1

Nuclear localization destabilizes the stress regulated transcription factor Msn2

Erich Durchschlag1, Wolfgang Reiter1, Gustav Ammerer and Christoph Schüller§

Institute of Biochemistry and Molecular Cell Biology, Max F. Perutz Laboratories, University

and BioCenter of Vienna A-1030 Vienna, Austria

Running Title: Nuclear Msn2 degradation

Key words: protein degradation, nuclear transport, protein kinase A, proteasome, stress

1) these authors have contributed equally

§To whom correspondence and reprint requests should be addressed:

Christoph Schüller Institute of Biochemistry and Molecular Cell Biology Max F. Perutz Laboratories University and BioCenter of Vienna Dr. Bohr-Gasse 9/5; A-1030, Vienna, Austria Phone: +43-1-4277-52815; FAX: +43-1-4277-9528 e-mail: Christoph.Schueller@univie.ac.at

JBC Papers in Press. Published on October 22, 2004 as Manuscript M407264200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

2

Summary

The transcriptional program of yeast cells undergoes dramatic changes during the shift from

fermentative growth to respiratory growth. A large part of this response is mediated by the stress

responsive transcription factor Msn2. During glucose exhaustion, Msn2 is activated and concentrated

in the nucleus. Simultaneously, Msn2 protein levels also drop significantly under this condition. Here

we show that the decrease in Msn2 concentration is due to its increased degradation. Moreover, Msn2

levels are also reduced under chronic stress or low PKA activity, both conditions that cause a

predominant nuclear localization of Msn2. Similar effects were found in msn5 mutant cells that block

Msn2 nuclear export. To approximate the effect of low PKA activity on Msn2, we generated a mutant

form with alanine substitutions in PKA phosphorylation sites. High expression of this Msn2 mutant is

detrimental for growth, suggesting that the increased degradation of nuclear Msn2 might be necessary

to adapt cells to low PKA conditions after the diauxic shift, or to allow growth under chronic stress

conditions.

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

3

Introduction

In budding yeast, two redundant stress-inducible transcription factors, Msn2 and Msn4, play an

important role in the response to environmental cues (1). Both of these highly related Zn finger

transcription factors mediate the induction of stress protective genes whenever cells encounter a shift

towards sub-optimal growth conditions (2-4). Furthermore, Msn2 and Msn4 are activated during

diauxic shift, a transition from fermentative growth on glucose to respiratory growth, causing a

transient increase of stress inducible transcripts (5,6). Activation of Msn2 usually occurs through a

series of complex steps that increase its nuclear concentration and promoter recruitment. It is thought

that Msn4 is mechanistically regulated in similar ways. Exposure to stress conditions such as high

osmolarity, rapamycin treatment, heat stress, short chain organic acids, alcohols, and membrane

damage throttles Msn2 nuclear export and increases its binding to the stress response elements

(STRE) (7-10). However, in all these cases the nature of the signaling events leading to Msn2

activation is still largely obscure.

In contrast to our lack in understanding Msn2 activating signals, it is well established that

protein kinase A (PKA) activity plays an overriding role in the negative regulation of Msn2 function.

PKA activity imposes itself onto Msn2 nuclear import, nuclear export and possibly DNA binding (9).

Low PKA activity has been found to increase the expression level of Msn2 dependent genes, whereas

high PKA activity has been described to cause the opposite effect (11). Consequently, the question

emerged whether environmental stresses activate Msn2 function simply by antagonizing or modulating

PKA signalling. In fact, genetic interactions have been described between the TOR (target of

rapamycin) pathway and the Ras-PKA pathway, that are consistent with this assumption (12).

Moreover, TOR mediated nutrient signals have been shown to affect Msn2 function (13). Other studies

however rather support the conclusion that the Ras-PKA pathway does not mediate acute stress

responses (14). Of all tested stress treatments only glucose starvation appeared to induce changes in

the PKA dependent phosphorylation of serine 620 in the Msn2 NLS (14) whereas all other acute

stresses do not change a PKA dependent modification of this site. These findings might reflect

differences between short-term and long-term responses to environmental fluctuations. For example,

during the post diauxic shift, Msn2 is probably mainly activated due to an extended drop in protein

kinase A activity.

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

4

The distinct transcriptional response to acute stress exposure is usually transient, suggesting

that adaptive systems are in operation that help a cell to resume its support for growth and cell division

rather than invest into damage protection. Indeed, during stress relief, and during stress adaptation,

Msn2 is rapidly relocated from the nucleus to the cytoplasm. The situation is different, however, when

glucose is exhausted in a growing culture after the diauxic shift with constantly low PKA activity. Since

genetic evidence has shown that under low PKA activity Msn2 becomes detrimental for growth, the

question arises by which mechanism Msn2 is inactivated after the diauxic shift to avoid growth arrest.

Here we provide evidence that this adaptive effect might be achieved through different degradation

rates of nuclear versus cytoplasmic Msn2. Further analysis showed that Msn2 protein levels are

always reduced under conditions that cause prolonged nuclear localization of the protein. In

comparison to other transcription factors, for which degradation has been shown as a means of

regulation, the overall rates of Msn2 degradation are relatively slow in all cases. This observation

might suggest that protein degradation is unimportant for Msn2 regulation under short-term fluctuating

conditions. As shown through the use of a hyperactive allele of MSN2, however, nuclear degradation

of the factor might be important for avoiding prolonged growth arrest under sustained stress

conditions.

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

5

Experimental procedures

Yeast strains, media and growth conditions

All strains are derivatives of W303-1A (MAT a, ura3-1, leu2-3, his3-11, trp1-1, ade2-1, can1-1000).

W303msn2∆msn4∆msn5∆ was generated by isogenic crossing of W303msn2∆msn4∆ (9) with

W303msn5∆ (14). The correct genotype of the resulting strain was verified by PCR.

