percent of the employee’s income).

The premium tax credits will be advanceable and refundable, meaning they will be available when an individual purchases coverage and will be available regardless of whether an individual owes any taxes. The premium tax credits will vary with income and are structured so that the premium an individual or family will have to pay will not exceed a specified percentage of income, ranging from 2 percent for those with incomes up to 133 percent of the poverty level (about $14,400 for an individual) to 9.5 percent for those with incomes between 300 and 400 percent of the poverty level ($32,490 to $43,320 for an individual).

For more information on how the new health care reform laws affect your family or your business, visit our website at ExperientHealth.com, like us on Facebook (Experienthealth) or follow us on Twitter (@experientTeam).

Leah Gustafson is a marketing specialist for Virginia Farm Bureau Health Care Consultants.

Producers network (continued from page 15)

“We are not GAP-certified either but hope to be by mid-July,” Saunders said. “We started the process by attending a workshop and going through the paperwork. It’s the cost of doing business and having something on paper for sanitization and showing that we have good, wholesome products for sale.”

GAP is a U.S. Department of Agriculture audit verification program that focuses on best agricultural practices to verify that farms are producing fruits and vegetables in the safest manner possible to minimize risks of microbial food safety hazards. The program currently is voluntary.

Tom Smith, who works with GAP audit verifications with the Virginia Department of Agriculture and Consumer Services, said retailers “are really driving the GAP machine. Some stores are requesting that producers obtain GAP certification to sell to them.”

Wythe Morris, a Virginia Cooperative Extension agent in Carroll County, has conducted many GAP workshops and has developed GAP-related training materials that Extension staff use. “The two best marketing tools you have,” he told producers, “are local products and safe products. GAP certification is all about trying to fix sanitation and other issues before they happen.”

Insurance called critical for managing riskFrom a legal standpoint, safety precautions and liability

insurance are essential for protecting a small farming operation, conference participants were told.

“You play a very important role in our food system,” said attorney Jesse. J. Richardson Jr. “People feel safe” buying from local farmers. They know who produced the product, so that gives them a lot of comfort.”

But at the same time, “your processes have to be very routinized, and you have to be very careful. If one of you messes up and someone gets sick, … that might taint all of you.”

Richardson is an associate professor of urban affairs and planning at Virginia Tech who frequently speaks on farm business planning issues.

There will always be some risk associated with producing and selling foods, he said, but producers can take steps to manage that risk. His three recommendations were to emphasize safety in all business practices; purchase liability insurance; and work closely with insurance professionals to assess potential risks on a farm.

“I would much rather have your insurance agent see something than one of your customers get hurt,” Richardson said. “Your insurance agent doesn’t want you to get sued.”


For good nutrition, don’t pass on the peasBy Kathy Dixon

Garden peas, snow peas or sugar snap peas—no matter what pod they’re packaged in—green peas are a rich source of B vitamins and folate, which assist with the metabolism of fats, proteins and carbohydrates.

Peas also are high in vitamin K, manganese, vitamin C and dietary fiber.

“Peas are one of the best ‘fast foods’ naturally packaged in a little green pod,” said Dr. Elena Serrano, associate professor and a Virginia Cooperative Extension specialist in human nutrition, foods and exercise at Virginia Tech. “Peas are one of those foods that taste best in season and make spring eating that much better.”

Garden peas need to be shelled before eating, but snow and snap peas have edible pods. Interestingly, garden peas have more nutrients than their snow and snap cousins.

One cup of cooked green peas has about 130 calories, contains 51 percent of the daily recommended amount of vitamin K, almost 38 percent of the recommended amount of vitamin C and 27 percent of the daily amount of vitamin B1.

Garden peas are available from spring through the beginning of winter, while sugar snap peas have limited availability from late spring through early summer. They also are a favorite among kids who otherwise might not like vegetables, Serrano said.

“Sugar snap peas can really jazz up salads and stir fry dishes. Additionally, they are great to serve with low-fat dips as a healthy appetizer or tailgate food.”