W303cdc35∆pde2∆ was generated by introducing the cdc35::kanMX disruption cassette, which was

recovered from the EUROSCARF collection, into W303pde2∆ (14). W303erg6∆ was a kind gift from K.

Kuchler (Vienna BioCenter).

Standard yeast culture methods were used as described by (9). Yeast cells were grown in

YPD or synthetic medium at 30°C to an OD600=1 and either used immediately, exposed to stress (7%

ETOH, 0.4M NaCl, or 37°C heat shock) or further grown through stationary phase. For cAMP

depletion cultures of W303cdc35∆pde2∆ were grown at 30°C in selective medium containing 3mM

cAMP to OD600=0,8, washed and re-suspended in cAMP-free medium and further incubated at 30°C.

For copper induction cells were grown at 30°C in selective media to logarithmic phase (OD600=0,8)

CuSO4 was added to a final concentration of 50µM for 30 minutes. CuSO4 was removed by two

washing steps and cells were resuspended in CuSO4-free medium and treated as indicated. To inhibit

proteasome activity W303erg6∆ cultures were diluted to OD600=0.2 and grown to OD600=1. MG132

(Sigma) was added to a final concentration of 50µM and 100µM.

Plasmids

All plasmids derive from plasmid pMsn2 (9). pYMSN2-myc was created by introducing a myc9-NotI

cassette (15) into NotI digested pYMSN2-GFP (9). Plasmids pCUP1MSN2 and pCUP1MSN2-GFP

were generated by introducing a SacII/ SalI 700bp PCR fragment of the CUP1 promoter generated

using oligos SacII-Cup1_fwd and SalI-Cup1_rev into SacII/SalI cut pYMSN2 and pYMSN2-GFP,

respectively. Plasmids pCUP1MSN2∆NES and pCUP1MSN2∆NES-GFP, both contain a mutant

version of Msn2 lacking amino acids 246 to 325, were obtained by replacing the ADH1 promoter

sequence of plasmid pADH1MSN2∆NES and pADH1MSN2∆NES-GFP, respectively, with the

SacII/SalI CUP1 promoter fragment. Plasmid pADH1MSN2∆NES-GFP was obtained by ligation of a

SalI/BamHI cut PCR fragment generated using oligos Msn2SalI and BamHI-∆NES-rev with

BamHI/NdeI cut PCR fragment (oligos BamHI-∆NES-fwd and EGFPseq-rev) into the SalI-NdeI cut

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

6

plasmid pAMG (9). Plasmid pADH1MSN2∆NES was obtained by removing the NotI fragment

containing the EGFP sequence from pADH1MSN2∆NES-GFP. Plasmids pCUP1-PKIMSN2 and

pCUP1-PKIMSN2-GFP were generated by replacing the MSN2 promoter from plasmids pYMSN2 and

pYMSN2-GFP with a SacII/SalI Fragment containing the CUP1 promoter fused to the PKI sequence.

Plasmids pCUP1MSN2A5 and pCUP1MSN2A5-GFP were generated by introducing a SalI cut PCR

fragment obtained with oligos Msn2SalI and Msn2x12SalI-rev and pYMSN2 as a template into SalI cut

pAMG8 (9), to obtain the full length ORF of MSN2A5. The internal XhoI fragment was then introduced

into XhoI cut pCUP1MSN2 and pCUP1MSN2-GFP to generate pCUP1MSN2A5 and pCUP1MSN2A5-

GFP.

Western blot- and northern blot analysis

Cells were harvested by centrifugation, re-suspended in buffer A (50mM HEPES pH=8, 0.4M

(NH4)2SO4, 1mM EDTA, 5% Glycerol) containing protease inhibitors (Boehringer, Complete EDTA

free) and broken with glass beads at 4°C for 20 minutes. Extracts were cleared by two 20 minutes

centrifugation steps at 4°C and boiled in 50% (v/v) 2xSDS sample buffer. 50µg of total protein for each

sample was loaded on a 7% SDS PAGE and separated. Proteins were transferred to nitrocellulose

membranes and immunodetection of proteins was carried out with ECLplus (Amersham) according to

the instructions of the supplier. Msn2 was detected with rabbit anti-Msn2 antiserum (kindly provided by

F.Estruch, Valencia), Kar2 with rabbit anti-Kar2 antiserum (a gift from A.Kal; University of Amsterdam)

and the Myc-epitope with monoclonal 9E10 antibody. Northern blot analysis was carried out as

described (16). CTT1 was detected with a probe derived from the EcoRI fragment from plasmid

pRB322-5109 (17) and for IPP1 we used a PCR fragment generated with the oligos IPP1-fwd and

IPP1-rev.

Catalase activity was determined in crude extracts prepared by breaking 20 OD600 equivalents

of cells in 100µl breaking buffer (50mM Tris pH 7, 10% glycerol) with glass beads at 4°C. 10µl crude

extract (protein concentration usually between 5 and 10mg/ml) was added to 3ml Catalase buffer

(50mM Na2HPO4 pH7, 0,1% Triton X-100, 200mM H2O2) mixed immediately and the disappearance of

H2O2 at 240nm was followed for up to 3 minutes. Catalase activity was calculated in µM H2O2 per

minute per mg total protein (ε = 43,75).

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

7

GFP-fluorescence microscopy

Fluorescence microscopy experiments were performed as described previously (Görner et al., 1998;

Görner et al., 2002). GFP was visualized in live cells without fixation. Nuclei were stained by addition

of 2µg/ml 4,6 diamidino-2-phenylindol (DAPI) dye to the cultures 10 minutes prior to microscopy. All

cells were viewed using a Zeiss Axioplan 2 fluorescence microscope. Images were captured with a

Quantix CCD camera using IP-Lab or Lightview software.

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

8

Results

Msn2 levels are diminished after the diauxic shift.

Under logarithmic growth conditions yeast cells maintain a balanced level of Msn2 protein that does

not change under acute stress conditions (9). Similarly, according to Chi et al. adaptation to heat

shock had no effect on Msn2 levels, leading to the proposal that an increase in the nuclear export rate

of Msn2 was the main stress adaptive feature (18). However, an analysis of Msn2 behaviour during

the diauxic shift made us re-evaluate the possibility of Msn2 regulation by protein degradation. A

western blot analysis showed that an epitope tagged version of Msn2, which was expressed from a

centromeric plasmid under the control of the native promoter (pYMSN2-myc), revealed a dramatic

reduction of Msn2 protein levels at later growth stages between OD600 of 6 and 8 (Figure 1A).

Surprisingly this effect was not accompanied by a similar reduction in MSN2 transcript levels

(unpublished data). Moreover, similar results were obtained with native Msn2 (unpublished data) and

with Msn2 expressed from a heterologous promoter (unpublished data). Since Msn2 disappeared

within a short time in the early diauxic shift, it was most likely that Msn2 was degraded at higher rates

during this period of growth. The localization of Msn2 during the diauxic shift was followed by

fluorescence microscopy of a Msn2-GFP fusion driven by the ADH1 promoter. Msn2-GFP

accumulates in the nucleus when glucose is exhausted in the culture (Figure 1B). However, we

noticed reduction of the GFP signal at later growth stages, an impression conform with our western

blot analysis. This observation also suggested a connection between Msn2 localization and protein

stability.

Cells under chronic stress exhibit a reduction in Msn2 levels.

To address the question whether it is nuclear localization per se or stress and starvation signals, that

caused enhanced Msn2 degradation, we analyzed different conditions known to relocate Msn2 to the

nucleus. Exponentially growing cells were exposed to prolonged treatments with ethanol, mild osmotic

stress and heat shock. Msn2 protein levels decreased noticeably during growth at high temperature,

and after the addition of stressful amounts of ethanol to the culture (Figure 2A). In contrast, osmotic

stress had no effect on Msn2 levels. Analysis of the localization pattern of Msn2-GFP during stress

treatments indicated that both chronic ethanol and chronic heat stress lead to the permanent nuclear

localization of Msn2-GFP. On the contrary, osmotic stress caused only transient nuclear localization of

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

9

Msn2-GFP, and Msn2-GFP began to reappear in the cytosol after one hour (Figure 2B). These

obsevations support the hypothesis that prolonged nuclear accumulation of Msn2-GFP leads to a

reduction of Msn2 protein levels.

Reduction of protein kinase A causes a decrease in Msn2 protein levels.

Since PKA is a potent modulator of Msn2 localization and activity, we tested whether low PKA activity

has a similar effect as glucose depletion and stress on Msn2 stability (9,14). To manipulate PKA

activity we used a strain lacking both the adenylylcyclase gene (CDC35) and the high affinity

phosphodiesterase gene (PDE2), causing a prolonged stability of cAMP in the cells; a requirement for

manipulation of the intracellular cAMP pool. After cAMP removal, Msn2 protein levels dropped

significantly over a period of 2 hours (Figure 3A). To verify effective Msn2 activation under these

conditions, we analyzed nuclear localization of Msn2-GFP (Figure 3B) and transcriptional induction of

the Msn2-dependent CTT1 gene (Figure 3C) (16). The kinetics of the induction of the CTT1 gene and

the slow kinetics of nuclear concentration of Msn2 after cAMP removal, might be due to the pde2

deletion causing a delayed drop in intracellular cAMP levels (19). These data demonstrate that in

unstressed cells, and in the presence of glucose, reduced cAMP levels, presumably through a drop of

PKA acivity, are sufficient to cause a drop of Msn2 levels.

Nuclear accumulation destabilizes Msn2.

The common denominator of the conditions causing a drop in Msn2 protein levels is its nuclear

accumulation. Nuclear export of Msn2 is dependent on the nuclear export factor Msn5, which has

been implicated in a wide variety of signaling systems (20-23). To monitor the stability of Msn2 in the

nuclear compartment, we determined Msn2 protein levels in msn5∆ strains by western blotting. We

observed that msn5∆ strains exhibit an approximately 3-fold reduced steady state level of Msn2

protein (Figure 4A). As shown in Figure 4B, msn5∆ cells exhibit a permanently enhanced nuclear

signal from a Msn2-GFP fusion. Interestingly, despite the unusual, constitutive nuclear localization of

Msn2, environmental stress response (ESR) gene transcription is still under proper stress regulation

(Figure 4C), suggesting that an increase in nuclear localization of Msn2 alone is normally not sufficient

for the induction of its target genes. We used catalase activity as a readout system for CTT1

expression (24). Both the basal CTT1 expression as well as the temperature induced expression are

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

10

at comparable levels. The relatively normal basal CTT1 expression observed in the msn5∆, might be

explained by the reduction in Msn2 protein levels.