All varieties are sold both fresh and frozen. If you are using frozen peas, a 10-ounce package equals 1½ pounds of fresh peas in the pod.

“The difference [in nutrients] is negligible if the difference were to prevent someone from eating them,” Serrano said. “Whatever it takes to eat them is the key.”

To maintain the most nutritional value, rinse fresh peas but don’t soak them. They can be steamed, boiled or sautéed. Peas lose their flavor if they’re overcooked, so cook them just long enough to soften them—usually just a couple of minutes.

They can be cooked or eaten raw and are good for soups, stews, baked dishes and salads.

“I like to add peas to pasta and rice dishes for color and added nutrients,” Serrano said. She prepares penne pasta with cubed ham, peas and Parmesan cheese and makes stir-fried rice using peas, other veggies, leftover meat and scrambled eggs.

Good for You!

Peas lose their flavor when overcooked, so cook just long enough to soften them—usually a couple of minutes.


Peas OrientaleINGREDIENTS

3 10-ounce packages frozen peas, cooked2 16-ounce cans water chestnuts, drained

and thinly sliced2 20-ounce cans bean sprouts, drained1 pound mushrooms, sautéed in butter2 10.5-ounce cans cream of mushroom

soup2 3.5-ounce cans fried onion rings

DIRECTIONS

Preheat oven to 350° and grease a casserole dish. Mix the vegetables with the soup and place in a casserole dish. Bake for 30 minutes, and top with the onion rings before baking another 15 minutes.

Source: recipe of Mrs. Fred Leustig of Highland County in Country Treasures from Virginia Farm Bureau Kitchens

Good for You!

Minted Spring Pea SaladINGREDIENTS

2½ cups fresh green peas, shelled1 small shallot, peeled and thinly sliced1 small leek, cleaned and thinly sliced

(white part only)zest and juice of 1 lemon¼ cup extra-virgin olive oil½ cup shredded fresh mint leavessalt and freshly ground black pepper to taste

DIRECTIONS

Bring a large pot of salted water to a boil. Pour the peas into the water, and cook for no more than 2 minutes. Drain, and immediately plunge the peas into a bowl of ice water. Drain and pat dry with a towel. Puree ½ cup of the peas in a blender or food processor.

Place the whole cooked peas, pea puree, shallot and leek in a medium, nonreactive bowl, and toss gently to combine.

Add the lemon zest and juice, olive oil and mint. Season to taste with salt and pepper, and toss gently until the vegetables are coated.

Source: University of Maryland College of Agriculture and Natural Resources

Ten ounces of frozen peas is equal to 1½ pounds of fresh peas in the pod.

Heart of the Home

Crepes are sweet celebration of strawberry seasonWhether sweet or savory, crepes can form a delightful housing for all kinds of filling. This sweet crepe recipe created by food writer Kendra

Bailey Morris blends chocolate hazelnut spread with fresh strawberry slices.

Chocolate Hazelnut Spread Crepes with Strawberries and Vanilla Whipped CreamCREPE INGREDIENTS

1 cup all-purpose flourpinch of saltpinch of sugar2 eggs1½ cups whole milk¼ teaspoon vanilla extract¼ teaspoon orange liqueurunsalted butter, for cooking crepes1½ cups chocolate hazelnut spread (such

as Nutella)1 cup fresh strawberries, hulled and sliced

DIRECTIONS

In a mixer, blend together on high the flour, salt, sugar, eggs, milk, vanilla and orange liqueur for about 45 seconds. Remove the batter to a large bowl, cover, and refrigerate for 1 hour. You also can make the batter a day ahead and keep it refrigerated until ready to use.