To exclude interference with the de novo synthesis of Msn2, the open reading frame of the

MSN2 gene was placed under the control of a conditional promoter. We chose the CUP1 promoter

because it is inducible by low (50µM) amounts of Cu2+ ions, which do not activate any genes known to

be under Msn2 control (our unpublished results). The CUP1 promoter controlled Msn2 construct was

introduced on a centromeric plasmid (pCUP1MSN2) in the strains W303msn2∆msn4∆ and

W303msn2∆msn4∆msn5∆. Msn2 synthesis was induced for 30 minutes followed by removing Cu2+

from the medium. We followed the Msn2 protein levels on western blots and found a loss of detectable

Msn2 protein within 90 minutes. In contrast, in the wildtype strain no such decrease was visible (Figure

4D and 5A) thus indicating that the reduced Msn2 levels in the msn5∆ mutant are most probably due

to enhanced turnover. To avoid the pleiotropic effects of the msn5∆ mutant, we also studied the

behaviour of Msn2 mutants that show increased nuclear accumulation. To permanently localize Msn2

in the nucleus, we used a mutant version of Msn2 that lacked a sequence required for efficient

cytoplasmic localization. This sequence most likely included a Msn5 dependent nuclear export signal

(amino acids 246 to 325) (14) and was therefore designated Msn2∆NES. Msn2∆NES was placed

under the control of the CUP1 promoter (pCUP1MSN2∆NES) and expressed in the strain

W303msn2∆msn4∆. As shown in Figure 5A, the levels of the mutant protein clearly declined more

rapidly than the wild-type product. Nothern blot analysis indicated that this effect is not due to

influences on mRNA stability. In both cases, MSN2 mRNA levels rise sharply after Cu2+ addition, only

to fall to their previous levels within minutes after removal of Cu2+. The decline in Msn2 protein levels

obviously occurs at a much slower rate (our unpublished results). Fluorescence microscopy with a

CUP1 regulated Msn2∆NES-GFP expression system confirms the predominant nuclear localization of

the mutant protein. Moreover, after its synthesis is triggered by presence of Cu2+, the signal is lost

more rapidly after removal of Cu2+ than its wild-type control (Figure 5B). We also considered the

possiblity that the internal deletion of Msn2∆NES might affect the stability of the mutant protein.

Therefore, we investigated the behavior of another Msn2 mutant form which is also constitutively

accumulated in the nucleus. This mutant carried simultaneous point mutations in five putative PKA

phosphorylation sites substituting serine 288, 582, 620, 625, and 633 to alanine (Msn2A5) (Figure 8A),

but still contained the sequence deleted in MSN2∆NES. Expression analysis of a CUP1-regulated

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

11

Msn2A5 mutant revealed that after CUP1 promoter shut-off, the drop in Msn2A5 protein level was

comparable to what we observed with the MSN2∆NES mutant (Figure 5A and 5C). Quantification of

the band intensities shows that the half life of nuclear Msn2 is between 60 and 90 minutes (Figure 5C).

It is important to note that this increase in degradation occurred even in the absence of stress. To

further investigate the possibility of an intrinsic instablility of the MSN2∆NES mutant we compared its

protein levels to nuclear Msn2. To achieve comparable conditions the stability of both proteins was

determined after CUP1 promoter shut-off under 7% ethanol stress (Figure 5A). Quantification indicates

a similar stability of both Msn2 and Msn2∆NES in the nucleus (Figure 5C) thus excluding a large

impact of the internal deletion on Msn2 stability. Taken together, these data therefore suggest that

nuclear localization of Msn2 could be causally linked with lower Msn2 protein stability.

Subcellular localization but not stress is the major determinant for Msn2 stability.

If degradation of Msn2 is exclusively dependent on nuclear localisation, then Msn2 levels should be

stable in the cytosol even under stress or starvation conditions. To test this possibility we fused a short

nuclear export signal derived from the mammalian protein kinase A inhibitor (PKI) (25) to the N-

terminus of Msn2. This construct was expressed under the control of the CUP1 promoter

(pCUP1PKIMSN2). Synthesis of both, Msn2 and PKIMsn2, was induced for 30 minutes by addition of

copper in exponentially growing cultures. After removal of copper, cells were stressed with 7% ethanol

and Msn2 as well as PKIMsn2 levels were analyzed by western blots. While Msn2 levels dropped

significantly, PKIMsn2 protein levels remained constant over a period of three hours (Figure 6A). The

sub-cellular localization of both proteins under these conditions was verified using GFP fusions. As

shown in Figure 6B, Msn2-GFP accumulates in the nucleus in ethanol stressed cells, however, PKI-

Msn2-GFP remained in the cytosol with a slight accumulation at the outer nuclear rim. These data

supported the notion that it is not stress per se but the localization of the protein that determines the

stability of Msn2.

The proteasome inhibitor MG132 inhibits degradation of nuclear Msn2.

Most short lived proteins are degraded via the 26S proteasomal pathway. If Msn2 degradation in the

nucleus is mediated through this route, inhibition of the proteasome should lead to accumulation of

Msn2. To test this we used a strain lacking the ERG6 gene (W303erg6∆) a mutation facilitating the

uptake of the proteasome inhibitor MG132 (26). We used two concentrations of MG132 dissolved in

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

12

DMSO and found increased levels of Msn2 protein in a dose dependent manner (Figure 7A) relative to

the DMSO control. The DMSO concentration was adjusted to 0.1% in both treated cultures.

Quantification shows a two- to threefold increase of the Msn2 protein level within a relatively short time

(30 minutes) of incubation. To verify the intracellular localization of Msn2 under the used conditions we

determined the localization of a Msn2-GFP fusion protein. Exposure to 0.1% DMSO causes rapid

nuclear accumulation of Msn2-GFP (Figure 7B). Prolonged treatment with 0,1% DMSO results in

decreasing levels of Msn2 similar to other stress conditions (Figure 7C). Taken together, these data

suggest intranuclear degradation of Msn2 by the proteasome.

Constitutive activation of Msn2 is detrimental for growth.

To assess whether degradation of Msn2 has a physiologically relevant aspect, we studied the growth-

phenotype of the Msn2A5 mutation, a constitutively active version of Msn2. Forced expression of

Msn2A5 under control of the CUP1 promoter efficiently inhibited cell growth indicating that an excess

of Msn2A5 is detrimental to yeast growth (Figure 8B). Concomitantly, we found high levels of CTT1

expression, one of the major Msn2 target genes (Figure 8C). During the diauxic shift, wild-type Msn2

becomes dephosphorylated at its PKA phosphorylation sites followed by a noteable drop in its cellular

concentration (Görner, W. Reiter unpublished). Since Msn2A5 has lost five of its putative PKA

phosphorylation sites (Figure 8A), the mutant protein can be viewed as a dephosphorylated and

perhaps hyperactive form of Msn2. If maintained at high levels, due to an unusually active promoter,

the continuous expression of the full set of Msn2 controlled ESR genes might be detrimental for

growth and/or proliferation. Under normal condition the increased degradation rates of Msn2 could

prevent such a scenario.

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

13

Discussion

Elimination of transcription factors by regulated proteolysis has emerged as an important

regulatory principle (for review see (27,28)). In this work we addressed the question whether such a

mechanism could be relevant for Msn2 dependent gene expression during growth adjustments and

stress adaptive processes in yeast. Overall, our results confirmed previous notions on Msn2 stability,

namely that degradation is not an important feature for adaptation to acute short-term stress

conditions (9,14,18). However, we were also able to define growth situations in which differences in

the steady state level of Msn2 could best be explained by an enhanced degradation rate of this

protein. Low levels of Msn2 were usually associated with chronic stress or severe limitations in carbon

source. This observation raised two major questions: First, what is the cause and nature of the

increased degradation? Second, what is its physiological significance?

In yeast, Gcn4 provides perhaps one of the best-understood examples for transcription factor

modulation by degradation (29). Gcn4 is the main player in the regulation of amino acid and purine

biosynthesis genes increasing their expression whenever the translational system is depleted of

aminoacyl-tRNAs. In cells grown on rich medium, Gcn4 levels normally become quite low due to

increased protein degradation. Under these conditions Gcn4 is phosphorylated by the Pho85-Pcl5

cyclin-CDK, a modification allowing the E3 complex SCFcdc4 to recognize Gcn4 (30). Another, but

functionally quite similar, modification of Gcn4 is introduced by Srb10, a cyclin dependent protein

kinase of the mediator complex, suggesting a feedback mechanism for transcriptionally active Gcn4

(18). Most of the lessons learned by the Gcn4 system might, however, not be applicable to Msn2.

The most dramatic difference between the two factors is the relative stability of Msn2 under all

growth conditions when compared to Gcn4. Even under chronic stress Msn2 has a half-life that is

measured in hours rather than minutes as found for Gcn4. A second point relates to the cause of

degradation. Is it initiated by specific phosphorylation events similar to the situation found with Gcn4 or

is it rather the consequence of localization? Although Msn2 has been reported to become

ubiquitinated via SCFcdc4 complex in vitro just as Gcn4, we propose that the degradation is rather a

consequence of nuclear occupation rates than stress or starvation dependent modifications signals. In

the two best studied examples of SCFcdc4 mediated degradation pathways, namely Sic1 and Gcn4,

phosphorylation plays an essential part in raising the affinity between the E3 complex and its

substrates (31,32). So far, similar modifications have not been identified for Msn2. It is clear, however,

that PKA dependent modification sites should not be relevant. First of all, dephosphorylation rather

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

14

than phosphorylation at the PKA motifs results in high nuclear accumulation as well as a decrease in

Msn2 levels. Moreover, not all conditions that cause low levels of Msn2 lead to a prolonged decrease

in PKA dependent Msn2 phosphorylation. So, if there are targets in Msn2 that direct signal-induced

increases in ubiquitination and degradation, they are likely to differ from the PKA motifs. However,

such a conclusion would make it difficult to explain the effects observed under low PKA kinase activity.

Since prolonged nuclear accumulation currently remains the only common denominator of all the

conditions causing low Msn2 levels, we believe that nuclear location of Msn2 per se is the crucial

parameter. The fact that enforced nuclear export suppresses an increase in Msn2 degradation under

chronic stress clearly supports this contention. The same data also invalidate any model of stress or

starvation induced cytoplasmic degradation of Msn2, an interpretation that would be otherwise

consistent with the cytological observations of Msn2-GFP fusions.

The simple assumption of different, but constant, degradation rates between nuclear and

cytoplasmic Msn2 could in principle explain all the phenomena described here. One concern,

however, might be the reliability of Msn2 half-life values as they are derived from promoter shut-off

analysis followed by western blot assays. The half-life, as estimated by us, for nuclear Msn2 correlates

well with the half-life mentioned by Chi et al., who used metabolic labeling. One has to take into

account that the growth conditions necessary, and routinely used, for effective metabolic labeling

experiments constitute a poor growth environment. Therefore, the values for the Msn2 half-life of

about one hour in stressed or starved cells is likely to be correct. A similar value was obtained for cells

under optimal growth conditions but with enforced nuclear accumulation of Msn2. This contrasts with

our estimates in normal cells at optimal growth conditions, in which Msn2 half-life should approach

three hours. We are aware that values between the indicated levels are difficult to measure and that

subtle differences cannot be quantified and therefore interpreted with any confidence. Nevertheless,

we assume that the differences documented here are indeed noticeable. In this regard it should be

noted that (18) claimed to find no difference in Msn2 stability between msn5∆ and wild-type cells. We

assume that this is not due to technical reasons but that the differences might have been missed if

wild-type cells and mutant cells were compared at late growth stages (e.g. post- diauxic shift).