To a crepe or other nonstick pan, add about a ½ teaspoon of the butter. Heat the pan to medium-high, and swirl the butter to coat the pan well. Whisk the crepe bat-ter if it’s separated, add ¼ to 1/3 cup of the batter to the pan and swirl it so it coats the entire pan bottom. Cook the crepe for about 3 minutes or until set and the bottom is browned. Then loosen the crepe with a spatula, and turn it over in the pan. Cook about another minute or until it’s lightly browned on both sides. Repeat until you’ve used up all the batter. You should have about 8 crepes.

Spread each crepe with some of the hazelnut spread and sprinkle with a few strawberries. Fold the crepe over twice to make a triangular shape, and set it aside. Repeat with the remaining crepes. Top each with vanilla whipped cream, and serve.

Vanilla Whipped Cream INGREDIENTS

1 cup heavy whipping cream1 tablespoon sugar1 teaspoon vanilla extract or vanilla bean paste

DIRECTIONS

Chill a metal bowl in the freezer. Pour in the cream, sugar and vanilla, and beat with a hand-held mixer until you can form soft peaks. Cover and chill until ready to serve.


Other fresh Virginia-grown fruits are delicious in crepes as well.

kath

y d

ixo

n

Heart of the Home

This rich pasta dish uses fresh spring peas and is “creamy and decadent,” said food writer Kendra Bailey Morris.

The richness comes from the blend of cream and cheeses, and Morris recommends serving the pasta with a tossed salad and crusty bread “for soaking up any extra sauce.”

Penne Pasta with Fresh Peas and Gorgonzola CheeseINGREDIENTS

1½ cups heavy cream or half-and-half2 small garlic cloves, minced5 ounces Gorgonzola cheese or other good-quality blue cheese½ cup freshly grated Parmesan cheesesalt and pepper, to tastepinch of dried red pepper, if desired1 pound penne pasta, cooked al dente and drained¾ cup fresh shelled peasadditional Gorgonzola for garnish

DIRECTIONS

In a sauté pan large enough to hold the cooked pasta, over medium heat, bring the cream and garlic to a simmer. Boil gently, uncovered, for 10 to 15 minutes, or until reduced in volume by about half. Add the Gorgonzola and Parmesan cheeses. Continue to cook uncovered for about 10 minutes or until the sauce has thickened. Season to taste.

Add the cooked pasta and peas to the sauce, and cook another 3 to 4 minutes. Spoon the pasta into bowls, and top with additional Gorgonzola.

Serves 4 to 6.

Enjoy the richness of spring with peas and creamy pasta


Gorgonzola is an Italian blue cheese with a crumbly, soft texture.

Kendra Bailey Morris appears each month on Real Virginia, Virginia Farm Bureau’s weekly television program, courtesy of Virginia Grown, a program of the Virginia Department of Agriculture and Consumer Services. Morris is an author and culinary instructor whose work appears in Better Homes and Gardens, Food Republic, Virginia Living, Chile Pepper and other publications and is a former food columnist for the Richmond Times-Dispatch. Her blog is at fatbackandfoiegras.blogspot.com.

To find the station nearest you that airs Real Virginia, or to view the show online, visit VaFarmBureau.org.

kath

y d

ixo

n


Our58thyear

KILL LAKE WEEDSProven AQUACIDE PELLETS

Marble sized pellets. Work at any depth

KillLakeWeeds.com/54T

10 lb. bag treats up to 4,000 sq. ft. $84.00.50 lb. bag treats up to 20,000 sq. ft. $331.00.FREE SHIPPING!! Certified and approved by state agencies. State permit may be required. Registered with the Federal E. P. A.

Before After

AQAAQAQAQQAQAQAQAQAQAAAAAAQAQAQQAQAAQAQAQQQQQQQQQQQQQUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAAAUAUAUAUAAUAACCICICIIICIIIIIIIIICCICICICIICCCCICCC DEDEDEDEEDDDDDDDDDDDDDDDDDDD CCCCCO.O.OOAQUACIDE CO.PO Box 10748, DEPT 54T, White Bear Lake, MN 55110-0748

Order online today or request free information.