To what extent could different degradation rates of nuclear versus cytoplasmic Msn2 be useful

for a yeast cell? Acute stress situations, during otherwise optimal growth conditions, will normally

cause a transient growth arrest and elicit dramatic changes in the transcriptional program (2,33). Msn2

plays an important role in this response. Upon stress relief, it should be advantageous to resume

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

15

growth as quickly as possible. Indeed, the rapid return of stress specific transcripts to normal levels is

reflected in the dynamic localization pattern of Msn2 (9,16). Control of the nucleo-cytoplasmic shuttling

of Msn2 could therefore easily lead to the required rapid redistribution of Msn2 without impairing a

cell’s capacity for subsequent responses. The nuclear half-life of Msn2 would still exceed the time

frame of the response (as actually observed here during osmotic shock), and its contribution towards

adaptation would thus be negligible. Chronic stress might require a different strategy from acute stress

since cells will undergo long-term changes in their physiology. The diauxic shift, during which cells

switch from fermentative growth to respiratory growth, might serve as an example for such a chronic

condition. The drop in glucose concentration leads to lower PKA activity, which in turn activates Msn2

(14). If glucose is permanently depleted, Msn2 receives a constitutive signal for nuclear accumulation

and activation. Under these conditions, higher nuclear degradation rates should be sufficient to

prevent, over time, an inappropriate high activation of stress specific genes. Similar arguments could

be made for permanent stress situations. A relatively modest difference in degradation rates between

nuclear and cytoplasmic Msn2, may promote Msn2 inactivation under such chronic stress or starvation

conditions but might also preserve an ample supply of the factor when responding to rapidly changing

conditions.

There is previous evidence that active Msn2 could become detrimental for growth. First,

absence of PKA activity, which causes dephosphorylation and activation of Msn2, leads to growth

arrest, which is suppressed by the absence of Msn2 and Msn4 (34). Here we provide a second

example, as a largely unregulated form of Msn2 can be mimicked by serine to alanine replacements in

5 PKA consensus sites. This Msn2A5 mutant protein is constitutively localized in the nucleus. It

activates Msn2-dependent genes and is detrimental for growth when expressed at high levels. The

exact reason for the growth arrest caused by active Msn2 is currently not known but could be a

cumulative effect of the up-regulation of whole ESR cluster or the specific effects of a few regulatory

genes.

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

16

Acknowledgments

We thank F. Estruch for materials, the Ammerer Lab for support and particularly S.M.Salah for

discussions, P. Kovarik and F. Kragler for critically reading the manuscript. We especially thank

V.DeWever and C.Brocard for sharing unpublished results and discussion. This work was supported

by the FWF grant P12015 to the late H. Ruis.

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

17

References

1. Estruch, F. (2000) FEMS Microbiol Rev 24, 469-486

2. Gasch, A. P., Spellman, P. T., Kao, C. M., Carmel-Harel, O., Eisen, M. B., Storz, G., Botstein,

D., and Brown, P. O. (2000) Mol Biol Cell 11, 4241-4257

3. Causton, H. C., Ren, B., Koh, S. S., Harbison, C. T., Kanin, E., Jennings, E. G., Lee, T. I.,

True, H. L., Lander, E. S., and Young, R. A. (2001) Mol Biol Cell 12, 323-337

4. Schüller, C., Mamnun, Y. M., Mollapour, M., Krapf, G., Schuster, M., Bauer, B. E., Piper, P.

W., and Kuchler, K. (2004) Mol Biol Cell 15, 706-720

5. DeRisi, J. L., Iyer, V. R., and Brown, P. O. (1997) Science 278, 680-686

6. Cameroni, E., Hulo, N., Roosen, J., Winderickx, J., and De Virgilio, C. (2004) Cell Cycle 3

7. Kobayashi, N., and McEntee, K. (1993) Mol Cell Biol 13, 248-256

8. Marchler, G., Schüller, C., Adam, G., and Ruis, H. (1993) EMBO J 12, 1997-2003

9. Görner, W., Durchschlag, E., Martinez-Pastor, M. T., Estruch, F., Ammerer, G., Hamilton, B.,

Ruis, H., and Schüller, C. (1998) Genes Dev 12, 586-597

10. Moskvina, E., Imre, E. M., and Ruis, H. (1999) Mol Microbiol 32, 1263-1272

11. Jones, D. L., Petty, J., Hoyle, D. C., Hayes, A., Ragni, E., Popolo, L., Oliver, S. G., and

Stateva, L. I. (2003) Physiol Genomics 16, 107-118

12. Schmelzle, T., Beck, T., Martin, D. E., and Hall, M. N. (2004) Mol Cell Biol 24, 338-351

13. Beck, T., and Hall, M. N. (1999) Nature 402, 689-692

14. Görner, W., Durchschlag, E., Wolf, J., Brown, E. L., Ammerer, G., Ruis, H., and Schüller, C.

(2002) EMBO J 21, 135-144

15. Piatti, S., Bohm, T., Cocker, J. H., Diffley, J. F., and Nasmyth, K. (1996) Genes Dev 10, 1516-

1531

16. Martinez-Pastor, M. T., Marchler, G., Schüller, C., Marchler-Bauer, A., Ruis, H., and Estruch,

F. (1996) EMBO J 15, 2227-2235

17. Spevak, W., Fessl, F., Rytka, J., Traczyk, A., Skoneczny, M., and Ruis, H. (1983) Mol Cell Biol

3, 1545-1551

18. Chi, Y., Huddleston, M. J., Zhang, X., Young, R. A., Annan, R. S., Carr, S. A., and Deshaies,

R. J. (2001) Genes Dev 15, 1078-1092

19. Wilson, R. B., Renault, G., Jacquet, M., and Tatchell, K. (1993) FEBS Lett 325, 191-195

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

18

20. Hopper, A. K. (1999) Curr Biol 9, 803-806

21. Alepuz, P. M., Matheos, D., Cunningham, K. W., and Estruch, F. (1999) Genetics 153, 1219-

1231

22. Kaffman, A., Rank, N. M., O'Neill, E. M., Huang, L. S., and O'Shea, E. K. (1998) Nature 396,

482-486

23. Yoshida, K., and Blobel, G. (2001) J Cell Biol 152, 729-740

24. Belazzi, T., Wagner, A., Wieser, R., Schanz, M., Adam, G., Hartig, A., and Ruis, H. (1991)

EMBO J 10, 585-592

25. Wen, W., Harootunian, A. T., Adams, S. R., Feramisco, J., Tsien, R. Y., Meinkoth, J. L., and

Taylor, S. S. (1994) J Biol Chem 269, 32214-32220

26. Lee, D. H., and Goldberg, A. L. (1996) J Biol Chem 271, 27280-27284

27. Muratani, M., and Tansey, W. P. (2003) Nat Rev Mol Cell Biol 4, 192-201

28. Conaway, R. C., Brower, C. S., and Conaway, J. W. (2002) Science 296, 1254-1258

29. Hinnebusch, A. G., and Natarajan, K. (2002) Eukaryot Cell 1, 22-32

30. Shemer, R., Meimoun, A., Holtzman, T., and Kornitzer, D. (2002) Mol Cell Biol 22, 5395-5404

31. Feldman, R. M., Correll, C. C., Kaplan, K. B., and Deshaies, R. J. (1997) Cell 91, 221-230

32. Meimoun, A., Holtzman, T., Weissman, Z., McBride, H. J., Stillman, D. J., Fink, G. R., and

Kornitzer, D. (2000) Mol Biol Cell 11, 915-927

33. Gasch, A. P., and Werner-Washburne, M. (2002) Funct Integr Genomics 2, 181-192

34. Smith, A., Ward, M. P., and Garrett, S. (1998) EMBO J 17, 3556-3564

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

19

Figure legends

Figure 1. Msn2 levels are reduced after diauxic shift. (A) Strain W303msn2∆msn4∆, carrying the

plasmid pYMSN2-myc, expressing Msn2 with a C-terminal myc-tag under the native MSN2 promoter,

was grown in rich medium and samples were taken at the indicated optical densities. Total protein

extracts were prepared and analyzed on western blots with antibodies directed against the myc

epitope and Kar2 as a loading control. (B) Localization of N-terminally GFP-tagged Msn2 was

determined by fluorescence microscopy at the indicated optical densities (OD600).

Figure 2. Nuclear accumulation under stress conditions diminishes Msn2 levels. (A) Western

blot showing the steady state levels of Msn2 during long-term exposure to different stress conditions.

Wild type (W303-1A) cultures were diluted to OD600 of 0.1 and grown to logarithmic phase. When

cultures reached OD600 of 1, stress treatments were applied and samples were taken in 90 minutes

intervalls. Msn2 levels were determined by western blot analysis with antibodies directed against

Msn2. Kar2 levels served as loading control. (B) W303-1A cells carrying a ADH1 promoter driven

MSN2-GFP fusion construct were subjected to the same stress conditions as in (A). Localization of

Msn2-GFP was visualized by fluorescence microscopy.

Figure 3. cAMP depletion Nuclear accumulation destabilizes Msn2.

Decrease of Msn2 levels after cAMP depletion. (A) Cultures of W303cdc∆35pde2∆ were diluted to

OD600 of 0.1 in medium containing 3mM cAMP, grown to OD600 of 0.8, washed and resuspended in

cAMP-free medium. Samples were taken at the indicated time points after cAMP depletion, and Msn2

levels were determined by western analysis with antibodies directed against Msn2. (B) Fluorescence

microscopy of Msn2-GFP in W303cdc35∆pde2∆cells after cAMP depletion. (C) Northern blot showing

the expression of the Msn2-dependent catalase T (CTT1) gene before and after cAMP depletion. Cells

were treated as in (B). Samples were taken 30 and 40 minutes after cAMP depletion, CTT1 and IPP1

mRNA levels were visualized by hybridization of radioactive probes and autoradiography.

Figure 4. Msn2 levels are reduced in msn5∆ cells . (A) Msn2 steady state levels were determined

by western blotting in W303-1A and W303msn5∆ cells in the exponential growth phase. (B)

Fluorescence microscopy of Msn2-GFP in W303-1A wild type and in W303msn5∆ mutant cells. (C)

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

20

Catalase T activity after a 45 min 28° to 38°C heat shock in W303msn2∆msn4∆ and

W303msn2∆msn4∆msn5∆ strains expressing MSN2 from the ADH1 promoter. (D) Msn2 was

expressed under the control of the CUP1 promoter in strain W303msn2∆msn4∆msn5∆ and Msn2

protein levels were followed on western blots after promoter shut off.

Figure 5. Subcellular localization determines Msn2 stability. (A) Msn2 stability in the nucleus.

Plasmids expressing MSN2, MSN2∆NES, and MSN2A5 under the control of the CUP1 promoter were

introduced into strain W303msn2∆msn4∆. Transformants were grown over night, diluted to OD600 0,1

and grown to logarithmic phase until OD600 0,8. 50µM CuSO4 was added. After 30 minutes incubation

cells were washed and resuspended in Cu2+-free medium (0 minutes). Samples were taken after one,

two and three hours. Msn2, Msn2∆NES, and Msn2A5 levels were analyzed on western blots with an

antiserum directed against Msn2. Kar2 levels served as a loading control. (B) Fluorescence

microscopy visualizing of Msn2∆NES-GFP and Msn2A5-GFP. Both GFP fusion genes were under the

control of the CUP1 promoter and were inspected after 1 hour induction with 50µM Cu2+. (C)

Quantification of Msn2 protein levels. Blots were scanned with ImageQant. Msn2 bands were

normalized with the Kar2 signal. The Msn2 level after copper induction was set to one for each series.