800-328-9350

Some call it agriculture.For us, it’s a way of life.

FirstFarmers Helping Farmers Grow

www.firstbank.comMember FDIC

Bank AgCredit

540-437-0604 540-828-2020

Call an AgCredit specialist today.

540-885-8000


Help people find your spring and summer farm products, with Farm Bureau Fresh

If you are a Virginia farmer who direct-markets meats, eggs, produce or fibers, there’s a Farm Bureau member benefit that can make it easier for potential customers to find you.

Farm Bureau Fresh, based on the Virginia Farm Bureau website at VaFarmBureau.org/marketplace, lets members place free, searchable listings of up to 45 words. Farm Bureau began promoting Farm Bureau Fresh last year to anyone with an interest in local foods and other farm products.

Consumers can use Farm Bureau Fresh to search for products in any of 11 categories, or use a ZIP code to locate all producers in a specific area who sell to the public. In addition to addresses, phone numbers and farm websites, they’ll be able to access a map and Google travel directions to your farm, stand or other venue.

Products currently are being listed in the following categories:

• agritourism;

• aquaculture;

• bees and honey;

• Christmas trees;

• CSAs;

• eggs;

• fiber;

• flowers;

• fruit;

• meat;

• mushrooms;

• pick-your-own;

• pumpkins; and

• vegetables.

Watch this!To view RealVirginia,

visit VaFarmBureau.org.

May’s Real Virginia focuses on farmers’ markets, home gardening

How did the city of Roanoke revitalize its downtown core? The Star City’s historic farmers’ market was a key player, as you’ll see in the May editions of Real Virginia. We’ll also visit an Augusta County sheep farm that processes wool in its own mill. Garden expert Mark Viette has spring tips for preparing your soil, and Chris Mullins at Virginia State University shows how to plant ingredients for homemade salsa. Plus, food writer Kendra Bailey Morris will share recipes for a Mexican-style beef and salsa dish and slow-cooker barbecue.

Real Virginia airs nationwide at 6:30 p.m. on the first Wednesday of each month on RFD-TV on the Voice of Agriculture program on Dish Network and DirecTV. It can also be watched weekly on WVPT Harrisonburg, WBRA Roanoke, WCVE Richmond, WHRO in Norfolk, WVVA in Bluefield and WTKR in Norfolk, as well as on 41 cable systems across the state. It’s available online at VaFarmBureau.org.

Check local television listings, or visit VaFarmBureau.org for a list of participating stations.


Marketplace

CROPSAZOMITE – Mineral supplement with over 70 trace elements. www.Azomite.com for Va. dealers. DF International 540-373-3276.

DEER, RABBIT, GROUNDHOG REPELLENT – $12.95 makes ten gallons. Safe, effective, weatherproof long-lasting guaranteed. www.repels.net, 540-586-6798.

FOR RENT – Pulaski County 65 acres, 6+ pastures 3+ ponds, auto waterer. Available Spring, 540-633-0243.

PEBBLE HALL WILDFLOWERS – Herbs. Seasonal pick your own, educational and photo opportunities. Facebook us. 540-421-7698.

FARM EQUIPMENT1959 CAT D-7 – Bulldozer electric start, hydraulic blade, $6,000. 434-392-3401.

BACCO – Tobacco packer with scales, in good condition. Used about 5 years, $3,000. 434-376-3749.

BRUSH HOG – 10-ft. sidewinder $3,850. Haybaler IH 435 always shed kept, VG condition, family owned $3,500. 703-994-1511.

COMPLETE – Hydraulic bale ramp for 458 John Deere round baler, new condition, $800. 540-337-6940.

FOLEY BELSAW MILL – Model 4660915, steel frame, 46-inch saw blade $3,850. Cell 434-547-9913, 804-492-4839.

HOLLAND PLANTER – Model 1265, 3-pt. hitch, very good condition, $700. 804-730-1663.

JET POST DRIVER – Tufline subsoiler, two parabolic shanks, JD 38 chopper. 540-223-2757.