Figure 6. Ethanol stress does not destabilize cytoplasmic Msn2. (A) Msn2 and PKIMsn2 levels

under stress conditions. Strain W303msn2∆msn4∆ was transformed with plasmids carrying a native

MSN2 gene or a PKI-nuclear export signal MSN2 fusion (PKIMSN2) under the control of the CUP1

promoter (pCUP1MSN2, pCUP1-PKIMSN2). CuSO4 was added to a final concentration of 50µM to

exponentially growing cultures for 30 minutes, Cu2+ was removed and 7%v/v Ethanol was added after

the washing step. Samples were taken at the indicated time points for western analysis to determine

the amount of Msn2. (B) Fluorescence microscopy showing the intracellular localization of GFP-

tagged versions of Msn2 and PKIMsn2, respectively, expressed under the control of the ADH1

promoter. Arrow indicates nuclear rim staining of PKIMsn2-GFP. DNA was stained with 2µg/ml DAPI.

Figure 7. The proteasome inhibitor MG132 blocks degradation of nuclear Msn2. (A) Over night

cultures of W303-∆erg6 cells were diluted and grown to an optical density of OD600 = 1. The

proteasome inhibitor MG132 dissolved in DMSO was added to a final concentration of 50µM and

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

21

100µM, respectively. Samples were taken before and 30 minutes after MG132 treatment and Msn2

levels were determined by western analysis. Quantification of Msn2 levels normalized to Kar2 levels

are indicated. The amount of Msn2 before inhibitor treatment was set to 100%. (B) Subcellular

localization of Msn2-GFP expressed under the control of the ADH1 promoter during 0,1% DMSO

treatment. Msn2-GFP was visualized by fluorescence microscopy. (C) Msn2 levels in cells stressed

with with 0,1% DMSO.

Figure 8. Forced expression of active Msn2 is detrimental for growth. (A) Protein kinase A

consensus sites in Msn2. Positions of serine residues changed to alanine are indicated. (B)

W303msn2∆msn4∆ cells transformed with plasmids carrying pCUP1MSN2A5 and the wild type

plasmid pCUP1MSN2 were spotted in serial dilutions on YPD plates and on YPD plates containing

0.25 mM Cu2+. Growth was recorded after incubation for 48 hours at 30°C. (C) Msn2A5 is a

hyperactive allele. W303msn2∆msn4∆ cells carrying pCUP1MSN2A5 and pCUP1MSN2 were grown

to logarithmic phase and Cu2SO4 was added to 50µM final concentration. Northern blot showing the

mRNA level of the Msn2-dependent catalase T (CTT1) gene before and after induction of MSN2A5

and MSN2 by the copper promoter.

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

22

Table 1: Yeast strains and plasmids used in this study

Yeast Strains Genotype Source

W303-1A a ura3 leu2 his3 trp1 ade2 can1 Nasmyth K; Vienna

W303msn2∆msn4∆ a msn2∆::TRP1 msn4∆::HIS3 Görner et al., 1998

W303msn5∆ a msn5∆::HIS3 Görner et al., 2002

W303erg6∆ α lys2 leu2 ura3 erg6∆::LEU2 Kuchler K; Vienna

W303msn2∆msn4∆ msn5∆ a msn2∆::TRP1 msn4∆::HIS3 msn5∆::HIS3 this study

W303cdc35∆pde2∆ a pde2∆::Trp1 cdc35∆::KanMX6 this study

Plasmids Relevant Inserts Source

pADH1MSN2 ADH1-MSN2 Görner et al., 1998

pADH1MSN2-GFP ADH1-MSN2-GFP Görner et al., 1998

pYMSN2-myc MSN2-9xmyc Görner et al., 1998

pYMSN2-GFP MSN2-GFP Görner et al., 1998

pCUP1MSN2 CUP1Promoter-MSN2 this study

pCUP1MSN2-GFP CUP1 Promoter -MSN2-GFP this study

pCUP1MSN2∆NES CUP1 Promoter -MSN2∆246-325 this study

pCUP1MSN2∆NES-GFP CUP1 Promoter -MSN2∆246-325-GFP this study

pCUP1MSN2A5 CUP1 Promoter -MSN2 S288,582,620,625,633A this study

pCUP1MSN2A5-GFP CUP1 Promoter -MSN2 S288,582,620,625,633A -GFP this study

pCUP1-PKIMSN2 CUP1 Promoter -PKINES-MSN2 this study

pCUP1-PKIMSN2-GFP CUP1 Promoter - PKINES-MSN2-GFP this study

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

23

Table 2: Oligos used in this study

EGFPseq-rev 5`-AGCGCGATCACATGGTCCTGCTGG-3`

Msn2Sal1 5`-CTAAAATGACGGTCGACCATG-3`

Msn2x12SalI-rev 5`-AAACGTAATCGTCGACATCTAGCATGGAGTCTATGTTCAG-3`

IPP1-fwd 5`-CCCTTGTACGCTGACAAGG-3`

IPP1-rev 5`-GCTTCACCGGAGAAGGC-3`

SacII-Cup1_fwd 5`-GATCCGCGGGGGGTATTACTACGGCAAACTTCAACGA-3`

SalI-Cup1_rev 5`-ATGGTCGACCGTCATTTTATGTGATGATTGATTGATTG-3`

PKI-NES fwd 5`-ATGACGGTCAACGAATTAGCCTTGAAA-3`

SalI-Cup1p-PKI_rev 5`-

GGTCGACGTTGATATCAAGACCTGCTAATTTCAAGGCTAATTCGTTGACCGTCATTTTATGTGATG

ATTGATTGATTG-3`

BamHI-∆NES rev 5`-CTCTCCACTGCCCGTAACGGAAACGGATCCT-3`

BamHI-∆NES fwd 5`-TAGCATTATTAGTACTCTTAATTTCAGGATCCT-3`

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from

Erich Durchschlag, Wolfgang Reiter, Gustav Ammerer and Christoph SchullerNuclear localization destabilizes the stress regulated transcription factor Msn2

published online October 22, 2004J. Biol. Chem. 

  10.1074/jbc.M407264200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on July 11, 2018http://w

ww

.jbc.org/D

ownloaded from