MANURE SPREADER – 125 Pequea, never used $3,000. Purchased from dealer for $4,500. 804-450-2699.

MECHANICAL BED SHAPER – Also installs plastic and irrigation line. Great timesaver, excellent condition, $2,800. 540-878-6054.

NEW HOLLAND – 1033 stackwagon, 105 bale capacity, working condition, $3,000. 757-434-9889.

NEW HOLLAND – 575 square hay baler, purchased new and shelter kept, VGC, $5,500. 757-434-9889.

SPECIAL BUILT – Cattle trailer, sides remove for hay, 100 bushel corn grinder, best offer. 434-993-2341.

THREE-POINT WHEEL RAKE – Two basket tedder, Allis Chalmers B #10, John Deere Mower. 434-841-6717.

TWO TIRES – 18.4x34, one new $475, one 90% tread $350, on rims, aired up, pair $800. 757-426-7832.

WILLMAR – 6T. fertilizer spreader, good shape $1,800. 1983 JD 300B backhoe average $4,500, Louisa. 540-223-22103.

ZETOR 3340 – 4x4, cab, loader. 276-988-3775.

LIVESTOCKBOER GOATS – For sale, registered full blood buck, taking reservations for kids born March, April. 540-955-0374.

FOR SALE – Angus Bulls, calving ease, semen tested, excellent bloodlines, reasonably priced and good selection. Delivery available. C-Stock Farm, Scottsville day 434-286-2743, after 7 p.m. 434-981-1397 or 434-286-2423.

FOR SALE – Baby Guineas $3 each or $25 for ten. Bantam chicks $1 each. 434-332-5132.

HORSE BOARDING – Peaceful setting, retired horses, owners lives on farm. Quality care, best feed. 540-348-6209.

HUDSON HERITAGE FARMS – Highland cattle, Boer and Toggenburg goats, horned Dorset and Gulf Coast sheep. 434-753-9327.

MADISON COUNTY – Va. Locally raised all natural 100% pastured, grain-finished Angus, AngusX and Hereford beef. Wholesale, retail, shipping available. 540-923-4036.

REGISTERED – Black Angus seed stock; fall born; bulls and heifers; AI sire. Sammy Smith 434-664-8767.

TEXAS LONGHORNS – Steers and breeding stock available. www.lakecountrylonghorns.com. 757-377-5660.

WANTED – Young Guernsey milk cow, must be easy to milk. Will have wonderful home. 804-966-8882.

Watch this!To view

Real Virginia, visit VaFarmBureau.org

Members of Virginia Farm Bureau will receive one free 15-word classified ad per membership per year in Virginia Farm Bureau News, which is mailed to producer members, or in Cultivate, which is mailed to associate members.

Ads of 16 to 30 words must be accompanied by payment of $20.Any additional ads placed by members in the same calendar

year must be accompanied by payment of $10 for 15 words or fewer, or $20 for 16 to 30 words. Ads submitted without payment will be returned. We do not invoice for classified ads or provide proofs or tearsheets.

Ads with more than 30 words and ads from nonmembers will not be accepted.

Use the form in this issue of Virginia Farm Bureau News or the online form at VaFarmBureau.org/marketplace to place your ad. No ads or cancellations will be taken by phone. Ads will be accepted only from members whose membership is current.

Magazine classified ads can be placed in the following five categories only:

• Crops;

• Farm Equipment;

• Hay/Straw;

• Livestock; and

• Livestock equipment.

Classified ads will be published in the following issues:

• April Cultivate (mailed to associate members only);

• May Farm Bureau News (mailed to producer members only);

• July Cultivate (mailed to associate members only); and

• August Farm Bureau News (mailed to producer members only).

2013 magazine classified ad schedule and policies

Finding your member numberWhen placing your ad, be sure to include your Farm Bureau member number, which can be found above your name on the mailing label

of your copy of Virginia Farm Bureau News. All member numbers will be verified.


Marketplace

Important:We are not responsible for typographical errors or errors due to illegible handwriting (No refunds available). Classified ads carried in Virginia Farm Bureau News and Cultivate do not constitute an endorsement by Virginia Farm Bureau Federation and its affiliated companies and organizations. We reserve the right to edit or reject ads, including ads that represent a business in competition with the Virginia Farm Bureau Federation, Virginia Farm Bureau Mutual Insurance Company or any of our affiliated or affinity partners. We reserve the right to edit or reject any advertisement that makes reference to any particular political party or group, religious belief or denomination, race, creed, color or national origin.

Step 1Use the form below to provide contact information and the text for your ad.• Ads will be accepted from Farm Bureau

members only.• Classified ads are not transferable. • Please type or print.• Classified ads will not be accepted or

cancelled over the phone.

Step 2Indicate the issues in which you want your ad to run.

Step 3Select the category in which you want your ad to run (Pick one only).

Step 4Your first ad of 15 words or less is free with your membership. Pricing for additional ads:1–15 words $10/ad16–30 words $20/adAdditional ads must be accompanied by a check (no cash) for each issue in which the ad is to appear.• Make check payable to: Virginia Farm Bureau.

• Ads longer than 30 words will not be accepted.

• We do not invoice for classified ads or provide proofs or tearsheets.

• Ads submitted without payment will be returned.

Step 5Mail your ad (and payment) to: Virginia Farm Bureau News / Cultivate Classifieds P.O. Box 27552 Richmond, VA 23261-7552Or place it via the Virginia Farm Bureau website at VaFarmBureau.org/Marketplace.

DeadlinesAds and cancellations must be received (not mailed) by the following deadlines:

Issue Deadline

Mailed to producer members August June 28

Mailed to associate members July May 31

How to place your classified ad

One free 15-word ad per membership per year; dues must be paid before placing ad.

Moving?If your address or phone number has changed — or is about to —

don’t forget to contact your county Farm Bureau office to ensure that

your membership and subscription information stays current!

NAME: _____________________________________________________________________________________________________________________

MEMBER NO.: _______________________________________________________________________________________________________________

COUNTY: ___________________________________________________________________________________________________________________

ADDRESS: __________________________________________________________________________________________________________________

CITY: ______________________________________________________ STATE: ________________________________ ZIP: ___________________

DAYTIME PHONE NUMBER: ____________________________________________________ E-MAIL ADDRESS: ______________________________

Ads will not be accepted without the information above

ADVERTISEMENT (one word per space; please type or print):

1. ____________________________ 2. ____________________________ 3. _______________________________ 4. ______________________________ 5. __________________________________

6. ____________________________ 7. ____________________________ 8. _______________________________ 9. ______________________________ 10. _________________________________

11. ___________________________ 12. ___________________________ 13. _______________________________ 14. _____________________________ 15. _________________________________

ISSUE IN WHICH AD SHOULD RUN:❑ July (mailed to associate members)

❑ August (mailed to producer members)

Category in which ad should run (select only one):

❑ Crops

❑ Farm Equipment

❑ Hay/Straw

❑ Livestock

❑ Livestock Equipment

No other categories available

❑ Payment enclosed: $________________❑ This is my one free 15-word ad for 2013

❑ Please place my ad online in the VFB Marketplace for free (Ads expire with membership).

❑ Please place my ad in The Delmarva Farmer for 4 weeks at no additional cost to me.

( ) phone number

* Ad placement available for these issues only

The Experts in Rural Finance

Land. The best investment on earth.

If you are interested in owning your own land, Farm Credit can help. We have been providing financing for land and

farms to people just like you for 95 years.

800-919-FARM (3276)www.farmcredit.com

Financing for:Building or buying a homeFarms, lots & home sitesSmall or large tracts of landTimber & recreational tractsHunting & fishing properties

May 2013 FBN

Documents

Transcript of May 2013 FBN